Способ прогнозирования наследственной предрасположенности к раку молочной железы



Способ прогнозирования наследственной предрасположенности к раку молочной железы
Способ прогнозирования наследственной предрасположенности к раку молочной железы
Способ прогнозирования наследственной предрасположенности к раку молочной железы
Способ прогнозирования наследственной предрасположенности к раку молочной железы

 


Владельцы патента RU 2522501:

федеральное государственное бюджетное учреждение "Научно-исследовательский институт онкологии имени Н.Н. Петрова" Министерства здравоохранения Российской Федерации (RU)
Федеральное государственное унитарное предприятие "Государственный научный центр "Научно-исследовательский институт органических полупродуктов и красителей" (ФГУП "ГНЦ "НИОПИК") (RU)

Изобретение относится к области медицины, в частности, к клинической онкологии, медицинской генетике, молекулярной диагностике и может быть использовано для прогнозирования наследственной предрасположенности к раку молочной железы. Способ характеризуется тем, что проводят амплификацию коротких фрагментов гена BLM протяженностью до 200 п.о., с последующим высокоразрешающим плавлением, включающим оптимизированный для гена BLM этап формирования гетеродуплексов: быстрый нагрев до 95°С и медленное снижение температуры до 50°С; выбирают один фрагмент с аберрантным профилем плавления для секвенирования, секвенируют выбранный фрагмент и при выявлении мутации гена BLM прогнозируют наследственную предрасположенность к раку молочной железы. Способ повышает точность детекции мутации, прост в исполнении и высокоинформативен: позволяет выявлять до 100% мутаций в гене BLM.

 

Изобретение относится к области медицины, в частности, к клинической онкологии, медицинской генетике, молекулярной диагностике и может быть использовано для прогнозирования наследственной предрасположенности к раку молочной железы (РМЖ).

Известные способы прогнозирования наследственной предрасположенности к РМЖ основаны на использовании молекулярно-генетических методик.

Известен способ прогнозирования наследственной предрасположенности к РМЖ путем выявления мутаций в гене BRCA1 [Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, Liu Q, Cochran C, Bennett LM, Ding W, et al. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science. 1994 Oct 7;266(5182):66-71].

Известен способ прогнозирования наследственной предрасположенности к РМЖ путем выявления мутаций в гене BRCA2 [Wooster R, Bignell G, Lancaster J, Swift S, Seal S, Mangion J, Collins N, Gregory S, Gumbs C, Micklem G. Identification of the breast cancer susceptibility gene BRCA2. Nature. 1995 Dec 21-28;378(6559):789-92].

Известен способ прогнозирования наследственной предрасположенности к РМЖ путем выявления мутаций в гене СНЕК2.[Vahteristo P, Bartkova J, Eerola H, Syrjakoski К, Ojala S, Kilpivaara О, Tamminen A, Kononen J, Aittomaki K, Heikkila P, Holli K, Blomqvist C, Bartek J, Kallioniemi OP, Nevanlinna H. A CHEK2 genetic variant contributing to a substantial fraction of familial breast cancer. Am J Hum Genet. 2002 Aug; 71(2):432-8].

Известен способ прогнозирования наследственной предрасположенности к РМЖ путем выявления мутаций в гене PALB2[Rahman N, Seal S, Thompson D, Kelly P, Renwick A, Elliott A, Reid S, Spanova K, Barfoot R, Chagtai T, Jayatilake H, McGuffog L, Hanks S, Evans DG, Eccles D; Breast Cancer Susceptibility Collaboration (UK), Easton DF, MR. PALB2, which encodes a BRCA2- Stratton interacting protein, is a breast cancer susceptibility gene. Nat Genet. 2007 Feb; 39(2): 165-7].

Перечисленные способы выявляют причины не более 20% случаев семейной агрегации РМЖ. Причины формирования риска РМЖ в оставшихся родословных остаются неизвестными. Поиск новых генов, ассоциированных с РМЖ, представляется достаточно важной задачей. Во-первых, сведения о присутствии РМЖ-предрасполагающих мутаций у той или иной женщины позволяют сформировать индивидуальный комплекс медицинских мероприятий, направленных на профилактику и своевременную диагностику этого заболевания. Во-вторых, данные последних лет свидетельствуют о том, что наследственные раки нуждаются в особых, отличных от «спорадических» карцином, схемах лечебных воздействий.

Техническим результатом изобретения является расширение арсенала средств, направленных на прогнозирование наследственной предрасположенности к РМЖ, повышение точности и информативности в индивидуальном прогнозе, снижение материальных затрат.

Указанный технический результат достигается тем, что в способе прогнозирования наследственной предрасположенности к раку молочной железы, согласно изобретению, проводят амплификацию коротких фрагментов гена BLM протяженностью до 200 п.о., с последующим высокоразрешающим плавлением, включающим оптимизированный для гена BLM этап формирования гетеродуплексов: быстрый нагрев до 95°С и медленное снижение температуры до 50°С; выбирают один фрагмент с аберрантным профилем плавления для секвенирования, секвенируют выбранный фрагмент и при выявлении мутации гена BLM прогнозируют наследственную предрасположенность к раку молочной железы.

В результате анализа наследственных мутаций в генах репарации ДНК у 95 пациенток, демонстрирующих характеристики наследственного рака молочной железы; в 2 случаях обнаружена мутация p.Q548X в гене BLM. Расширенное исследование позволило выявить наследуемые дефекты в гене BLM у 17/1,498 (1.1%) больных РМЖ по сравнению с 2/1,093 (0.2%) здоровыми женщинами (р=0.004). Встречаемость мутаций в гене BLM у больных с семейной историей РМЖ достигала 2.4% (6/251). Результаты проделанной работы позволяют заключить, что мутации гена BLM демонстрируют высокую встречаемость в популяции, а их выявление целесообразно для прогнозирования предрасположенности к раку молочной железы.

Разработанный способ прогнозирования наследственной предрасположенности к РМЖ включает два последовательных этапа: анализ всех возможных мутаций гена BLM (см. табл.) методом ПЦР с последующим высокоразрешающим плавлением, оптимизированным для гена BLM, и секвенирование только одного из аберрантных фрагментов. Подобный подход позволяет значительно удешевить и ускорить процедуру анализа.

Аберрантный характер кривой плавления устанавливается по отличию от кривых плавления контрольных образцов без мутации. Выбранный фрагмент подвергается секвенированию по стандартным протоколам. В случае если ни один из анализируемых фрагментов не отличается от контрольных образцов, дают заключение об отсутствии мутаций без дополнительного секвенирования.

Точность детекции мутаций была улучшена за счет выбора ампликонов около 200 п.о. и включения этапа формирования гетеродуплексов (быстрый нагрев амплификата до 95°С и медленное охлаждение до 50°С).

Таблица
Праймер Последовательность 5′→3′ Длина ампликона
BLM-ex2-F TGTGATTAATGCAAAGTACCTA 189
BLM-ex2-R CTATGTGACAGCAAACCAGT
BLM-ex3_1-F GATTCTTTGCTCAGTTGGGA 187
BLM-ex3_1-R TGACACATTAGTTACAGATACA
BLM-ex3_2-F TGTATCTGTAACTAATGTGTCA 200
BLM-ex3_2-R GCAAGAAATCTGGCAATAATG
BLM-ex3_3-F TCATTATTGCCAGATTTCTTGC 175
BLM-ex3_3-R CAGAAGTATCAAAGTCATCCA
BLM-ex3_4-F TGGATGACTTTGATACTTCTG 212
BLM-ex3_4-R AGTCATCCTTCTGTTCCTCA
BLM-ex3_5-F TGAGGAACAGAAGGATGACT 142
BLM-ex3_5-R GTTACCTCTTTCATCTTCCAA
BLM-ex4-F CTGTAGATAATAGCGAAAAGAA 173
BLM-ex4-R AGTTTACCTAAGGCATTTTGAA
BLM-ex5-F TGCAGTACGTTAAAGGACC 228
BLM-ex5-R CATACAGCCACAGGTTCAA
BLM-ex6-F TAGACAGATAAGTTTACAGCA 133
BLM-ex6-R CCTTATGTTCCGCTGCTGA
BLM-ex7_1-F ACGTTGTTCTCTTTTCTCTCT 223
BLM-ex7_1-R GTGGTAGTCAGTAAACAGTC
BLM-ex7_2-F GACTGTTTACTGACTACCAC 190
BLM-ex7_2-R CAGCAGTGCTTGTGAGAACA
BLM-ex7_3-F TGTTCTCACAAGCACTGCTG 222
BLM-ex7_3-R GATACTGATTTAATTGGCCGA
BLM-ex7_4-F TCGGCCAATTAAATCAGTATC 200
BLM-ex7_4-R TGATGATTTGCTATGGTTTTTC
BLM-ex8-F TCCTAGACAAGTCAGCACAA 229
BLM-ex8-R TTCCTGCCAATTCACTTCTAA
BLM-ex9-F AACTTTTACATTCATGCTCTG 186
BLM-ex9-R TTACATCCAAGGAAGTCAGC
BLM-ex10-F ATACTTAGATTCCAGCTACATA 125
BLM-ex10-R AACCTTTTCTGGAGTGACATA
BLM-ex11-F CCTAGATCTGTGCAAGTAAC
BLM-ex11-R TAGTATGTATTTATCGGTATTTC
BLM-ex12-F CTCCAAGTAGTCTGAAAAGCA
BLM-ex12-R GTGACGTGCAACAACTTACA
BLM-ex13-F GGACTTTTTTAGGTTTAGCAT
BLM-ex13-R AGACAGCTAATCACATGGC
BLM-ex14-F GTACTCTTGGTTTCTTGGCA
BLM-ex14-R GTTACCTGACAGCCATCCT
BLM-ex15_1-F GTCTGTGCCTTATGAATCTA
BLM-ex15_1-R GCAGTGAGATATTTCCCCA
BLM-ex15_2-F GCATCTCTCCCTAAATCTGT
BLM-ex15_2-R CCACAATAGCAGGAGTAGA
BLM-ex16_1-F GTCTTACTATAGTCTTCATCTCT
BLM-ex16_1-R CACCAAAGTAGGCCAAAAGCT
BLM-ex16_2-F GAATGCAGGAGAATACAGCTT
BLM-ex16_2-R CGGAGACCACCTTTTGCAAT
BLM-ex17-F GGGTTATGATGAATCTACTAT
BLM-ex17-R ACCCAAGAAAATGTCGACCA
BLM-ex18_1-F CTTCTATTTGAGGGTGATGAT
BLM-ex18_1-R CATAAGCGATCGCCTGGTCA
BLM-ex18_2-F GATTTTGGATGAAGACTTATATAT
BLM-ex18_2-R CAGTATCTATAAGCTTGGACAA
BLM-ex19-F CTCCTATGATTTGTTTCTCTCT
BLM-ex19-R GTGCCACGTAACAAAGGATA
BLM-ex20-F GTGGGTTTTCTATGGGTGAT
BLM-ex20-R CATGGCTGTGTACTAACCT
BLM-ex21_1-F CGTGGACCAGTGCGACAT
BLM-ex21_1-R CTTTGGGAGGCTGGCATCT
BLM-ex21_2-F GAAGAAGTGCCGCTGAGGA
BLM-ex21_2-R CAGAGCTGTTGCACTTTTGT
BLM-ex22-F GGGGGTCTGCCACATGTA
BLM-ex22-R CTATGTACATTGAGATTCGGTT

Сущность изобретения иллюстрируется графическими изображениями на фиг.1, 2, где:

На фиг.1 представлена схема протокола №1 для скрининга мутаций в гене BLM: Case - исследуемый образец, hd1 и hd2 - контрольные образцы без мутации, К- контроль ПЦР без матрицы.

На фиг.2 представлена схема протокола №2 для скрининга мутаций в гене BLM: Case - исследуемый образец, hd1 и hd2 - контрольные образцы без мутации, К- контроль ПЦР без матрицы.

Способ осуществляют следующим образом.

ДНК лейкоцитов периферической крови, полученной от тестируемых лиц, выделяют стандартным соль-хлороформным методом. Праймеры для амплификации 32 фрагментов кодирующей последовательности гена и экзон-интронных границ, представлены в табл.При использовании 96-луночного формата для скрининга всей последовательности требуется 2 раунда ПЦР по 1,5 часа. В протокол реакции включают исследуемый образец, два контрольных образца без мутаций и один контроль реакционной смеси без матрицы. Схема протоколов представлена на фиг.1,2.

Реакционная смесь состоит из 1 мкл раствора ДНК (все образцы в реакции подводят к одной концентрации - 20 нг/мкл) и 9 мкл смеси для ПЦР. Смесь для ПЦР содержит 1-кратный ПЦР-буфер, 2.5 мМ MgCl2, 200 мкМ дЦТФ, 200 мкМ дТТФ, 200 мкМ дГТФ, 200 мкМ дАТФ, 1 мкМ каждого праймера (конечная концентрация - 0,1 ОЕ/л) и 0,5 ед "hot-start" ДНК-полимеразы. Дополнительно в реакцию включают интеркалирующий краситель EvaGreen (Biotium, Hayward, CA) в концентрации, рекомендованной производителем. ПЦР-реакция начинается с 10-минутной активации ДНК-полимеразы при 95°С; для накопления ПЦР-продукта проводится 40 циклов амплификации (денатурация: 10 сек при 95°С; отжиг: 15 сек при 58°С; синтез: 20 сек при 72°С). После завершения ПЦР следует этап высокоразрешающего плавления ампликонов. Программа плавления заключается в увеличении температуры на 0,2°С в каждом цикле продолжительностью 10 с, температурный интервал плавления составлял от 75 до 92°. Точность детекции мутаций повышается за счет выбора ампликонов около 200 п.о. и включения этапа формирования гетеродуплексов (быстрый нагрев амплификата до 95°С и медленное охлаждение до 50°С).

Анализ профилей плавления производят с использованием соответствующего программного обеспечения, прилагаемого к используемому в лаборатории оборудованию.

При выявлении, по меньшей мере, одной мутации гена BLM прогнозируют наследственную предрасположенность к РМЖ.

Предлагаемый способ является простым в исполнении и высокоинформативным: позволяет выявлять до 100% мутаций в гене BLM. Популяционная частота носительства мутаций в данном гене составляет 0.2%. Наследственные дефекты гена BLM отвечают примерно за 1.1% общей заболеваемости РМЖ, причем этот показатель достигает 2.4% у больных с семейной формой РМЖ. Способ рекомендован пациенткам с BRCA-негативным, пациенткам с клиническими признаками наследственного РМЖ и, в случае обнаружения мутации, их здоровым родственницам.

Способ прогнозирования наследственной предрасположенности к раку молочной железы, характеризующийся тем, что проводят амплификацию коротких фрагментов гена BLM протяженностью до 200 п.о., с последующим высокоразрешающим плавлением, включающим оптимизированный для гена BLM этап формирования гетеродуплексов: быстрый нагрев до 95°С и медленное снижение температуры до 50°С; выбирают один фрагмент с аберрантным профилем плавления для секвенирования, секвенируют выбранный фрагмент и при выявлении мутации гена BLM прогнозируют наследственную предрасположенность к раку молочной железы.



 

Похожие патенты:

Группа изобретений относится к области медицинской диагностики, иммунологии и онкологии, в частности к новым онкомаркерам и способам диагностики онкологических заболеваний.

Изобретение относится к области медицины и предназначено для дифференциальной диагностики рака предстательной железы. В клетках периферической крови пациента методом полимеразной цепной реакции в режиме реального времени измеряют экспрессию генов Тр53, GSTP1 и IL10 относительно референтного гена β-актина (АСТВ).

Изобретение относится к области диагностики злокачественной опухоли. Изобретение относится к способу улавливания, детекции, охарактеризовывания и количественного определения экзосом человека в небольших объемах жидкостей организма человека с использованием сэндвич-ELISA-теста.

Группа изобретений относится к выбору подходящего противоракового лекарственного средства для лечения рака легких, прогнозированию реакции опухоли легких на лечение противораковым лекарственным средством, а также к применению матрицы для выбора подходящего противоракового лекарственного средства для лечения рака легких.

Изобретение относится к способам определения эффективности лиганда ионного канала. Ex vivo способ определения эффективности лиганда ионного канала in vivo в зависимости от присутствия плазмы, включает стадии: a) приведение клетки, экспрессирующей ионный канал, в контакт с i) плазмой животного и ii) лигандом ионного канала и b) определение эффекта лиганда ионного канала на клетку, или a) приведение клетки, экспрессирующей ионный канал, в контакт с i) плазмой животного и ii) соединением, которое определяют как лиганд ионного канала, и b) определение эффекта соединения на клетку, или a) приведение клетки, экспрессирующей ионный канал, в контакт с плазмой животного, которому был введен лиганд ионного канала, и b) определение эффекта лиганда ионного канала на клетку.

Изобретение относится к области биохимии. Способ идентификации клеток, которые показывают восприимчивость к ингибированию передачи сигнала, в которую вовлечены рецептор фактора роста фибробластов (FGF-R) или его вариант, включающий определение статуса фосфорилирования субстрата 2 рецептора FGF-R (FRS-2), его варианта или его фрагмента, содержащего тирозин, в биологическом образце, в качестве биомаркера такой чувствительности к ингибированию, где в отношении клеток, которые показывают фосфорилирование тирозина FRS-2, можно ожидать, что они покажут восприимчивость к ингибированию передачи сигнала с участием FGF-R.

Группа изобретений относится к медицине и может быть использована для обнаружения злокачественных опухолей, включая рак молочной железы, рак почек. Для этого проводят измерение экспрессии полипептида, обладающего способностью связываться посредством реакции антиген-антитело с антителом против белка CAPRIN-1, имеющего любую из аминокислотных последовательностей с четными номерами SEQ ID NO:2-30 списка последовательностей, в образце, полученном из живого организма, посредством реакции антиген-антитело в образце, выделенном из живого организма.

Настоящее изобретение относится к прогностическому анализу, а также к способу его применения для определения вероятности продуцирования терапевтического ответа в пораженных клетках или тканях на лечение заболевания, имеющего этиологию, связанную с избыточной пролиферацией клеток, с использованием сердечного гликозида.

Настоящее изобретение относится к медицине и описывает способ определения раковых клеток в плевральном выпоте или асцитической жидкости у больных с подозрением на злокачественные новообразования, предусматривающий взятие экссудата у обследуемого больного в количестве 10 мл, причем серозную жидкость из плевральной или брюшной полости обследуемого больного помещают в искусственную среду, где создают давление, необходимое для прохождения всего исследуемого экссудата через калиброванный фильтр с диаметром пор одна тысяча нанометров, при этом опухолевые клетки задерживаются в осадке на калиброванном фильтре, осадок наносят на предметные стекла, которые предварительно обезжиривают и охлаждают для лучшего прилипания опухолевых клеток и высыхания, затем фиксируют мазки - отпечатки трехпроцентным спиртовым раствором Лейшмана в течение 2-4 минут, далее смывают дистиллированной водой и красят азур-эозиновой смесью в соотношении 3:1 продолжительностью 15 минут, после покраски промывают дистиллированной водой, сушат на воздухе и приступают к просмотру под микроскопом.

Изобретение относится к лабораторной диагностике, а именно к одностадийному способу одновременной детекции раковых клеток толстой кишки или элементов раковых клеток толстой кишки в биологическом образце из лимфатических узлов.

Изобретение относится к диагностическим методам в медицине и может быть использовано в онкологии при адъювантной терапии опухолей, а также при длительном наблюдении за пациентами после оперативного удаления опухолей. Способ описывает определение циркулирующих раковых клеток, чувствительных к адъювантной гормональной терапии, в крови больных раком молочной железы, включает выделение и обогащение циркулирующих опухолевых клеток с использованием антител с магнитными метками, получение лизатов циркулирующих опухолевых клеток, извлечение мРНК из лизатов циркулирующих опухолевых клеток, получение кДНК, получение амплифицированной ДНК, определение экспрессии маркерных генов, при этом в случае наличия одного из маркеров GA733-2, MUC-1, HER2 делается заключение о наличии циркулирующих опухолевых клеток, и при обнаружении маркеров ESR1, PGR делается заключение о наличии циркулирующих опухолевых клеток, чувствительных к гормональной терапии. Способ позволяет значительно увеличить вероятность обнаружения циркулирующих опухолевых клеток, чувствительных к адъювантной гормональной терапии, повысить точность измерений и увеличить число анализируемых характеристик циркулирующих опухолевых клеток, повысить чувствительность методов анализа и эффективность диагностики при работе с больными раком молочной железы для оценки прогноза и эффективности терапии, улучшить эффективность лечения и выживаемость онкологических больных. 5 ил., 1 пр.

Группа изобретений относится к области биохимии. Предложен L-фукоза α1→6-специфичный лектин, экстрагируемый из базидиального гриба или сумчатого гриба, характеризующийся пиковым значением молекулярной массы около 4500 m/z, определяемым при масс-спектрометрическом анализе MALDI-TOF. Новый L-фукоза α1→6-специфичный лектин обладает высоким сродством к L-фукоза α1→6 сахарной цепи, определяемым константой ассоциации 1,0×104 М-1 или более (при 25ºС), и имеет константу ассоциации 1,0×103 М-1 или менее (при 25ºС) с высокоманнозными сахарными цепями и/или гликолипидами, не содержащими L-фукоза α1→6 сахарную цепь. В одном варианте предложенный L-фукоза α1→6 специфичный лектин представляет собой белок или пептид, состоящий из аминокислотной последовательности, выбранной из SEQ ID NO:2-6. L-фукоза α1→6-специфичный лектин используют для специфического обнаружения L-фукоза α1→6 сахарной цепи и эффективной очистки L-фукоза α1→6 сахарной цепи или сахарной цепи, не содержащей L-фукозу α1→6. 6 н. и 10 з.п. ф-лы, 38 ил., 8 табл., 4 пр.

Изобретение относится к способу индуцирования противоопухолевого иммунитета приведением в контакт антиген-представляющей клетки с иммунологически активным фрагментом, выбранным из группы, состоящей из: (i) иммунологически активного фрагмента полипептида, кодируемого нуклеиновой кислотой ТОМ34, представляющего собой декапептид, обладающий способностью индуцировать цитотоксические Т-клетки, содержащий аминокислотную последовательность SEQ ID NO:7; (ii) иммунологически активного фрагмента полипептида, кодируемого нуклеиновой кислотой ТОМ34, представляющего собой пептид, обладающий способностью индуцировать цитотоксические Т-клетки, где пептид содержит аминокислотную последовательность SEQ ID NO:7, в которой 1 или 2 аминокислоты замещены или добавлены; (iii) иммунологически активного фрагмента (ii), где вторая аминокислота с N-конца аминокислотной последовательности SEQ ID NO:7 представляет собой фенилаланин, тирозин, метионин или триптофан; и (iv) иммунологически активного фрагмента (ii), где С-концевая аминокислота аминокислотной последовательности SEQ ID NO:7 представляет собой фенилаланин, лейцин, изолейцин, триптофан или метионин, или с полинуклеотидом, кодирующим указанный фрагмент, или с вектором, содержащим этот полинуклеотид. Применение изобретения обеспечивает эффективную иммунотерапию рака. 10 ил., 3 табл.

Группа изобретений основана на применении рецептора хемокина CCR4 в качестве маркера для идентификации и/или стадирования рака. Информацию диагностического характера получают путем измерения уровней CCR4, экспрессируемого эпителиальными опухолевыми клетками в образце солидной или негематологической опухоли пациента. Группа изобретений относится также к применению олигонуклеотидного праймера или зонда, способного к гибридизации в жестких условиях с SEQ ID NO:1, для обнаружения присутствия или измерения количества экспрессии CCR4 эпителиальными клетками солидной опухоли или негематологической опухоли. Использование группы изобретений позволяет более точно и надежно диагностировать или стадировать рак. 3 н. и 34 з.п. ф-лы, 22 ил., 13 пр.

Изобретение касается диагностического реагента для диагностики рака поджелудочной железы и/или панкреатита, включающего α1→6 специфический лектин, который отличается сильным сродством и высокой специфичностью к фукозе. Фукозный α1→6 специфичный лектин имеет возможность воздействовать на патологический гаптоглобин, содержащийся в образце, взятом у живого организма. При этом указанный лектин: (1) выделен из базидиомицетов; (2) имеет молекулярную массу от 4000 до 40000, установленную ДСН (додецилсульфатом натрия) электрофероза в полиакриламидном геле, и (3) имеет сродство с фукозной α1→6 сахарной цепью с константой связывания 1.0×104 M-1 или более при температуре 25°C и (4) с константой связывания 1.0×103 M-1 или менее при температуре 25°C для длинной маннозной сахарной цепи и/или гликолипида, не содержащего фукозную α1→6 сахарную цепь. Изобретение обеспечивает точную диагностику рака поджелудочной железы и/или панкреатита. 2 з. п. ф-лы, 13 ил., 3 табл.
Изобретение относится к области медицины, а именно к способу качественной дифференциальной диагностики доброкачественных и злокачественных новообразований слизистой оболочки языка по содержанию биомаркеров в ротовой жидкости. Cущность способа состоит в том, что определяют количественное содержание матриксной металлопротеиназы 2 (ММП 2) в ротовой жидкости пациента, за группу клинического контроля принимают уровень 1,7-2,9 нг/мл, при количестве ММП 2 14,4-24,3 нг/мл диагностируют папиллому слизистой оболочки языка пациента, при содержании в ротовой жидкости ММП 2 пациента 4,1-6,8 нг/мл диагностируют рак слизистой оболочки языка. В качестве биомаркера для качественной дифференциальной экспресс-диагностики новообразований слизистой оболочки языка в ротовой жидкости определяют тканевый ингибитор металлопротеиназы 2 (ТИМП 2), при этом за группу клинического контроля принимают уровень 6,44-11,23 нг/мл, при содержании ТИМП 2 29,25-48,75 нг/мл диагностируют папиллому слизистой оболочки языка, при содержании ТИМП 2 57,23-95,03 нг/мл диагностируют рак слизистой оболочки языка. Использование заявленного способа позволяет повысить точность дифференциальной диагностики доброкачественных и злокачественных новообразований слизистой оболочки языка. 1 з.п. ф-лы, 6 пр.

Изобретение относится к медицине, а именно к иммунотерапии, и может быть использовано для оценки эффективности лечения у пациента с раком. Для этого пациенту вводят иммуногенную композицию, которая содержит рекомбинантный вирусный вектор, экспрессирующий in vivo весь или часть MUC-1 антигена. При этом способ анализа включает получение биологического образца от пациента после введения указанной иммуногенной композиции и измерение уровней интерферона γ в образце. Уровни интерферона γ свыше приблизительно 4 пг/мл свидетельствуют о том, что пациент демонстрирует успешный клинический выход для лечения. Изобретение позволяет оценить клинический результат лечения рака у пациента.14 з.п. ф-лы., 3 ил., 1 пр.

Предложенная группа изобретений относится к области медицины, в частности онкологии и молекулярной биологии. Предложены способ и набор праймеров и зонда с последовательностями SEQ ID NO: 1, 2 и 3 для осуществления полимеразной цепной реакции в режиме реального времени для диагностики светлоклеточной почечноклеточной карциномы (СПК). Оценивают количественное содержание мРНК гена ACY1. При сниженном содержании мРНК в предположительно пораженной раком ткани человека по сравнению с количеством мРНК в здоровой ткани диагностируют СПК. Предложенная группа изобретений позволяет с высокой достоверностью диагностировать СПК, в том числе на ранней стадии опухолевого заболевания. 2 н. и 2 з.п. ф-лы, 1 ил., 5 табл., 6 пр.

Предложенная группа изобретений относится к области медицины, в частности онкологии и молекулярной биологии. Предложены способ и набор праймеров и зонда с последовательностями SEQ ID NO: 1, 2 и 3 для осуществления полимеразной цепной реакции в режиме реального времени для диагностики светлоклеточной почечноклеточной карциномы (СПК). Оценивают количественное содержание мРНК гена NETO2. При повышенном содержании мРНК в предположительно пораженной раком ткани человека по сравнению с количеством мРНК в здоровой ткани диагностируют СПК. Предложенная группа изобретений позволяет с высокой достоверностью диагностировать СПК, в том числе на ранней стадии опухолевого заболевания. 2 н. и 2 з.п. ф-лы, 1 ил., 5 табл., 6 пр.

Группа изобретений относится к области медицины, фармацевтики и биохимии и касается маркера метастазов злокачественности меланомной опухоли, содержащего аминокислотную последовательность SEQ ID NO:1. Заявлены также выделенное антитело и моноклональное антитело, которые распознают белок TM9SF4 человека путем связывания с пептидным фрагментом SEQ ID NO:1, а также набор для детекции злокачественности опухолей, содержащий указанное антитело, применение SEQ ID NO:1 для определения метастатического характера меланомы. Группа изобретений обеспечивает быструю детекцию метастазирования меланомной опухоли. 7 н. и 3 з.п. ф-лы, 8 пр., 2 табл., 10 ил.
Наверх