Синтетические олигонуклеотидные праймеры для идентификации штаммов и изолятов бактерии pasteurella multocida серогруппы а у крупного рогатого скота и способ их применения


 


Владельцы патента RU 2527153:

Государственное научное учреждение Институт экспериментальной ветеринарии Сибири и Дальнего Востока Российской академии сельскохозяйственных наук (ГНУ ИЭВСиДВ Россельхозакадемии) (RU)

Изобретение относится к ветеринарной микробиологии и биотехнологии, а именно к генетической инженерии. Предложены синтетические олигонуклеотидные праймеры для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы A у крупного рогатого скота и способ их применения. Предложенный способ включает проведение ПЦР с синтетическими олигонуклеотидными праймерами на район гена hyaD Pasteurella multocida, перенос продукта амплификации на гель и оценку проведения реакции. Для постановки ПЦР используют ДНК, выделенную из патологического материала или бактериальных культур. ПЦР проводят в 1 раунд. В случае положительной реакции синтезируется фрагмент, соответствующий размеру 218 п.н. Способ может быть использован в ветеринарной микробиологии для диагностики пастереллеза сельскохозяйственных животных. 2 н.п. ф-лы, 5 табл.

 

Изобретение относится к ветеринарной микробиологии и биотехнологии, а именно к генетической инженерии, и может быть использовано для диагностики пастереллеза сельскохозяйственных животных.

Pasteurella multocida - условно-патогенная грамотрицательная бактерия, являющаяся комменсальным обитателем поверхности слизистых оболочек верхних дыхательных путей животных и птиц, способная, при воздействии неблагоприятных факторов внешней среды и/или вирусной инфекции, преодолевать защитные механизмы организма и вызывать тяжелые поражения легких.

На основании строения капсульного антигена все штаммы бактерии делятся на 5 серогрупп. Штаммы серогруппы А вызывают пневмонии у крупного рогатого скота, овец, а также пастереллез птиц и кроликов. Для штаммов этой серогруппы характерно наличие гиалуроновой кислоты в составе капсулы (Carter, G.R. Recommendations for a standard system of designating serotypes of Pasteurella multocida / G.R. Carter, M.M. Chengappa // American Association of Veterinary Laboratory Diagnosticians, 1981. P.37-42).

До настоящего времени основным способом типирования штаммов и изолятов Р. multocida серогруппы А в нашей стране является тест на выявление гиалуроновой кислоты в капсуле бактерии. Для этого изучаемую 18-часовую бульонную культуру Р. multocida высевают штрихом на чашку Петри с 1,5% агаром Хоттингера. Затем перпендикулярно ей высевают штрихом суточную бульонную культуру Staphylococcus aureus, синтезирующую гиалорунидазу. Обе культуры должны пересекаться. Чашки с посевами инкубируют при 37°С в течение 18-24 часов. Штаммы Pasteurella multocida, образующие вблизи (до 5 мм) от линии роста S. aureus более мелкие колонии, чем на удалении от этой линии, считают синтезирующими гиалуроновую кислоту и относят к серогруппе А. Размер колоний штаммов и изолятов других серогрупп не изменяется (Методические указания по лабораторной диагностике пастереллезов животных и птиц. Утверждены Главным управлением ветеринарии министерства сельского хозяйства РФ №22-7/82 от 20.08.1992 г.).

К недостаткам данного способа относятся необходимость получения чистой культуры Р. multocida и поддержания культуры S. aureus. Кроме этого, в процессе культивирования Р. multocida на питательных средах могут возникать спонтанные мутации, приводящие к появлению безкапсульных вариантов бактерии, что приводит к невозможности их типирования по данному способу.

Наиболее близким аналогом, принятым за прототип, является способ, основанный на выявлении фрагмента генов hyaC-hyaD, отвечающих за синтез гиалуроновой кислоты у сероварианта А Р. multocida в полимеразной цепной реакции (ПЦР), включающий, синтез 2 пар специфических олигонуклеотидных праймеров: RGPMA5 5′aatgtttgcgatagtccgttaga3′ и RGPMA6 5′atttggcgccatatcacagtc3′, RGPMANP1 5′gaagtcggcggaaacta3′ и RGPMANP2 5′agtcttttctttcgctttctg3′, амплификацию ДНК возбудителя в два раунда, специфическую идентификацию продукта ПЦР размером 374 п.н. с помощью электрофореза в 2% агарозном геле (Gautam R. Specific identification of Pasteurella multocida serogroup-A isolates by PCR assay / R. Gautam, A.A. Kumar, V.P. Singh, Vijendra P. Singh, Т.К. Dutta, S.B. Shiva-chandra // Res.in Vet. Science. - 2004. - Vol.76. - P.179-185).

К недостаткам данного способа можно отнести то, что он разработан для идентификации штаммов и изолятов Pasteurella multocida серогруппы А в пробах патологического материала, полученного от больных птиц, требует проведения ПЦР в два раунда, а в результате реакции синтезируется фрагмент размером 374 п.н. Чувствительность способа составляет 1,2×104 бактериальных клеток на пробу.

Задачей изобретения является разработка синтетических олигонуклеотидных праймеров для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы А у крупного рогатого скота и способа их применения.

Поставленная задача решается тем, что подобрана и синтезирована пара синтетических олигонуклеотидных праймеров для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы А у крупного рогатого скота, согласно изобретению имеют нуклеотидные последовательности: SEQ ID NO:1 - 5′ tgaaaggggcatcacaaggt 3′, SEQ ID NO:2 - 5′ cccaaggcatataagtcagggt 3′.

Задача решается также тем, что в способе идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы А у крупного рогатого скота, включающем выделение ДНК из проб биоматериала или бактериальных культур и проведение ПЦР с синтетическими олигонуклеотидными праймерами, согласно изобретению используют пару олигонуклеотидных праймеров SEQ ID NO:1 - 5′ tgaaaggggcatcacaaggt 3′, SEQ ID NO:2 - 5′ cccaaggcatataagtcagggt 3′, ПЦР проводят в 1 раунд, при получении фрагмента, соответствующего размеру 218 п.н., диагностируют штаммы и изоляты бактерии Pasteurella multocida серогруппы А.

Изобретение иллюстрируется следующими примерами

Пример 1. Получение синтетических олигонуклеотидных праймеров.

Поиск новых синтетических олигонуклеотидных праймеров осуществляют на основе анализа полного генома штамма Pasteurella multocida «36950», представленного в базе данных GenBank (http://www.ncbi.nlm.nih.gov/GenBank/GenBankSearch.html), при помощи пакета программного обеспечения «Lasergen». Полученные последовательности нескольких пар праймеров дополнительно тестируют на специфичность с помощью моделирования ПЦР в программе «Vector NTI Suite» с последовательностями геномов штаммов других серогрупп Р. multocida, представителей семейства Pasteurellaceae и Enterobacteriaceae, представленных в базе данных GenBank.

Окончательный выбор праймеров основывают на следующих критериях: высокий индекс сходства фрагмента и ДНК различных штаммов Pasteurella multocida серогруппы А, высокая температура отжига (GC- метод), большая длина консенсусов, отсутствие гетеродуплексов.

Химический синтез праймеров осуществляют амидофосфитным методом на автоматическом синтезаторе ASM-102U. Концентрацию синтетических олигонуклеотидных праймеров в маточном растворе определяют спектрометрическим методом.

Таким образом, были выбраны синтетические олигонуклеотидные праймеры, комплементарные высококонсервативной области генома Pasteurella multocida участка гена hyaD, отвечающего за синтез гиалуронсинтетазы:

SEQ ID NO:1 - 5′ tgaaaggggcatcacaaggt 3′,

SEQ ID NO:2 - 5′ cccaaggcatataagtcagggt 3′.

Пример 2. Способ выявления бактерии Pasteurella multocida серогруппы А с помощью синтетических олигонуклеотидных праймеров в полимеразной цепной реакции (ПЦР) в пробах патологического материала и культурах бактерий

Способ осуществляется в несколько этапов.

Этап 1. Подготовка проб патологического материала и бактериальных культур для исследования

Для исследования от павших или вынужденно убитых животных с признаками бронхопневмонии отбирают пробы внутренних органов (легких на границе нормального и измененного участка, бронхиальных и средостенных лимфатических узлов) не позднее 3-5 часов после гибели животного.

Из полученных проб делают посев методом отпечатков на мясопептонный агар с добавлением 5% дефибрированной крови барана (кровяной мясопептонный агар). Инкубируют в термостате при температуре 37°С в атмосфере 5% СО2.

Через 24±2 часа инкубации просматривают чашки Петри с агаром на наличие типичных для пастерелл колоний (прозрачных, диаметром до 3 мм, округлых с ровными краями, слизистой консистенции, серого цвета). Их этих колоний делают мазки на стекле и окрашивают их по Грамму для предварительного типирования. При обнаружении в мазке грамотрицательных кокобактерий, окрашенных биполярно, колонию отбирают для исследования в ПЦР.

Для этого отдельные колонии, не смешивая, снимают с поверхности агара, переносят в отдельные стерильные стеклянные пробирки, содержащие 200 мкл стерильной дистиллированной воды, перемешивают на вортексе. Взвесь бактерий разводят стерильной дистиллированной водой до концентрации 109 КОЕ/мл.

Пробы органов животных помещают в фарфоровые ступки, растирают с песком и разводят физиологическим раствором в соотношении 1/5-1/10, затем центрифугируют и надосадочную жидкость используют для выделения ДНК.

Взвесь бактерий в концентрации 109 КОЕ/мл используют для выделения ДНК без подготовки.

Этап 3. Выделение ДНК из проб биоматериала или взвеси бактерий. Выделение ДНК проводят любым доступным способом, включающим лизис клеток, депротеинизацию лизата, осаждением ДНК из раствора, отмывку спиртами, высушивание и растворение ДНК в буферном растворе.

Этап 4. Амплификация участка ДНК Pasteurella multocida, кодирующего участок гена hyaD.

Полимеразная цепная реакция. Состав реакционной смеси: ПЦР-буфер (60 mM Tris-HCl [рН 8.5], 1,5 мМ MgCl2, 25 тМ KCl, 10 мМ 2-меркаптэтанола, 0,1% Тритон Х-100), 0,2 мМ dNTP, no 0,2 мкг каждого праймера, 1.25 е.а. Taq-ДНК-полимеразы, 5 мкл выделенной ДНК.

Температурный режим проведения ПЦР: 95°С - 5 мин - 1 цикл; 95°С - 10 сек, 55°С - 15 сек, 72°С - 20 сек - 35 циклов; 72°С - 5 мин.

Этап 3. Определение размера продуктов ПЦР.

Продукты ПЦР анализируют методом электрофореза в 2%-ном агарозном геле в стандартном трис-боратном буфере (рН 8,0) по стандартной методике.

Результаты электрофореза учитывают, просматривая гель в ультрафиолетовом свете с длиной волны 254 нм на приборе «Трансиллюминатор».

Используют маркер молекулярного веса 100 bp. Результат ПЦР считают положительным, если продукт ПЦР соответствует размеру фрагмента в 218 нуклеотидную пару.

Таким образом, предлагаемый способ позволяет эффективно выявлять штаммы и изоляты бактерий вида Pasteurella multocida серогруппы А в пробах патологического материала от больных животных и бактериальных культурах.

Пример 3. Определение чувствительности, специфичности и эффективности ПЦР по заявленному способу и по способу, взятому за прототип

Для определения чувствительности метода по заявленному способу в сравнении с прототипом суточную культуру контрольного штамма Pasteurella multocida «W13Ф», выращенную на мясопептонном агаре с добавлением 5% дефибрированной крови барана, переносят в бактериологическую пробирку, содержащую 1000 мкл стерильной дистиллированной воды или физиологического раствора, разводят до концентрации 1011 КОЕ/мл, титруют методом 10-кратных разведении до разведения 101 КОЕ/мл, каждое разведение подвергают исследованию в ПЦР. Чувствительность разработанной ПЦР составляет 103 КОЕ/мл.

Результаты опытов по сравнению чувствительности реакции представлены в таблице 1.

Таблица 1
Концентрация Pasteurella multocida серогруппы А в пробе, КОЕ/мл Результаты ПЦР по заявленному способу Результаты ПЦР по способу, взятому за прототип
107 + +
106 + +
105 + +
104 + +
103 + -
102 - -

Результаты опытов по сравнению специфичности реакции представлены в таблице 2.

Таблица 2
Бактерии Результаты ПЦР по заявленному способу Результаты ПЦР по способу, взятому за прототип
Pasteurella multocida серогруппа А (штамм «W130») + +
Pasteurella multocida серогруппа D (штамм Т80) - -
Pasteurella multocida серогруппа В (штамм 681) - -
Salmonella typhimurium - -
E. coli - -
Примечание: «+» - положительный результат;
«-» - отрицательный результат.

Результаты опытов по сравнению эффективности реакции при исследовании патологического материала, полученного от больных телят, и культур бактерий, выделенных на искусственных питательных средах из органов телят, представлены в таблице 3.

Таблица 3
№ п/п Исследованные пробы Количество Количество положительных проб по заявленному способу / % от исследованных Количество положительных проб по способу, взятому за прототип / % от исследованных
1 Легкое 30 30/100 25/83
2 Бронхиальные лимфатические узлы 30 30/100 20/67
3 Средостенные лимфатические узлы 30 30/100 22/73
4 Культура бактерий, выделенная из органов телят 30/100 30/100 30/100

Таким образом, предлагаемый способ обладает высокой чувствительностью (103 КОЕ/мл), специфичностью и эффективностью при выявлении участка гена hyaD бактерии Pasteurella multocida серогруппы А в пробах патологического материала, полученного от больных телят, культурах бактерий, выделенных на искусственных питательных средах. Способ, принятый за прототип, обладает более низкой чувствительностью (104 КОЕ/мл) и на 17-33% менее эффективен при исследовании проб легких, бронхиальных и средостенных лимфоузлов от больных животных.

Пример 4. Сравнение эффективности типирования Pasteurella multocida серогруппы А по заявленному способу и по способу, взятому за аналог

Преимущества разработанного способа представлены в таблицах 4 и 5.

Таблица 4
Штаммы и изоляты Pasteurella multocida Результаты типирования Pasteurella multocida серогруппы А по заявленному способу Результаты типирования Pasteurella multocida серогруппы А по способу, взятому за аналог
Штамм W130 (серогруппа А) + +
Штамм Т80 (серогруппа В) - -
Штамм 681 (серогруппа D) - -
Изолят Б37 + +
Изолят АГМ + +
Изолят СР + +
Изолят Эвика/2012 + -
Изолят Ир + -
Примечание: «+» - положительный результат;
«-» - отрицательный результат.
Таблица 5
Вирус (штамм, изолят) Типирование Pasteurella multocida серогруппы А по заявленному способу Типирование Pasteurella multocida серогруппы А по способу, взятому за аналог
Время исследования одной пробы биоматериала 4 часа 10 суток
Себестоимость исследования одной пробы (руб.):
Трудозатраты (чел.). 2 3
Оплата труда сотрудников 500 2750
Стоимость реактивов и питательных сред 60 120
Прочие расходы 200 500
Необходимость получения чистой культуры Необязательно Обязательно

Таким образом, заявляемый способ обеспечивают достижение цели изобретения: выявляется участок гена hyaD, отвечающего за синтез гиалуронсинтетазы Pasteurella multocida, непосредственно в пробах легких, бронхиальных и средостенных лимфоузлов и культурах бактерий. Он позволяет сократить сроки проведения исследований до четырех часов, снизить себестоимость диагностики в 4,5 раза, трудозатраты в 1,5 раза, исключить необходимость выделения чистой культуры.

1. Пара синтетических олигонуклеотидных праймеров для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы А у крупного рогатого скота согласно изобретению имеют нуклеотидные последовательности: SEQ ID NO:1 - 5′ tgaaaggggcatcacaaggt 3′, SEQ ID NO:2 - 5′ cccaaggcatataagtcagggt 3′.

2. Способ идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы А, включающий выделение ДНК из проб биоматериала или бактериальных культур и проведение ПЦР с синтетическими олигонуклеотидными праймерами, отличающийся тем, что используют пару синтетических олигонуклеотидных праймеров по п.1, ПЦР проводят в 1 раунд, при получении фрагмента, соответствующего размеру 218 п.н., диагностируют штаммы и изоляты бактерии Pasteurella multocida серогруппы А.



 

Похожие патенты:

Изобретение относится к области биотехнологии и касается видовой и штаммовой идентификации бифидобактерий филотипа Bifidobacterium longum. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейства RelBE и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора видо- и штаммоспецифичных олигонуклеотидов, ПЦР продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера.

Изобретение относится к иммунологии. Предложены варианты применения вариантов набора генов (фармакодинамических (ФД) маркеров) с повышенной регуляцией экспрессии или действия, индуцируемых интерфероном альфа (ИФНα).

Изобретение относится к области биотехнологии и касается способа идентификации лактобацилл. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейств RelBE и MazEF и характеризуется тем, что для идентификации проводят амплификацию геномных ДНК с использованием набора олегонуклеотидов определенной структуры, ПЦР-продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера.

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления видовой принадлежности родиолы четырехнадрезной {Rhodiola quadrifida (Pall.) Fisch.

Изобретение касается способа определения генотипов золотистого стафилококка. Представленный способ включает получение чистой культуры микроорганизмов на плотной питательной среде с последующим выделением и амплификацией ДНК возбудителя с помощью мультиплексной полимеразной цепной реакции (ПЦР) и с детекцией результатов методом электрофореза в агарозном геле.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченного зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени.

Изобретение относится к биотехнологии и может быть использовано для дифференцированного определения числа жизнеспособных актинобактерий рода Rhodococcus, иммобилизованных в нерастворимом гелевом носителе.

Изобретение относится к биотехнологии. Предложенный способ предусматривает получение образцов высокоочищенной ДНК, фрагментацию выделенной ДНК эндонуклеазой рестрикции, не имеющей сайта узнавания в амплифицируемом районе, гидролиз фрагментированной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI или ее изошизомером, лигирование универсального олигонуклеотидного адаптера к гидролизованной ДНК с последующей амплификацией в реальном времени с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен не менее 3 нуклеотидам 3' конца ДНК у исследуемого места гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и составление заключения на основании флуоресцентного сигнала о наличии последовательности Pu(5mC)GPy.

Изобретение относится к биотехнологии, конкретно к определению восприимчивости к внутрибольничной инфекции пациента с септическим шоком, и может быть использовано в медицине.

Группа изобретений относится к области микробиологии и биотехнологии. Способ детекции живых клеток микроорганизма в тестируемом образце путем отличия живых клеток от мертвых клеток или поврежденных клеток предусматривает добавление в тестируемый образец средства, способного к ковалентному связыванию с ДНК или РНК при облучении светом с длиной волны от 350 нм до 700 нм; облучение тестируемого образца; амплификацию мишеневой области ДНК или РНК микроорганизма, содержащегося в тестируемом образце, способом амплификации нуклеиновых кислот в присутствии средства подавления действия вещества, ингибирующего амплификацию нуклеиновых кислот, соли магния, соли органической кислоты или соли фосфорной кислоты, без выделения нуклеиновых кислот из клеток и анализа продукта амплификации. Способ может быть осуществлен посредством применения набора, состоящего из средства, способного к ковалентному связыванию с ДНК или РНК при облучении светом с длиной волны от 350 нм до 700 нм, средства подавления действия вещества, ингибирующего амплификацию нуклеиновых кислот и праймеров для амплификации мишеневой области. При помощи данных изобретений можно с высокой чувствительностью и точностью детектировать живые клетки микроорганизмов в различных биологических образцах. 2 н. и 25 з.п. ф-лы, 17 ил., 12 табл., 9 пр.

Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для амплификации и последующего секвенирования ITS1-5.8S-ITS2 сосудистых растений, включающего проведение полимеразой цепной реакции с помощью универсальных праймеров со следующим нуклеотидным составом: primer ITS-for CGTAACAAGGTTTCCGTAG, primer ITS-rew GGAATCCTTGTAAGTTTCTTT. Изобретение позволяет эффективно анализировать структуру внутреннего транскрибируемого спейсера рибосомной ДНК сосудистых растений. 1ил.

Изобретение относится к области медицины, в частности к клинической лабораторной диагностике. Предложен биологический микрочип для выявления и многопараметрического анализа противохолерных антител в сыворотке крови человека, содержащий массив дискретно нанесенных и иммобилизованных на поверхности подложки O-антигенов V. cholerae и холерного токсина, сгруппированных в отдельные зоны. Изобретение обеспечивает проведение параллельного иммунологического анализа нескольких образцов сыворотки крови человека на наличие противохолерных антител к широкому спектру антигенов возбудителя холеры с определением иммуноглобулинов класса G и M за короткое время. 2 з.п. ф-лы, 3 ил., 2 пр.

Изобретение относится к биотехнологии и представляет собой способ оценки чувствительности клеток рака легкого к доксорубицину (IC50), а также набор для осуществления данного способа. Способ основан на сравнении уровней экспрессии маркерных генов АВСС1, ERCC1, FTL, GSTP1, МТ2А, RRM1, TUBB3 в исследуемых клетках с уровнями экспрессии указанных генов в контрольных клетках NCI-H322. Способ включает гибридизацию флуоресцентно меченых препаратов нуклеиновых кислот, приготовленных из клеток или тканей человека, с массивом данных олигонуклеотидных зондов, иммобилизованных на твердой подложке. Отмывают подложку от неспецифически связавшихся препаратов. Сканируют подложку лазерным сканером и анализируют полученное изображение. При повышенной экспрессии генов ERCC1, МТ2А, RRM1 и TUBB3 и пониженной экспрессии генов АВСС1, GSTP1, FTL в исследуемых клетках по отношению к клеткам NCI-H322, IC50 доксорубицина для исследуемых клеток оценивают на уровне IC50≥0,54 мкМ, и клетки относят к устойчивым. При пониженной экспрессии генов ERCC1, МТ2А, RRM1 и TUBB3 и повышенной экспрессии генов АВСС1, GSTP1, FTL в исследуемых клетках по отношению к клеткам NCI-H322, IC50 доксорубицина для исследуемых клеток оценивают на уровне IC50≤0,073 мкМ, и клетки относят к чувствительным. Предложенное изобретение позволяет определять чувствительность клеток рака легкого к доксорубицину с высокой точностью. 2 н.п. ф-лы, 1 ил., 1 табл., 2 пр.

Изобретение относится к области биотехнологии, конкретно к набору синтетических олигонуклеотидных пар праймеров, и может быть использовано в судебно-медицинской идентификационной экспертизе. Заявленный набор состоит из пар праймеров, комплементарных соответствующим участкам пятнадцати микросателлитных локусов Y-хромосомы, которые представляют собой пары праймеров, из которых один имеет флуоресцентную метку, а второй является немеченым, при этом прямые праймеры для каждого из локусов несут на 5'-конце флуоресцентную метку: ТЕТ (4,7,2',7'-тетрахлоро-6-карбоксифлуоресцеин) для DYS385a/b, DYS390, DYS391, DYS426 и DYS439; FAM (6-карбоксифлуоресцеин) для DYS392, DYS393, DYS437 и DYS438; и HEX (4,7,2',4',5',7'-гексахлоро-6-карбоксифлуоресцеин) для DYS394, DYS388, DYS389I/II и DYS434. Изобретение относится также к способу выявления генотипов для идентификации личности в российской популяции с использованием вышеуказанных праймеров. Изобретение позволяет проводить идентификацию личности в российской популяции с высокой чувствительностью, специфичностью и точностью по сравнению с существующими аналогами. 2 н.п. ф-лы, 2 ил.

Цель изобретения - разработка эффективного способа генотипирования крупного рогатого скота по DGAT1-гену на основе ПЦР-ПДРФ-анализа. Разработанный способ проведения ПЦР-ПДРФ для генотипирования крупного рогатого скота по аллелям А и К гена DGAT1, отличающийся от ближайшего прототипа [1] тем, что на этапе ПЦР используются другие последовательности олигонуклеотидных праймеров: DGAT1-1: 5'-CCGCTTGCTCGTAGCTTTCGAAGGTAACGC-3' (SEQ ID NO:1) DGAT1-2: 5'-CCGCTTGCTCGTAGCTTTGGCAGGTAACAA-3' (SEQ ID NO:2) DGAT1-3: 5'-AGGATCCTCACCGCGGTAGGTCAGG-3' (SEQ ID NO:3), а на этапе ПДРФ применяется другая эндонуклеаза рестрикции - TaqI, с генерацией генотип-специфичных фрагментов: генотип АА=82/18 bp, генотип КК=100 bp и генотип АК=100/82/18 bp (фиг.1 и 2). 2 ил., 2 табл.
Изобретение относится к биотехнологии, а именно к генетической инженерии. Техническим результатом изобретения является возможность определения генетической группы - нуклеотипа B вируса блютанга с помощью ОТ-ПЦР, что позволит существенно сократить материальные затраты и время проведения работ по определению серотипа вируса блютанга в образцах исследуемого биологического материала. Предложенные праймеры используются для идентификации вируса блютанга нуклеотипа B (3, 13 и 16 серотипы) методом ОТ-ПЦР. 2 табл.

Изобретение относится к биотехнологии. Описан способ проведения ПЦР для эффективной идентификации аллельных вариантов Waxy-генов пшеницы. Способ отличается от известных из уровня техники использованием прямого праймера 4F-c: 5'-CCCCCAAGAGCAACTACCAGT-3'. Также описан способ ПЦР-ПДРФ для эффективной идентификации аллельных вариантов Waxy-генов пшеницы. Способ отличается от известных из уровня техники тем, что после этапа ПЦР проводят процедуру ПДРФ-анализа с эндонуклеазным расщеплением ампликонов рестриктазой AcsI. Цель изобретения - разработка способов проведения ПЦР и ПЦР-ПДРФ для эффективной идентификации аллельных вариантов Waxy-генов пшеницы. 2 н.п. ф-лы, 4 ил., 2 табл.

Изобретение относится к медицине и микробиологии. Предложен способ определения микобактерий туберкулеза генотипа Beijing в режиме реального времени путем определения вставки элемента IS6110 в локусе генома dnaA-dnaN, отличающийся тем, что применяют ПЦР в режиме реального времени с использованием двух специфических праймеров 5`-AGATCAGAGAGTCTCCGGACTCA и 5`-CGCCGGGACTGTATGAGTCT и флуоресцентно-меченого зонда R6G-5`-TGTGCACAGCGACACTCACAGCCA-3`-BHQ2, оценку результата производят путем регистрации сигнала флуоресценции по каналу R6G с длиной волны 555нм, причем при наличии в образце ДНК штамма микобактерий туберкулеза генотипа Beijing экспоненциальный рост сигнала флуоресценции ПЦР при анализе чистой ДНК происходит между 10-15 циклами, а при анализе клеточных лизатов - между 15 и 20 циклами. Изобретение может быть использовано для лабораторного определения микобактерий туберкулеза генотипа Beijing. 3 ил., 2 пр.

Изобретение относится к области биотехнологии, конкретно к выявлению рака легкого с помощью аптамеров, и может быть использовано в диагностике. Аптамеры получают в результате селекции, включающей чередование раундов позитивной селекции аптамеров к измельченным опухолевым тканям легкого человека, забиравшимся после операции у онкологических больных, и негативной селекции к здоровым тканям легкого и цельной крови здоровых людей, с выявлением пула аптамеров с наибольшей аффинностью, его клонирования, секвенирования, проверки на специфичность связывания с опухолевыми клетками легкого. Полученные аптамеры обладают высокой чувствительностью к продуктам распада опухоли и циркулирующим раковым клеткам в периферической крови больных раком легкого, что позволяет повысить эффективность диагностики рака легкого человека. 2 з.п. ф-лы, 2 ил., 1 пр.
Наверх