Набор синтетических олигонуклеитидов для выявления видовой принадлежности родиолы четырехнадрезной (rhodiola quadrifida (pall.) fisch. et mey.)

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления видовой принадлежности родиолы четырехнадрезной {Rhodiola quadrifida (Pall.) Fisch. et Mey). Набор включает видоспецифичные участки для создания прямого, обратного праймеров и разрушаемого зонда, а именно прямой праймер - CGGCAACGGATATCTCGGCT-3', обратный праймер - 5'-GGCCTCGCААССАССACTTGTC-3', разрушаемый зонд - (флуоресцентная метка)-5'-CCGTGAACCATCGAGTTTTT-3'-(гаситель). Предложенное изобретение позволяет достоверно, быстро и с высокой чувствительностью идентифицировать видовую принадлежность лекарственного растения - родиолы четырехнадрезной (Rhodiola quadrifida (Pall.) Fisch. et Mey.) в ходе проведения скрининга растительного сырья. 1 ил., 1 пр.


Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии. Использование набора синтетических олигонуклеотидов позволяет достоверно идентифицировать видовую принадлежность лекарственного растения - родиолы четырехнадрезной (Rhodiola quadrifida (Pall.) Fisch. et Mey.). Изобретение может быть использовано для выявления видовой принадлежности данного растения; в ходе проведения скрининга растительного сырья, для контроля на соответствие состава, декларированного производителем.

Среди большого количества методов генодиагностики с целью идентификации присутствия ДНК интересующего вида растений в образце, в качестве основы нашего изобретения был принят формат ПЦР с детекцией в режиме реального времени на основе разрушаемого зонда. ПЦР в реальном времени имеет преимущество перед обычными ПЦР-системами идентификации - отсутствие необходимости последующего анализа, что минимизирует риск контаминации в лаборатории. Характерна также повышенная чувствительность и отсутствие ложноположительного результата при неспецифичном отжиге праймеров. Кроме того, следует отметить обеспеченность практически всех молекулярно-генетических диагностических лабораторий оборудованием, необходимым для проведения ПЦР с детекцией в режиме реального времени и широкое использование метода в клинической диагностике и органами госконтроля.

При проведении анализа методов детекции продукта полимеразной цепной реакции выбран метод на основе разрушаемого зонда, так как он относится к специфичным методам детекции, возможно свободное использование без нарушения авторских и смежных прав (первоначально система разрушаемого зонда предложена в 1991 году, при этом все патенты на настоящий момент закончили свое действие).

Техническим результатом заявляемого изобретения является разработка праймеров и разрушаемых зондов на основе данных видоспецифичных нуклеотидных последовательностей ядерной ДНК растений. В качестве видоспецифичных участков нами используется ITS2 фрагмент ядерной ДНК (internal transcribed spacer 2), обладающий большой копийностью в геноме [Alvarez, I. & Wendel, J.F. (2003) Ribosomal ITS sequences and plant phylogenetic inference // Mol. Phylogenet. Evol. 29, 417-434], и используемый в проектировании системы ДНК-баркодинга. В этом регионе показана высокая вариабельность и потенциальная применимость в качестве маркерного участка [Stoeckle, М. (2003) Use of DNA barcodes to identify flowering plants // Bioscience 53,2-3].

Прототип - рассмотрим идентификацию лекарственных растений с использованием фрагмента ITS2, амплифицированного специфичными праймерами [Chiou SJ, Yen JH, Fang CL, Chen HL, Lin TY Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers/ZPlanta Med. 2007, Oct; 73(13): 1421-6. Epub 2007 Oct 1]. В прототипе используются специфичные наборы праймеров BEL-1/BEL-3 и BEL-2/BEL-3 для амплификации ITS2 участка рДНК 55 лекарственных растений.

Принципиальные отличия прототипа от заявленного изобретения следующие: идентифицируется лекарственное растение с нуклеотидными последовательностями специфичных праймеров отличные от заявленных. Набор синтетических олигонуклеотидов для выявления видовой принадлежности лекарственного растения - родиолы четырехнадрезной (Rhodiola quadrifida (Pall.) Fisch. et Mey.), включающий проведение полимеразной цепной реакции с фрагментом ITS2 ядерной ДНК, где для идентификации данного растения используют специфичные прямой, обратный праймеры и разрушаемый зонд.

Работа над созданием праймеров строится следующим образом.

1) С помощью открытых и коммерческих баз данных нуклеотидных последовательностей различных видов растений либо в результате самостоятельного определения нуклеотидной последовательности растений выбирается участок генома, встречающийся у всех видов.

2) На основании выбранного участка генома с помощью специального программного обеспечения или вручную подбирается последовательность олигонуклеотидов, используемых для проведения ПЦР-реакции (2 праймера и зонд). На данном этапе работа заключается в создании выравнивания многих последовательностей и выборе участка последовательности, где присутствуют отличия для создания прямого, обратного праймеров и зонда. Выравнивание геномных последовательностей означает сравнение последовательностей многих видов друг с другом, поиск гомологичных для растений участков.

3) Изготовление праймеров и зонда производится на автоматических синтезаторах.

4) С помощью практических экспериментов доказывается пригодность подобранных последовательностей для конкретных целей.

Анализ нуклеотидного полиморфизма последовательности ITS2 на основании данных NCBI (http://www.ncbi.nlm.nih.gov/) и секвенированных de novo последовательностей видов, не размещенных в генбанке, позволяет применить данные последовательности в качестве основы для создания праймеров. Для детекции накопления продукта ПЦР в ходе реакции используют технологию с разрушаемым зондом (Holland Р М, Abramson R D, Watson R, Gelfand D H. Detection of specific polymerase chain reaction product by utilizing the 5'-3' exonuclease activity of Thermus aquaticus DNA polymerase.//Proc Natl Acad Sci U S A. 1991 August 15; 88(16): 7276-7280).

В качестве флуоресцентной метки используют, например, FAM, в качестве гасителя BHQ1 (возможны другие комбинации флуорофоров и гасителей и это не является предметом охраны авторских прав).

Аналогичные наборы, реакционные смеси, праймеры для амплификации и выявления видовой принадлежности родиолы четырехнадрезной (Rhodiola quadrifida (Pall.) Fisch. et Mey.) не известны.

Ход работы с применением набора синтетических олигонуклеотидов для амплификации состоит из следующих шагов.


1) Растительный материал перед проведением ПЦР с помощью заявляемого набора проводится через процедуру пробоподготовки с использованием набора Diamont DNA kit, в соответствии с инструкцией производителя; в ходе этой процедуры из растительного материала выделяется ДНК, которую в свою очередь используют для ПЦР.

2) Полимеразную цепную реакцию проводят на амплификаторе CFX96 (Bio-Rad, USA). Амплификация проводится по следующей программе: 1 цикл: 95°С - 3 мин; 40 циклов: 95°С - 10 сек, 58°С - 30 сек (на данной стадии производится сканирование уровня флуоресценции). Инкубационная смесь конечным объемом 25 мкл содержит: 14,1 мкл Н2O; 2 мкл ДНК; 2,5 мкл 10Х буфер; 2,5 мкл 25 мМ MgCl2; по 1 мкл 10 мМ каждого праймера; 0,5 мкл зонда; 1,2 мкл 20 мМ dNTPs; 0,2 мкл Taq-полимеразы. Результат амплификации определяют по нарастанию уровня флуоресценции, рис.1.

Для выявления родиолы четырехнадрезной {Rhodiola quadrifida (Pall.) Fisch. et Mey.), в качестве прямого праймера используется последовательность ДНК со следующим нуклеотидным составом: 5'-CGGCAACGGATATCTCGGCT-3', в качестве обратного праймера используется последовательность ДНК со следующим нуклеотидным составом: 5'-GGCCTCGCAACCACCACTTGTC-3', в качестве разрушаемого зонда используется последовательность ДНК со следующим нуклеотидным составом: (флуоресцентная метка)-5'-CCGTGAACCATCGAGTTTTT-3'-(гаситель). Гаситель располагается и на 5'-конце, а флуоресцентная метка на 3'-конце разрушаемых зондов. Разработан набор синтетических олигонуклеотидов для выявления видовой принадлежности лекарственного растения - родиолы четырехнадрезной (Rhodiola quadrifida (Pall.) Fisch. et Mey.) методом полимеразной цепной реакцией с детекцией в режиме реального времени. Набор обладает высокой чувствительностью и специфичностью, позволяющий быстро и достоверно провести идентификацию рассмотренного лекарственного растения.

Набор синтетических олигонуклеотидов для выявления видовой принадлежности родиолы четырехнадрезной {Rhodiola quadrifida (Pall.) Fisch. et Mey), включающий проведение полимеразной цепной реакции с фрагментом ITS2 ядерной ДНК, отличающийся тем, что для выявления родиолы четырехнадрезной (Rhodiola quadrifida (Pall.) Fisch. et Mey.) используют видоспецифичные участки для создания прямого, обратного праймеров и разрушаемого зонда:
в качестве прямого праймера - последовательность ДНК со следующим нуклеотидным составом: 5'-CGGCAACGGATATCTCGGCT-3',
в качестве обратного праймера - последовательность ДНК со следующим нуклеотидным составом: 5'-GGCCTCGCААССАССACTTGTC-3',
в качестве разрушаемого зонда - последовательность ДНК со следующим нуклеотидным составом: (флуоресцентная метка)-5'-CCGTGAACCATCGAGTTTTT-3'-(гаситель).


Похожие патенты:

Изобретение касается способа определения генотипов золотистого стафилококка. Представленный способ включает получение чистой культуры микроорганизмов на плотной питательной среде с последующим выделением и амплификацией ДНК возбудителя с помощью мультиплексной полимеразной цепной реакции (ПЦР) и с детекцией результатов методом электрофореза в агарозном геле.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченного зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени.

Изобретение относится к биотехнологии и может быть использовано для дифференцированного определения числа жизнеспособных актинобактерий рода Rhodococcus, иммобилизованных в нерастворимом гелевом носителе.

Изобретение относится к биотехнологии. Предложенный способ предусматривает получение образцов высокоочищенной ДНК, фрагментацию выделенной ДНК эндонуклеазой рестрикции, не имеющей сайта узнавания в амплифицируемом районе, гидролиз фрагментированной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI или ее изошизомером, лигирование универсального олигонуклеотидного адаптера к гидролизованной ДНК с последующей амплификацией в реальном времени с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен не менее 3 нуклеотидам 3' конца ДНК у исследуемого места гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и составление заключения на основании флуоресцентного сигнала о наличии последовательности Pu(5mC)GPy.

Изобретение относится к биотехнологии, конкретно к определению восприимчивости к внутрибольничной инфекции пациента с септическим шоком, и может быть использовано в медицине.

Изобретение относится к области биотехнологии и касается набора для выявления Ку-лихорадки методом ПЦР-РВ. Охарактеризованный набор содержит синтетические олигонуклеотиды, ограничивающие фрагмент гена groEL: GroEL F 5′ CTTCTACTGTTATGACGCCTTCTTTGC 3′ GroEL R 5′ CGCAAGTAGGCACCATTTCTGC 3′, и флуоресцентный зонд: GroEL Probe 5′ FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3′.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения наличия у пациента повышенного риска обладания сердечно-сосудистым заболеванием или нарушением по полиморфным вариантам генов.
Изобретение относится к области молекулярной биологии и генной инженерии. Предложены способ и набор для детекции малопредставленных фракций РНК в биологическом образце и для детекции микоплазменного загрязнения, для чего используют операции обратной транскрипции РНК в кДНК с использованием обратной транскриптазы Thermus thermophilus (rTth-pol) в условиях "горячего старта", инактивации ОТ обработкой хаотропным средством, детекции представляющей интерес кДНК посредством полимеразной цепной реакции (ПЦР).

Настоящее изобретение относится к области биотехнологии и касается способа амплификации и детекции нуклеотидных последовательностей в реакционной смеси и набору, используемому в этом способе.

Изобретение касается способа определения генотипов золотистого стафилококка. Представленный способ включает получение чистой культуры микроорганизмов на плотной питательной среде с последующим выделением и амплификацией ДНК возбудителя с помощью мультиплексной полимеразной цепной реакции (ПЦР) и с детекцией результатов методом электрофореза в агарозном геле.

Изобретение относится к области биотехнологии и касается набора для выявления Ку-лихорадки методом ПЦР-РВ. Охарактеризованный набор содержит синтетические олигонуклеотиды, ограничивающие фрагмент гена groEL: GroEL F 5′ CTTCTACTGTTATGACGCCTTCTTTGC 3′ GroEL R 5′ CGCAAGTAGGCACCATTTCTGC 3′, и флуоресцентный зонд: GroEL Probe 5′ FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3′.
Изобретение относится к области биотехнологии, конкретно к молекулярной биологии и онкологии, и может быть использовано для диагностики терминальных мутаций в гене RET, ассоциированных с наследственной предрасположенностью к раку щитовидной железы (РЩЖ).
Изобретение относится к области биотехнологии, конкретно к молекулярной биологии и онкологии, и может быть использовано для диагностики терминальных мутаций в гене RET, ассоциированных с наследственной предрасположенностью к раку щитовидной железы (РЩЖ).

Группа изобретений относится к области биотехнологии. Настоящее изобретение обеспечивает синтетические 5'UTR области, содержащие первый полинуклеотидный фрагмент в виде второго интрона гена кальциевой АТФазы саркоплазматического/эндоплазматического ретикулума и второй полинуклеотидный фрагмент, представленный частью 5' нетранслируемой области (5'UTR) гена казеина.

Изобретение относится к области биохимии, в частности к способу получения одноцепочечной кольцевой РНК. Способ включает синтез смысловой цепи и антисмысловой цепи, содержащих нуклеотидную последовательность с неспаренными нуклеотидами на 5'-конце и 3'-конце, и одновременно лигирование нуклеотида на 5'-конце нуклеотидной последовательности с неспаренными нуклеотидами в смысловой цепи с нуклеотидом на 3'-конце нуклеотидной последовательности с неспаренными нуклеотидами в антисмысловой цепи и, наоборот, с использованием лигазы.

Настоящее изобретение относится к области биотехнологии и касается способа амплификации и детекции нуклеотидных последовательностей в реакционной смеси и набору, используемому в этом способе.

Группа изобретений относится к области биотехнологии. Способ модульного конструирования ДНК аптамеров, способных специфически и высокоаффинно связывать тромбин, имеющих стабилизированную основную субструктуру, предусматривает сборку их структуры моделированием из комбинации трех структурных модулей, содержащих квадруплексный модуль нуклеиновой кислоты, дуплексный модуль нуклеиновой кислоты и соединяющий их модуль нуклеиновой кислоты, имеющий неканоническую структуру, путем определения третичной структуры его спектральным методом кругового дихроизма с подтверждением факта образования более стабильного G-квадруплекса, отличного от квадруплексной структуры исходного структурного квадруплексного модуля.

Изобретение относится к области биохимии, в частности к способу селекции аптамеров к клеточным рецепторам и поверхностным белкам, который включает проведение раундов селекции, каждый из которых включает стадии: позитивной селекции с дальнейшим удалением несвязавшаяся ДНК; негативной селекции с последующим отделением связавшихся с негативной мишенью последовательностей; амплификацию полученных в ходе селекции аптамеров с получением ПЦР-продукта.

Изобретение относится к области молекулярной биологии, биохимии и медицины. Предложена L-нуклеиновая кислота - антагонист MCP-1 и способ её детектирования.

Изобретение относится к области генной инженерии и может быть использовано для регулирования проницаемости метан-продуцирующей клетки. Получают полипептид, который способен проникать в метан-продуцирующую клетку и повышать ее проницаемость, характеризующийся аминокислотной последовательностью SEQ ID NO:117, 118 или 119 или по меньшей мере 90% идентичностью к указанной последовательности или по меньшей мере 15 последовательно расположенными аминокислотами указанной последовательности. Также получают полинуклеотид, кодирующий указанный полипептид, клонирующий и экспрессирующий векторы, которые используют для получения клеток-хозяев, продуцирующих полипептид или предназначенных для репликации вектора. Полипептид может содержать флуоресцентную метку на N-концевом аминокислотном остатке. Изобретение позволяет повысить проницаемость метанпродуцирующей клетки. 14 н. и 4 з.п. ф-лы, 35 ил., 3 пр.

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления видовой принадлежности родиолы четырехнадрезной {Rhodiola quadrifida Fisch. et Mey). Набор включает видоспецифичные участки для создания прямого, обратного праймеров и разрушаемого зонда, а именно прямой праймер - CGGCAACGGATATCTCGGCT-3, обратный праймер - 5-GGCCTCGCААССАССACTTGTC-3, разрушаемый зонд - -5-CCGTGAACCATCGAGTTTTT-3-. Предложенное изобретение позволяет достоверно, быстро и с высокой чувствительностью идентифицировать видовую принадлежность лекарственного растения - родиолы четырехнадрезной Fisch. et Mey.) в ходе проведения скрининга растительного сырья. 1 ил., 1 пр.
