Набор синтетических олигонуклеотидов для амплификации и секвенирования its1-5.8s-its2 сосудистых растений



Набор синтетических олигонуклеотидов для амплификации и секвенирования its1-5.8s-its2 сосудистых растений
Набор синтетических олигонуклеотидов для амплификации и секвенирования its1-5.8s-its2 сосудистых растений

 


Владельцы патента RU 2528063:

Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Алтайский государственный университет" (RU)

Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для амплификации и последующего секвенирования ITS1-5.8S-ITS2 сосудистых растений, включающего проведение полимеразой цепной реакции с помощью универсальных праймеров со следующим нуклеотидным составом: primer ITS-for CGTAACAAGGTTTCCGTAG, primer ITS-rew GGAATCCTTGTAAGTTTCTTT. Изобретение позволяет эффективно анализировать структуру внутреннего транскрибируемого спейсера рибосомной ДНК сосудистых растений. 1ил.

 

Изобретение относится к области молекулярной генетики и геносистематики, может быть использовано для синтеза и последующего анализа структуры внутреннего транскрибируемого спейсера рибосомной ДНК сосудистых растений.

Для молекулярно-генетических исследований в области систематики растений на уровне видов наиболее часто используемыми являются внутренние транскрибируемые спейсеры (ITS) области ядерной рибосомальной ДНК (18S-5.8S-26S), обладающие большой копийностью в геноме [Alvarez, I. & Wendel, J. F. (2003) Ribosomal ITS sequences and plant phylogenetic inference // Mol. Phylogenet. Evol. 29, 417-434]. В этом регионе показана высокая вариабельность и потенциальная применимость в качестве маркерного участка (за исключением папоротников) [Stoeckle, М. (2003) Use of DNA barcodes to identify flowering plants // Bioscience 53, 2-3]. На уровне видов дискриминация и простота технического исполнения подтверждаются в большинстве филогенетических исследований, при использовании ITS к тому же существует большое количество данных о последовательностях для данного региона. Анализ полиморфизма межгенных спейсеров позволяет изучать филогенетические отношения между близкородственными видами, а также изучать филогению между популяциями внутри вида и между отдельными индивидуумами.

Преимущество региона ITS в том, что она может быть амплифицирована по частям (имеется два более мелких фрагмента - ITS1 и ITS2 - прилегающих к 5.8S локусу, который расположен в центре всего участка и консервативен). Консервативный регион 5.8S на самом деле содержит филогенетической информацию для дискриминации на уровне классов [Cullings, К. W. & Vogler, D. R. (1998) A 5.8S nuclear ribosomal RNA gene sequence database: applications to ecology and evolution // Mol. Ecol. 7, 919-923]. Некоторые участки 5.8S из немногих видов растений и грибов имеют индели [Hershkovitz, М.А. & Lewis, L.А. (1996) Deep-level diagnostic value of the rDNA-ITS region // Mol. Biol. Evol. 13, 1276-1295]. Для филогенетической реконструкции ITS, как любой быстро развивающийся некодирующий локус, может потребовать разработки комплекса оценки гомологии последовательности. Таким образом, 5.8S локус может служить в качестве опорной точки для поиска алгоритмов, которые используются для филогенетических целей.

Для проведения полимеразной цепной реакции используют праймеры - короткие ДНК-затравки, между которыми происходит синтез определенной последовательности. Для амплификации последовательностей межгенных спейсеров используют, как правило, праймеры, качественный состав которых определяется по нуклеотидной последовательности структурных субъединиц рибосомальных повторов, т.е. 18S и 28S рДНК. Ограниченность использования праймеров обусловлена их видоспецифичностью [Blattner F.R. (1999) Direct amplification of the entire ITS region from poorly preserved plant material using recombinant PCR. In.: Biotechniques 27:1180-1186; White TJ, Bruns T, Lee S, Taylor J, (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Shinsky JJ, White TJ, editors. PCR Protocols: A Guide to Methods and Applications, 315-322. Academic Press, San Diego; Фризен H. Молекулярные методы, используемые в систематике растений. - Барнаул: АзБука, 2007.-64 с.].

Рассмотрим прототип - способ исследования структурно-функциональной организации ДНК рибосомального кластера эукариот, предусматривающий проведение полимеразной цепной реакции с помощью универсальных праймеров, где в качестве праймеров используют последовательности ДНК со следующим ITS1-5.8S-ITS2 нуклеотидным составом:

5' -CTACTAGATGGTTCGATTAGTC-3'

5'-GTCCCTGCCGTTTGTACACA-3'

для анализа внутреннего межгенного спейсера; ITS1-5.8S-ITS2 [Патент RU №2113481 от 20.06.98. Способ исследования структурно-функциональной организации ДНК рибосомального кластера эукариот].

Недостатком данного метода является то, что берется широкий круг таксонов эукариот. Данное обстоятельство чревато тем, что довольно высок процент загрязнения: в результате полимеразной цепной реакции может произойти преимущественная амплификация ITS1-5.8S-ITS2 нецелевого вида.

Работа над созданием праймеров строится следующим образом.

1) С помощью открытых и коммерческих баз данных нуклеотидных последовательностей различных видов сосудистых растений либо в результате самостоятельного определения нуклеотидной последовательности сосудистых растений выбирается участок генома, уникальный для данной группы видов.

2) На основании выбранного участка генома с помощью специального программного обеспечения или вручную подбирается последовательность олигонуклеотидов, используемых для проведения ПЦР-реакции (часто 2 праймера). На данном этапе работа заключается в создании выравнивания многих последовательностей и выборе участка последовательности, где отсутствуют отличия. Выравнивание геномных последовательностей означает сравнение последовательностей многих видов друг с другом, поиск универсальных для сосудистых растений участков.

3) Изготовление праймеров производится на автоматических синтезаторах.

4) С помощью практических экспериментов доказывается пригодность подобранных последовательностей для конкретных целей.

Анализ нуклеотидного полиморфизма последовательности ITS1-5.8S-ITS2 на основании данных NCBI (http://www.ncbi.nlm.nih.gov/) (нуклеотидная база данных представляет собой набор последовательностей из нескольких источников, в том числе GenBank, RefSeq, ТПА и PDB). Данные базы обеспечивают основу для медико-биологических исследований и открытий - позволяют применить данные последовательности в качестве основы для создания праймеров.

Для определения универсальных праймеров выявлены сверхконсервативные субпоследовательности 18S и 28S рДНК различных видов сосудистых растений, которые используются в качестве основы для подбора праймеров для работы методом ПЦР.

Предлагаемое изобретение используется для синтеза и последующего анализа структуры внутреннего транскрибируемого спейсера рибосомной ДНК сосудистых растений. Задачей данного изобретения является поиск универсальных праймеров, применимых для анализа структуры ITS1-5.8S-ITS2 сосудистых растений.

Поставленная задача решается посредством определения последовательности праймеров, а именно для амплификации ITS1-5.8S-ITS2 рибосомной ДНК сосудистых растений предложена пара праймеров следующего нуклеотидного состава:

Аналогичные наборы, реакционные смеси, праймеры для амплификации и последующего секвенирования ITS1-5.8S-ITS2 рибосомной ДНК сосудистых растений неизвестны.

Заявляемый набор синтетических олигонуклеотидов для амплификации и последующего секвенирования ITS1-5.8S-ITS2 проверяют на различных видах сосудистых растений.

Ход работы с применением набора синтетических олигонуклеотидов для амплификации и последующего секвенирования ITS1-5.8S-ITS2 рибосомной ДНК сосудистых растений состоит из следующих шагов.

1) Растительный материал перед проведением ПНР с помощью заявляемого набора проводится через процедуру пробоподготовки с использованием набора Diamont DNA kit (ООО «АБТ», Россия) в соответствии с инструкцией производителя; в ходе этой процедуры из растительного материала выделяется ДНК, которую в свою очередь используют для ПЦР.

2) Полимеразную цепную реакцию проводят на амплификаторе MyCycler (Bio-Rad, USA). Амплификация проводится по следующей программе: 6 циклов: 30 циклов: 94°C - 45 сек, 56°C - 60 сек, 72°C - 70 сек; завершающая стадия: 72°C - 10 мин, охлаждение при 4°C.

Инкубационная смесь конечным объемом 25 мкл содержит: 14,6 мкл H2O; 2 мкл ДНК; 2,5 мкл 10Х буфер; 2,5 мкл 25 мМ MgCl2; по 1 мкл 10 мМ каждого праймера; 1,2 мкл 20 мМ dNTPs; 0,2 мкл Taq-полимеразы.

3) Разделение продукта амплификации производится в 1,8% агарозном геле и 0,5 М ТАЕ-буфере при 2,5 В/см в горизонтальной электрофорезной камере Pharmacia LKB-GNA 200. После электрофореза гель окрашивается раствором этидиум бромида в концентрации 2,5 мг/л в течение 20 мин и фотографируется в проходящем УФ-излучении. На фиг.1 наблюдают результат амплификации ITS1-5.8S-ITS2 рибосомной ДНК различных видов сосудистых растений.

Наличие продуктов амплификации во всех дорожках подчеркивает универсальность предлагаемых праймеров.

Секвенирование проводят на автоматическом секвенаторе ABI Prism 3500 xl с использованием протоколов и наборов реагентов, универсальных рекомендуемых производителем и предлагаемых праймеров. Примеры некоторых последовательностей ITS1-5.8S-ITS2 рибосомной ДНК, размещенные в генбанке NCBI.

1) Последовательность ITS 1-5.8S-ITS2 Bunias orientalis секвенированная с помощью предлагаемых праймеров размещена в генбанке NCBI под номером HE863772.1.

2) Последовательность ITS1-5.8S-ITS2 Rhododendron fauriei секвенированная с помощью предлагаемых праймеров размещена в генбанке NCBI под номером HM854166.1.

3) Последовательность ITS1-5.8S-ITS2 Calluna vulgaris секвенированная с помощью предлагаемых праймеров размещена в генбанке NCBI под номером HM854157.1.

4) Последовательность ITS1-5.8S-ITS2 Rhodiola rosea секвенированная с помощью предложенных праймеров размещена в генбанке NCBI под номером GU384199.1.

5) Последовательность ITS1-5.8S-ITS2 Rhododendron adamsii секвенированная с помощью предложенных праймеров размещена в генбанке NCBI под номером HM854164.1.

6) Последовательность ITS1-5.8S-ITS2 Rhododendron japonicum секвенированная с помощью предложенных праймеров размещена в генбанке NCBI под номером HM854167.1.

Набор синтетических олигонуклеотидов для амплификации и последующего секвенирования ITS1-5.8S-ITS2 сосудистых растений, включающий проведение полимеразной цепной реакции с помощью универсальных праймеров, отличающийся тем, что в качестве праймеров используются последовательности ДНК со следующим нуклеотидным составом:
primer ITS-for CGTAACAAGGTTTCCGTAG
primer ITS-rew GGAATCCTTGTAAGTTTCTTT



 

Похожие патенты:

Группа изобретений относится к области микробиологии и биотехнологии. Способ детекции живых клеток микроорганизма в тестируемом образце путем отличия живых клеток от мертвых клеток или поврежденных клеток предусматривает добавление в тестируемый образец средства, способного к ковалентному связыванию с ДНК или РНК при облучении светом с длиной волны от 350 нм до 700 нм; облучение тестируемого образца; амплификацию мишеневой области ДНК или РНК микроорганизма, содержащегося в тестируемом образце, способом амплификации нуклеиновых кислот в присутствии средства подавления действия вещества, ингибирующего амплификацию нуклеиновых кислот, соли магния, соли органической кислоты или соли фосфорной кислоты, без выделения нуклеиновых кислот из клеток и анализа продукта амплификации.

Изобретение относится к ветеринарной микробиологии и биотехнологии, а именно к генетической инженерии. Предложены синтетические олигонуклеотидные праймеры для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы A у крупного рогатого скота и способ их применения.

Изобретение относится к области биотехнологии и касается видовой и штаммовой идентификации бифидобактерий филотипа Bifidobacterium longum. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейства RelBE и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора видо- и штаммоспецифичных олигонуклеотидов, ПЦР продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера.

Изобретение относится к иммунологии. Предложены варианты применения вариантов набора генов (фармакодинамических (ФД) маркеров) с повышенной регуляцией экспрессии или действия, индуцируемых интерфероном альфа (ИФНα).

Изобретение относится к области биотехнологии и касается способа идентификации лактобацилл. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейств RelBE и MazEF и характеризуется тем, что для идентификации проводят амплификацию геномных ДНК с использованием набора олегонуклеотидов определенной структуры, ПЦР-продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера.

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления видовой принадлежности родиолы четырехнадрезной {Rhodiola quadrifida (Pall.) Fisch.

Изобретение касается способа определения генотипов золотистого стафилококка. Представленный способ включает получение чистой культуры микроорганизмов на плотной питательной среде с последующим выделением и амплификацией ДНК возбудителя с помощью мультиплексной полимеразной цепной реакции (ПЦР) и с детекцией результатов методом электрофореза в агарозном геле.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченного зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени.

Изобретение относится к биотехнологии и может быть использовано для дифференцированного определения числа жизнеспособных актинобактерий рода Rhodococcus, иммобилизованных в нерастворимом гелевом носителе.

Изобретение относится к области биохимии, в частности к биологическому ДНК маркеру, позволяющему идентифицировать ген Rx у культурного картофеля S. tuberosum и его гомологи у родственных дикорастущих видов рода Solanum sect.

Изобретение относится к биотехнологии и представляет собой выделенную полинуклеотидную молекулу с функцией rEVE, рекомбинантный вектор экспрессии, экспрессионный шаттл-вектор, клетку-хозяина, а также способы с использованием вышеуказанной выделенной полинуклеотидной молекулы.

Изобретение относится к области биохимии, в частности к способу специфического отбора высокоаффинных молекул ДНК (ДНК-аптамеров) к рекомбинантному белку-мишени. Указанный способ включает синтез единой полипептидной цепи рекомбинантного белка, содержащего в своем составе фрагмент глютатион-S-трансферазы, целевой белок-мишень, пептидную последовательность, расщепляемую летальным фактором B.

Изобретение относится к области генной инженерии, конкретно к анализу нарушений, связанных с раком яичников, и может быть использовано в медицине. Способ включает определение геномного статуса метилирования CpG-динуклеотидов в каждой последовательности из группы последовательностей SEQ ID NO:1-10 с использованием набора зондов, специфичных для указанных последовательностей и способных гибридизоваться с последовательностью по всей длине.

Изобретение относится к области биотехнологии и касается набора, включающего олигодезоксирибонуклеотидные праймеры и флуоресцентно меченный зонд для идентификации ДНК аденовируса серотипов 3, 4, 7, 14, 21 методом гибридизационно-флуоресцентной полимеразной цепной реакции в режиме реального времени.
Изобретение относится к молекулярной биологии и генетике клетки. Предложен способ, включающий этапы предварительной экстракции геномной ДНК, выделения специфической фракции однонитевых G-оверхенгов теломерной ДНК и последующей амплификации их минусовой цепи с дуплекс-специфическим анализом, причем этапы амплификации включают модификацию 3'-концов теломерных оверхенгов с помощью терминальной дезоксинуклеотидилтрансферазы и осуществляются с использованием набора праймеров SEQ ID NO: 1-5.

Изобретение относится к области молекулярной биологии. Предложен одноцепочечный модифицированный олигонуклеотид, способный ингибировать экспрессию рецептора фактора роста фибробластов 4 FGFR4, а также соответствующие композиция и способы лечения диабета, ожирения, метаболического синдрома, ингибирования экспрессии FGFR4, снижения уровня глюкозы и снижения массы тела.
Изобретение относится к области биохимии и молекулярной биологии, а именно к способу очистки синтетических олигодезоксирибонуклеотидов. Основной задачей настоящего изобретения является разработка эффективного способа очистки олигодезоксирибонуклеотидов с высоким выходом и высокой степенью очистки от производных кремниевой кислоты, пригодного для крупномасштабного синтеза.

Группа изобретений относится к области биохимии. Предложен сосуд из пластика для сорбирования нуклеиновых кислот из жидкой среды.
Изобретение относится к области биохимии. .

Изобретение относится к области медицины, а именно к способу выделения ДНК Mycoplasma hominis (М. hominis) для дальнейшего применения в диагностическом алгоритме. Изобретение представляет способ выделения ДНК Mycoplasma hominis из крови путем ее разделения центрифугированием на супернатант и осадок, последующее обогащение исследуемого материала, выделение ДНК методом аффинной сорбции с добавлением сорбента и лизирующего буфера, инкубацию, трехкратную отмывку сорбентного осадка центрифугированием и удаление надосадочной жидкости, высушиванием сорбентного осадка, добавление раствора для элюции ДНК и детекцию ПЦР-методом. Способ отличается тем, что в качестве исследуемого материала используют осадок цельной крови, а его обогащение производят в процессе выделения ДНК путем удвоения числа пробирок на один образец со 100 мкл осадка цельной крови и 20 мкл сорбента в каждой, в которые перед третьей отмывкой добавляют по 375 мкл отмывочного раствора, а их содержимое соединяют в одну пробирку и к сорбентному осадку добавляют раствор для элюции ДНК в количестве 40 мкл. Изобретение обеспечивает повышение точности диагностики M. Hominis. 1 табл.
Наверх