Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор



Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор
Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор
Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор
Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор
Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор
Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор
Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор
Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор
Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор
Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор
Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор
Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор
Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор
Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси и используемый в нем набор

 


Владельцы патента RU 2523589:

КВИАГЕН ГАМБУРГ ГМБХ (DE)
КВИАГЕН ГМБХ (DE)

Настоящее изобретение относится к области биотехнологии и касается способа амплификации и детекции нуклеотидных последовательностей в реакционной смеси и набору, используемому в этом способе. Представленный способ включает предоставление исследуемого образца, реагентов для осуществления амплификации посредством полимеразной цепной реакции (ПЦР) и, по меньшей мере, четырех двояко-меченных зондов. Каждый из зондов является специфическим к своей нуклеотидной последовательности, подлежащей детекции, несет флуоресцентную метку и соответствующий тушитель флуоресценции, причем два зонда несут одинаковую метку и зонды, которые несут одинаковую метку, различаются по температуре плавления (Тпл., Tm). Далее проводят амплификацию нуклеотидных последовательностей и анализ кривой плавления при помощи двояко-меченных зондов в реакционной смеси. Охарактеризованное решение может быть использовано в мультиплексном ПЦР-анализе в реальном времени при диагностике биоагентов. 2 н. и 7 з.п. ф-лы, 9 ил., 21 табл., 2 пр.

 

Область, к которой относится изобретение

Настоящее изобретение относится к области биологии и химии, более конкретно, к области молекулярной биологии и генетики человека. Изобретение относится к области идентификации некоторых нуклеотидных последовательностей в образце. В частности, изобретение относится к области одновременной амплификации и детекции нуклеотидных последовательностей в реакционной смеси. Изобретение относится к способам, наборам и системам детекции нуклеотидных последовательностей в образце.

Предпосылки создания изобретения

Методы диагностики, которые позволяют точно, специфически и быстро обнаруживать биологические агенты, например патогены в образцах, играют все возрастающую роль как в мониторинге заболевания, так и в диагностике биоагентов. Некоторые методы анализов позволяют своевременно и точно детектировать физиологически или клинически релевантные организмы, что способствует раннему обнаружению инфекционного или другого опасного агента.

ДНК-микрочип представляет собой набор микроскопических точек ДНК, обычно представляющих собой единичные гены, удерживающиеся на твердой поверхности за счет ковалентного связывания с химической матрицей. ДНК чипы отличаются от других типов микрочипов только тем, что они либо измеряют ДНК, либо используют ДНК как часть системы детекции. В качественных или количественных определениях с ДНК-микрочипами используется селективный характер ДНК-ДНК или ДНК-РНК гибридизации в условиях высокой жесткости и при детекции с помощью флуорофоров. ДНК-чипы обычно используют для профилирования экспрессии, т.е. мониторинга уровней экспрессии тысяч генов одновременно, или для сравнительной геномной гибридизации. Недостатком этой системы является то, что перед анализом необходимо провести множество стадий. Чип также не является чувствительным.

До настоящего времени наиболее чувствительные методы детекции включают ПЦР. Определение присутствия или отсутствия множества биологических агентов в едином образце можно осуществлять методами мультиплексного анализа.

В мультиплексном ПЦР-анализе используются наборы из множества уникальных праймеров в одной ПЦР-реакции для продуцирования ампликонов различных размеров, специфических для различных ДНК-последовательностей, т.е. различных трансгенов. Нацеливаясь на множество генов сразу, можно в одном эксперименте получить дополнительную информацию, для получения которой иным способом требовалось бы в несколько раз больше реагентов и больше времени. Температуры отжига для каждого набора праймеров следует оптимизировать, чтобы получать корректные результаты в ходе одной реакции, а размеры ампликонов, т.е. длина пар оснований, должны достаточно отличаться, чтобы давать раздельные полосы при визуализации методом гель-электрофореза.

Мультиплексный ПЦР-анализ в реальном времени представляет собой метод, который можно использовать для диагностики. ПЦР-анализы могут быть ограничены сложностью оптимизации ПЦР реакций для тестирования на множество агентов в экономически эффективном числе реакционных пробирок. Как правило, число зондов, необходимых для обеспечения высокоточного подтверждения результата, составляет от двух, примерно, до шести последовательностей. Как известно специалисту в области молекулярной биологии и генетики человека, оптимизация реакции ПЦР с использованием различных пар праймеров и зондов может представлять собой очень трудную задачу, которая все труднее поддается контролю по мере увеличения числа детектируемых мишеней. Анализы на основе реакции ПЦР могут ограничиваться также числом имеющихся уникальных меток для анализа результатов. Например, в ПЦР-анализах в реальном времени обычно используются флуоресцентные метки.

Число меток, которые можно использовать в одной реакции, ограничено числом каналов передачи цвета флуоресценции в применяемой системе оптической детекции.

Большое преимущество мог бы дать метод одновременной амплификации и детекции множества нуклеотидных последовательностей в одном контейнере.

Международная патентная заявка WO 2005/111243 А2 относится к методу детекции агентов в двух контейнерах (емкостях). В действительности недостатком метода, раскрываемого в WO 2005/111243 А2, является то, что необходимы два контейнера (две емкости). Было бы желательно, чтобы для реакции требовалась одна емкость (контейнер).

Сущность изобретения

Настоящее изобретение относится к способу одновременной амплификации и детекции нуклеотидных последовательностей в реакции (в реакционной смеси), включающему следующие стадии: (i) предоставление образца, содержащего по меньшей мере одну нуклеотидную молекулу; (ii) предоставление реагентов для осуществления реакции амплификации, причем реагенты содержат по меньшей мере четыре, предпочтительно, по меньшей мере пять, более предпочтительно, по меньшей мере шесть зондов, отличающихся тем, что (а) каждый из зондов является специфическим к нуклеотидной последовательности; (б) по меньшей мере два, предпочтительно, по меньшей мере три зонда несут одинаковую метку; и (в) каждый из зондов, который несет одинаковую метку, имеет температуру плавления (Тпл., Tm), которая отличается более чем на 2°С от температуры плавления других зондов с такой же меткой при их диссоциации от целевой нуклеотидной последовательности при нагревании; (iii) амплификацию нуклеотидных последовательностей в реакции; (iv) детекцию амплифицированных нуклеиновых кислот путем определения, связан ли меченый зонд со своей нуклеотидной последовательностью; и (v) определение температуры, при которой каждый данный меченый зонд диссоциирует от нуклеотидной последовательности, с которой он связан. Изобретение относится также к наборам для применения в таком способе.

Термин "нуклеотидная последовательность" по данному описанию в контексте настоящего изобретения означает последовательность нуклеиновой кислоты. Нуклеиновая кислота может, среди прочего, представлять собой РНК, ДНК, кДНК (комплементарную ДНК), ЗНК (LNA, запертую (закрытую) нуклеиновую кислоту), мРНК (матричную РНК), мтРНК (митохондриальную РНК), рРНК (рибосомную РНК), тРНК (транспортную РНК), siPHK (малую интерферирующую РНК), snPHK (малую ядерную РНК), snoPHK (малую ядрышковую РНК), scaPHK (малую РНК из телец Кахаля), микроРНК, дц(дн)РНК (двухцепочечную (двухнитевую)РНК), рибозим, рибосвич, вирусную РНК, дцДНК (двухцепочечную ДНК), оцДНК (одноцепочечную ДНК), плазмидную ДНК, космидную ДНК, хромосомную ДНК, вирусную ДНК, мтДНК (митохондриальную ДНК), яДНК (ядерную ДНК), snДНК (малую ядерную ДНК) и т.п., или нуклеиновую кислоту любого класса или подкласса, отличную от нуклеиновой кислоты в образце.

Термин "зонд" по данному описанию означает нуклеиновую кислоту, способную связывать другую нуклеиновую кислоту.

Термин "ткань" по данному описанию относится к любой ткани или жидкости человека, животного или растения, включая, но без ограничения, ткань молочной железы, предстательной железы, кровь, сыворотку, спинномозговую жидкость (ликвор), ткани печени, почки, головы и шеи, глотки, щитовидной железы, поджелудочной железы, желудка, толстой кишки, колоректального рака, матки, шейки матки, кости, костный мозг, ткани яичек, головного мозга, нервную ткань, ткань яичника, кожи и легкого).

Термин "набор зондов" по данному описанию означает набор из трех или более агентов, которые могут взаимодействовать с молекулой нуклеиновой кислоты в конкретном положении, т.е. последовательности.

Термин "метка" по данному описанию означает частицу (фрагмент), которая связана (ковалентной или нековалентной связью) с зондом, если она может вызывать сигнал, который можно обнаружить оптическими или другими физическими методами.

Подробное описание изобретения

В первом аспекте настоящее изобретение относится к способу одновременной амплификации и детекции нуклеотидных последовательностей в реакции (в реакционной смеси), включающему следующие стадии:

(i) предоставление образца, содержащего по меньшей мере одну нуклеотидную молекулу;

(ii) предоставление реагентов для осуществления реакции амплификации, причем реагенты включают по меньшей мере четыре, предпочтительно, по меньшей мере пять, более предпочтительно, по меньшей мере шесть зондов, отличающихся тем, что

(а) каждый из зондов является специфическим к нуклеотидной последовательности;

(б) по меньшей мере два, предпочтительно, по меньшей мере три зонда несут одинаковую метку; и

(в) каждый из зондов, который несет одинаковую метку, имеет температуру плавления (Тпл., Tm), которая отличается более чем на 2°С от температуры плавления других зондов с такой же меткой, когда они диссоциируют от целевой нуклеотидной последовательности при нагревании;

(iii) амплификацию нуклеотидных последовательностей в реакции;

(iv) детекцию амплифицированных нуклеиновых кислот путем определения, связан ли меченый зонд со своей нуклеотидной последовательностью; и

(v) определение температуры, при которой каждый данный меченый зонд диссоциирует от нуклеотидной последовательности, с которой он связан.

В предпочтительном варианте способа по изобретению реагенты включают по меньшей мере четыре зонда, причем по меньшей мере два зонда несут одинаковую метку.

В другом предпочтительном варианте способа по изобретению реагенты включают по меньшей мере четыре зонда, причем по меньшей мере три зонда несут одинаковую метку.

В другом предпочтительном варианте способа по изобретению реагенты включают по меньшей мере пять зондов, причем по меньшей мере два зонда несут одинаковую метку.

В другом предпочтительном варианте способа по изобретению реагенты включают по меньшей мере пять зондов, причем по меньшей мере три зонда несут одинаковую метку.

В другом предпочтительном варианте способа по изобретению реагенты включают по меньшей мере пять зондов, причем по меньшей мере четыре зонда несут одинаковую метку.

В другом предпочтительном варианте способа по изобретению реагенты включают по меньшей мере шесть зондов, причем по меньшей мере два зонда несут одинаковую метку.

В другом предпочтительном варианте способа по изобретению реагенты включают по меньшей мере шесть зондов, причем по меньшей мере три зонда несут одинаковую метку.

В другом предпочтительном варианте способа по изобретению реагенты включают по меньшей мере шесть зондов, причем по меньшей мере четыре зонда несут одинаковую метку.

В другом предпочтительном варианте способа по изобретению реагенты включают по меньшей мере семь зондов, причем по меньшей мере два зонда несут одинаковую метку.

В другом предпочтительном варианте способа по изобретению реагенты включают по меньшей мере семь зондов, причем по меньшей мере три зонда несут одинаковую метку.

В другом предпочтительном варианте способа по изобретению реагенты включают по меньшей мере семь зондов, причем по меньшей мере четыре зонда несут одинаковую метку.

В другом предпочтительном варианте способа по изобретению реагенты включают по меньшей мере восемь зондов, причем по меньшей мере два зонда несут одинаковую метку.

В другом предпочтительном варианте способа по изобретению реагенты включают по меньшей мере восемь зондов, причем по меньшей мере три зонда несут одинаковую метку.

В другом предпочтительном варианте способа по изобретению реагенты включают по меньшей мере восемь зондов, причем по меньшей мере четыре зонда несут одинаковую метку.

Метки зондов, предпочтительно, являются флуоресцентными метками.

Две или более флуоресцентных метки считают одинаковой меткой, если их длина волны максимального излучения находится в пределах 10 нм, предпочтительно, в пределах 5 нм. Наиболее предпочтительно, чтобы одинаковые флуоресцентные метки являлись идентичными флуоресцентными красителями.

Предпочтительно, чтобы зонды, несущие одинаковую метку, имели различные температуры плавления (Тпл., Tm) таким образом, чтобы их можно было различить по температуре плавления.

Как указывается выше, предпочтительно, чтобы зонды с одинаковой меткой имели температуры плавления, которые различались бы по меньшей мере на 2°С, предпочтительно, по меньшей мере, на 5°С, более предпочтительно, примерно, на 5-10°С, еще более предпочтительно, примерно, на 5-8°С, еще более предпочтительно, примерно, на 5-7°С, еще более предпочтительно, примерно, на 5-6°С. Следует понимать, что в данном описании при указании температур термин "примерно" ("около") включает отклонения (девиации) до +/-10% от численного значения температуры.

В конкретном варианте настоящее изобретение относится к способу одновременной амплификации и детекции нуклеотидных последовательностей в реакции (в реакционной смеси), включающему следующие стадии: (i) предоставление образца, содержащего по меньшей мере одну нуклеотидную молекулу; (ii) предоставление реагентов для осуществления реакции амплификации, причем реагенты содержат по меньшей мере два набора зондов, отличающихся тем, что (а) каждый из наборов зондов состоит по меньшей мере из трех зондов; (б) каждый из зондов является специфическим к нуклеотидной последовательности; (в) каждый из зондов данного набора зондов несет отличную метку; (г) все зонды данного набора зондов имеют сходную, предпочтительно, идентичную температуру плавления (Тпл., Tm), когда они диссоциируют от целевой нуклеотидной последовательности при нагревании; (iii) амплификацию нуклеотидных последовательностей в реакции; (iv) детекцию амплифицированных нуклеиновых кислот путем определения, связан ли меченый зонд со своей нуклеотидной последовательностью; и (v) определение температуры, при которой каждый данный меченый зонд диссоциирует от нуклеотидной последовательности, с которой он связан.

В другом варианте изобретения способ включает по меньшей мере три набора зондов, причем каждый набор зондов содержит по меньшей мере три зонда.

Изобретение становится более понятным, если рассмотреть Фигуру 1. Набор зондов по изобретению содержит по меньшей мере 3 зонда. Набор зондов можно рассматривать как все эти зонды с одинаковой меткой, но также как все эти зонды с одинаковой температурой плавления (Тпл.). В идеале зонды в наборе зондов, которые имеют одинаковую метку или метки, которые не отличаются друг от друга, имеют различные температуры плавления. Зонды в наборе зондов с идентичной или очень близкой температурой плавления должны иметь различные метки.

Специалист в области молекулярной биологии и генетики человека знает, что обычно реагенты включают, например, фермент для амплификации, буфер, нуклеотиды и т.п. Естественно, это зависит от типа амплификации.

Заявители разработали способ, который позволяет осуществлять мультиплексную амплификацию, например, с 20 матриц. В одном варианте изобретения используют 5 различных меток, и все зонды с общей меткой имеют немного различающуюся температуру плавления. С другой стороны, все зонды с одинаковой температурой плавления имеют различные метки. Определяя метку и температуру плавления либо в ходе, либо после амплификации, заявители впервые получили способ, позволяющий анализировать, например, указанные 20 матриц в одной пробирке.

Чтобы лучше понять общий принцип, посмотрите, пожалуйста, на Фигуру 1. На этой Фигуре все зонды в первом ряду имеют общую метку. Все зонды в первом ряду отличаются своей температурой плавления. Все зонды в колонке D имеют общую конкретную температуру плавления. При условии, что зонды в ряду один имеют зеленую метку, а метки у всех зондов в колонке D различны, но все эти зонды имеют общую температуру плавления 55°С, можно определить, присутствует ли в реакционной смеси матрица для зонда "4", так как в этом случае обнаруживается зеленый сигнал метки при температуре плавления 55°С.

В принципе эту "детекцию амплифицированных нуклеиновых кислот путем определения, связан ли меченый зонд со своей нуклеотидной последовательностью" и "определение температуры, при которой каждый конкретный меченый зонд диссоциирует от нуклеотидной последовательности, с которой он связан" можно проводить в конце данной реакции или в ходе реакции.

Могут применяться различные методы амплификации, например амплификация по типу катящегося кольца (такую как Liu, et al., "Rolling circle DNA synthesis: Small circular oligonucleotides as efficient templates for DNA polymerases," J. Am. Chem. Soc. 118: 1587-1594 (1996)), изотермическая амплификация (такую как в Walker, et al., "Strand displacement amplification - an isothermal, in vitro DNA amplification technique", Nucleic Acids Res. 20 (7): 1691-6 (1992)), лигазная цепная реакция (такая как в Landegren, et al., "A Ligase-Mediated Gene Detection Technique," Science 241: 1077-1080, 1988, или в Wiedmann, et al., "Ligase Chain Reaction (LCR) - Overview and Applications," PCR Methods and Applications (Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, NY, 1994) pp.S51-S64). Однако предпочтительной является амплификация с помощью полимеразной цепной реакции.

Если реакция представляет собой полимеразную цепную реакцию, "детекцию амплифицированных нуклеиновых кислот путем определения, связал ли меченый зонд со своей нуклеотидной последовательностью" и "определение температуры, при которой каждый конкретный меченый зонд диссоциирует от нуклеотидной последовательности, с которой он связан" можно проводить после каждого цикла, через один цикл, более чем через один цикл, через интервалы или по окончании полной ПЦР-реакции.

ПЦР-реакция может состоять из 10-100 "циклов" денатурации и синтеза молекулы ДНК. В предпочтительном варианте изобретения температура, при которой проводится денатурация при реакции амплификации (термоциклирования), составляет, примерно, от 90°С до температуры выше 95°С, более предпочтительно, примерно, 92-94°С. Предпочтительные методы амплификации термоциклической реакцией представляют собой полимеразные цепные реакции, включающие, примерно, 10-100 циклов, более предпочтительно, примерно, 25-50 циклов, и максимальные температуры, примерно, от 90°С до температуры выше 95°С, более предпочтительно, 92-94°С. В предпочтительном варианте изобретения ПЦР проводят, используя ДНК-полимеразу I для получения, в количествах, возрастающих в геометрической прогрессии в зависимости от числа стадий, по меньшей мере одной целевой нуклеотидной последовательности, при условии, что (а) что достаточно хорошо известно, что можно синтезировать олигонуклеотидные праймеры, которые гибридизуются с концами последовательности-мишени, и (б) что имеется небольшое количество последовательности-мишени для инициации цепной реакции. Продукт цепной реакции будет представлять собой дискретный нуклеотидный дуплекс с концами, соответствующими концам используемых специфических праймеров. В качестве исходной нуклеиновой кислоты можно использовать любой источник нуклеиновой кислоты, в очищенном или неочищенном виде, если он содержит, или предположительно содержит, нужную целевую нуклеиновую последовательность (последовательность-мишень). Так, например, в процессе можно использовать ДНК, которая может быть одноцепочечной или двухцепочечной. Помимо этого можно применять гидрид ДНК-РНК, который содержит по одной цепи (нити) каждой из этих нуклеиновых кислот. Можно также применять смесь любой из этих нуклеиновых кислот или можно использовать также нуклеиновые кислоты из описанной выше реакции амплификации с применением тех же самых или других праймеров. Амплифицируемой нуклеиновой кислотой, предпочтительно, является ДНК. Амплифицируемая целевая нуклеотидная последовательность может представлять собой лишь участок молекулы большего размера или может изначально являться дискретной молекулой для того, чтобы конечная последовательность-мишень представляла собой целую нуклеотидную кислоту. Необязательно, чтобы амплифицируемая целевая последовательность-мишень изначально присутствовала в чистом виде; она может являться минорной частью сложной смеси или участком нуклеотидной последовательности конкретного животного ввиду того, что его ткни могут составлять только минорную (малую) часть конкретного образца. Исходная нуклеиновая кислота может содержать более одной заданной целевой нуклеотидной последовательности, причем эти последовательности могут быть одинаковыми или различными. Следовательно, способ применим для одновременной амплификации множества целевых нуклеотидных последовательностей, локализованных на одних и тех же или на различных нуклеотидных молекулах. Нуклеиновая(ые) кислота(ы) можно получать из любого источника, они включают плазмиды и клонированную ДНК, ДНК из любого источника, включая бактерии, дрожжи, вирусы и высшие организмы, такие как растения или животные. ДНК можно получать, например, из крови или другой жидкости, или тканевого материала, такого как клетки ворсинчатого хориона или амниона, различными методами, например, такими как методы, описанные в Maniatis et al., Molecular Cloning: A Laboratory Manual, (New York: Cold Spring Harbor Laboratory) pp. 280-281 (1982). Можно применять метод Templex, который объединяет технологию Tem-PCR, разработанный Genaco, и программу Luminex на основе хМАР.

В анализе используют локус - специфические праймеры. Олигонуклеотидные праймеры можно получать любым подходящим методом, например, таким как фосфотриэфирный или фосфодиэфирный метод или их варианты с применением автоматического синтезатора. В одном таком автоматическом варианте в качестве исходных материалов используют диэтилфосфорамидиты, их можно получать как описано в статье Beaucage et al., Tetrahedron Letters, 22: 1859-1862 (1981), вводимой в данное описание в качестве ссылки. Один метод синтеза олигонуклеотидов на модифицированной твердой подложке описан в патенте США No.4458006, который вводится в данное описание в качестве ссылки. Можно также использовать праймер, который выделен из биологического источника (например, расщеплением рестриктазой). Предпочтительные праймеры имеют длину, примерно, 15-100, более предпочтительно, примерно, 20-50, наиболее предпочтительно, примерно, 20-40 оснований. Обязательным условием является, чтобы праймеры, используемые в методе, охватывали область, содержащую целевую последовательность. Целевую нуклеотидную последовательность амплифицируют, используя нуклеиновую кислоту, содержащую такую последовательность, в качестве матрицы. Если нуклеиновая кислота содержит две цепи (нити), необходимо разделить (расшить) цепи нуклеиновой кислоты перед использованием ее в качестве матрицы либо на отдельной стадии, либо одновременно с синтезом продуктов удлинения праймера. Это расшивание на одноцепочечные нити можно осуществлять любым подходящим методом денатурации, включая физические, химические или ферментативные методы. Один физический метод расшивания нуклеиновой кислоты на одноцепочечные нити включает нагревание нуклеиновой кислоты до полной (>99%) денатурации. Типичная термическая денатурация может включать интервал (ранжирование) температур, примерно, от 80°С до 105°С, предпочтительно, примерно, от 90°С до 98°С, еще более предпочтительно, от 93°С до 95°С, временной интервал составляет, примерно, от 1 до 10 минут. В случае изотермической амплификации расшивание на одноцепочечные нити можно также индуцировать ферментом класса, известного как геликазы, или ферментом RecA, который обладает геликазной активностью и заведомо денатурирует ДНК. Условия реакции, необходимые для расшивания двухцепочечных нуклеиновых кислот на одноцепочечные нити геликазами, описаны в Cold Spring Harbor Symposia on Quantitative Biology, Vol.XLIII "DNA: Replication and Recombination" (New York: Cold Spring Harbor Laboratory, 1978), а обзор методов применения RecA дан в Radding, Ann. Rev. Genetics, 16: 405-37 (1982), вводимых в данное описание в качестве ссылки.

Этот синтез можно осуществлять любым подходящим методом. Обычно его проводят в водном буферном растворе. В некоторых предпочтительных вариантах изобретения рН буфера около 7.5-8.9 к буферу, содержащему разделенные цепи матрицы. К буферу, содержащему разделенные одноцепочечные нити матрицы прибавляют, предпочтительно, молярный избыток (для клонированной нуклеиновой кислоты соотношение праймер:матрица равно обычно, примерно, 1000:1, а для геномной нуклеиновой кислоты соотношение праймер:матрица равно обычно, примерно, 106:1) олигонуклеотидных праймеров. Однако понятно, что в некоторых случаях применения процесса по данному описанию количество комплементарной нити может быть неизвестным, так что количество праймера по отношению к количеству комплементарной цепи не может быть определено точно. Однако, на практике праймер добавляется в молярном избытке по сравнению с количеством комплементарной цепи (матрицы), когда амплифицируемая последовательность содержится в сложной смеси длинноцепных нуклеотидных нитей. Большой молярный избыток предпочтителен для повышения эффективности процесса.

Нуклеозидтрифосфаты, предпочтительно, дАТФ (dATP), dCTP, dGTP, dTTP и/или dUTP также добавляют в смесь для синтеза (реакционную смесь) в адекватных количествах. Предпочтительная молярная концентрация нуклеотидов составляет от 0.025 мМ до 1 мМ, предпочтительно, от 0.05 до 0.6 мМ, наиболее предпочтительно, 0.1-0.5 мМ.

Предпочтительно, полимеразу по изобретению выбирают из группы родов Thermus, Aquifex, Thermotoga, Thermocridis, Hydrogenobacter, Thermosynchecoccus и Thermoanaerobacter.

Предпочтительно, полимеразу по изобретению выбирают из группы организмов Aquifex aeolicus, Aquifex pyogenes, Thermus thermophilus, Thermus aquaticus, Thermotoga neapolitana, Thermus pacificus, Thermus eggertssonii и Thermotoga maritima.

Наиболее предпочтительно, чтобы полимераза представляла собой полимеразу Taq. Однако, как более подробно излагается ниже, в некоторых вариантах изобретения предпочтительно, чтобы полимераза проявляла 5'-3' экзонуклеазную активность. В других вариантах изобретения предпочтительно, когда полимераза не обладает 5'-3' экзонуклеазной активностью. В большинстве вариантов изобретения предпочтительно, чтобы полимераза не обладала 3'-5' экзонуклеазной активностью.

В одном варианте изобретения в ходе ПЦР вводятся урапильные остатки. Урацил - ДНК-гликозилаза (урацил-N-гликозилаза) является продуктом гена ung Escherichia coli, и ее клонировали, секвенировали и экспрессировали в Е. coll. Урацил - ДНК-гликозилаза (UDG) удаляет эти урапильные остатки из ДНК (одно- и двухцепочечной), не разрушая сахар - фосфодиэфирный скелет ДНК, тем самым предупреждая ее использование в качестве гибридизационной мишени или в качестве матрицы для ДНК-полимераз. Полученные АР-сайты являются чувствительными к гидролитическому расщеплению при повышенных температурах. Поэтому удаление урацильных оснований обычно сопровождается фрагментацией ДНК. Специалист в области молекулярной биологии и генетики человека знает, как использовать урацил-ДНК- гликозилазу, чтобы избежать образования примесей. Как фермент, так и урацилсодержащий нуклеотид могут входить в набор по настоящему изобретению.

Желательно, чтобы метки зондов в первом и втором и т.д. наборе зондов представляли собой флуоресцентные метки и чтобы они имели очень близкую длину волны излучения. Теоретически это значит, что их можно обнаружить, не меняя настройки длины волны, которую можно детектировать с помощью датчика. Предпочтительно, чтобы метки зондов в первом, втором и третьем и т.д. зонде были идентичны.

Предпочтительно, чтобы зонды, несущие одинаковую метку, различались по температуре плавления (Tm) таким образом, чтобы их можно было различить по температуре плавления на данном приборе, обычно разница температур плавления должна составлять более 0.1°С, 0.2°С, 0.3°С, 0.4°С, 0.5°С, 1°С, 1.5°С, 2°С, 2.5°С, 3°С, 4°С, 5°С, 6°С, 7°С, 8°С, 9°С или 10°С. Предпочтительно, чтобы эта разница составляла 1°С, 1.5°С, 2°С, 2.5°С, 3°С, 4°С, 5°С.

В одном варианте изобретения переходы двухцепочечных сегментов при плавлении можно определять мониторингом интенсивности флуоресценции красителей, специфических к двухцепочечным нуклеиновым кислотам (dsNAS). Краситель, специфический к двухцепочечной нуклеиновой кислоте, выбирают из группы, состоящей из SYBR® Green I, SYBR® Gold, этидия бромида, пропидия бромида, Pico Green, Hoechst 33258, YO-PRO-I и YO-YO-I, SYTO®9, LC Green®. LC Green® Plus+, EvaGreen™. Эти насыщающие красители способны существовать в достаточно насыщающих условиях относительно ДНК во время и после амплификации, минимально ингибируя ПЦР. Например, при максимальных ПЦР-совместимых концентрациях краситель, связывающий дцДНК имеет процент насыщения по меньшей мере 50%. В других вариантах изобретения процент насыщения составляет по меньшей мере 80%. В других вариантах изобретения процент насыщения составляет по меньшей мере 99%. Понятно, что процент насыщения означает процент флуоресценции по сравнению с флуоресценцией того же самого красителя в насыщающих концентрациях. Насыщающая концентрация представляет собой концентрацию, которая дает наивысшую интенсивность флуоресценции, возможную в присутствии заданного количества дцДНК. Так как эти красители могут присутствовать в значительно повышенных концентрациях, не оказывая заметного влияния на некоторые реакции нуклеиновых кислот, эти красители могут применяться, в частности, для мониторинга конформации одноцепочечных нуклеиновых кислот и дцДНК.

Предпочтительной реакцией является полимеразная цепная реакция.

Предпочтительно, чтобы зонды выбирались из следующей группы: зонд TaqMan, молекулярный маяк, "скорпион" - зонд и LightCycler зонд. Детекцию самого продукта амплификации можно осуществлять, используя один из следующих зондов: зонд TaqMan, молекулярный маяк, "скорпион" - зонд, LightCycler зонд, гибридизационный зонд, зонд замещения и другие типы форматов зондов, специфических к последовательности.

В TaqMan® анализе используется 5' нуклеазная активность Taq ДНК-полимеразы по расщеплению флуоресцентно меченного зонда (FAM™ меченного MGB).

Молекулярные маяки представляют собой одноцепочечные олигонуклеотидные гибридизационные зонды, которые образуют структуру типа стебель-и-петля (Фигура 2). Петля содержит последовательность зонда, которая комплементарна последовательности-мишени, а ствол образуется отжигом комплементарных последовательностей плеч, которые расположены на каждой стороне последовательности зонда. Флуорофор ковалентной связью связывается с концом одного плеча, а тушитель (гаситель флуоресценции) ковалентной связью связывается с концом другого плеча. Молекулярные маяки не флуоресцируют в свободном состоянии в растворе. Однако, когда они гибридизуются с нуклеотидной нитью, содержащей последовательность-мишень, они претерпевают конформационное изменение, которое вызывает их яркую флуоресценцию. В отсутствие мишеней зонд имеет темный цвет, так как стебель помещает флуорофор настолько близко к нефлуоресцирующему тушителю, что их электроны временно (транзиторно) становятся общими, при этом утрачивается способность флуорофора флуоресцировать. Когда зонд встречает молекулу-мишень, он образует гибрид зонд-мишень, который является более длинным и более устойчивым, чем гибрид со стеблем. Жесткость и длина гибрида зонд-мишень исключает существование гибрида со стеблем. Затем молекулярный маяк претерпевает самопроизвольное изменение конформации, которое заставляет стеблевой гибрид диссоциировать, а флуорофор и тушитель отдаляться друг от друга, возобновляя флуоресценцию. Молекулярные маяки добавляют к реакционной смеси перед проведением амплификации гена и флуоресценцию измеряют в реальном времени. Можно синтезировать молекулярные маяки, которые содержат флуорофоры, окрашенные в разные цвета, что делает возможным осуществление способа по изобретению.

Цвет полученной в результате флуоресценции, если таковой имеется, в комбинации с определением температуры плавления позволяет идентифицировать патогенный агент.

Праймеры типа "скорпион" (Фигура 3) представляют собой бифункциональные молекулы, в которых праймер ковалентной связью связан с зондом. Молекулы также содержат флуорофор и гаситель (тушитель). В отсутствие мишени гаситель почти полностью поглощает излучение, испускаемое флуорофором. В процессе "Скорпион" ПЦР- реакции в присутствии мишени флуорофор и гаситель разделяются, что приводит к повышению испускаемого флуоресцентного излучения. Флуоресценцию можно детектировать и измерять в реакционной пробирке.

Система Light Cycler FRET зондов (с резонансным переносом энергии) представляет собой пару одноцепочечных меченных флуоресцентной меткой олигонуклеотидов. Зонд 1 (донорный зонд) метят по 3' концу донорным флуорофором (обычно флуоресцеином), а Зонд 2 (акцепторный зонд) метят по 5' концу одним из четырех известных флуорофоров (красным 610, 640, 670 или 705). Свободную 3' гидроксильную группу Зонда 2 необходимо блокировать фосфатной группой (Р), чтобы предотвратить удлинение за счет Taq ДНК-полимеразы. Во избежание пространственных затруднений между донорным и акцепторным флуорофорами на обоих зондах, необходим спейсер из 1-5 нуклеотидов (nt) (длина 4-25Å), чтобы отделить два зонда друг от друга. Перед началом любой количественной ПЦР-реакции в реальном времени внутри пробирки может наблюдаться фоновая флуоресценция.

На стадии отжига количественной ПЦР в реальном времени ПЦР праймеры и зонды Light Cycler гибридизуют со специфическими областями-мишенями, что приводит к непосредственной близости донорного красителя с акцепторным красителем. Когда донорный краситель возбуждается светом от прибора Light Cycler (hγ1), происходит резонансный перенос энергии (FRET) от донорного красителя к акцепторному. Перенос энергии заставляет акцепторный краситель излучать свет (hγ2), имеющий большую длину волны, чем свет, излучаемый прибором (hγ1). Длину волны света, излучаемого акцепторным флуорофором, детектируют с помощью оптического блока прибора. Усиления измеряемого флуоресцентного сигнала прямо пропорционально количеству аккумулирующейся целевой ДНК.

Другие альтернативные зонды представляют собой зонды серии Eclipse (Epoch, Nanogen), displacement зонды (зонды замещения) (Cheng et al., Nucleic Acids Research, 2004, Vol.32, No.7), зонды- плеяды (pleiades) (NAR 2007 Vol 35 5 e30) и plexor системы (Promega). Несомненно, изобретение также охватывает другие системы зондов.

В одном варианте изобретения зонд TaqMan объединяют с включенным красителем, применяемым для определения температуры плавления.

В другом варианте изобретения зонд TaqMan объединяют с гибридизационным зондом, применяемым для определения температуры плавления, в особом варианте изобретения TaqMan зонд является гибридизационным зондом. В другом варианте изобретения зонд TaqMan является не гибридизационным зондом, а гибридизационным зондом служит отдельный олигонуклеотид.

На Фигуре 4 показан предпочтительный вариант изобретения. В данном случае реакционная смесь содержит как гибридизационный зонд, так и зонд TaqMan. В данном случае (а) каждый набор зондов состоит, например, по меньшей мере из двух зондов, отличающихся тем, что эти зонды представляют собой гибридизационные зонды, (б) каждый из зондов является специфическим к нуклеотидной последовательности, (в) каждый из гибридизационных зондов (например, BHQ 1, BHQ 2, BHQ 3 на Фигуре 4) в данном наборе зондов несет отличную (другую) метку (см., например, колонку А на Фигуре 1), (г) все зонды в данном наборе зондов имеют сходную, предпочтительно, идентичную температуру плавления (Tm) (см., например, колонку А на Фигуре 1), когда они диссоциируют от их целевой нуклеотидной последовательности (последовательности-мишени) при нагревании. В процессе реакции происходит амплификация нуклеотидных последовательностей, амплифицированные нуклеиновые кислоты детектируют и определяют температуру, при которой каждый данный меченый зонд диссоциирует от нуклеотидной последовательности, с которой он был связан. В данном варианте изобретения предпочтительным, хотя не непременным, требованием является, чтобы точка плавления гибридизационного зонда была ниже точки плавления праймеров, применяемых для амплификации.

Один пример показан на Фигуре 5. В процессе ПЦР при данной точке плавления (точке плавления гибридизационного зонда Q1) гибридизационный зонд Q1 диссоциирует от цепи ДНК. Гибридизационный зонд несет гаситель. После диссоциации зонд TaqMan вызывает сигнал, идущий от флуоресцентной метки, который более не гасится. Точка плавления становится известной благодаря сигналу (точка плавления mp1). Метка известна (FL1). Следовательно, можно определить, что этот гибридизационный зонд специфичен, например, к патогену 1 (р1), который, как теперь найдено, присутствует в реакционной смеси. Одновременно зонд TaqMan позволяет делать количественные определения онлайн в процессе ПЦР.

Предпочтительно, чтобы реакционная смесь дополнительно содержала краситель, специфический к двухцепочечной нуклеиновой кислоте. Если применяется краситель, специфический к двухцепочечной нуклеиновой кислоте, предпочтительно, чтобы этот краситель был выбран из группы, состоящей из SYBR® Green I, SYBR® Gold, этидия бромида, пропидия бромида, Pico Green, Hoechst 33258, YO-PRO-1 и YO-YO-I. Самым предпочтительным красителем является SYBR® Green I.

В соответствии с данным изобретением желательно, чтобы спектр красителя, специфический к двухцепочечной нуклеиновой кислоте, отличался от спектра меток, которые несут зонды.

В идеале метка представляет собой флуоресцентную метку, и эту метку выбирают из группы, включающей FAM (5- или 6- карбоксифлуоресцеина), VIC, NED, флуоресцеина, FITC, IRD- 700/800, СУЗ, CY5, CY3.5, CY5.5, HEX, TET, TAMRA, JOE, ROX, BODIPY TMR, Oregon Green, Родамин зеленый, Родамин красный, Техасский красный, Yakima Yellow, Alexa Fluor PET, Biosearch Blue™, Marina Blue®, Bothell Blue®, Alexa Fluor® 350 FAM™, SYBR® Green 1, EvaGreen™, Alexa Fluor® 488 JOE™, VIC™, HEX™, TET™, CAL Fluor® Gold 540, Yakima Yellow®, ROX™, CAL Fluor® Red 610, Cy3.5™, Texas Red®, Alexa Fluor® 568 Cy5™, Quasar™ 670, LightCycler Red 640®, Alexa Fluor 633 Quasar™ 705, LightCycler Red705®, Alexa Fluor® 680, SYTO®9, LC Green®, LC Green® Plus+.

Альтернативный вариант метода основан на следующем главном принципе: анализ кривой плавления, проводимый на завершающей стадии ПЦР с использованием единственного зонда с двумя метками, позволяет дифференцировать мишени. Чтобы избежать гидролиза этого зонда, который обычно происходит на стадиях удлинения в процессе TaqMan ПЦР в реальном времени, выбирают таким образом, чтобы точка плавления (Tm) зонда была на 10°С ниже Тm ПЦР-праймеров. В конце ПЦР реакции зонд оставляют гибридизоваться и смесь, проводят постадийное повышение температуры при непрерывном мониторинге флуоресценции. Как в классической TaqMan ПЦР в реальном времени, генерирование флуоресцентного сигнала зондом основано на явлении переноса резонансной энергии по Ферстеру (FRET). Однако, и в противоположность тому, что происходит при TaqMan ПЦР в реальном времени, в данном варианте изобретения гидролиз имеющихся молекул зонда под действием полимеразы Taq либо совсем не идет, либо идет лишь частично. Точнее сказать, что метод основан на уменьшении FRET, наблюдаемом, когда зонд отсоединяется от мишени, принимая случайную конформацию одноцепочечной нуклеиновой кислоты. Среднее расстояние между молекулами репортера и гасителя в зонде с двумя метками становится короче, когда зонд высвобождается из гибрида с последовательностью-мишенью. Так как эффект FRET обратно пропорционален величине этого расстояния в шестой степени, можно легко детектировать разницу между флуоресцентной эмиссией конфигураций зонда в гибридизованном и расплавленном виде. Общая схема показана на Фигуре 6. На Фигуре цикл за циклом показано изменение флуоресценции для различных температур реакции. В предпочтительном варианте данного способа применяемая полимераза не проявляет 5'-3' экзонуклеазной активности.

В предпочтительном варианте изобретения используются "асимметричные" концентрации праймеров. Это осуществляют, меняя отношение обоих праймеров к каждой мишени таким образом, чтобы праймер, вызывающий связывание цепи ДНК с зондом, прибавлялся в более высокой концентрации, чем другой праймер.

В одном альтернативном варианте способа по изобретению (а) меченый зонд представляет собой группу, состоящую из гибридизационного зонда и зонда TaqMan, (б) зонд TaqMan несет указанную метку, (в) указанная метка представляет собой флуоресцентную метку, (г) дополнительно зонд TaqMan содержит гаситель, (д) необязательно, гибридизационный зонд несет дополнительный гаситель, способный гасить флуоресценцию метки, связанной с зондом TaqMan, (е) указанный зонд TaqMan и указанный гибридизационный зонд способны связывать указанную нуклеотидную последовательность по соседству таким образом, что когда оба зонда связаны с соответствующими последовательностями, гаситель (тушитель), находящийся на гибридизационном зонде, по меньшей мере частично, тушит флуоресценцию указанной метки на указанном зонде TaqMan. Предпочтительно, однако, чтобы гибридизационный зонд нес дополнительный гаситель, способный тушить флуоресценцию метки, связанной с зондом TaqMan.

В данном изобретении зонды с идентичными метками образуют группу с гибридизационными зондами, которые имеют температуры плавления (Tm), отличающиеся настолько, чтобы это отличие можно было определить, например, по меньшей мере, на 0.1°С, 0.5°С, 1°С, 1.5°С, 2°С, 2.5°С, 3°С, 4°С, 5°С, 6°С, 7°С, 8°С, 9°С или 10°С. Предпочтительно, чтобы эта разница составляла более 0.5°С, 1°С, 1.5°С, 2°С, 2.5°С, 3°С, 4°С, 5°С. Наиболее предпочтительно, чтобы температуры плавления отличались, примерно, на 5°С. В данном варианте изобретения предпочтительно также, чтобы температура плавления (Тпл., Tm) гибридизационного зонда была ниже, чем температура плавления (Тпл., Tm) зонда TaqMan. Следовательно, когда при отжиге температура реакции повышается, гибридизационный зонд диссоциирует от комплементарной цепи, генерируя первый сигнал по достижении Tm. Затем полимераза получает доступ к зонду TaqMan, что вызывает второй TaqMan сигнал.

Также в этом варианте изобретения предпочтительно, чтобы температура плавления (Tm) гибридизапионного зонда была ниже температуры, при которой полимераза проявляет свою оптимальную активность. Это обеспечивает возможность диссоциации гибридизационных зондов и свободный доступ полимеразы к зонду TaqMan. Очевидно, оптимальным является использование полимеразы, которая проявляет 5'-3' экзонуклеазную активность.

Для проведения ПЦР в реальном времени требуется инструментальная платформа (установка), которая состоит из термоциклера, компьютера, оптического устройства для регистрации возбуждения и излучения флуоресценции и программного обеспечения для сбора и анализа данных. Эти установки, выпускаемые рядом производителей, отличаются объемом выборки (некоторые имеют стандартный формат 96-луночных или 384-луночных планшетов, другие обрабатывают меньше образцов или для них требуются специальные стеклянные капиллярные пробирки, некоторые имеют формат блока, другие - карусели), методом возбуждения (в некоторых используются лазеры, другие используют источники света широкого спектра с настраиваемыми фильтрами или с одним или более диодов), методом детекции (в некоторых используется камера, в других применяется фотоувеличительная трубка или различные типы систем детектирования света) и общей чувствительностью. Имеются также специфические отличия между платформами, относящиеся к способу обработки результатов с помощью программ. В принципе выпускающиеся установки, имеющие два или более каналов детекции, применимы для способа по настоящему изобретению.

Изобретение относится также к набору, содержащему по меньшей мере четыре, предпочтительно, по меньшей мере пять, более предпочтительно, по меньшей мере шесть зондов, которые способны гибридизоваться, в жестких условиях, с одной или более нуклеотидных молекул, отличающемуся тем, что

(а) каждый из зондов является специфическим к нуклеотидной последовательности;

(б) по меньшей мере два, предпочтительно, по меньшей мере три зонда несут одинаковую метку; и

(в) каждый из зондов, который несет одинаковую метку, имеет температуру плавления (Тпл., Tm), которая отличается более чем на 2°С от температуры плавления других зондов с такой же меткой, когда они диссоциируют от целевой нуклеотидной последовательности при нагревании.

В предпочтительном варианте изобретения набор содержит по меньшей мере четыре зонда, причем по меньшей мере два зонда несут одинаковую метку.

В другом предпочтительном варианте изобретения набор содержит по меньшей мере четыре зонда, причем по меньшей мере три зонда несут одинаковую метку.

В другом предпочтительном варианте изобретения набор содержит по меньшей мере пять зондов, причем по меньшей мере два зонда несут одинаковую метку.

В другом предпочтительном варианте изобретения набор содержит по меньшей мере пять зондов, причем по меньшей мере три зонда несут одинаковую метку.

В другом предпочтительном варианте изобретения набор содержит по меньшей мере пять зондов, причем по меньшей мере четыре зонда несут одинаковую метку.

В другом предпочтительном варианте изобретения набор содержит по меньшей мере шесть зондов, причем по меньшей мере два зонда несут одинаковую метку.

В другом предпочтительном варианте изобретения набор содержит по меньшей мере шесть зондов, причем по меньшей мере три зонда несут одинаковую метку.

В другом предпочтительном варианте изобретения набор содержит по меньшей мере шесть зондов, причем по меньшей мере четыре зонда несут одинаковую метку.

В другом предпочтительном варианте изобретения набор содержит по меньшей мере семь зондов, причем по меньшей мере два зонда несут одинаковую метку.

В другом предпочтительном варианте изобретения набор содержит по меньшей мере семь зондов, причем по меньшей мере три зонда несут одинаковую метку.

В другом предпочтительном варианте изобретения набор содержит по меньшей мере семь зондов, причем по меньшей мере четыре зонда несут одинаковую метку.

В другом предпочтительном варианте изобретения набор содержит по меньшей мере восемь зондов, причем по меньшей мере два зонда несут одинаковую метку.

В другом предпочтительном варианте изобретения набор содержит по меньшей мере восемь зондов, причем по меньшей мере три зонда несут одинаковую метку.

В другом предпочтительном варианте изобретения набор содержит по меньшей мере восемь зондов, причем по меньшей мере четыре зонда несут одинаковую метку.

Две или более флуоресцентных метки считают одинаковой меткой, если их длина волны максимального излучения находится в пределах 10 нм, предпочтительно, в пределах 5 нм. Наиболее предпочтительно, чтобы одинаковые флуоресцентные метки являлись идентичными флуоресцентными красителями.

Как указывается выше, предпочтительно, чтобы зонды с одинаковой меткой имели температуры плавления, которые различались бы по меньшей мере на 2°С, предпочтительно, по меньшей мере на 5°С, более предпочтительно, примерно, на 5-10°С, еще более предпочтительно, примерно, на 5-8°С, еще более предпочтительно, примерно, на 5-7°С, еще более предпочтительно, примерно, на 5-6°С.

В конкретном варианте настоящее изобретение относится к набору, содержащему по меньшей мере 6 зондов, которые способны гибридизоваться, в жестких условиях, с одной или более нуклеотидных молекул, отличающемуся тем, что (а) первая группа по меньшей мере из трех зондов несет первую метку, и температуры плавления всех зондов в этой группе различны; и (б) вторая группа по меньшей мере из трех зондов несет вторую метку, а температуры плавления всех зондов в этой группе различны.

Изобретение также относится к набору, содержащему по меньшей мере 9 зондов, которые способны гибридизоваться, в жестких условиях, с одной или более нуклеотидных молекул, отличающемуся тем, что (а) первая группа по меньшей мере из двух зондов несет первую метку, и температуры плавления всех зондов в этой группе различны; и (б) вторая группа по меньшей мере из двух зондов несет вторую метку, и температуры плавления всех зондов в этой группе различны; (в) третья группа по меньшей мере из двух зондов несет третью метку и температуры плавления всех зондов в этой группе различны; и по меньшей мере третья (? четвертая) группа по меньшей мере из двух зондов несет третью метку и температуры плавления всех зондов в этой группе различны. Естественно, изобретение также относится к набору, содержащему большее число наборов зондов и/или большее число зондов.

Если температуры плавления (Tm) зондов различны, то разница между температурами плавления составляет по меньшей мере, 0.5°С, 1°С, 1.5°С, 2°С, 2.5°С, 3°С, 4°С, 5°С, 6°С, 7°С, 8°С, 9°С или 10°С. Предпочтительно, чтобы эта разница составляла более 1°С, 1.5°С, 2°С, 2.5°С, 3°С, 4°С, 5°С. Желательно, чтобы температуры плавления отличались, примерно, на 5°С. В идеале у зондов с одинаковой меткой интервалы разницы между температурами плавления (Tm) выбирают таким образом, чтобы их можно было надежно различать в процессе анализа, например, на 5°С. В таком варианте изобретения зонды, меченные, например, флуоресцеином, имеют температуру плавления (Tm), например, 40°С, 45°С, 50°С и 55°С.

Набор по изобретению может дополнительно включать буфер, нуклеотиды, один или более ферментов, таких как полимераза.

Набор может быть приготовлен в виде предварительной смеси (премикса), к которой пользователю необходимо только добавить зонд.

Праймеры и зонды по изобретению могут быть специфическими к различным мишеням, таким как маркеры заболевания, патогены, аналитические маркеры или любая другая мишень, на которую их можно направлять с помощью амплификации. В частности, изобретение применимо для анализа патогенов. Наиболее распространенным бактериальным заболеванием является туберкулез, вызываемый бактерией Micobacterium tuberculosis, который убивает около 2 миллионов человек в год, больше всего в Африке южнее Сахары. Патогенные бактерии вызывают другие заболевания, распространенные во всем мире, такие как пневмония, причиной которой могут быть такие бактерии, как Streptococcus и Pseudomonas, и алиментарные заболевания, которую вызывают такие бактерии как Shigella, Campylobacter и Salmonella. Также патогенные бактерии вызывают такие инфекции, как столбняк, брюшной тиф, дифтерия, сифилис и проказа. Одним из основных путей попадания загрязнений в пищу и в воду является попадание неочищенных сточных вод в питьевую воду или на сельскохозяйственные угодья, в результате инфицируются люди, которые потребляют эту загрязненную воду и пищу. В развивающихся странах основная часть сточных вод попадает в окружающую среду или на поля. Это типичный способ переноса возбудителей холеры, гепатита А, полиомиелита и ротавируса. Таким образом, в вариантах изобретения праймеры и зонды специфичны к одной или более патогенных бактерий.

Набор можно применять для диагностики человека или животных, для проверки пищи и воды, для применения в анализе или для научных целей.

Описание Фигур

Фигура 1

На Фигуре 1 показан принцип изобретения. В реакционных смесях все зонды, например, из ряда один имеют общую метку. Однако температуры плавления зондов различны. Поэтому можно идентифицировать каждый зонд за счет разницы между температурами плавления. Например, все зонды в колонке D имеют одинаковую температуру плавления, но разные метки. Поэтому можно идентифицировать каждый зонд за счет отличающейся метки.

Фигура 2

На Фигуре 2 показан принцип работы молекулярного маяка. Молекулярные маяки можно использовать в качестве детекторного зонда для ампликонов, например, для диагностических целей. Так как негибридизованные молекулярные маяки не флуоресцируют (темные), нет необходимости выделять гибриды зонд-мишень для определения числа ампликонов, синтезированных в ходе анализа. Поэтому молекулярные маяки идеально подходят для целей настоящего изобретения. Молекулярные маяки прибавляют в аналитическую смесь перед проведением амплификации и флуоресценцию измеряют в реальном времени.

Фигура 3

В случае использования зондов типа "Скорпион" специфическую к последовательности стимуляцию и детекцию продукта ПЦР проводят, используя один олигонуклеотид. Зонд типа "Скорпион" в негибридизованном состоянии сохраняет конфигурацию "стебель-и-петля". Флуорофор связывают с 5' концом, а гасят флуоресценцию частицей, связанной с 3' концом. 3' участок стебля содержит также последовательность, комплементарную продукту удлинения праймера. Эта последовательность связывается с 5' концом специфического праймера через неамплифицированный мономер. После удлинения праймера типа "Скорпион" последовательность специфического зонда способна связываться со своим комплементом в пределах удлиненного ампликона, открывая при этом шпилечную петлю. Это предотвращает тушение флуоресценции, и наблюдается сигнал.

Фигура 4

На Фигуре 4 показан один из предпочтительных вариантов изобретения. В данном случае в реакционной смеси присутствуют по два зонда для каждой последовательности-мишени. Первый гибридизационный зонд несет метку, например, флуоресцентную метку, которая гасится прилегающим зондом TaqMan. Когда достигается температура плавления, гибридизационный зонд диссоциирует от цепи, с которой он связан. В этот момент флуоресцентная метка больше не гасится и генерируется сигнал.

Фигура 5

На Фигуре 5 показан один из предпочтительных вариантов изобретения.. Флуоресцентный сигнал FL 1 при температуре плавления mpl указывает на присутствие в реакционной смеси целевой последовательности (последовательности-мишени) р1.

Фигура 6

На Фигуре 6 показано изменение интенсивности флуоресцентного сигнала, генерируемого единичным зондом с двумя метками, происходящее в течение цикла, а также в процессе ПЦР. Сильный сигнал регистрируется, когда зонд связывается с мишенью. Он становится слабее при диссоциации. Сигнал также становится сильнее к концу реакции вследствие увеличения количества матрицы.

Фигура 7

На Фигуре 7 показан процесс по изобретению. На панели А показан предпочтительный вариант изобретения, уже описанный на Фигуре 1. Реакции осуществляются с применением зондов, например зондов из ряда один, имеющих общую метку. Однако температуры плавления зондов отличаются, примерно, на 5°С и находятся в примерном интервале от 60°С до 80°С, как указано на панели А. Примерный интервал температур плавления от 60°С (примерно, среднее +/-10% девиация) до 80°С является предпочтительным, если сигнал детектируется также в ПЦР в реальном времени, так как эти температуры вполне совместимы с обычными параметрами ПЦР. В данном примере в образце должна содержаться мишень 22. На панели В схематически показан результат ПЦР в реальном времени для такого мультиплексного анализа в случае, когда в образце содержится мишень 22 (показана кружком, обведенным черным), присутствие ее становится заметным при увеличении кривой амплификации в канале детекции, детектирующем метку на зонде для мишени 22. Сбор данных в ПЦР в реальном времени является дополнительной, а не основной стадией для осуществления способа по изобретению. На Фигуре 7 (1?) С результаты эксперимента с многоканальным анализом (детекцией) кривой плавления показаны на стадии реакции, когда имеется достаточно продукта, чтобы генерировать сигнал. В предпочтительном варианте изобретения это происходит в фазе плато. Осуществляя многоканальный анализ кривой плавления, можно идентифицировать каждый зонд с помощью разницы между температурами плавления. Например, все зонды в колонке (столбце) D имеют одинаковую температуру плавления, но различные метку. Можно идентифицировать каждый зонд за счет различия меток, что делает многоканальный анализ кривой плавления основным элементом изобретения. Показанные пики на кривой плавления представляют собой сигнал dF/dT, где максимум на пике относится к точке плавления соответствующего зонда.

Фигура 8

На Фигуре 8 показаны результаты многоканального анализа кривой плавления из Примера 1. Показаны флуоресцентные кривые плавления смесей из реакций в четырех повторах, полученные для ПЦР матриц из Таблицы 9. На горизонтальных рисунках (панелях), помеченных как "зеленый", "оранжевый" и "темно-красный", показаны сигналы, полученные в соответствующих каналах детекции, представленных в Таблице 5. Группы данных, разделенные пунктирной горизонтальной линией, являются результатами для шести различных ПЦР матриц из Таблицы 9, четко демонстрирующими только ожидаемый положительный сигнал пика плавления в ожидаемом канале детекции и с ожидаемой точкой плавления, с положительным контролем (внутренний контроль), который всегда является достоверным положительным контролем.

Фигура 9

На Фигуре 9 показаны результаты Пост-ПЦР анализа кривой плавления из примера 2. На рисунке (панели) А показаны флуоресцентные пики плавления (df/dT) одноплексных реакций для реакционных смесей, полученных в условиях ПЦР из Таблицы 20. Точки плавления, определенные для каждого из четырех зондов, показаны под соответствующими картинками и приводятся в Таблице 21.

На панели В показаны флуоресцентные пики плавления (df/dT) (слева направо): первый - дуплексный для Ubi и HPRT, второй - триплексный для Ubi, HPRT и HSP, третий - квадруплексный для Ubi, HPRT, HSP и Cmyc. Полученные точки плавления для каждого из четырех зондов показаны под соответствующими картинками и приводятся в Таблице 21. Эти результаты ясно демонстрируют, что некоторые зонды, несущие одну и ту же метку, можно четко разделить на основании их точек плавления.

Примеры

Пример 1: Вариант воплощения способа по изобретению, а именно, мультиплексной ПЦР в реальном времени с последующим анализом кривой плавления с помощью флуореспентно-меченых зондов

В данном эксперименте продемонстрирована осуществимость технического замысла, показанного на Фигуре 7. Реакции задуманы, как показано в Таблице 7, осуществляются в четверном повторе и проводятся в соответствии с протоколом, представленным в Таблице 6. Для этой цели используют реагенты из Таблицы 8. Состав 20х Праймер-миксов (Primer mix) и 50х Зонд-миксов (Probe mix) показан в Таблицах 2 и 3, соответственно. Последовательности праймеров и зондов показаны в Таблице 1. В качестве нуклеиновой кислоты-матрицы в ПЦР используют продукт ПЦР, полученный с применением кДНК из человеческих лейкоцитов, а соответствующий for (прямой) и rev (обратный) праймеры для каждой мишени показаны в Таблице 1. ПЦР- продукт очищают, используя набор QiaQuick (Qiagen) для очистки ПЦР- продуктов, и используют в разведении 1:1000. Матрицы добавляют в отдельные реакционные смеси как указано в Таблице 9: В первом случае "только 1C" добавляют только Ubi- матрицу, играющую роль внутреннего положительного контроля. Во втором случае добавляют Ubi 1C и Мишень 1 Alb. В третьем случае используют Ubi 1C и Мишень 2 Cmyc. В четвертом случае вводят Ubi 1C и Мишень 3 ТВР. В пятом случае добавляют Ubi 1C и Мишень 4 GAP. Для шестого случая в качестве матрицы добавляют Ubi 1C и Мишень 5 SRY.

ПЦР в реальном времени проводят на термоциклере RotorGene 6000 PCR System (6-канальном) с ротором на 72 позиции. Характеристики 6 каналов детекции даны в Таблице 5, включая примеры флуоресцентных красителей, которые подходят для детекции в соответствующих каналах. Показатели ПЦР циклов и соответствующей кривой плавления показаны в Таблице 6.

Затем данные эксперимента анализируют с помощью подходящей программы. Экспериментальные значения CT, полученные в ходе ПЦР в реальном времени для внутреннего контроля (1C) и соответствующих мишеней, даются в Таблице 10. Определяют точки плавления зондов (максимум пика плавления на Фигуре 8), результаты представлены в Таблице 11. Пики плавления, полученные для 6 различных экспериментальных условий (Таблица 9) в реакциях в четверном повторе показаны в Таблице 8. Во всех реакциях получен ожидаемый результат, отражающий значения СТ в корректном канале детекции и пики плавления с предполагаемой точкой плавления для соответствующего зонда, детектирующего добавляемую мишень.

Таблица 1:
Название мишени и последовательность праймера/зонда
Название олигонуклеотида Последовательность (5'-3')
GAPDH for (SEQ ID NO.1) TTCCACCCATGGCAAAT
GAPDH rev (SEQ ID NO.2) GAA GAT GGT GAT GGG ATT TC
PE-GAPDH-P (SEQ ID NO.3) CAA GCT TCC CGT TCT CAG CC
SRY-for (SEQ ID NO.4) TCC TCA AAA GAA ACC GTG CAT
SRY-rev (SEQ ID NO.5) AGATTAATG GTTGCTAAGGAC TGGAT
SRY-TM-FAM (SEQ ID NO.6) CAC CAG CAG TAA CTC CCC АСА ACC TCT TT
ALB for (SEQ ID NO.7) TGC CCT GTG CAG AAG ACT АСА ТА
ALB rev (SEQ ID NO.8) CGA GCT CAA CAA GTG CAG TT
ALB Short(18bp)_MK (SEQ ID NO.9) AAG TGA CAG AGT CAC CAA
PEc-myc-for (SEQ ID NO.10) TCA AGA GGT GCC ACG TCT CC
PEc-myc-rev (SEQ ID NO.11) TCT TGG CAG CAG GAT AGT CCT Т
PEc-mycPro_MK (SEQ ID NO.12) CAG CAC AAC TAC GCA GCG CCT CC
UBI-TM.for (SEQ ID NO.13) GTT AAG CTG GCT GTC CTG AAA TAT Т
UBI.TM.rev (SEQ ID NO.14) CCC CAG CAC CAC ATT CAT С
UBI Short(17bp)_MK (SEQ ID NO.15) TAG TCG CCT TCG TCG AG
TBP_HE for (SEQ ID NO.16) TGG AAC CCA CAG TCA TTG ATG A
TBP_HE rev (SEQ ID NO.17) TGA TCT CCT TGC CAA TGG TGT A
TBP_MK (SEQ ID NO.18) AGATGCTGCCAATAACTATGCCCGAG G
Таблица 2:
Концентрации праймеров
Мишень Концентрация праймера 1х Концентрация праймера 20х Primer Mix (праймер-микс)
GAPDH FOR 0.4 мкМ REV 0.1 мкМ FOR 8 мкМ REV 2 мкМ
SRY FOR 0.1 мкМ REV 0.4 мкМ FOR 2 мкМ REV 8 мкМ
ALB FOR 0.1 мкМ REV 0.4MKM FOR 2 мкМ REV 8 мкМ
cmyc FOR 0.1 мкМ REV 0.4 мкМ FOR 2 мкМ REV мкМ
UBI FOR 0.4 мкМ REV 0.1 мкМ FOR 8 мкМ REV 2 мкМ
ТВР FOR 0.1 мкМ REV 0.4 мкМ FOR 2 мкМ REV 8 мкМ
Таблица 3:
Концентрации зондов
Мишень Концентрация зонда 1х Probe Mix (Зонд- микс) 50х
GAPDH (PE-GAPDH-P) 0.3 мкМ 15 мкМ
SRY (SRY-TM-FAM) 0.3 мкМ 15 мкМ
ALB (ALB Short(18bp)_MK) 0.8 мкМ 40 мкМ
Cmyc (PEc-mycPro_MK) 0.1 мкМ 5 мкМ
UBI (UBI Short(17bp)_MK) 0.2 мкМ 10 мкМ
ТВР (TBP_MK) 0.2 мкМ ЮмкМ
Таблица 4:
Метки зондов (Название олигонуклеотида)
Мишень Метка зонда 5'-3'
GAPDH (РЕ-GAPDH-P) FAM- BHQ1
SRY (SRY-TM-FAM) FAM-BHQ1
ALB (ALB Short(18bp)_MK) ROX-BHQ2
Cmyc (PEc-mycPro_MK) ROX-BHQ2
UBI (UBI Short(17bp)_MK) LC670 BBQ
ТВР (TBP_MK) LC670 BBQ
Таблица 5:
Характеристики каналов термоциклера RotorGene 6000
Канал Источник возбуждения/Детекционный фильтр Детектируемые красители (Примеры)
Синий 365±20 нм/460±15 нм Edans, Marina Blue®, AMCA-X, Atto390, Alexa Fluor® 350
Зеленый 470±10 нм/510±5 нм FAM™, Флуоресцеин, Циан 500 Alexa Fluor® 488
Желтый 530±5 нм/555±5 нм JOE™, VIC™, HEX™, TET™, Yakima Yellow®, Cal Fluor Orange 560
Оранжевый 585±5 нм/610±5 нм ROX™, Cy3.5®, Texas Red®, Alexa Fluor® 568, CAL Fluor™ Red 610
Красный 625±10 нм/660±10 нм Cy5®, Quasar 670™, LightCycler Red 640®, Alexa Fluor™ 633
Темно-красный (малиновый) 680±5 нм/712 long полоса пропускания Quasar705™, LC Red 705®, LightCycler Red 670 Alexa Fluor® 680
Таблица 6:
Параметры ПЦР-циклов с применением набора QuantiFast Multiplex PCR Master Mix
ПЦР
Начальная активация ПЦР 95°С 5 мин
Денатурация 95°С 30 сек
Отжиг/Удлинение 60°С 30 сек
Число циклов 40х
Кривая плавления
Pre Melt денатурация 95°С 30 сек
Программа плавления
Линейное повышение от 55°С 95°С
1 градус Цельсия каждая стадия
Ожидание 90 сек Секунда pre-melt (перед плавлением) выдерживания на первой стадии
Ожидание 5 сек Секунда на каждой стадии после этого

Настройка программы для кривой плавления: Оптимизация для каждой пробирки. Программа позволяет осуществлять сбор данных только из одного канала детекции, построение 3 последовательных кривых, детектирование результатов плавления сначала из канала детекции зеленого цвета, затем канала детекции оранжевого, а затем канала детекции темно- красного цвета.

Таблица 7:
Состав реакционной смеси мультиплексного ПЦР анализа
Компонент Конечная концентрация
QuantiFast Multiplex PCR MM 2x 1x
Primer Mix 20x (праймер-микс) 1x
Probe Mix 50x (зонд-микс) 1x
Зода без РНК-азы Доводят до 25 мкл на реакцию
Конечный объем реакционной смеси 25 мкл
Таблица 8:
Компоненты и код материалов для проведения TaqMelt 6plex PCR
QuantiFast Multiplex PCR faster Mix Оба компонента из набора: QuantiFast Multiplex PCR Kit, Qiagen, Material-# 204652
Вода без РНК- азы
GAPDH for От Tib MolBiol http://www.tib-molbiol.de/de/
GAPDH rev
PE-GAPDH-P
SRY-for
SRY-rev
SRY-TM-FAM
ALB for
ALB rev
ALB Short(18bp)_MK
PEc-myc-for
PEc-myc-rev
PEc-mycPro_MK
UBI-TM for
UBI-TM rev
UBI Short(17bp)_MK
TBP_HE for
TBPJHE rev
TBP_MK
Таблица 9:
Условия матричной ПЦР
Условия Ожидаемый позитивный сигнал (Канал детекции) Ожидаемый позитивный сигнал (Канал детекции)
IC только IC Ubi LC670 (Темно-красный) -
IC+Мишень 1 IC Ubi LC670 (Темно-красный) Alb ROX (Orange)
IC+Мишень 2 IC Ubi LC670 (Темно-красный) Cmyc ROX (Orange)
IC+Мишень 3 IC Ubi LC670 (Темно-красный) TBP LC670 (Темно- красный)
IC+Мишень 4 IC Ubi LC670 (Темно-красный) GAP FAM (Green)
IC+Мишень 5 IC Ubi LC670 (Темно-красный) SRY FAM (Green)
Таблица 10:
CT Результаты эксперимента Одна мишень+Внутренний контроль (IC)
Канал
Название Зеленый Оранжевый Темно-красный
IC только 21.0
IC+Мишень 1 22.2 21.1
IC+Мишень 2 17.1 21.1
IC+Мишень 3 18.2
IC+Мишень 4 16.0 20.7
IC+Мишень 5 16.4 21.0
Таблица 11:
Tm Результаты эксперимента Одна мишень + Внутренний контроль (IC)
Зеленый Оранжевый Темно-красный
Название ТМ1 ТМ1 ТМ1 ТМ2
IC только 63.5°С
IC+Мишень 1 61.0°С 64.0°С
IC+Мишень 2 73.8°С 64.0°С
IC+Мишень 3 64.3°С 70.3°С
IC+Мишень 4 66.0°С 64.0°С
IC+Мишень 5 72.2°С 64.0°С

Пример 2

Реализация технического замысла, а именно, метода мультиплексной ПЦР в реальном времени с последующим анализом кривой плавления с помощью различных зондов с различимыми температурами плавления ™, определяемыми в канале детекции FAM.

В данном эксперименте демонстрируется способность различать несколько зондов, несущих одинаковую метку, в одном и том же канале детекции. Состав реакционных смесей показан в Таблице 18, реакции проводят по протоколу, представленному в Таблице 17. Для этой цели используют реагенты из Таблиц 18 и 19. Состав 20х Праймер-миксов (Primer mix) и 10 мкМ Зонд-миксов (Probe mix) показан в Таблицах 13 и 14, соответственно. Последовательности праймеров и зондов показаны в Таблице 12. В качестве нуклеиновой кислоты-матрицы используют /RxN кДНК, полученную с применением РНК из человеческих лейкоцитов, а соответствующий for (прямой) и rev (обратный) праймеры для каждой мишени показаны в Таблице 12. Одноплексные реакционные смеси для каждой из четырех мишеней, дуплексные и триплексные и квадруплексные реакционные смеси готовят и анализируют. Семь различных условий и ожидаемые результаты представлены в Таблице 20.

ПЦР в реальном времени проводят на термоциклере RotorGene 6000 PCR System (6-канальном) с ротором на 72 позиции. Характеристики 6 каналов детекции даны в Таблице 16, включая примеры флуоресцентных красителей, которые подходят для детекции в соответствующих каналах. Показатели ПЦР циклов и соответствующей кривой плавления показаны в Таблице 17.

Затем результаты эксперимента анализируют с помощью подходящей программы. Определяют точки плавления зондов (максимум пиков плавления, показанных на Фигуре 9), результаты представлены в Таблице 21.

Таблица 12:
Название мишени и последовательность праймера/зонда
Название олигонуклеотида Тоследовательность (5'-3')
UBI-TM.5' (SEQ ID NO 13) GTT AAG CTG GCT GTC CTG AAA TAT Т
UBI-TM.3' (SEQ ID NO 14) CCC CAG CAC CAC ATT CAT
UBI Short_MK (SEQ ID NO 15) TAG TCG CCT TCG TCG AG
HPRT-TMfor (SEQ ID NO 19) CTC AAC TTT AAC TGG AAA GAA TGT С
HPRT-TMrev (SEQ ID NO 20) TCC TTT TCA CCA GCA AGC Т
HPRT-TM (SEQ ID NO 21) TTG CTT TCC TTG GTC AGG CAG TAT AAT С
HSP89-TM.5' (SEQ ID NO 22) CAA GTC TGG GAC CAA AGC GT
HSP89-TM.3' (SEQ ID NO 23) AAA ACC AAC ACC GAA CTG GC
HSP (23bp)_MK (SEQ ID NO 24) CAT GGA AGC TTT GCA GGC TGG TGC AGA
PEc-myc-for (SEQ ID NO 10) TCA AGA GGT GCC ACG TCT CC
Pec-myc-rev (SEQ ID NO 11) TCT TGG CAG CAG GAT AGT CCT Т
HE_c-myc Penta Proben (HydrolEasy)_MK (SEQ ID NO 12) CAG CAC AAC TAC GCA GCG CCT CC Модифицирована модификаторами HYNA из Pentabse (www.pentabse.com) для повышения Tm, примерно, до 77°С.
Таблица 13:
Концентрация праймера
Мишень Концентрация праймера 1х Концентрация праймера 20х Primer Mix
UBI FOR 0,1 мкМ REV 0,4 мкМ FOR 8 мкМ REV 2 мкМ
HPRT FOR 0,4 мкМ REV 0.1 мкМ FOR 2 мкМ REV 8 мкМ
HSP FOR 0,1 мкМ REV 0,4 мкМ FOR 2 мкМ REV 8 мкМ
cmyc FOR 0,1 мкМ REV 0,4 мкМ FOR 2 мкМ REV 8 мкМ
Таблица 14:
Концентрация зонда
Мишень Концентрация зонда 1x Probe Mix 50x (зонд-микс)
UBI Short_MK 0,2 мкМ 10 мкМ
HPRT-TM 0,2 мкМ 10 мкМ
HSP (23bp)_MK 0,2 мкМ 10 мкМ
HE_c-myc Penta Proben (HydrolEasy)_VIK 0,2 мкМ 10 мкМ
Таблица 15:
Метки зондов (Название олигонуклеотида)
Мишень Метка зонда 5'-3'
UBI Short_MK FAM-BHQ1
HPRT-TM FAM-BHQ1
HSP (23bp)_MK FAM-BHQ1
HE_c-myc Penta Proben (HydrolEasy)_MK FAM-BHQ1
Таблица 16:
Характеристики каналов термоциклера RotorGene 6000
Канал Источник возбуждения/Детекционный фильтр Детектируемые красители (Примеры)
Синий 365±20 нм/460±15 нм Edans, Marina Blue®, AMCA-X, Atto390, Alexa Fluor® 350
Зеленый 470±10 нм/510±5 нм FAM™, Флуоресцеин, Циан 500 Alexa Fluor® 488
Желтый 530±5 нм/555±5 нм JOE™, VIC™, HEX™, TET™, Yakima Yellow®, Cat Fluor Orange 560
Оранжевый 585±5 нм/610±5 нм ROX™, Cy3.5®, Texas Red®, Alexa Fluor® 568, CAL Fluor™ Red 610
Красный 625±10 нм/660±10 нм Cy5®, Quasar 670™, LightCycler Red 640®, Alexa Fluor™ 633
Темно-красный (малиновый) 680±5 нм/712 long полоса пропускания Quasar705™, LC Red 705®, LightCycler Red 670 Alexa Fluor® 680
Таблица 17:
Параметры ПЦР-циклов с применением набора QuantiFast Multiplex PCR Master Mix
ПЦР
Начальная активация ПЦР 95°С 5 мин
Денатурация 95°С 30 сек
Отжиг/Удлинение 60°С 30 сек
Число циклов 40х
Кривая плавления
Pre Melt денатурация 95°С 30 сек
Программа плавления
Линейное повышение от 55°С 95°С
1 градус Цельсия каждая стадия
Ожидание 90 сек Секунда pre-melt (перед плавлением, предплавление) выдерживания на первой стадии
Ожидание 5 сек Секунда на каждой стадии после этого

Настройка программы для кривой плавления: Оптимизация для каждой пробирки. Программа позволяет осуществлять сбор данных только из одного канала детекции.

Таблица 18:
Состав реакционной смеси мультиплексного ПЦР анализа
Компонент Конечная концентрация
QuantiFast Multiplex PCR MM 2x
Primer Mix 20x (праймер-микс)
Зонд 10 мкМ 0.2 мкМ
Вода без РНК-азы Доводят до 20 мкл на реакцию
Конечный объем реакционной смеси 20 мкл
Таблица 19:
Компоненты и коды материалов для проведения ПЦР
QuantiFast Multiplex PCR Master Mix Оба компонента из набора: QuantiFast Multiplex PCR Kit, Qiagen, Material-# 204652
Вода без РНК-азы
UBI-TM.5' Supplier Tib MolBiol http://www.tib-molbiol.de/de/
UBI-TM.3'
UBI Short_MK
HPRT-TMfor
HPRT-TMrev
HPRT-TM
HSP89-TM.5'
HSP89-TM.3'
HSP (23bp)_MK
PEc-myc-for
Pec-myc-rev
HE_c-myc PentaProben (HydrolEasy)_MK Поставщик Pentabase http://www.pentabase.com/
Таблица 20:
Экспериментальные условия проведения ПЦР
Условия Ожидаемый позитивный сигнал (Канал детекции)
Единичный Ubi 1 Тпл.
Единичный HPRT 1 Тпл.
Единичный HSP 1 Тпл.
Единичный cmyc 1 Тпл.
Дуплекс Ubi, HPRT 2 Тпл.
Триплекс HPRT, HSP, cmyc 3 Тпл.
4плекс Ubi, HPRT, HSP, cmyc 4 Тпл.
Таблица 21:
Тпл, полученные в эксперименте с одной мишенью + внутренний контроль (IC)
Зеленый
Название Тпл °С
Единичный Ubi 60,7
Единичный HPRT 65,0
Единичный HSP 71,0
Единичный cmyc 77,0
Дуплекс Ubi, HPRT 60,7/65
Триплекс HPRT, HSP, cmyc 60,7/65/71
4плекс Ubi, HPRT, HSP, cmyc 60,7/65,0/71/77°С

1. Способ амплификации и детекции нуклеотидных последовательностей в реакционной смеси, включающий следующие стадии:
(i) предоставление образца, содержащего, по меньшей мере, одну нуклеотидную последовательность, подлежащую детекции;
(ii) предоставление реагентов для осуществления амплификации посредством полимеразной цепной реакции (ПЦР);
(iii) предоставление, по меньшей мере, четырех двояко-меченных зондов, причем
(а) каждый из зондов является специфическим к своей нуклеотидной последовательности, подлежащей детекции;
(б) каждый из зондов несет флуоресцентную метку и соответствующий тушитель флуоресценции, причем, по меньшей мере, два зонда несут одинаковую метку; и
(в) зонды, которые несут одинаковую метку, различаются по температуре плавления (Тпл., Tm), таким образом, чтобы их можно было различить по температуре плавления;
(iv) амплификацию нуклеотидных последовательностей в процессе ПЦР;
(v) проведение анализа кривой плавления при помощи двояко-меченных зондов в реакционной смеси, включающего
(а) детекцию амплифицированных нуклеиновых кислот посредством определения, связался ли каждый из меченных зондов со своей нуклеотидной последовательностью;
(б) определение температуры, при которой каждый меченый зонд диссоциирует от нуклеотидной последовательности, с которой он связался.

2. Способ по п.1, в котором, по меньшей мере, три зонда несут одинаковую метку.

3. Способ по п.1, в котором зонды выбирают из группы, состоящей из зондов TaqMan и зондов - молекулярных маяков.

4. Способ по п.1, в котором реакционная смесь дополнительно содержит краситель, специфический к двухцепочечной нуклеиновой кислоте, который спектрально отличается от меток зондов.

5. Способ по п.4, в котором краситель, специфический к двухцепочечной нуклеиновой кислоте, выбирают из группы, состоящей из SYBR® Green I, SYBR® Gold, этидия бромида, пропидия бромида, Pico Green, Hoechst 33258, YO-PRO-I и YO-YO-I, Boxto, EvaGreen, LC Green, LC Green Plus и SYTO 9.

6. Способ по п.1, в котором флуоресцентную метку выбирают из группы,состоящей из FAM (5- или 6-карбоксифлуоресцеина), VIC, NED, флуоресцеина, FITC, IRD-700/800, CY3, CY5, CY3.5, CY5.5, HEX, TET, TAMRA, JOE, ROX, BODIPY TMR, Oregon Green (Орегон зеленый), Родамин зеленый, Родамин красный, Техасский красный (Texas Red), Yakima Yellow, Alexa Fluor PET, Biosearch Blue™, Marina Blue®, Bothell Blue®, Alexa Fluor® 350 FAM™, SYBR® Green 1, EvaGreen™, Alexa Fluor® 488 JOE™, VIC™, HEX™, TET™, CAL Fluor® Gold 540, Yakima Yellow®, ROX™, CAL Fluor® Red 610, Cy3.5™, Texas Red®, Alexa Fluor® 568 Cy5™, Quasar™ 670, LightCycler Red 640®, Alexa Fluor 633 Quasar™ 705, LightCycler Red705®, Alexa Fluor® 680, SYTO®9, LC Green®, LC Green® Plus+.

7. Набор, для применения в анализе кривой плавления, охарактеризованном в пункте 1, содержащий, по меньшей мере, четыре двояко-меченных зонда, в котором:
(а) каждый из зондов специфичен к своей нуклеотидной последовательности, подлежащей детекции;
(б) каждый из зондов несет флуоресцентную метку и соответствующий тушитель флуоресценции, причем, по меньшей мере, два зонда несут одинаковую метку; и
(в) зонды, которые несут одинаковую метку, различаются по температуры плавления (Тпл., Tm), таким образом, чтобы их можно было различить по температуре плавления.

8. Набор по п.7, в котором, по меньшей мере, три зонда несут одинаковую метку.

9. Набор по п.7, в котором зонды выбраны из группы, состоящей из зондов TaqMan и зондов - молекулярных маяков.



 

Похожие патенты:
Изобретение относится к области биохимии. Проводят количественную оценку эффективности олеиновой кислоты как переносчика РНК через биологические мембраны.

Изобретение относится к области биотехнологии и касается синтетических олигонуклеотидов-праймеров. Представленные праймеры фланкируют участки генов PB2, PB1, PA, NP, MP, NS низкопатогенных вирусов гриппа птиц и не дают перекрестных реакций с родственными видам.

Группа изобретений относится к области биотехнологии. Способ определения уровня экспрессии гена МСР1 (CCL2) предусматривает оценку количества его мРНК методом полимеразной цепной реакции (ОТ-ПЦР) с детекцией сигнала в реальном времени в образцах клеток, тканей и биологических жидкостей человека.

Изобретение относится к области медицины, генетической инженерии и молекулярной биологии. Предложен способ мониторинга рака молочной железы у субъекта.

Изобретение относится к области биохимии, в частности к применению QTL аллеля, ассоциированного с устойчивостью к Bemisia для придания устойчивости к Bemisia растения Capsicum annuum.

Изобретение относится к биотехнологии и представляет собой способ определения у спортсмена состояния утомления и состояния «перетренированности» по повышенной экспрессии гена триптофинил-тРНК-синтетазы (ТРСазы).

Изобретение относится к области микробиологии и паразитологии микроорганизмов. Способ предусматривает рестрикционный анализ бактериальной ДНК бластоцист с использованием комбинации эндонуклеаз рестрикции - Нае III, Pst I и Hind III, позволяющих идентифицировать простейших с различной степенью вирулентности.

Изобретение относится к биотехнологии и представляет собой способ оценки воспаления и/или резистентности к инсулину у животного путем количественного определения присутствия анализируемого вещества в сыворотке или плазме.

Предложенная группа изобретений относится к области медицины и ветеринарии. Предложен биокомпозит для обеспечения восстановительных процессов после повреждения у млекопитающего, содержащий носитель, по меньшей мере одну нуклеиновую кислоту, содержащую гены, кодирующие VEGF и/или SDF-1, и клетки, обеспечивающие репаративную регенерацию.

Предложенная группа изобретений относится к области ветеринарии. Предложена иммуногенная композиция для собак, содержащая эффективное количество вирионов парвовируса с белком типа VP-2, содержащим нуклеиновую кислоту, выбранную из группы, состоящей из SEQ ID NO:2 и SEQ ID NO:4.

Группа изобретений относится к области биотехнологии. Способ модульного конструирования ДНК аптамеров, способных специфически и высокоаффинно связывать тромбин, имеющих стабилизированную основную субструктуру, предусматривает сборку их структуры моделированием из комбинации трех структурных модулей, содержащих квадруплексный модуль нуклеиновой кислоты, дуплексный модуль нуклеиновой кислоты и соединяющий их модуль нуклеиновой кислоты, имеющий неканоническую структуру, путем определения третичной структуры его спектральным методом кругового дихроизма с подтверждением факта образования более стабильного G-квадруплекса, отличного от квадруплексной структуры исходного структурного квадруплексного модуля.

Изобретение относится к области биохимии, в частности к способу селекции аптамеров к клеточным рецепторам и поверхностным белкам, который включает проведение раундов селекции, каждый из которых включает стадии: позитивной селекции с дальнейшим удалением несвязавшаяся ДНК; негативной селекции с последующим отделением связавшихся с негативной мишенью последовательностей; амплификацию полученных в ходе селекции аптамеров с получением ПЦР-продукта.

Изобретение относится к области молекулярной биологии, биохимии и медицины. Предложена L-нуклеиновая кислота - антагонист MCP-1 и способ её детектирования.

Изобретение относится к области ветеринарной вирусологии и касается тест-системы и способа для обнаружения РНК вируса болезни Шмалленберг. Предложенная тест-система включает праймер Schm U, имеющий нуклеотидную последовательность 5'-САА ССА GAA GAA GGC САА GA-3', праймер Schm L, имеющий нуклеотидную последовательность 5'-TCT GGC АСА GGA TTT GAG AC-3' и зонд Schm Z, имеющий последовательность 5'-[Hex] CCC CAC САА AAG TAA GAT CGA CAC [BHQ2]-3'.

Изобретение относится к области биотехнологии и касается набора праймеров для выявления генетического материала (РНК) и дифференциации вируса парагриппа человека 1, 2, 3 и 4 типов в клинических образцах.

Изобретение относится к области биотехнологии и сельского хозяйства. В способе растения обрабатывают раствором биологически активного вещества, в качестве которого используют 24-эпибрассинолид.

Изобретение относится к биохимии и представляет собой полипептид, обладающий антимикробной активностью, включающий аминокислотную последовательность, которая имеет, по меньшей мере, 70% идентичности с аминокислотной последовательностью, соответствующей положениям 1-21 SEQ ID NO:2.
Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для выявления ДНК пародонтопатогенного микроорганизма Treponema denticola методом полимеразной цепной реакции.
Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для выявления ДНК пародонтопатогенного микроорганизма Candida albicans методом полимеразной цепной реакции.

Изобретение относится к области молекулярной биологии и может быть использовано в диагностических исследованиях, направленных на выявление возбудителей острых кишечных инфекций (ОКИ).

Изобретение относится к области биохимии, в частности к способу получения одноцепочечной кольцевой РНК. Способ включает синтез смысловой цепи и антисмысловой цепи, содержащих нуклеотидную последовательность с неспаренными нуклеотидами на 5'-конце и 3'-конце, и одновременно лигирование нуклеотида на 5'-конце нуклеотидной последовательности с неспаренными нуклеотидами в смысловой цепи с нуклеотидом на 3'-конце нуклеотидной последовательности с неспаренными нуклеотидами в антисмысловой цепи и, наоборот, с использованием лигазы. Нуклеотидная последовательность с неспаренными нуклеотидами на 5'-конце смысловой цепи и нуклеотидная последовательность с неспаренными нуклеотидами на 3'-конце антисмысловой цепи связаны друг с другом с образованием петли. Нуклеотидная последовательность с неспаренными нуклеотидами на 3'-конце смысловой цепи и нуклеотидная последовательность с неспаренными нуклеотидами на 5'-конце антисмысловой цепи также связаны друг с другом с образованием петли. Смысловая и антисмысловая цепи спарены с образованием стебля. Длина петли составляет 9 нуклеотидов, а длина стебля составляет от 19 до 31 нуклеотида. 2 з.п. ф-лы, 9 ил., 5 пр.
Наверх