Фармакодинамические маркеры, индуцированные интерфероном альфа



Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа
Фармакодинамические маркеры, индуцированные интерфероном альфа

 


Владельцы патента RU 2527068:

МЕДИММУН, ЛЛК (US)

Изобретение относится к иммунологии. Предложены варианты применения вариантов набора генов (фармакодинамических (ФД) маркеров) с повышенной регуляцией экспрессии или действия, индуцируемых интерфероном альфа (ИФНα). Описаны варианты способа идентификации пациентов для получения MEDI-545 по обнаружению таких профилей экспрессии ИФНα-индуцируемых ФД маркеров. Использование изобретения обеспечивает распознавание тех пациентов, для которых лечение нейтрализующим антителом MEDI-545 может быть действительно эффективным, что может найти применение в медицине. 7 н. и 3 з.п. ф.-лы, 90 ил., 33 табл., 22 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к фармакодинамическим (ФД) маркерам, индуцируемым интерфероном альфа (ИФНα), зондам и наборам, которые выявляют ФД маркеры, а также к способам их применения.

Предпосылки создания изобретения

Настоящее изобретение включает ФД маркеры, индуцируемые ИФНα. ФД маркеры могут применяться в способах лечения пациентов терапевтическим агентом, который связывает и модулирует действие ИФНα, способах идентификации пациентов в качестве кандидатов для применения терапевтического агента, который связывает и модулирует действие ИФНα, способах диагностирования у пациента расстройства, связанного с повышенными уровнями ИФНα, способах мониторинга прогрессирования заболевания у пациента, получающего лечение терапевтическим агентом, который связывает и модулирует действие ИФНα, и способах идентификации перспективных лекарственных средств для лечения ИФНα-опосредованных расстройств.

Краткое описание изобретения

В одном из вариантов осуществления настоящего изобретения описан способ идентификации пациента в качестве кандидата для лечения терапевтическим агентом, который связывает и модулирует действие ИФНα. В образце, взятом у пациента, выявляют наличие или отсутствие профиля экспрессии ИФНα-индуцируемых ФД маркеров.

В другом варианте осуществления настоящего изобретения описан способ лечения пациента с заболеванием или расстройством, опосредованным ИФН первого типа (ИФН I типа) или ИФНα. Агент, который связывает и модулирует действие ИФН I типа или ИФНα, вводят пациенту. Агент нейтрализует у пациента профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα.

В еще одном из вариантов осуществления настоящего изобретения описан способ лечения аутоиммунного заболевания пациента, у которого проявляется умеренный или выраженный ИФН I типа или ИФНα ФД маркерный профиль. Агент, который связывает и модулирует действие ИФН I типа или ИФНα, вводят пациенту. Агент нейтрализует у пациента профиль экспрессии ФД маркеров, индуцируемных ИФН I типа или ИФНα.

Еще один вариант осуществления настоящего изобретения относится к способу нейтрализации у пациента, нуждающегося в этом, профиля экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα. Агент, который при введении пациенту связывает и нейтрализует действие ИФН I типа или ИФНα, вводят пациенту. Агент нейтрализует у пациента профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα.

В другом варианте осуществления настоящего изобретения описан способ диагностики у пациента расстройства, связанного с повышенными уровнями ИФНα. Наличие или отсутствие профиля экспрессии ФД маркеров, индуцируемых ИФНα, устанавливают в образце, взятом у пациента.

В еще одном из вариантов осуществления настоящего изобретения описан способ мониторинга прогрессирования заболевания у пациента, которого лечат терапевтическим агентом, связывающим и модулирующим действие ИФНα. Первый профиль экспрессии ФД маркеров, индуцируемых ИФНα, получают в первом образце, взятом у пациента. Терапевтический агент, который связывает и модулирует действие ИФНα, вводят пациенту. Второй профиль экспрессии ФД маркеров, индуцируемых ИФНα, получают во втором образце, взятом у пациента. Сравнивают первый и второй профили экспрессии ФД маркеров, индуцируемых ИФНα.

В еще одном из вариантов осуществления настоящего изобретения описан способ идентификации перспективного терапевтического средства для лечения ИФНα-опосредованных расстройств. Клетки, включающие профиль экспрессии ФД маркеров, индуцируемых ИФНα, приводят в соприкосновение с агентом. Выявляют в клетках наличие или отсутствие изменения в профиле экспрессии ФД маркеров, индуцируемых ИФНα.

Другой вариант осуществления настоящего изобретения включает набор зондов.

Еще один вариант осуществления настоящего изобретения включает набор, содержащий зонды.

В еще одном из вариантов осуществления настоящего изобретения описан способ выявления действия ИФН в образце. Клетки, включающие полинуклеотидную последовательность, представляющую репортерный ген под контролем ИФН-стимулирующего ответ элемента, инкубируют с образцом. Выявляют экспрессию репортерного гена.

Краткое описание фигур

Фиг.1. Анализ методом количественной ПЦР TaqMan экспрессии гена IFI44 в цельной крови здоровых доноров, простимулированной ИФНα.

Фиг.2. Анализ методом количественной ПЦР TaqMan экспрессии гена IRF2 в цельной крови здоровых доноров, простимулированной ИФНα.

Фиг.3. Анализ методом количественной ПЦР TaqMan экспрессии гена RSAD2 в цельной крови здоровых доноров, простимулированной ИФНα.

Фиг.4. Анализ методом количественной ПЦР TaqMan экспрессии гена G1P3 в цельной крови здоровых доноров, простимулированной ИФНα.

Фиг.5. Анализ методом количественной ПЦР TaqMan экспрессии гена HERC5 в цельной крови здоровых доноров, простимулированной ИФНα.

Фиг.6. Нейтрализация продуктом MEDI-545 экспрессии гена RAB8B, индуцированной ИФН-α, в цельной крови здоровых доноров.

Фиг.7. Нейтрализация продуктом MEDI-545 экспрессии гена IRF7, индуцированной ИФН-α, в цельной крови здоровых доноров.

Фиг.8. Нейтрализация продуктом MEDI-545 экспрессии гена MARCKS, индуцированной ИФН-α, в цельной крови здоровых доноров.

Фиг.9. Нейтрализация продуктом MEDI-545 экспрессии гена IL6ST, индуцированной ИФН-α, в цельной крови здоровых доноров.

Фиг.10. Нейтрализация продуктом MEDI-545 экспрессии гена Ly6E, индуцированной ИФН-α, в цельной крови здоровых доноров.

Фиг.11. Нейтрализация продуктом MEDI-545 экспрессии гена IFIT3, индуцированной ИФН-α, в цельной крови здоровых доноров.

Фиг.12. Нейтрализация продуктом MEDI-545 экспрессии гена IFIT1, индуцированной ИФН-α, в цельной крови здоровых доноров.

Фиг.13. Нейтрализация продуктом MEDI-545 экспрессии гена HERC5, индуцированной ИФН-α, в цельной крови здоровых доноров.

Фиг.14. Нейтрализация продуктом MEDI-545 экспрессии гена OAS1, индуцированной ИФН-α, в цельной крови здоровых доноров.

Фиг.15. Нейтрализация продуктом MEDI-545 экспрессии гена OAS3, индуцированной ИФН-α, в цельной крови здоровых доноров.

Фиг.16. Нейтрализация продуктом MEDI-545 экспрессии гена RSAD2, индуцированной ИФН-α, в цельной крови здоровых доноров.

Фиг.17. Стимуляция ex vivo цельной крови идентифицирует гены, индуцируемые ИФН типа I.

Фиг.18. Нейтрализация продуктом MEDI-545 25 генов, наиболее индуцируемых ИФН I типа, в цельной крови отдельных пациентов с волчанкой.

Фиг.19. Heatmap целевой модуляции и схема анализа главных компонентов (АГК) с применением индуцируемых ИФН I типа зондов, обдающих самой повышенной регуляцией в цельной крови пациента 1541 до и после лечения антителом MEDI-545.

Фиг.20. Heatmap целевой модуляции и схема анализа главных компонентов (АГК), основанные на 25 генах, индуцируемых ИФН I типа, с наиболее повышенной регуляцией в цельной крови пациента 1449 до и после применения антитела MEDI-545.

Фиг.21. Heatmap целевой модуляции по расчетам 165 генов, индуцируемых ИФН I типа, с повышенной регуляцией в цельной крови пациента, обработанного 0,3 мг/кг антитела MEDI-545.

Фиг.22. Анализ главных компонентов (АГК) с применением 169 зондов устанавливает, что 24/35 больных с СКВ, индуцируемой ИФН I типа, обладают статистически значимой формой колебаний ИФН I типа в цельной крови.

Фиг.23. Антитело MEDI-545 нейтрализует 25 индуцируемых ИФН I типа зондов с наиболее повышенной регуляцией у пациентов с волчанкой. Целевую нейтрализацию 25 ФД маркеров, индуцируемых ИФН I типа, с самой повышенной регуляцией генов измеряют на 1, 4, 7, 14 и 28 сутки для каждого пациента. Дозы находятся в диапазоне от 0 (плацебо) до 3 мг/кг MEDI-545.

Фиг.24. Антитело MEDI-545 нейтрализует 25 индуцируемых ИФН I типа зондов с самой повышенной регуляцией у пациентов с волчанкой. Целевую нейтрализацию топовых 25 ФД маркеров, индуцируемых ИФН I типа, с самой повышенной регуляцией генов измеряют на 1, 4, 7, 14 и 28 сутки для каждого пациента. Дозы находятся в диапазоне от 0 (плацебо) до 30 мг/кг MEDI-545.

Фиг.25а и б. Heatmap (а) и АГК (б), показывающие нейтрализацию топовых 25 зондов, индуцируемых ИФН I типа, в цельной крови пациента с СКВ, которому вводили 30 мг/кг MEDI-545 на 0, 1, 4, 7 и 14 сутки после дозирования.

Фиг.26а и б. АГК график пациентов с волчанкой до (а) и после (б) дозирования контроля плацебо показывают, что нет тенденции к изменению генной кривой, индуцируемой ИФН I типа. 25 наборов генных зондов, индуцируемых ИФН I типа, с самой повышенной регуляцией используют для проведения анализа АГК.

Фиг.27. Повышена регуляция подтипов ИФНα I типа в цельной крови отдельных пациентов с волчанкой.

Фиг.28. Распределение стандартного кратного изменения топовых 25 зондов, индуцируемых ИФН I типа, в цельной крови отдельных пациентов с волчанкой.

Фиг.29а-в. В тесте попарного ранжирования кратности изменения установили, что антитело MEDI-545 нейтрализует гены ИФН I типа в клиническом исследовании. Самые нейтрализованные гены показаны для (а) пациентов СКВ с характеристикой гена ИФН I типа на 14 сутки после применения антитела MEDI-545; (б) пациенты с СКВ, не имеющие признака гена ИФН I типа через 14 суток после применения антитела MEDI-545; и (в) пациенты с СКВ на 14 сутки после применения плацебо. Отмеченные желтым цветом признаки генов ИФН I типа определены в качестве имеющих.

Фиг.30. Иерархическое кластерирование 1384 зондов показывает, что они по-разному регулируются ИФНα подтипами, ИФНβ, ИФНγ и ФНОα в простимулированной ex vivo цельной крови. Каждая линия соответствует одному набору зондов, а каждая колонка соответствует отдельному образцу. Длины разветвлений показывают корреляцию, с которой наборы зондов/образцы соединены, причем более длинные ветки показывают более слабую корреляцию. Цвет означает уровень относительной экспрессии отдельных наборов генов по сравнению со стандартной экспрессией контролей, не подвергавшихся воздействию. Красный цвет означает повышенную регуляцию по сравнению с контролем; зеленый цвет означает пониженную регуляцию по сравнению с контролем; черный цвет означает отсутствие изменений.

Фиг.31а-31б. (а). Иерархическое кластерирование относительной экспрессии 25 наборов индуцируемых ИФН I типа генов, которые сверхэкспрессируются в цельной крови ех vivo при исследовании различных ИФНα подтипов, ИФНβ, ИФНγ и ФНОα. (б). Heatmap относительной экспрессии тех же 25 наборов генов по сравнению с контролем без обработки в кератиноцитах ех vivo при исследовании ИФНα2а, ИФНβ, ИФНγ и ФНОα. Красный цвет означает повышенную регуляцию генной экспрессии относительно контроля, не подвергшегося обработке, зеленый цвет означает пониженную регуляцию генной экспрессии относительно контроля, не подвергшегося обработке, черный цвет означает отсутствие существенного изменения в генной экспрессии испытуемых образцов относительно контроля.

Фиг.32а-32в. Сверхэкспрессия распределения стандартного (а) и среднего (б) кратного изменения 25 индуцируемых ИФН I типа зондов установлена в 26 парах образцов поврежденной кожи, сравниваемых с образцами неповрежденной кожи. (в) в результате усреднения стандартного и среднего кратного изменения для 25 индуцируемых ИФН I типа зондов установлена сверхэкспрессия в 26 парах образцов поврежденной кожи и неповрежденной кожи.

Фиг.33а-33г. Относительная экспрессия отдельных индуцируемых ИФН I типа генов ((a) HPSE, (б) OASL и (в) HERC6) и генов, не индуцируемых ИФН ((г) SERPINB4), на поврежденной коже по сравнению с неповрежденной кожей и неповрежденной коже по сравнению с нормальной кожей у больных псориазом на основании данных по микроматрицам. Кратное изменение этих генов в поврежденной коже сравнивают с генами парного образца неповрежденной кожи, хотя неповрежденную кожу сравнивают со стандартом 21 контроля нормальной кожи. Величина j9 для HPSE, OASL, HERC6 и SERPINB4 представляет сравнение между нормальной кожей и неповрежденной кожей, между поврежденной кожей и нормальной кожей (представлены парами): 0,468, <0,00001; 0,376, <0,00001; 0,03, <0,00001; 0,0002, <0,00001.

Фиг.34а-34б. (а) Иерархическое кластерирование всех профилированных от больных псориазом (21 нормальный (синий линии) 26 парных образцов неповрежденной кожи (черные линии) и поврежденной кожи (красные линии) от 24 больных псориазом и 3 образцов поврежденной кожи (красные линии) от 3 больных псориазом, у которых парные образцы неповрежденной кожи не дают достаточного количества кРНК для гибридизации или сканируемого выравнивания, имеют коэффициенты масштабирования, которые более чем в три раза превышают стандарт), используя 164 индуцируемых ИФН I типа наборов генов с повышенной регуляцией в поврежденной коже по сравнению с данными у большей части неповрежденной кожи. Каждая линия соответствует одному набору зондов, причем каждая колонка соответствует одному образцу. Длины разветвлений показывают степень корреляции, с которой образцы соединены, причем более длинные ответвления показывают более слабую корреляцию. Цвет означает уровень относительной экспрессии отдельных наборов генов по сравнению со стандартной экспрессией 21 нормального образца. Красный цвет означает повышенную регуляцию по сравнению с контролем; зеленый цвет означает пониженную регуляцию по сравнению с контролем, (б) АГК всех образцов больных псориазом профилированных по 164 повышенной регуляции ИФН I типа-индуцируемых зондов, установленных в поврежденной коже по сравнению с данными у большинства парных образцов неповрежденной кожи. (АГК подсчитывают и данные визуализируют в продукте компании Spotfire). Каждый кружок представляет один образец (синие кружки=нормальная кожа; черные кружки=кожа без повреждений; красные кружки=поврежденная кожа).

Фиг.35. Сверхэкспрессия выбранных индуцируемых ИФН I типа генов в 18 парах поврежденной и неповрежденной кожи от 18 больных псориазом, основыванная на анализе taqMan кРВ-ПЦР, используя BioMark™ 48.48 динамическую систему фирмы Fluidigm.

Фиг.36а-36б. Корреляция коэффициента распределения сверхэкспрессированных генов в кожных повреждениях пациентов с псориазом между результатами taqMan и результатами выравнивания. Гены группируют, основываясь на коэффициенте корреляции между результатом количественной РВ-ПЦР TaqMan и измерений по микроматрицам, (а) корреляция коэффициента распределения всех 40 генов с повышенной регуляцией в кожных повреждениях, которые подтверждаются с помощью количественной РВ-ПЦР TaqMan; (б) корреляция коэффициента распределения 29 индуцируемых ИФН-генов.

Фиг.37а-37г. Сравнение taqMan кРВ-ПЦР анализа, используя BioMark™ 48.48 динамическую систему и результаты генного чипа Affymetrix® для выбранных генов ISG15 и МХ1, индуцируемых ИФН I типа.

Фиг.38. Подтверждение с помощью TaqMan кРВ-ПЦР результатов сверхэкспрессии генов IFI27 и CXCL10, индуцируемых ИФН I типа, полученных с помощью генного чипа Affymetrix®.

Фиг.39а-39е. Стимулирование ex vivo нормальных кератиноцитов лейкоцитарным ИФН и ИФНα2а и доза-зависимая нейтрализация индуцируемых ИФН I типа генов с помощью ИФНα антитела, (а) нейтрализация сверхэкспрессии гена ISG15 в ответ на 350 МЕд/мл ИФНα2а, (б) нейтрализация сверхэкспрессии гена ISG15 в ответ на 150 МЕд/мл лейкоцитарного ИФН, (в) нейтрализация сверхэкспрессии гена USP18 в ответ на 350 МЕд/мл ИФНα2а, (г) нейтрализация сверхэкспрессии гена USP18 в ответ на 150 МЕд/мл лейкоцитарного ИФН, (д) нейтрализация сверхэкспрессии гена IFIT2 в ответ на 350 МЕд/мл ИФНα2а, и (е) нейтрализация сверхэкспрессии гена IFIT2 в ответ на 150 МЕд/мл лейкоцитарного ИФН. Кривую титрования каждой дозы получают по результатам трех повторов. Сверхэкспрессию отдельных генов без ИФНα антитела нормализуют до 1.

Фиг.40а-40в. Относительная экспрессия и РНК и средние кратные изменения ИФН I типа α подтипов (фиг.40а), других представителей интерферонов типа I (фиг.40б), и ИФНα рецепторов (фиг.40в) в кожных повреждениях (КП) или в коже без повреждений (КБП) по сравнению с кожей здорового нормального контрольного субъекта (ЗНК). Стандартные и относительные уровни иРНК указанных цитокинов и их рецепторов в нормальной коже двух здоровых доноров были масштабированы до 1, основываясь на исследованиях taqMan кВР-ПЦР, используя матричные карты TaqMan низкой плотности (TaqMan low density - TLDA) от фирмы Applied Biosciences. Красный цвет: относительное кратное изменение иРНК в неповрежденной коже по сравнению с нормальной кожей; красный цвет: относительное кратное изменение иРНК в поврежденной коже по сравнению с неповрежденной кожей. Величины p для сверхэкспрессии указанных отдельных генов в неповрежденной коже или в поврежденной коже по сравнению со здоровой нормальной кожей (перечислены попарно) следующие: ИФНα1, 0,303, <0,001; ИФНα2, 0,389, 0,072; ИФНα5, <0,001, 0,002; ИФНα6, 0,664, 0,093; ИФНα7, 0,586, 0,077; ИФНα8, 0,430, 0,049; ИФНα14, 0,224, 0,049; ИФНα17, 0,552, 0,0203; ИФНα21, 0,113, 0,003; ИФНβ, 0,255, 0,022; ИФНк, 0,03, <0,001; ИФНω, 0,516, 0,049; ИФНAR1, 0,192, <0,001; ИФНAR2, <0,001, <0,001, соответвенно.

Фиг.41. Относительная экспрессия иРНК и средние кратные изменения рецепторов ИФНγ, ФНОα и ИФНγ в поврежденной коже (ПК) или неповрежденной коже (НК) по сравнению с кожей от здоровых нормальных контролей (ЗНК). Средние величины относительных уровней иРНК цитокинов и их рецепторов в нормальной коже двух здоровых доноров были масштабированы до 1, основываясь на исследованиях taqMan кВР-ПЦР, используя TLDA от фирмы Applied Biosciences. Черный цвет: относительное кратное изменение иРНК в неповрежденной коже по сравнению с нормальной кожей; красный цвет: относительное кратное изменение иРНК в поврежденной коже по сравнению с нормальной кожей. Величины p по экспрессии отдельных генов в неповрежденной коже или в поврежденной коже по сравнению с нормальной здоровой кожей (представлены попарно) следующие: ИФНγ, 0,02, <0,001; ИФНGR1, <0,001, <0,001; ИФНGR2, <0,001, <0,001; ФНОα, <0,001, <0,001, соответственно.

Фиг.42. Диаграмма Венна, иллюстрирующая и число наборов зондов, которые изменены под действием ИФН I типа, ИФНγ и ФНОα во время стимуляции ex vivo, и наборы зондов, которые изменены в поврежденной коже по сравнению с неповрежденной кожей. Красные номера: наборы зондов, которые показывают повышенную экспрессию при обработке цитокином, или сравнения с исходным уровнем неповрежденной кожи; зеленые номера: наборы зондов, которые показывают пониженную экспрессию при обработке цитокином или сравнении с исходным уровнем неповрежденной кожи. Пресекающиеся области представляют наборы зондов, которые являются общими для обоих сравнений.

Фиг.43а и 43б. Совместная экспрессия генов, индуцируемых ИФН I типа, тип-II ИФН и ФНО, в поврежденной/неповрежденной коже пациентов с псориазом, основанная на результатах генного чипа Affymetrix genechip®. ИФН I типа, тип-II ИФН и ФНОα индуцируемые гены были отобраны, основываясь на экспериментах по стимулированию ех vivo (примеры 10 и 16). Набор зондов по меньшей мере с двухкратным изменением в поврежденной коже относительно неповрежденной расценивается в качестве сверхэкспрессируемого. (а) число ИФН I типа, ИФНα и ФНОα индуцируемых генов с повышенной регуляцией в поврежденной коже показывает строгую корреляцию. (б) число ИФН I типа, ИФНα и ФНОα индуцируемых генов в поврежденной коже существенно отличается при попарных сопоставлениях.

Фиг.44. Иммуногистохимический анализ образцов биопсии из кожи больных псориазом, неповрежденной кожи и кожи здоровых доноров. BDCA2 является специфическим маркером для клеточных инфильтратов pDC, которые содержатся в большем количестве в поврежденной коже по сравнению с неповрежденной кожей и полностью отсутствуют в нормальной коже. CD83 является маркером для mDC, CD4 присутствует на Т-клетках и дентритных клетках. Окрашивание белка STAT1 наблюдают в эпидермисе поврежденной кожи (и в ядре, и в цитоплазме) и в кожных одноядерных воспалительных клетках, но не в коже без повреждений и не в здоровой коже. Повышение белка ISG15 наблюдают в коже при псориазе и в меньшей степени в коже без повреждений, но не выявляют в здоровой коже.

Фиг.45. Диаграмма Венна, иллюстрирующая число наборов зондов, которые показывают измененную экспрессию на уровне иРНК в поврежденной коже по сравнению с неповрежденной кожей или в неповрежденной коже по сравнению с нормальной кожей у больных псориазом. Величины, заштрихованные красным, означают число наборов зондов с существенно повышенной регуляцией, хотя такие величины, заштрихованные зеленым цветом, означают число наборов зондов с существенно пониженной регуляцией. Перекрывающаяся область представляет наборы зондов, общие для обоих сопоставлений.

Фиг.46. Графическое представление сигнального метаболического пути ИФН, который активируется в поврежденной коже больных псориазом. Визуализацию метаболического пути получают с помощью интегрального программного обеспечения GeneGo′s MetaCore. Отдельные символы означают хорошо описанные белки или белковые комплексы. Стрелки, связывающие белки, представляют стимулирующее, ингибирующее или взаимодействующее действие белка на белок-мишень. Термометры, находящиеся рядом с отдельными символами, представляют относительные уровни экспрессии (красный цвет означает сверхэкспрессию, зеленый цвет означает пониженную экспрессию) транскриптов, которые включают белок (или белковый комплекс) в определенном метаболическом пути.

Фиг.47а и 47б. Таблица представляет кратное изменение (fold change - fc; log2 преобразование) и величину q (рассчитанную по FDR) топовых 100 наборов генов с повышенной регуляцией в поврежденной коже по сравнению с непроврежденной кожей при псориазе. Также перечисленными являются log2 трансформированные кратные изменения и величины q этих генов при сравнении неповрежденной кожи со здоровой нормальной кожей контролей. ИФН I типа индуцированные гены выделены жирным шрифтом.

Фиг.48. Специфическое отделение поврежденной кожи от неповрежденной кожи и нормальной кожи - иерархическое кластерирование всех образцов, используя профили транскрипции всех генов на матрице целого генома (Affymetrix целый геном U133 plus v2.0 матрица).

Фиг.49. Набор зондов, идентифицированных в качестве индуцируемых ИФНα, по перекрыванию на фиг.42.

Фиг.50. Набор зондов, идентифицированных в качестве индуцируемых ИФНα, по перекрыванию на фиг.42.

Фиг.51. Набор зондов, идентифицированных в качестве индуцируемых ИФН I типа, по перекрыванию на фиг.42.

Фиг.52. Иммуногистохимический анализ биопсийных образцов из кожных повреждений пациентов с СКВ, обработанных плацебо, для обнаружения pDC, mDC и Т-клеточных инфильтратов.

Фиг.53. Иммуногистохимический анализ биопсийных образцов из кожных повреждений пациентов с СКВ, обработанных плацебо, для обнаружения HERC5, ISG15 и IP10 белков, белков, экспрессированных с индуцированных ИФН I типа генов.

Фиг.54. Иммуногистохимический анализ биопсийных образцов из кожных повреждений у пациентов с СКВ, обработанных 10 мг/кг MEDI-545, для выявления pDC, mDC и Т-клеточных инфильтратов.

Фиг.55. Иммуногистохимический анализ биопсийных образцов из кожных повреждений пациентов с СКВ, обработанных продуктом MEDI-545 в количестве 10 мг/кг, для обнаружения HERC5, ISG15 и белков IP10, белков, экспрессированных с индуцируемых ИФН I типа генов.

Фиг.56. Иммуногистохимический анализ биопсийных образцов из кожных повреждений пациентов с СКВ, обработанных антителом MEDI-545 в количестве 10 мг/кг, для обнаружения pDC, mDC и Т-клеточных инфильтратов.

Фиг.57. Иммуногистохимический анализ биопсийных образцов из кожных повреждений пациентов с СКВ, обработанных продуктом MEDI-545 в количестве 10 мг/кг, для обнаружения HERC5, ISG15 и белков IP10, белков, экспрессированных с типа индуцируемых ИФН I типа генов.

Фиг.58а и 58б. Heatmap (а) и АГК (б), показывающие нейтрализацию топовых 25 ИФН I типа индуцируемых генов в биопсийном образце кожи пациента с СКВ, обработанного MEDI-545 в количестве 10 мг/кг на 0 сутки и 7 сутки после дозирования.

Фиг.59а-г. Выявление активности ИФН I и II типа в биоисследовании ИФН.

Фиг.60а и 60б. Выявление MEDI-545 (а) и MEDI-546 (б)-опосредованной нейтрализации действия ИФНα в биоисследовании ИФН.

Фиг.61. Выявление анти-ИФНα-опосредованной нейтрализации действия ИФНα в биоисследовании ИФН.

Фиг.62. Выявление анти-ИФНα-опосредованной нейтрализации действия ИФНα в биоисследовании ИФН.

Фиг.63. Выявление анти-ИФНα-опосредованной нейтрализации действия ИФНα в биоисследовании ИФН.

Фиг.64. Heatmap модуляции генной экспрессии в цельной крови здоровых доноров, простимулированных ex vivo ИФНα, ФНОα или ИФНα/β. Отрицательный контроль (ОК).

Фиг.65. Индуцируемые ИФН I типа гены содержатся среди генов с наиболее повышенной регуляцией в цельной крови пациентов с СКВ.

Фиг.66. Регуляция молекул иРНК ИФНγ, ИФНω, ИФНАR1 и ИФНАR2 повышена в цельной крови пациентов с волчанкой.

Фиг.67. Heatmap показывает модулирование экспрессии гена в МКПК здорового донора ех vivo, простимулированную сывороткой пациентов с волчанкой.

Фиг.68а и 68б. (а) График АГК показывает пациентов с волчанкой, у которых имеется сильный/умеренный индуцируемый ИФН I типа показатель (примерно 66% в данной выборке) собрана вместе. (б) Таблица показывает 25 генов, использованных для анализа АГК.

Фиг.69. Подтверждение сверхэкспрессии отдельных индуцируемых ИФН I типа генов у пациентов с волчанкой, основанное на исследованиях taqMan KPB-ПЦР (количественная реального времени полимеразная цепная реакция), используя BioMark™ 48.48 динамический массив фирмы Fluidigm (массив с переменными границами).

Фиг.70а и 70б. (а) Способность четырех разных образцов сыворотки пациентов с СКВ индуцировать действие ИФН I типа в исследовании репортерного гена. (б) Число транскриптов, индуцированных по меньшей мере трехкратно в МКПК здорового человека каждым из четырех разных образцов сыворотки пациентов с СКВ после совместного инкубирования на протяжении 4 ч.

Фиг.71a и 716. Большинство генов, нейтрализованных воздействием анти-ИФНα антителом через 4 ч после совместного инкубирования сыворотки пациента с СКВ и МКПК здорового человека, является ИФН I типа генами, хотя большинство генов, нейтрализованных анти-ИФНα антителом через 18 ч после совместного инкубирования сыворотки пациента с СКВ и МКПК здорового человека, не является ИФН I типа генами, что было показано (а) анализом heatmap и представлено (б) в виде гистограмм.

Фиг.72а и 71б. Представлены (а) ИФН I типа гены и (б) гены, не относящиеся к ИФН I типа генам, регуляция которых была повышена и нейтрализована анти-ИФНα антителом 18 ч после совместного инкубирования сыворотки пациента с СКВ и МКПК здорового человека, но регуляция которых не была повышена после 4 ч совместного инкубирования сыворотки пациента с СКВ и МКПК здорового человека.

Фиг.73. Представлены метаболические пути и клеточные процессы, нейтрализованные анти-ИФНα антителом 18 ч после совместного инкубирования сыворотки пациента с СКВ и МКПК здорового человека.

Фиг.74а и 74б. Выявление (а) повышенных и (б) пониженных уровней специфических белков в сыворотке пациентов с волчанкой.

Фиг.75. Анализ QuantiGenePlex 1.0 ИФН-индуцируемых генных подписей в цельной крови 5 здоровых доноров, простимулированных 20 Ед/мл ИФНα2b.

Фиг.76. Доза-зависимые изменения в генной экспрессии в крови одного здорового донора, после обработки множественными концентрациями ИФНα2b.

Фиг.77. Выявление ИФН-индуцируемых транскриптов в образцах цельной крови субъектов с СКВ, сохраняемых в пробирках PAXgene, с выявляемой и невыявляемой активностью ИФНα в сыворотке.

Фиг.78. Корреляция между QuantiGenePlex и Fluidigm технологиями в образцах цельной крови субъектов с СКВ, сохраняемых в пробирках PAXgene.

Фиг.79. Продольное тестирование образцов СКВ после введения анти-ИФНα моноклонального антитела: сравнение QuantiGenePlex 2.0 и Fluidigm технологий.

Фиг.80. Типичный вариант heatmap, визуализирующий (в убывающем порядке) показатель сверхэкспрессии генов ИФН I типа; показатель сверхэкспрессии гранулоцитов; показатель пониженной экспрессии Т-клеток, показатель пониженной экспрессии NK-клеток и показатель пониженной экспрессии В-клеток в цельной крови 46 больных СКВ (показано красной линией около heatmap) по сравнению с цельной кровью от 24 здоровых доноров (показано синей линией около heatmap) ИФН = интерферон; СКВ = системная красная волчанка.

Фиг.81а-81в. Гены, индуцируемые ИФН I типа, в цельной крови пациентов с СКВ могут применяться для разделения пациентов с СКВ с признаком генов ИФН I типа и здоровых нормальных контролей. (а) Трехмерная диаграмма АГК цельной крови 46 образцов от пациентов с СКВ, используя 114 индуцируемых ИФН I типа зондов, показывает повышенную регуляцию в цельной крови пациентов с СКВ по сравнению с соответствующим показателем от 24 здоровых доноров. (б) Диаграмма АГК цельной крови от 54 пациентов с СКВ в предстоящем исследовании, используя набор 114 индуцируемых ИФН I типа генов с повышенной регуляцией, подтверждает сверхэкспрессию генов ИФН I типа у пациентов с СКВ. (в) График АГК цельной крови от 100 образцов СКВ в настоящем и последующих исследованиях с применением панели из 21 индуцируемого ИФН I типа гена с повышенной регуляцией у пациентов с СКВ по сравнению с 24 здоровыми донорами. Каждая точка представляет один образец (синие точки - здоровые субъекты; красные точки - пациенты с СКВ). ИФН = интерферон; АГК = анализ главных компонент; СКВ = системная красная волчанка.

Фиг.82. Относительная экспрессия молекул иРНК и средние кратные изменения (горизонтальные гистограммы) рецепторов ФНО-α, ИФН-γ и ИФН-γ-рецепторов в цельной крови пациентов с СКВ по сравнению со здоровыми контрольными субъектами (Р<0,05 для всех). Средние величины относительных уровней иРНК указанных цитокинов и их рецепторов в цельной крови 24 здоровых доноров были масштабированы до 1, основываясь на исследованиях taqMan кВР-ПЦР. ИФН = интерферон; КРВ-ПЦР = количественная реального времени транскриптазная полимеразная цепная реакция; СКВ = системная красная волчанка; ФНО = фактор некроза опухоли.

Фиг.83а-83в. TaqMan кРВ-ПЦР подтверждает сверхэкспрессию ИФН I типа - индуцируемых генов в цельной крови пациентов с СКВ. (а) Относительные кратные изменения 15 индуцируемых ИФН I типа генов (в общем обозначаемых 1-15) у пациентов с СКВ сравнивают со здоровыми донорами (p<0,05 для всех). Средние значения относительных уровней иРНК генов в объединенной РНК от 24 здоровых доноров были масштабированы до 1, основываясь на исследованиях taqMan кВР-ПЦР. Горизонтальные линии представляют среднее кратное изменение. (б и в) Оценка TaqMan кРВ-ПЦР сверхэкспрессии панели из 21 гена индуцированных ИФН I типа генов в цельной крови пациентов с СКВ методом определения, применимым для выравнивания целого генома. Относительная сверхэкспрессия 21 гена, индуцируемого ИФН I типа, у двух пациентов с СКВ, показана с помощью методов с применением микрочипа (слева) и TaqMan (справа). Коэффициенты корреляции между TaqMan QRT-PCR и микрочипом составляют 0,9861 и 0,9888 для пациентов Х и Y, соответственно. ИФН = интерферон; КРВ-ПЦР = количественная реального времени обратной транскриптазы полимеразная цепная реакция; СКВ = системная красная волчанка.

Фиг.84. Величина сверхэкспрессии генов ИФН I типа в цельной крови пациентов с СКВ по измерениям средней кратности изменения 25 наиболее сверхэкспрессируемых индуцируемых ИФН I типа генов или по оценке генов ИФН I типа у отдельных пациентов с СКВ. Горизонтальные линии представляют средние величины. Пациентов, у которых оценка показателя генов ИФН I типа ≥10, оценивают в качестве обладающих сильными показателями генов ИФН I типа; пациентов, у которых оценка показателя генов ИФН I составляет 4-10, оценивают в качестве обладающих умеренными показателями генов ИФН I типа; пациентов, у которых оценка показателей генов ИФН I типа ≤4, оценивают в качестве обладающих слабыми показателями ИФН I типа. ИФН = интерферон; СКВ = системная красная волчанка.

Фиг.85а-85в. Разделение 35 пациентов с СКВ на группы с низким (а; зеленый цвет), умеренным (б; серый цвет) и высоким (в; красный цвет) показателем гена ИФН I типа основано на средней кратности изменения по панели из 21 гена индуцируемых ИФН I типа генов. Плотности для каждого пациента с СКВ подсчитывают и изображают графически, используя кратное изменение для каждого из 21 гена от каждого пациента с СКВ по log2 шкале для представления распределения величин кратного изменения 21 гена. Вертикальные пунктирные линии разделяют 3 класса оценок генных подписей: 7 пациентов со слабым проявлением генов ИФН I типа = среднее кратное изменение <1,91 (0,93 по log2 шкале), 8 пациентов с умеренным проявлением генов ИФН I типа = среднее кратное изменение 1,91-5,53 и 20 пациентов с сильным проявлением генов ИФН I = среднее кратное изменение >5,53 (2,47 по log2 шкале). ИФН = интерферон; СКВ = системная красная волчанка.

Фиг.86. Доза-зависимая нейтрализация с помощью антитела MEDI-545 21 индуцируемого ИФН-α/β гена с повышенной регуляцией у пациентов с СКВ.

Фиг.87а и 87б. Heatmap (а) и АГК (б), показывающие нейтрализацию 21 индуцируемого ИФН-α/β гена с повышенной регуляцией в цельной крови пациентов с СКВ, обработанной MEDI-545 в количестве 30 мг/кг (0, 1, 4, 7 и 14 сутки после дозировки).

Фиг.88а и 88б. Диаграммы АГК, полученные с применением 21 индуцируемого ИФН-α/β зонда с повышенной регуляцией, не показывают нейтрализации ИФН подписи у пациентов, обработанных плацебо.

Фиг.89. Нейтрализация 21 индуцируемого ИФН-α/β гена с повышенной регуляцией установлена у пациентов после лечения антителом MEDI-545 в количестве 0,3, 1,0, 3,0, 10,0 и 30,0 мг/кг.

Фиг.90. Методология подсчета нейтрализации мишени для фиг.89.

Подробное описание изобретения

Настоящее изобретение охватывает способы идентификации, диагностики, лечения и мониторинга прогрессирования заболевания у пациентов. К пациентам относятся какие-либо животные с ИФН I типа или ИФНα-индуцируемым заболеванием, расстройством или состоянием. Пациент может иметь заболевание, расстройство или состояние в качестве результата экспериментального исследования, например, это может быть экспериментальная модель, разработанная для заболевания, расстройства или состояния. В другом варианте у пациента может быть заболевание, расстройство или состояние в отсутствие экспериментальной манипуляции. К пациентам относятся люди, мыши, крысы, лошади, свиньи, кошки, собаки и какие-либо другие животные, используемые для исследования.

Пациент может иметь профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα. Профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, может быть сильным профилем, умеренным профилем или слабым профилем. Профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, может быть легко определен в качестве сильного, умеренного или слабого путем выяснения кратности нарушения регуляции профиля экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента (например, кратного увеличения у пациента экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, регуляция которых повышена), относительно контрольного образца (образцов) или контрольного пациента (пациентов) и сравнения кратности регуляции у пациента по сравнению с другими пациентами, имеющими профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα. Кратность нарушения регуляции может быть подсчитана известными в данной области способами. См., например, пример 8.

Профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, может включать повышение регуляции какой-либо группы генов или группы генов, выявленных зондами, указанными в табл.19, 20, 21, 22, 23, 24, 26, 28 или 30. Группа генов или группа генов, выявляемых зондами, идентифицированными в табл.19, 20, 21, 22, 23, 24, 26, 28 или 30, может включать какие-либо по меньшей мере 2, какие-либо по меньшей мере 3, какие-либо по меньшей мере 4, какие-либо по меньшей мере 5, какие-либо по меньшей мере 6, какие-либо по меньшей мере 7, какие-либо по меньшей мере 8, какие-либо по меньшей мере 9, какие-либо по меньшей мере 10, какие-либо по меньшей мере 11, какие-либо по меньшей мере 12, какие-либо по меньшей мере 13, какие-либо по меньшей мере 14, какие-либо по меньшей мере 15, какие-либо по меньшей мере 16, какие-либо по меньшей мере 17, какие-либо по меньшей мере 18, какие-либо по меньшей мере 19, какие-либо по меньшей мере 20, какие-либо по меньшей мере 21, какие-либо по меньшей мере 22, какие-либо по меньшей мере 23, какие-либо по меньшей мере 24, какие-либо по меньшей мере 25, какие-либо по меньшей мере 26, какие-либо по меньшей мере 27, какие-либо по меньшей мере 28, какие-либо по меньшей мере 29, какие-либо по меньшей мере 30, какие-либо по меньшей мере 40 или какие-либо по меньшей мере 50 генов, или генов, выявленных зондами, идентифицированных в указанных таблицах.

Группой генов, которые могут быть включены в профиль экспрессии пациента ФД маркеров, индуцируемых ИФН I типа или ИФНα, могут быть гены МХ1, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RASD2 и IFI44. К гену или генам, выявленным зондами, могут относиться гены IFI44, IFI27, IFI44L, DNAPTP6, LAMP3, LY6E, RSAD2, HERC5, IFI6, ISG15, OAS3, SIGLEC1, OAS2, USP18, RTP4, IFIT1, МХ1, OAS1, EPSTI1, PLSCR1 и IFRG28.

К генам могут относиться какие-либо по меньшей мере 2, какие-либо по меньшей мере 3, какие-либо по меньшей мере 4, какие-либо по меньшей мере 5, какие-либо по меньшей мере 6, какие-либо по меньшей мере 7, какие-либо по меньшей мере 8, какие-либо по меньшей мере 9, какие-либо по меньшей мере 10, или какие-либо по меньшей мере 11, или какие-либо по меньшей мере 12, или какие-либо по меньшей мере 13, или какие-либо по меньшей мере 14, или какие-либо по меньшей мере 15, или какие-либо по меньшей мере 16, или какие-либо по меньшей мере 17, или какие-либо по меньшей мере 18, или какие-либо по меньшей мере 19, или по меньшей мере, 20, или какие-либо по меньшей мере 21, или какие-либо по меньшей мере 22, или какие-либо по меньшей мере 23, или какие-либо по меньшей мере 24, или какие-либо по меньшей мере 25, или какие-либо по меньшей мере 26, или какие-либо по меньшей мере 27, или какие-либо по меньшей мере 28, или какие-либо по меньшей мере 29, или какие-либо по меньшей мере 30 из генов LAMP3, DNAPTP6, FLJ31033, HERC6, SERPING1, EPSTI1, RTP4, OASL, FBXO6, IFIT2, IFI44, OAS3, BATF2, ISG15, IRF7, RSAD2, IFI35, OAS1, LAP3, IFIT1, IFIT5, PLSCR1, IFI44L, MS4A4A, GALM, UBE2L6, TOR1B, SAMD9L, HERC5, TDRD7, TREX1, PARP12 и AXUD1.

Профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, может включать повышенную регуляцию целой группы генов или группы генов, выявляемых зондами, представленными в одной из таблиц (табл.19, или табл.20, или табл.21, или табл.22, или табл.23, или табл.24, или табл.26, или табл.28, или табл.30), или одного или нескольких генов, представленных на фиг.72, ФД маркеров, индуцируемых ИФН I типа или ИФНα. Профиль экспрессии ФД маркера может включать повышенную регуляцию всех генов, представленных в табл.24. Профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, может включать повышенную регуляцию генов, идентифицированных на фиг.72а или фиг.72б, или фиг.72а и фиг.72б.

Пациент, у которого имеется профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, может дополнительно иметь ФД маркер (маркеры) с пониженной регуляцией ИФН I типа или ИФНα. ФД маркеры с пониженной регуляцией могут включать какой-нибудь один, каких-нибудь два, каких-нибудь три, каких-нибудь четыре, каких-нибудь пять, каких-нибудь шесть, каких-нибудь семь, каких-нибудь восемь, каких-нибудь девять, каких-нибудь десять, каких-нибудь 15, каких-нибудь 20, каких-нибудь 25, каких-нибудь 30, каких-нибудь 35, каких-нибудь 40, каких-нибудь 45 или каких-нибудь 50 генов из табл.31 или какой-нибудь ген из CYP1B1, TGST1, RRAGD, IRS2, MGST1, TGFBR3 и RGS2.

Пациент, у которого имеется профиль экспрессии ФД маркеров, индуцированных ИФН I типа или ИФНα может дополнительно иметь повышенную регуляцию экспрессии какого-нибудь числа ИФНα или ИФН I типа подтипов. ИФНα или ИФН I типа подтипы могут включать какие-либо более чем один, более чем два, более чем три, более чем четыре, более чем пять, более чем шесть, более чем семь, более чем восемь, более чем девять или более чем десять ИФНα или ИФН I типа подтипов. Эти подтипы могут включать ИФНα1, ИФНα2, ИФНα4, ИФНα5, ИФНα6, ИФНα7, ИФНα8, ИФНα10, ИФНα14, ИФНα17, ИФНα21, ИФНβ или ИФНω. У пациента может быть повышенная регуляция экспрессии ИФН подтипов ИФНα1, ИФНα2, ИФНα8 и ИФНα14.

В другом варианте пациент, подвергнутый лечению способами, указанными в настоящем изобретении, может быть легко выявлен в качестве пациента, имеющего профиль генной экспрессии с повышенной регуляцией экспрессии какого-либо числа ИФНα или ИФН I типа подтипов. ИФНα или ИФН I типа подтипы могут включать какие-либо более чем один, более чем два, более чем три, более чем четыре, более чем пять, более чем шесть, более чем семь, более чем восемь, более чем девять или более чем десять ИФНα или ИФН I типа подтипов. К таким подтипам могут относиться ИФНα1, ИФНα2, ИФНα4, ИФНα5, ИФНα6, ИФНα7, ИФНα8, ИФНα10, ИФНα14, ИФНα17, ИФНα21, ИФНβ или ИФНω. К таким подтипам могут относиться ИФНα1, ИФНα2, ИФНα8 и ИФНα14.

Пациент, имеющий профиль экспрессии ФД маркеров, индуцированных ИФН I типа - или ИФНα, может также иметь повышенную регуляцию экспрессии ИФНα рецепторов, или ИФНAR1, или ИФНAR2, или обоих, или ФНОα, или ИФНγ, или ИФНγ рецепторов (или ИФНGR1, ИФНGR2, или и ИФНGR1, и ИФНGR2). Пациент может быть легко идентифицирован в качестве пациента, у которого наблюдается повышение экспрессии ИФНα рецепторов, или ИФНАR1, или ИФНАR2, или обоих, или ФНОα, или ИФНγ, или ИФНγ рецепторов (или ИФНGR1, ИФНGR2, или и ИФНGR1, и ИФНGR2).

Повышенная регуляция или пониженная регуляция профиля экспрессии ФД маркеров, индуцированных ИФН I типа - или ИФНα, пациента может быть выражена в какой-либо степени относительно аналогичного показателя в образце от контроля (которым может быть образец, который не является больной тканью пациента (например, кожа без повреждений от субъекта с псориазом) или от здорового субъекта, не имеющего заболевания или расстройства). Степень повышения регуляции или понижения регуляции может составлять по меньшей мере 10%, по меньшей мере 15%, по меньшей мере 20%, по меньшей мере 25%, по меньшей мере 30%, по меньшей мере 40%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 90%, по меньшей мере 100%, по меньшей мере 125%, по меньшей мере 150%, или по меньшей мере 200%, или по меньшей мере 300%, или по меньшей мере 400%, или по меньшей мере 500% от степени повышения регуляции или понижения регуляции контроля или контрольного образца.

Кроме того, у пациента может происходить сверхэкспрессия или они могут иметь ткань, которая сверхэкспрессирует ИФН I типа подтип в количестве, составляющем по меньшей мере 10%, по меньшей мере 15%, по меньшей мере 20%, по меньшей мере 25%, по меньшей мере 30%, по меньшей мере 40%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 90%, по меньшей мере 100%, по меньшей мере 125%, по меньшей мере 150%, или по меньшей мере 200%, или по меньшей мере 300%, или по меньшей мере 400%, или по меньшей мере 500% от количества в контроле. Подтип ИФН I типа может быть каким-либо из следующих: ИФНα1, ИФНα2, ИФНα4, ИФНα5, ИФНα6, ИФНα7, ИФНα8, ИФНα10, ИФНα14, ИФНα17, ИФНα21, ИФНβ или ИФНω. К подтипам ИФН I типа могут относиться все из числа ИФНα1, ИФНα2, ИФНα8 и ИФНα14.

Пациенты также могут включать или в другом варианте включают изменения уровней белков в сыворотке. Пациент может иметь повышенные уровни в плазме белков, например, адипонектина, альфа-фетопротеина, аполипопротеина CIII, бета-2 микроглобулина, ракового антигена 125, ракового антигена 19-9, эоксатина, FABP, фактора VII, ферритина, ИЛ-10, ИЛ-12р70, ИЛ-16, ИЛ-18, ИЛ-1ra, ИЛ-3, МСР-1, ММР-3, миоглобина, SGOT, тканевого фактора, TIMP-1, ФНО RII, ФНО-альфа, VCAM-1 или vWF. Пациент может иметь повышенные уровни в сыворотке каких-либо из белков 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 или 26. Повышенный уровень может составлять по меньшей мере 10%, по меньшей мере 15%, по меньшей мере 20%, по меньшей мере 25%, по меньшей мере 30%, по меньшей мере 40%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 90%, по меньшей мере 100%, по меньшей мере 125%, по меньшей мере 150%, или по меньшей мере 200%, или по меньшей мере 300%, или по меньшей мере 400%, или по меньшей мере 500% от уровня контроля, например, здорового субъекта. Изменением может быть снижение в сыворотке белков, например, BDNK, комплемента 3, CD40 лиганда, EGF, ENA-78, EN-RAGE, IGF-1, MDC, миелопероксидазы, RANTES или тромбопоэтина. Пациент может иметь пониженные уровни в сыворотке какого-либо из 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 или 11 из указанных белков. Пониженный уровень может составлять по меньшей мере 10%, по меньшей мере 15%, по меньшей мере 20%, по меньшей мере 25%, по меньшей мере 30%, по меньшей мере 40%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 90%, или по меньшей мере 100%, от уровня контроля, например, здорового субъекта. Профиль ФД маркера может включать один или несколько из указанных повышенных или пониженных уровней белков в сыворотке.

Пациент может дополнительно включать ауто-антитела, которые связываются с каким-либо из следующих ауто-антигенов: (а) интерферон - индуцируемым белком p78 миксовирусной (вируса гриппа) устойчивости 1; (б) surfeit 5, транскриптным вариантом c; (в) протеасомой (посомой, мультикаталитической протеазой) активаторной субъединицей 3 (РА28 гамма; Ki) trans c; (г) альфа рецептором ретиноевой кислоты; (д) белком теплового шока 10 кДа 1 (шаперонин 10); (е) тропомиозином 3; (ж) доменом, родственным гомологу плекстрина, семейство А, представитель 1; (з) цитоскелет-ассоциированным белком 1; (и) антигеном А2 синдрома Шегрена (60 кДа, рибонуклеопротеиновый ауто-антиген SS-A/Ro); (к) NADH дегидрогеназой (убихинон) 1, альфа/бета субкомплекс 1, 8 кДа; (л) гомологом 1 гена ядерного распределения (NudE - nuclear distribution gene E) (A. nidulans); (м) MutL гомологом 1, рак толстой кишки, неполипозный, 2 типа (Е. coli); (н) обогащенным лейцином повтором (в FLII) взаимодействующим белком 2; (о) тропомиозином 1 (альфа); (п) спастическая нижняя параплегия 20, спартином (синдром Тройера); (р) предимплантационным белком, вариантом транскрипта 1; (с) митохондриальным рибосомальным белком L45; (т) гомологом Lin-28 (С. elegans); (у) белком теплового шока 1, массой 90 кДа, альфа; (ф) dom-3 гомологом Z (С. elegans); (x) динеином, цитоплазматическим, легким промежуточным полипептидом 2; (ц) Ras-родственным субстратом 1 токсина С3 ботулизма (rho семейство, низкомолекулярный GTP связывающий белок); (ч) синовиальной саркомы, Х контрольная точка 2, вариантом транскрипта 2; (ш) моезином; (ш) гомологом упаковочного вектора {Drosophila), вариантом транскрипта 1; (э) GCN5 (тип 2 общего контроля аминокислотного синтеза 5 (дрожжи); (ю) эукариотического фактора элонгации трансляции 1, гамма; (я) эукариотического фактора элонгации трансляции 1, дельта; (аа) ДНК-повреждение-индуцирующий транскрипт 3; (бб) ССААТ/энхансер связывающим белком (С/ЕВР) гамма; и каким-либо другим аутоантигеном, описанным в предварительной заявке, озаглавленной «Auto-antibody markers of autoimmune disease», поданной 3 мая 2007 г., или в предварительной заявке, озаглавленной «Auto-antibody markers of autoimmune disease», поданной 6 ноября 2007 г. (например, описанные в табл.2, 4, 5 и 9, но ими перечень не ограничивается). Пациент может содержать ауто-антитела, которые связываются с каким-либо числом указанных ауто-антигенов, например, какими-либо по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 20, по меньшей мере 25 ауто-антигенами.

К другим заболеваниям, расстройствам или состояниям, индуцируемым ИФН I типа или ИФНα, относятся какие-либо из заболеваний, расстройств или состояний, которые проявляют профиль экспрессии или генную подпись ИФН I типа или ИФНα ФД маркеров. Следует учитывать, что профиль экспрессии и прояление генов ФД маркеров могут быть эквивалентными. К указанным заболеваниям, расстройствам или состояниям относятся заболевания, расстройства или состояния с аутоиммунным компонентом, например, системная красная волчанка (СКВ), инсулинзависимый сахарный диабет, воспаление кишечника (включая болезнь Крона, язвенный колит и целиакию), рассеянный склероз, псориаз, аутоиммунный тироидит, ревматоидный артрит, гломерулонефрит, идиопатический воспалительный миозит, Синдром Шегрена, васкулит, дерматомиозит, полиомиозит и саркоидоз. К другим заболеваниям, расстройствам или состояниям относится заболевание трансплантат против хозяина и отторжение трансплантата.

У пациентов также могут проявляться какие-либо из ряда симптомов, например, рассмотренных во временной патентной заявке «Methods of Treating Systemic Lupus Erythematosis» («Способы лечения системной красной волчанки»), поданной 16 апреля 2007 года, или может быть клиническая оценка CKBDAI или BILAG, рассмотренная в указанной заявке. К указанным симптомам могут относиться усталость, повреждение органов, сыпь на скулах («кожная бабочка») и алопеция. Оценка пациента может быть произведена с помощью известной клинической системы оценки, например, системы CKBDAI, которая является показателем проявления СКВ, определенным и оцененным за последние 10 суток (Bombardier C., и др., Arthritis Rheum 35, 1992, сс. 630-640). Степень проявления заболевания по системе оценки CKBDAI может варьировать 0 до 105. Выделяют следующие категории проявления заболевания по системе оценки CKBDAI: заболевание не проявляется (CKBDAI=0); слабое проявление (CKBDAI=1-5); умеренное проявление (CKBDAI=6-10); высокое проявление (CKBDAI=11-19); очень высокое проявление (CKBDAI=20 или больше). (Griffiths и др.). Другим индексом оценки заболевания является индекс BILAG - индекс активности СКВ, который основан на специфических клинических проявлениях в восьми системах органов: организма в целом, кожно-слизистой, нейрологической, скелетно-мышечной, сердечно-сосудистой, дыхательной, почечной и показателях крови. Оценка основывается на буквенной системе, но взвешенные нумерические оценки также могут быть назначены по каждой букве, создавая возможность подсчета оценки BILAG в диапазоне 0-72. (Griffiths и др.). Другие показатели оценки включают оценку PGA, сложный респондерный индекс (composite responder index - CRI) и тест ANAM4™. Способы, описанные в настоящем изобретении, например, лечение аутоиммунного расстройства, могут быть применены к какому-либо субъекту, идентифицированному в качестве имеющего какой-либо уровень проявления болезни по измерению какой-либо методикой классификации, известной в данной области, например, слабый, умеренный, высокий или очень высокий. Способы, описанные в настоящем изобретении, например, способ лечения аутоиммунного расстройства, могут привести к снижению у пациента проявления симптомов или могут привести к улучшению оценки заболевания, расстройства или состояния, которые индуцируются ИФН I типа или ИФНα.

Терапевтический агент может быть введен пациенту или пациент может быть идентифицирован в качестве кандидата на введение агента или терапевтического агента. Терапевтическим агентом является какая-либо молекула, которая связывает и модулирует действие ИФН I типа или ИФНα. Терапевтическим агентом может быть низкомолекулярное соединение или биологический агент. Если терапевтический агент является низкомолекулярным соединением, он может быть синтезирован или идентифицирован и выделен из природного источника.

Если терапевтический агент является биологическим агентом, он может быть антителом, специфическим для какого-либо подтипа (подтипов) ИФН I типа или ИФНα. Например, антитело может быть специфическим для какого-либо из ИФНα1, ИФНα2, ИФНα4, ИФНα5, ИФНα6, ИФНα7, ИФНα8, ИФНα10, ИФНα14, ИФНα17, ИФНα21, ИФНβ или ИФНω. В другом варианте антитело может быть специфичным для каких-либо двух, каких-либо трех, каких-либо четырех, каких-либо пяти, каких-либо шести, каких-либо семи, каких-либо восьми, каких-либо девяти, каких-либо десяти, каких-либо одиннадцати, каких-либо двенадцати ИФН I типа подтипов ИФНα. Если антитело специфично для более чем одного подтипа ИФН I типа, антитело может быть специфичным в отношении ИФНα1, ИФНα2, ИФНα4, ИФНα5, ИФНα8, ИФНα10 и ИФНα21, или оно может быть специфическим в отношении ИФНα1, ИФНα2, ИФНα4, ИФНα5, ИФНα8 или ИФНα10, или оно может быть специфическим в отношении ИФНα1, ИФНα2, ИФНα4, ИФНα5, ИФНα8 и ИФНα21, или оно может быть специфическим в отношении ИФНα1, ИФНα2, ИФНα4, ИФНα5, ИФНα10 и ИФНα21. Антитела, специфичные в отношении ИФН I типа или ИФНα включают антитело MEDI-545, какой-либо биопрепарат или антитело, отличное от MEDI-545, антитела, описанные в US 11/009410 и 11/157494, 9F3 и другие антитела, описанные в US 7087726 (пример 1 и пример 2, антитела, приведенные в табл.3 и табл.4, и/или антитела, описанные в табл., озаглавленной «Deposit of Material» в строках 25-54, колонка 56), NK-2 и YOK5/19 (WO 84/03105), LO-22 (US 4902618), 144 BS (US 4885166), и EBI-1, EBI-2, и EBI-3 (EP 119476). Терапевтический агент, который модулирует действие ИФНα, может нейтрализовать действие ИФНα. Специалистам в данной области известны препараты и составы таких биологических агентов и способов их введения.

Антитело может быть синтетическим антителом, моноклональным антителом, поликлональными антителами, рекомбинантно формируемым антителом, внутриклеточным антителом, полиспецифическим антителом (включая биспецифические антитела), антителом человека, гуманизированным антителом, химерным антителом, одноцепочечным (single-chain Fv - scFv) (включая биспецифическое одноцепочечное антитело - scFv), молекулой BiTE, одноцепочечным антителом, фрагментами Fab, фрагментом F(ab′), дисульфид-связанным фрагментом Fv (disulfide-linked Fv - sdFv), или эпитоп-связывающим фрагментом какого-либо из указанных выше антител. Антитело может быть какой-либо иммуноглобулиновой молекулой или иммунологически активной частью молекулы иммуноглобулина. Кроме того, антитело может относиться к какому-либо изотипу. Например, это может быть какой-либо из изотипов IgG1, IgG2, IgG3 или IgG4. Антитело может быть антителом полной длины, включающим вариабельные и константные области, или их антигенсвязывающий фрагмент, например, одноцепочечное антитело, или Fab, или Fab′2 фрагмент. Антитело также может быть конъюгировано или связано с терапевтическим агентом, например цитотоксином или радиоактивным изотопом.

В способах лечения второй агент, отличный от агента, который связывается, чтобы модулировать действие ИФНα, может быть введен пациенту. Ко вторым агентам относятся, но ими не ограничиваются, нестероидные противовоспалительные лекарственные средства, например ибупрофен, напрофен, сулиндак, диклофенак, пироксикам, кетопрофен, дифлунисал, набуметон, этодолак и оксапрозин, индометацин; противомалярийные средства, например гидроксихлороцин; кортикостероидные гормоны, например преднизон, гидрокортизон, метилпреднизолон и дексаметазон; метотрексат; иммуносупрессирующие агенты, например азатиоприн и циклофосфамид; и биологические агенты, которые, например, нацеливают Т-клетки, например алефацепт и эфализумаб, или нацеливают ФНОα, например, энбрель, ремикейд и хумира.

Лечение агентом может привести к нейтрализации профиля, индуцируемого ИФН I типа или ИФНα. Лечение агентом может привести к снижению проявления одного или нескольких симптомов заболевания или расстройства, опосредованных ИФН I типа или ИФНα. Лечение агентом может привести к более слабым вспышкам, связанным с заболеванием или расстройством, опосредованным ИФН I типа или ИФНα. Лечение агентом может привести к улучшенному прогнозу для пациента, у которого имеется заболевание или расстройство, опосредованное ИФН I типа или ИФНα. Лечение агентом может привести к улучшенному качеству жизни пациента. Лечение агентом может облегчить потребность в одновременном введении вторых агентов или может понизить дозу введения второго агента пациенту. Лечение агентом может уменьшить число госпитализаций пациентов, которые связаны с заболеванием или расстройством, опосредованным ИФН I типа или ИФНα.

Агент, который связывает и модулирует действие ИФН I типа или ИФНα, может нейтрализовать профиль, индуцируемый ИФН I типа или ИФНα. Нейтрализация профиля, индуцируемого ИФН I типа или ИФНα, может быть уменьшена на по меньшей мере один, по меньшей мере два, по меньшей мере три, по меньшей мере пять, по меньшей мере семь, по меньшей мере восемь, по меньшей мере десять, по меньшей мере двенадцать, по меньшей мере пятнадцать, по меньшей мере двадцать, по меньшей мере двадцать пять, по меньшей мере тридцать, по меньшей мере тридцать пять, по меньшей мере сорок, по меньшей мере сорок пять, или по меньшей мере пятьдесят генов, регуляция которых повышена ИФН I типа или ИФНα. Гены, у которых повышена регуляция ИФН I типа или ИФНα, могут быть какой-либо группой генов из табл.19, 20, 21, 22, 23, 24, 26, 28 или 30 согласно указанному выше. Нейтрализация ИФН I типа или ИФНα индуцируемого профиля является снижением по меньшей мере на 2%, по меньшей мере на 3%, по меньшей мере на 4%, по меньшей мере на 5%, по меньшей мере на 7%, по меньшей мере на 8%, по меньшей мере на 10%, по меньшей мере на 15%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 35%, по меньшей мере на 40%, по меньшей мере на 45%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, или по меньшей мере на 90% какого-либопо меньшей мере одного, по меньшей мере двух, по меньшей мере трех, по меньшей мере пяти, по меньшей мере семи, по меньшей мере восьми, по меньшей мере десяти, по меньшей мере двенадцати, по меньшей мере пятнадцати, по меньшей мере двадцати, по меньшей мере двадцати пяти, по меньшей мере тридцати, по меньшей мере тридцати пяти, по меньшей мере сорока, по меньшей мере сока пяти, или по меньшей мере, пятидесяти генов, регуляция которых повышена в каком-либо ИФН I типа или ИФНα-индуцируемом профиле. В другом варианте нейтрализация ИФН I типа или ИФНα-индуцируемом профиле относится к снижению экспрессии ИФН I типа или ИФНα-индуцируемых генов с повышенной регуляцией, которые составляют не более чем 50%, не более чем 45%, не более чем 40%, не более чем 35%, не более чем 30%, не более чем 25%, не более чем 20%, не более чем 15%, не более чем 10%, не более чем 5%, не более чем 4%, не более чем 3%, не более чем 2%, не более чем 1% от уровней экспрессии соответствующих ИФН I типа или ИФНα-индуцируемых генов в контрольном образце. Если агент, который связывается и модулирует действие ИФН I типа или ИФНα является биологическим агентом, например антителом, агент может нейтрализовать ИФН I типа или ИФНα профиль в дозах 0,3-30 мг/кг, 0,3-10 мг/кг, 0,3-3 мг/кг, 0,3-1 мг/кг, 1-30 мг/кг, 3-30 мг/кг, 5-30 мг/кг, 10-30 мг/кг, 1-10 мг/кг, 3-10 мг/кг или 1-5 мг/кг.

Нейтрализация ИФН I типа или ИФНα-индуцируемого профиля может быть повышенной экспрессией по меньшей мере одного, по меньшей мере двух, по меньшей мере трех, по меньшей мере пяти, по меньшей мере семи, по меньшей мере восьми, по меньшей мере десяти, по меньшей мере двенадцати, по меньшей мере пятнадцати, по меньшей мере двадцати, по меньшей мере двадцати пяти, по меньшей мере тридцати, по меньшей мере тридцати пяти, по меньшей мере сорока, по меньшей мере сорока пяти, или по меньшей мере пятидесяти генов, экспрессия которых снижается под действием ИФН I типа или ИФНα. Гены, экспрессия которых снижается под действием ИФН I типа или ИФНα, может быть какой-либо группой генов из табл.30. Нейтрализацией генов с пониженной регуляцией в ИФН I типа или ИФНα-индуцируемом профиле является повышение по меньшей мере на 2%, по меньшей мере на 3%, по меньшей мере на 4%, по меньшей мере на 5%, по меньшей мере на 7%, по меньшей мере на 8%, по меньшей мере на 10%, по меньшей мере на 15%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 35%, по меньшей мере на 40%, по меньшей мере на 45%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, или по меньшей мере на 90%, или по меньшей мере на 100%, или по меньшей мере на 125%, или по меньшей мере на 130%, или по меньшей мере на 140%, или по меньшей мере на 150%, или по меньшей мере на 175%, или по меньшей мере на 200%, или по меньшей мере на 250%, или по меньшей мере на 300%, или по меньшей мере на 500% каких-либо по меньшей мере одного, по меньшей мере двух, по меньшей мере трех, по меньшей мере пяти, по меньшей мере семи, по меньшей мере восьми, по меньшей мере десяти, по меньшей мере двенадцати, по меньшей мере пятнадцати, по меньшей мере двадцати, или по меньшей мере двадцат пяти генов, регуляция экспрессии которых понижается в каком-либо в ИФН I типа или ИФНα-индуцируемом профиле. В другом варианте нейтрализация ИФН I типа или ИФНα-индуцируемого профиля относится к повышению экспрессии ИФН I типа или ИФНα-индуцируемых генов, которые составляют не более чем 50%, не более чем 45%, не более чем 40%, не более чем 35%, не более чем 30%, не более чем 25%, не более чем 20%, не более чем 15%, не более чем 10%, не более чем 5%, не более чем 4%, не более чем 3%, не более чем 2%, не более чем 1% от уровней экспрессии соответствующих ИФН I типа или ИФНα-индуцируемых генов (с пониженной регуляцией) в контрольном образце. Если агент, который связывает и модулирует ИФН I типа или ИФНα действие, является биологическим агентом, например, антителом, агент может нейтрализовать ИФН I типа или ИФНα профиль в дозах 0,3-30 мг/кг, 0,3-10 мг/кг, 0,3-3 мг/кг, 0,3-1 мг/кг, 1-30 мг/кг, 3-30 мг/кг, 5-30 мг/кг, 10-30 мг/кг, 1-10 мг/кг, 3-10 мг/кг или 1-5 мг/кг.

Агент, который связывает и модулирует действие ИФН I типа или ИФНα, может дополнительно или в другом варианте нейтрализовать экспрессию одного или нескольких ИФН I типа или ИФНα подтипов. Подтипы ИФН I типа или ИФНα могут включать более одного, более двух, более трех, более четырех, более пяти, более шести, более семи, более восьми, более девяти или более десяти подтипов ИФН I типа или ИФНα. К указанным подтипам могут относиться ИФНα1, ИФНα2, ИФНα4, ИФНα5, ИФНα6, ИФНα7, ИФНα8, ИФНα10, ИФНα14, ИФНα17, ИФНα21, ИФНβ или ИФНω. К этим подтипам могут относиться все из числа ИФНα1, ИФНα2, ИФНα8 и ИФНα14. В другом варианте все подтипы могут включать ИФНα1, ИФНα2, ИФНα4, ИФНα5, ИФНα8, ИФНα10, ИФНα21. Нейтрализация ИФН I типа или ИФНα подтипов может представлять снижение по меньшей мере 2%, по меньшей мере 3%, по меньшей мере 4%, по меньшей мере 5%, по меньшей мере 7%, по меньшей мере 8%, по меньшей мере 10%, по меньшей мере 15%, по меньшей мере 25%, по меньшей мере 30%, по меньшей мере 35%, по меньшей мере 40%, по меньшей мере 45%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, или по меньшей мере 90% какого-либо по меньшей мере одного, по меньшей мере двух, по меньшей мере трех, по меньшей мере пяти, по меньшей мере семи, по меньшей мере восьми, или по меньшей мере десяти подтипов. Нейтрализация ИФН I типа или ИФНα подтипов может быть снижением экспрессии генов ИФН I типа или ИФНα подтипов, которые составляют не более чем 50%, не более чем 45%, не более чем 40%, не более чем 35%, не более чем 30%, не более чем 25%, не более чем 20%, не более чем 15%, не более чем 10%, не более чем 5%, не более чем 4%, не более чем 3%, не более чем 2%, не более чем 1% от уровней экспрессии соответствующих ИФН I типа или ИФНα подтипов в контрольном образце. Если агент, который связывает и модулирует ИФН I типа или ИФНα действие, является биологическим агентом, например, антителом, агент может нейтрализовать ИФН I типа или ИФНα подтипы в дозах 0,3-30 мг/кг, 0,3-10 мг/кг, 0,3-3 мг/кг, 0,3-1 мг/кг, 1-30 мг/кг, 3-30 мг/кг, 5-30 мг/кг, 10-30 мг/кг, 1-10 мг/кг, 3-10 мг/кг или 1-5 мг/кг.

Агент, который связывает и модулирует ИФН I типа или ИФНα действие может дополнительно или в другом варианте, нейтрализовать экспрессию ИФНα рецепторов, или ИФНAR1, или ИФНAR2, или обоих, или ФНОα, или ИФНγ, или ИФНγ рецепторов (любой из ИФНGR1, ИФНGR2, или оба - ИФНGR1 и ИФНGR2). Нейтрализация экспрессии ИФНα рецепторов, или ИФНAR1, или ИФНAR2, или обоих, или ФНОα, или ИФНγ, или ИФНγ рецепторов (ИФНGR1 или ИФНGR2, или и ИФНGR1, и ИФНGR2) может быть уменьшена на по меньшей мере 2%, по меньшей мере 3%, по меньшей мере 4%, по меньшей мере 5%, по меньшей мере 7%, по меньшей мере 8%, по меньшей мере 10%, по меньшей мере 15%, по меньшей мере 25%, по меньшей мере 30%, по меньшей мере 35%, по меньшей мере 40%, по меньшей мере 45%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, или по меньшей мере 90% какого-либо по меньшей мере одного, по меньшей мере двух, по меньшей мере трех, по меньшей мере пяти, или по меньшей мере шести указанных генов. Нейтрализация экспрессии ИФНα рецепторов, или ИФНAR1, или ИФНAR2, или ФНОα, или ИФНγ, или ИФНγ рецепторов (ИФНGR1 или ИФНGR2, или и ИФНGR1, и ИФНGR2) является снижением экспрессии по меньшей мере 50%, по меньшей мере 45%, по меньшей мере 40%, по меньшей мере 35%, по меньшей мере 30%, по меньшей мере 25%, по меньшей мере 20%, по меньшей мере 15%, по меньшей мере 10%, по меньшей мере 5%, по меньшей мере 4%, по меньшей мере 3%, по меньшей мере 2%, или по меньшей мере 1% от уровней экспрессии этих генов в контрольном образце. Если агент, связывающий и модулирующий действие ИФН I типа или ИФНα, является биологическим агентом, например антителом, агент может нейтрализовать экспрессию ИФНα рецепторов ИФНAR1 или ИФНAR2, или ФНОα, или ИФНγ, или ИФНγ рецепторов ИФНGR1 или ИФНGR2 в дозах 0,3-30 мг/кг, 0,3-10 мг/кг, 0,3-3 мг/кг, 0,3-1 мг/кг, 1-30 мг/кг, 3-30 мг/кг, 5-30 мг/кг, 10-30 мг/кг, 1-10 мг/кг, 3-10 мг/кг или 1-5 мг/кг.

Агент, который связывает и модулирует действие ИФН I типа или ИФНα, может дополнительно или в другом варианте нейтрализовать изменения уровней белков в сыворотке, например повысить уровни тех белков, регуляция уровней которых в сыворотке повышена до уровней, близких к уровням контрольных субъектов. Нейтрализация экспрессии белков в сыворотке, например, адипонектина, альфа-фетопротеина, аполипопротеина CIII, бета-2 микроглобулина, ракового антигена 125, ракового антигена 19-9, эотаксина, FABP, фактора VII, ферритина, ИЛ-10, ИЛ-12p70, ИЛ-16, ИЛ-18, ИЛ-1ra, ИЛ-3, МСР-1, ММР-3, миоглобина, SGOT, тканевого фактора, TIMP-1, ФНО RII, ФНО-альфа, VCAM-1, vWF, BDNK, комплемента 3, CD40 лиганда, EGF, ENA-78, EN- RAGE, IGF-1, MDC, миелопироксидазы, RANTES или тромбипоэтина, может быть осуществлена путем выработки уровня по меньшей мере одного, по меньшей мере двух, по меньшей мере трех, по меньшей мере пяти, по меньшей мере шести, по меньшей мере семи, по меньшей мере восьми, по меньшей мере девяти, по меньшей мере десяти, по меньшей мере двенадцати, по меньшей мере пятнадцати, по меньшей мере двадцати, или по меньшей мере, 25 указанных белков, в пределах по меньшей мере 2%, по меньшей мере 3%, по меньшей мере 4%, по меньшей мере 5%, по меньшей мере 7%, по меньшей мере 8%, по меньшей мере 10%, по меньшей мере 15%, по меньшей мере 25%, по меньшей мере 30%, по меньшей мере 35%, по меньшей мере 40%, по меньшей мере 45%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, или по меньшей мере 90% уровней белка в сыворотке здорового субъекта. Если агент, который связывается и модулирует ИФН I типа или ИФНα действие, является биологическим агентом, например антителом, агент может нейтрализовать уровни белков в сыворотке, например адипонектина, альфа-фетопротеина, аполипопротеина CIII, бета-2 микроглобулина, ракового антигена 125, ракового антигена 19-9, эотаксина, FABP, фактора VII, ферритина, ИЛ-10, ИЛ-12p70, ИЛ-16, ИЛ-18, ИЛ-1ra, ИЛ-3, МСР-1, ММР-3, миоглобина, SGOT, тканевого фактора, TIMP-1, ФНО RII, ФНО-альфа, VCAM-1, vWF, BDNK, комплемента 3, CD40 лиганда, EGF, ENA-78, ENRAGE, IGF-1, MDC, миелопироксидазы, RANTES или тромбипоэтина, в дозах 0,3-30 мг/кг, 0,3-10 мг/кг, 0,3-3 мг/кг, 0,3-1 мг/кг, 1-30 мг/кг, 3-30 мг/кг, 5-30 мг/кг, 10-30 мг/кг, 1-10 мг/кг, 3-10 мг/кг или 1-5 мг/кг.

Агент, который связывает и модулирует ИФН I типа или ИФНα действие, может дополнительно или в другом варианте снижать число или уровень аутоантител, которые связываются с каким-либо одним, какими-либо по меньшей мере 2, какими-либо по меньшей мере 3, какими-либо по меньшей мере 4, какими-либо по меньшей мере 5, какими-либо по меньшей мере 6, какими-либо по меньшей мере 7, какими-либо по меньшей мере 8, какими-либо по меньшей мере 9, какими-либо по меньшей мере 10, какими-либо по меньшей мере 15, или какими-либо по меньшей мере 20 из следующих аутоантигенов: (а) интерферон-индуцируемым белком p78 миксовирусной (вируса гриппа) устойчивости 1; (б) surfeit 5, транскриптным вариантом c; (в) протеасомой (посомой, мультикаталитической протеазой) активаторной субъединицей 3 (РА28 гамма; Ki) транс c; (г) альфа рецептором ретиноевой кислоты; (д) белком теплового шока 10 кДа 1 (шаперонин 10); (е) тропомиозином 3; (ж) доменом, родственным гомологу плекстрина, семейство А, представитель 1; (з) цитоскелет-ассоциированным белком 1; (и) антигеном А2 синдрома Шегрена (60 кДа, рибонуклеопротеиновый ауто-антиген SS-A/Ro); (к) NADH дегидрогеназой (убихинон) 1, альфа/бета субкомплекс 1, 8 кДа; (л) гомологом 1 гена ядерного распределения (NudE - nuclear distribution gene Е) (A. nidulans); (м) MutL гомологом 1, рак толстой кишки, неполипозный, 2 типа (Е. coli); (н) обогащенным лейцином повтором (в FLII) взаимодействующим белком 2; (о) тропомиозином 1 (альфа); (п) спастическая нижняя параплегия 20, спартином (синдром Тройера); (р) предимплантационным белком, вариантом транскрипта 1; (с) митохондриальным рибосомальным белком L45; (т) гомологом Lin-28 (С. elegans); (у) белком теплового шока 1, массой 90 кДа, альфа; (ф) dom-3 гомологом Z (С. elegans); (x) динеином, цитоплазматическим, легким промежуточным полипептидом 2; (ц) Ras-родственным субстратом 1 токсина C3 ботулизма (rho семейство, низкомолекулярный GTP связывающий белок); (ч) синовиальной саркомы, X контрольная точка 2, вариантом транскрипта 2; (ш) моезином; (щ) гомологом упаковочного вектора (Drosophila), вариантом транскрипта 1; (э) GCN5 (тип 2 общего контроля аминокислотного синтеза 5 (дрожжи); (ю) эукариотического фактора элонгации трансляции 1, гамма; (я) эукариотического фактора элонгации трансляции 1, дельта; (аа) ДНК-повреждение-индуцирующий транскрипт 3; (бб) ССААТ/энхансер связывающим белком (С/ЕВР) гамма; и каким-либо другим аутоантигеном, описанным в предварительной заявке, озаглавленной «Auto-antibody markers of autoimmune disease», поданной 3 мая 2007 г., или в предварительной заявке, озаглавленной «Auto-antibody markers of autoimmune disease», поданной 6 ноября 2007 г. (например, описанные в табл.2, 4, 5 и 9). Снижение уровня аутоантитела может составлять по меньшей мере 2%, по меньшей мере 3%, по меньшей мере 4%, по меньшей мере 5%, по меньшей мере 7%, по меньшей мере 8%, по меньшей мере 10%, по меньшей мере 15%, по меньшей мере 25%, по меньшей мере 30%, по меньшей мере 35%, по меньшей мере 40%, по меньшей мере 45%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, или по меньшей мере, 90% в присутствии какого-либо из аутоантител. Если агент, который связывает и модулирует действие ИФН I типа или ИФНα, является биологическим агентом, например антителом, агент может понизить число или уровень аутоантител в дозах 0,3-30 мг/кг, 0,3-10 мг/кг, 0,3-3 мг/кг, 0,3-1 мг/кг, 1-30 мг/кг, 3-30 мг/кг, 5-30 мг/кг, 10-30 мг/кг, 1-10 мг/кг, 3-10 мг/кг или 1-5 мг/кг.

Агент, связывающий и модулирующий действие ИФН I типа или ИФНα, не может нейтрализовать экспрессию генов, которые не включены в интерферон-индуцируемую подпись или профиль ФД маркеров.

Образцы также могут быть получены от пациентов в способах настоящего изобретения. К образцам относятся какие-либо биологические жидкости или ткани, например цельная кровь, слюна, моча, синовиальная жидкость, костный мозг, цереброспинальная жидкость, выделения из носа, мокрота, амниотическая жидкость, жидкость бронхоальвеолярного лаважа, мононуклеарные клетки периферической крови (МКПК), лейкоциты, клетки лимфоузлов, клетки селезенки или кожа. Образцы могут быть получены какими-либо способами, известными в данной области.

Профили экспрессии ФД маркеров, индуцированных ИФН I типа- или ИФНα, могут включать экспрессию или действие с повышенной регуляцией генов в клетках, в которых могут быть повышены уровни ИФНα относительно исходного уровня. Повышенная регуляция экспрессии или действия генов включает повышение экспрессии иРНК с гена, повышение экспрессии белка, кодируемого геном, или повышение действия белка, кодируемого геном. Может быть повышена экспрессия или действие генов в качестве прямого или непрямого ответа на ИФНα.

Повышенной регуляции экспрессия или действие какого-либо гена, выявленного в образце зондами или зондами в наборах в профиле экспрессии ФД маркеров, индуцированных ИФНα, могут быть по меньшей мере в 1,2 раза, по меньшей мере в 1,25 раза, по меньшей мере в 1,3 раза, по меньшей мере в 1,4 раза, по меньшей мере в 1,5 раза, по меньшей мере в 2,0 раза, по меньшей мере в 2,25 раза, по меньшей мере в 2,5 раза, по меньшей мере в 2,75 раза, по меньшей мере в 3,0 раза, по меньшей мере в 3,5 раза, по меньшей мере в 4,0 раза, по меньшей мере в 4,5 раза, по меньшей мере в 5,0 раз, по меньшей мере в 6,0 раз, по меньшей мере в 7,0 раз, по меньшей мере в 8,0 раз, по меньшей мере в 9,0 раз, по меньшей мере в 10,0 раз, по меньшей мере в 15,0 раз, по меньшей мере в 20,0 раз, по меньшей мере в 25,0 раз, или по меньшей мере в 50,0 раз больше относительно исходных уровней контрольных клеток, например клеток здоровых волонтеров, или клеток контрольных животных, или клеток, не подвергшихся воздействию ИФНα в культуре. Все гены в профиле экспрессии ФД маркеров, индуцированных ИФНα, могут обладать повышенной регуляцией экспрессии или действия в той же степени увеличения. В другом варианте гены в профиле экспрессии ФД маркерв могут иметь варьирующие уровни повышенной регуляции экспрессии или действия.

Пониженной регуляции экспрессия или действие какого-либо гена, выявленного в образце зондами или зондами в наборах в профиле экспрессии ФД маркеров, индуцированных ИФНα, могут составлять по меньшей мере 5%, по меньшей мере 10%, по меньшей мере 15%, по меньшей мере 20%, по меньшей мере 25%, по меньшей мере 30%, по меньшей мере 35%, по меньшей мере 40%, по меньшей мере 45%, по меньшей мере 50%, по меньшей мере 55%, по меньшей мере 60%, по меньшей мере 65%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98%, или по меньшей мере 99% относительно исходных уровней контрольных клеток, например клеток здоровых добровольцев, или клеток контрольных животных, или клеток, не подвергшихся воздействию ИФНα в культуре. Все гены в профиле экспрессии ФД маркеров, индуцированных ИФНα, могут иметь пониженной регуляции экспрессию или действие в той же степени снижения. В другом варианте гены в профиле экспрессии ФД маркера могут иметь варьирующие уровни пониженной регуляции экспрессии или действия.

Число генов, участвующих в профиле экспрессии ФД маркеров, индуцированных ИФНα, может составлять, меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 10, по меньшей мере 20, по меньшей мере 25, по меньшей мере 30, по меньшей мере 50, по меньшей мере 75, по меньшей мере 100, по меньшей мере 150, по меньшей мере 200, по меньшей мере 250, по меньшей мере 300, по меньшей мере 400, по меньшей мере 500, по меньшей мере 750, по меньшей мере 1000, по меньшей мере 1500, по меньшей мере 2000, по меньшей мере 2500, по меньшей мере 5000, по меньшей мере 10000, или по меньшей мере 15000 генов. К этим генам могут относиться гены, перечисленные в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30, и/или 31, и/или какие-либо гены, идентифицированные на фиг.72, 74, 75 или 77. К генам, включенным в профиль экспрессии ФД маркеров, индуцированных ИФНα, могут относиться гены повышенной регуляции, гены пониженной регуляции или комбинация генов с повышенной и пониженной регуляцией.

К генам, включенным в профиль экспрессии ФД маркеров, индуцированных ИФНα, могут относиться гены, представленные в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30, и/или 31, и/или какие-либо гены, идентифицированные на фиг.72, 74, 75 или 77. Гены, включенные в профиль экспрессии ФД маркеров, индуцируемых ИФНα, могут состоять или включать по меньшей мере 10%, по меньшей мере 20%, по меньшей мере 25%, по меньшей мере 30%, по меньшей мере 40%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 95%, или по меньшей мере 100% генов, представленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30, и/или 31, и/или какие-либо гены, идентифицированные на фиг.72, 74, 75 или 77.

ФД маркеров, индуцируемых ИФНα, профиле экспрессии могут включать какие-либо по меньшей мере 5 генов, например: МХ1, LLY6E, IFI27, OAS1, IFIT1; или МХ1, LLY6E, IFI27, OAS1, IFI6; или МХ1, LLY6E, IFI27, OAS1, IFI44L; или МХ1, LLY6E, IFI27, OAS1, ISG15; или МХ1, LLY6E, IFI27, OAS1, LAMP3; или МХ1, LLY6E, IFI27, OAS1, OASL; или МХ1, LLY6E, IFI27, OAS1, RSAD2; или МХ1, LLY6E, IFI27, OAS1, IFI44; или МХ1, LLY6E, IFI27, OAS1, IFIT2; или МХ1, LLY6E, IFI27, OAS1, OAS3; или МХ1, LLY6E, IFI27, OAS1, USP18; или МХ1, LLY6E, IFI27, OAS1, SIGLEC1; или МХ1, LLY6E, IFI27, OAS1, HERC5; или МХ1, LLY6E, IFI27, OAS1, DNAPTP6; или МХ1, LLY6E, IFI27, OAS1, LOC129607; или МХ1, LLY6E, IFI27, OAS1, EPSTI1; или МХ1, LLY6E, IFI27, OAS1, BIRC4BP; или МХ1, LLY6E, IFI27, OAS1, SIGLEC1; или МХ1, LLY6E, IFI27, OAS1, ген, выявленный зондом 229450_at; или МХ1, LLY6E, IFI27, OAS1, ген, выявленный зондом 235276_at; или LLY6E, IFI27, OAS1, IFIT1, IFI6; или LLY6E, IFI27, OAS1, IFIT1, IFI44L; или LLY6E, IFI27, OAS1, IFIT1, ISG15; или LLY6E, IFI27, OAS1, IFIT1, LAMP3; или LLY6E, IFI27, OAS1, IFIT1, OASL; или LLY6E, IFI27, OAS1, IFIT1, RSAD2; или LLY6E, IFI27, OAS1, IFIT1, IFI44; или LLY6E, IFI27, OAS1, IFIT1, IFIT2; или LLY6E, IFI27, OAS1, IFIT1, OAS3; или LLY6E, IFI27, OAS1, IFIT1, USP18; или LLY6E, IFI27, OAS1, IFIT1, SIGLEC1; или LLY6E, IFI27, OAS1, IFIT1, HERC5; или LLY6E, IFI27, OAS1, IFIT1, DNAPTP6; или LLY6E, IFI27, OAS1, IFIT1, LOC129607; или LLY6E, IFI27, OAS1, IFIT1, EPSTI1; или LLY6E, IFI27, OAS1, IFIT1, BIRC4BP; или LLY6E, IFI27, OAS1, IFIT1, SIGLEC1; или LLY6E, IFI27, OAS1, IFIT1, ген, выявленный зондом 229450_at; или LLY6E, IFI27, OAS1, IFIT1, ген, выявленный зондом 235276_at; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15; или IFI27, OAS1, IFIT1, IFI6, LAMP3; или IFI27, OAS1, IFIT1, IFI6, OASL; или IFI27, OAS1, IFIT1, IFI6, RSAD2; или IFI27, OAS1, IFIT1, IFI6, IFI44; или IFI27, OAS1, IFIT1, IFI6, IFIT2; или IFI27, OAS1, IFIT1, IFI6, OAS3; или IFI27, OAS1, IFIT1, IFI6, USP18; или IFI27, OAS1, IFIT1, IFI6, SIGLEC1; или IFI27, OAS1, IFIT1, IFI6, HERC5; или IFI27, OAS1, IFIT1, IFI6, DNAPTP6; или IFI27, OAS1, IFIT1, IFI6, LOC129607; или IFI27, OAS1, IFIT1, IFI6, EPSTI1; или IFI27, OAS1, IFIT1, IFI6, BIRC4BP; или IFI27, OAS1, IFIT1, IFI6, SIGLEC1; или IFI27, OAS1, IFIT1, IFI6, ген, выявленный зондом 229450_at; или IFI27, OAS1, IFIT1, IFI6, ген, выявленный зондом 235276_at; или OAS1, IFIT1, IFI6, IFI44L, ISG15; или OAS1, IFIT1, IFI6, IFI44L, LAMP3; или OAS1, IFIT1, IFI6, IFI44L, OASL; или OAS1, IFIT1, IFI6, IFI44L, RSAD2; или OAS1, IFIT1, IFI6, IFI44L, IFI44; или OAS1, IFIT1, IFI6, IFI44L, IFIT2; или OAS1, IFIT1, IFI6, IFI44L, OAS3; или OAS1, IFIT1, IFI6, IFI44L, USP18; или OAS1, IFIT1, IFI6, IFI44L, SIGLEC1; или OAS1, IFIT1, IFI6, IFI44L, HERC5; или OAS1, IFIT1, IFI6, IFI44L, DNAPTP6; или OAS1, IFIT1, IFI6, IFI44L, LOC129607; или OAS1, IFIT1, IFI6, IFI44L, EPSTI1; или OAS1, IFIT1, IFI6, IFI44L, BIRC4BP; или OAS1, IFIT1, IFI6, IFI44L, SIGLEC1; или OAS1, IFIT1, IFI6, IFI44L, ген, выявленный зондом 229450_at; или OAS1, IFIT1, IFI6, IFI44L, ген, выявленный зондом 235276_at; или IFIT1, IFI6, IFI44L, ISG15, LAMP3; или IFIT1, IFI6, IFI44L, ISG15, OASL; или IFIT1, IFI6, IFI44L, ISG15, RSAD2; или IFIT1, IFI6, IFI44L, ISG15, IFI44; или IFIT1, IFI6, IFI44L, ISG15, IFIT2 или IFIT1, IFI6, IFI44L, ISG15, OAS3; или IFIT1, IFI6, IFI44L, ISG15, USP18; или IFIT1, IFI6, IFI44L, ISG15, SIGLEC1; или IFIT1, IFI6, IFI44L, ISG15, HERC5; или IFIT1, IFI6, IFI44L, ISG15, DNAPTP6; или IFIT1, IFI6, IFI44L, ISG15, LOC129607; или IFIT1, IFI6, IFI44L, ISG15, EPSTI1; или IFIT1, IFI6, IFI44L, ISG15, BIRC4BP; или IFIT1, IFI6, IFI44L, ISG15, ген, выявленный зондом 229450_at; или IFIT1, IFI6, IFI44L, ISG15, ген, выявленный зондом 235276_at; или IFI6, IFI44L, ISG15, LAMP3, HERC5; или IFI6, IFI44L, ISG15, LAMP3, DNAPTP6; или IFI6, IFI44L, ISG15, LAMP3, LOC129607; или IFI6, IFI44L, ISG15, LAMP3, EPSTI1; или IFI6, IFI44L, ISG15, LAMP3, BIRC4BP; или IFI6, IFI44L, ISG15, LAMP3, ген, выявленный зондом 229450_at; или IFI6, IFI44L, ISG15, LAMP3, ген, выявленный зондом 235276_at; или IFI6, IFI44L, ISG15, LAMP3, SIGLEC1; или IFI6, IFI44L, ISG15, LAMP3, USP18; или IFI6, IFI44L, ISG15, LAMP3, OAS3; или IFI6, IFI44L, ISG15, LAMP3, IFIT2; или IFI6, IFI44L, ISG15, LAMP3, IFI44; или IFI6, IFI44L, ISG15, LAMP3, RSAD2; или IFI6, IFI44L, ISG15, LAMP3, OASL; или IFI44L, ISG15, LAMP3, OASL, RSAD2; или IFI44L, ISG15, LAMP3, OASL, IFI44; или IFI44L, ISG15, LAMP3, OASL, IFIT2; или IFI44L, ISG15, LAMP3, OASL, OAS3; или IFI44L, ISG15, LAMP3, OASL, USP18; или IFI44L, ISG15, LAMP3, OASL, SIGLEC1; или IFI44L, ISG15, LAMP3, OASL, HERC5; или IFI44L, ISG15, LAMP3, OASL, DNAPTP6; или IFI44L, ISG15, LAMP3, OASL, LOC129607; или IFI44L, ISG15, LAMP3, OASL, EPSTI1; or IFI44L, ISG15, LAMP3, OASL, BIRC4BP; или IFI44L, ISG15, LAMP3, OASL, ген, выявленный зондом 229450_at; или IFI44L, ISG15, LAMP3, OASL, ген, выявленный зондом 235276_at; или ISG15, LAMP3, OASL, RSAD2, IFI44; или ISG15, LAMP3, OASL, RSAD2, IFIT2; или ISG15, LAMP3, OASL, RSAD2, OAS3; или ISG15, LAMP3, OASL, RSAD2, USP18; или ISG15, LAMP3, OASL, RSAD2, SIGLEC1; или ISG15, LAMP3, OASL, RSAD2, HERC5; или ISG15, LAMP3, OASL, RSAD2, DNAPTP6; или ISG15, LAMP3, OASL, RSAD2, LOC129607; или ISG15, LAMP3, OASL, RSAD2, EPSTI1; или ISG15, LAMP3, OASL, RSAD2, BIRC4BP; или ISG15, LAMP3, OASL, RSAD2, ген, выявленный зондом 229450_at; или ISG15, LAMP3, OASL, RSAD2, ген, выявленный зондом 235276_at; или LAMP3, OASL, RSAD2, IFI44, IFIT2; или LAMP3, OASL, RSAD2, IFI44, OAS3; или LAMP3, OASL, RSAD2, IFI44, USP18; или LAMP3, OASL, RSAD2, IFI44, SIGLEC1; или LAMP3, OASL, RSAD2, IFI44, HERC5; или LAMP3, OASL, RSAD2, IFI44, DNAPTP6; или LAMP3, OASL, RSAD2, IFI44, LOC129607; или LAMP3, OASL, RSAD2, IFI44, EPSTI1; или LAMP3, OASL, RSAD2, IFI44, BIRC4BP; или LAMP3, OASL, RSAD2, IFI44, ген, выявленный зондом 229450_at; или LAMP3, OASL, RSAD2, IFI44, ген, выявленный зондом 235276_at; или OASL, RSAD2, IFI44, IFIT2, OAS3; или OASL, RSAD2, IFI44, IFIT2, USP18; или OASL, RSAD2, IFI44, IFIT2, SIGLEC1; или OASL, RSAD2, IFI44, IFIT2, HERC5; или OASL, RSAD2, IFI44, IFIT2, DNAPTP6; или OASL, RSAD2, IFI44, IFIT2, LOC129607; или OASL, RSAD2, IFI44, IFIT2, EPSTI1; или OASL, RSAD2, IFI44, IFIT2, BIRC4BP; или OASL, RSAD2, IFI44, IFIT2, ген, выявленный зондом 229450_at; или OASL, RSAD2, IFI44, IFIT2, ген, выявленный зондом 235276_at; или RSAD2, IFI44, IFIT2, OAS3, USP18; или RSAD2, IFI44, IFIT2, OAS3, SIGLEC1; или RSAD2, IFI44, IFIT2, OAS3, HERC5; или RSAD2, IFI44, IFIT2, OAS3, DNAPTP6; или RSAD2, IFI44, IFIT2, OAS3, LOC129607; или RSAD2, IFI44, IFIT2, OAS3, EPSTI1; или RSAD2, IFI44, IFIT2, OAS3, BIRC4BP; или RSAD2, IFI44, IFIT2, OAS3, ген, выявленный зондом 229450_at; или RSAD2, IFI44, IFIT2, OAS3, ген, выявленный зондом 235276_at; или IFI44, IFIT2, OAS3, USP18, SIGLEC1; или IFI44, IFIT2, OAS3, USP18, HERC5; или IFI44, IFIT2, OAS3, USP18, DNAPTP6; или IFI44, IFIT2, OAS3, USP18, LOC129607; или IFI44, IFIT2, OAS3, USP18, EPSTI1; или IFI44, IFIT2, OAS3, USP18, BIRC4BP; или IFI44, IFIT2, OAS3, USP18, ген, выявленный зондом 229450_at; или IFI44, IFIT2, OAS3, USP18, ген, выявленный зондом 235276_at; или IFIT2, OAS3, USP18, SIGLEC1, HERC5; или IFIT2, OAS3, USP18, SIGLEC1, DNAPTP6; или IFIT2, OAS3, USP18, SIGLEC1, LOC129607; или IFIT2, OAS3, USP18, SIGLEC1, EPSTI1; или IFIT2, OAS3, USP18, SIGLEC1, BIRC4BP; или IFIT2, OAS3, USP18, SIGLEC1, ген, выявленный зондом 229450_at; или IFIT2, OAS3, USP18, SIGLEC1, ген, выявленный зондом 235276_at; или OAS3, USP18, SIGLEC1, HERC5, DNAPTP6; или OAS3, USP18, SIGLEC1, HERC5, LOC129607; или OAS3, USP18, SIGLEC1, HERC5, EPSTI1; или OAS3, USP18, SIGLEC1, HERC5, BIRC4BP; или OAS3, USP18, SIGLEC1, HERC5, ген, выявленный зондом 229450_at; или OAS3, USP18, SIGLEC1, HERC5, ген, выявленный зондом 235276_at; или USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607; или USP18, SIGLEC1, HERC5, DNAPTP6, EPSTI1; или USP18, SIGLEC1, HERC5, DNAPTP6, BIRC4BP; или USP18, SIGLEC1, HERC5, DNAPTP6, ген, выявленный зондом 229450_at; или USP18, SIGLEC1, HERC5, DNAPTP6, ген, выявленный зондом 235276_at; или SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1; или SIGLEC1, HERC5, DNAPTP6, LOC129607, BIRC4BP; или SIGLEC1, HERC5, DNAPTP6, LOC129607, ген, выявленный зондом 229450_at; или SIGLEC1, HERC5, DNAPTP6, LOC129607, ген, выявленный зондом 235276_at; или HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP; или HERC5, DNAPTP6, LOC129607, EPSTI1, ген, выявленный зондом 229450_at; или HERC5, DNAPTP6, LOC129607, EPSTI1, ген, выявленный зондом 235276_at; или DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 229450_at; или DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 235276_at; или LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 229450_at, ген, выявленный зондом 235276_at. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии может также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ИФНα-индуцируемые ФД маркеры в профиле экспрессии могут включать какие-либо по меньшей мере 6 генов, например: МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI44L; или МХ1, LLY6E, IFI27, OAS1, IFIT1, ISG15; или МХ1, LLY6E, IFI27, OAS1, IFIT1, LAMP3; или МХ1, LLY6E, IFI27, OAS1, IFIT1, OASL; или МХ1, LLY6E, IFI27, OAS1, IFIT1, RSAD2; или МХ1, LLY6E, IPI27, OAS1, IFIT1, IFI44; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFIT2; или МХ1, LLY6E, IFI27, OAS1, IFIT1, OAS3; или МХ1, LLY6E, IFI27, OAS1, IFIT1, USP18; или МХ1, LLY6E, IFI27, OAS1, IFIT1, SIGLEC1; или МХ1, LLY6E, IFI27, OAS1, IFIT1, HERC5; или МХ1, LLY6E, IFI27, OAS1, IFIT1, DNAPTP6; или МХ1, LLY6E, IFI27, OAS1, IFIT1, LOC129607; или МХ1, LLY6E, IFI27, OAS1, IFIT1, EPSTI1; или МХ1, LLY6E, IFI27, OAS1, IFIT1, BIRC4BP; or МХ1, LLY6E, IFI27, OAS1, IFIT1, ген, выявленный зондом 229450_at; или МХ1, LLY6E, IFI27, OAS1, IFIT1, ген, выявленный зондом 235276_at; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L; или LLY6E, IFI27, OAS1, IFIT1, IFI6, ISG15; или LLY6E, IFI27, OAS1, IFIT1, IFI6, LAMP3; или LLY6E, IFI27, OAS1, IFIT1, IFI6, OASL; или LLY6E, IFI27, OAS1, IFIT1, IFI6, RSAD2; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFIT2; или LLY6E, IFI27, OAS1, IFIT1, IFI6, OAS3; или LLY6E, IFI27, OAS1, IFIT1, IFI6, USP18; или LLY6E, IFI27, OAS1, IFIT1, IFI6, SIGLEC1; или LLY6E, IFI27, OAS1, IFIT1, IFI6, HERC5; или LLY6E, IFI27, OAS1, IFIT1, IFI6, DNAPTP6; или LLY6E, IFI27, OAS1, IFIT1, IFI6, LOC129607; или LLY6E, IFI27, OAS1, IFIT1, IFI6, EPSTI1; или LLY6E, IFI27, OAS1, IFIT1, IFI6, BIRC4BP; или LLY6E, IFI27, OAS1, IFIT1, IFI6, ген, выявленный зондом 229450_at; или LLY6E, IFI27, OAS1, IFIT1, IFI6, ген, выявленный зондом 235276_at; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15; или IFI27, OAS1, IFIT1, IFI6, IFI44L, LAMP3; или IFI27, OAS1, IFIT1, IFI6, IFI44L, OASL; или IFI27, OAS1, IFIT1, IFI6, IFI44L, RSAD2; или IFI27, OAS1, IFIT1, IFI6, IFI44L, IFI44; или IFI27, OAS1, IFIT1, IFI6, IFI44L, IFIT2; или IFI27, OAS1, IFIT1, IFI6, IFI44L, OAS3; или IFI27, OAS1, IFIT1, IFI6, IFI44L, USP18; или IFI27, OAS1, IFIT1, IFI6, IFI44L, SIGLEC1; или IFI27, OAS1, IFIT1, IFI6, IFI44L, HERC5; или IFI27, OAS1, IFIT1, IFI6, IFI44L, DNAPTP6; или IFI27, OAS1, IFIT1, IFI6, IFI44L, LOC129607; или IFI27, OAS1, IFIT1, IFI6, IFI44L, EPSTI1; или IFI27, OAS1, IFIT1, IFI6, IFI44L, BIRC4BP; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ген, выявленный зондом 229450_at; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ген, выявленный зондом 235276_at; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3; или OAS1, IFIT1, IFI6, IFI44L, ISG15, OASL; или OAS1, IFIT1, IFI6, IFI44L, ISG15, RSAD2; или OAS1, IFIT1, IFI6, IFI44L, ISG15, IFI44; или OAS1, IFIT1, IFI6, IFI44L, ISG15, IFIT2; или OAS1, IFIT1, IFI6, IFI44L, ISG15, OAS3; или OAS1, IFIT1, IFI6, IFI44L, ISG15, USP18; или OAS1, IFIT1, IFI6, IFI44L, ISG15, SIGLEC1; или OAS1, IFIT1, IFI6, IFI44L, ISG15, HERC5; или OAS1, IFIT1, IFI6, IFI44L, ISG15, DNAPTP6; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LOC129607; или OAS1, IFIT1, IFI6, IFI44L, ISG15, EPSTI1; или OAS1, IFIT1, IFI6, IFI44L, ISG15, BIRC4BP; или OAS1, IFIT1, IFI6, IFI44L, ISG15, ген, выявленный зондом 229450_at; или OAS1, IFIT1, IFI6, IFI44L, ISG15, ген, выявленный зондом 235276_at; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, RSAD2; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, IFI44; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, IFIT2; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OAS3; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, USP18; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, SIGLEC1; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, HERC5; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, DNAPTP6; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, LOC129607; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, EPSTI1; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, BIRC4BP; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, ген, выявленный зондом 229450_at; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, ген, выявленный зондом 235276_at; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2; или IFI6, IFI44L, ISG15, LAMP3, OASL, IFI44; или IFI6, IFI44L, ISG15, LAMP3, OASL, IFIT2; или IFI6, IFI44L, ISG15, LAMP3, OASL, OAS3; или IFI6, IFI44L, ISG15, LAMP3, OASL, USP18; или IFI6, IFI44L, ISG15, LAMP3, OASL, SIGLEC1; или IFI6, IFI44L, ISG15, LAMP3, OASL, HERC5; или IFI6, IFI44L, ISG15, LAMP3, OASL, DNAPTP6; или IFI6, IFI44L, ISG15, LAMP3, OASL, LOC129607; или IFI6, IFI44L, ISG15, LAMP3, OASL, EPSTI1; или IFI6, IFI44L, ISG15, LAMP3, OASL, BIRC4BP; или IFI6, IFI44L, ISG15, LAMP3, OASL, ген, выявленный зондом 229450_at; или IFI6, IFI44L, ISG15, LAMP3, OASL, ген, выявленный зондом 235276_at; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFIT2; или IFI44L, ISG15, LAMP3, OASL, RSAD2, OAS3; или IFI44L, ISG15, LAMP3, OASL, RSAD2, USP18; или IFI44L, ISG15, LAMP3, OASL, RSAD2, SIGLEC1; или IFI44L, ISG15, LAMP3, OASL, RSAD2, HERC5; или IFI44L, ISG15, LAMP3, OASL, RSAD2, DNAPTP6; или IFI44L, ISG15, LAMP3, OASL, RSAD2, LOC129607; или IFI44L, ISG15, LAMP3, OASL, RSAD2, EPSTI1; или IFI44L, ISG15, LAMP3, OASL, RSAD2, BIRC4BP; или IFI44L, ISG15, LAMP3, OASL, RSAD2, ген, выявленный зондом 229450_at; или IFI44L, ISG15, LAMP3, OASL, RSAD2, ген, выявленный зондом 235276_at; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2; или ISG15, LAMP3, OASL, RSAD2, IFI44, OAS3; или ISG15, LAMP3, OASL, RSAD2, IFI44, USP18; или ISG15, LAMP3, OASL, RSAD2, IFI44, SIGLEC1; или ISG15, LAMP3, OASL, RSAD2, IFI44, HERC5; или ISG15, LAMP3, OASL, RSAD2, IFI44, DNAPTP6; или ISG15, LAMP3, OASL, RSAD2, IFI44, LOC129607; или ISG15, LAMP3, OASL, RSAD2, IFI44, EPSTI1; или ISG15, LAMP3, OASL, RSAD2, IFI44, BIRC4BP; или ISG15, LAMP3, OASL, RSAD2, IFI44, ген, выявленный зондом 229450_at; или ISG15, LAMP3, OASL, RSAD2, IFI44, ген, выявленный зондом 235276_at; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3; или LAMP3, OASL, RSAD2, IFI44, IFIT2, USP18; или LAMP3, OASL, RSAD2, IFI44, IFIT2, SIGLEC1; или LAMP3, OASL, RSAD2, IFI44, IFIT2, HERC5; или LAMP3, OASL, RSAD2, IFI44, IFIT2, DNAPTP6; или LAMP3, OASL, RSAD2, IFI44, IFIT2, LOC129607; или LAMP3, OASL, RSAD2, IFI44, IFIT2, EPSTI1; или LAMP3, OASL, RSAD2, IFI44, IFIT2, BIRC4BP; или LAMP3, OASL, RSAD2, IFI44, IFIT2, ген, выявленный зондом 229450_at; или LAMP3, OASL, RSAD2, IFI44, IFIT2, ген, выявленный зондом 235276_at; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18; или OASL, RSAD2, IFI44, IFIT2, OAS3, SIGLEC1; или OASL, RSAD2, IFI44, IFIT2, OAS3, HERC5; или OASL, RSAD2, IFI44, IFIT2, OAS3, DNAPTP6; или OASL, RSAD2, IFI44, IFIT2, OAS3, LOC129607; или OASL, RSAD2, IFI44, IFIT2, OAS3, EPSTI1; или OASL, RSAD2, IFI44, IFIT2, OAS3, BIRC4BP; или OASL, RSAD2, IFI44, IFIT2, OAS3, ген, выявленный зондом 229450_at; или OASL, RSAD2, IFI44, IFIT2, OAS3, ген, выявленный зондом 235276_at; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1; или RSAD2, IFI44, IFIT2, OAS3, USP18, HERC5; или RSAD2, IFI44, IFIT2, OAS3, USP18, DNAPTP6; или RSAD2, IFI44, IFIT2, OAS3, USP18, LOC129607; или RSAD2, IFI44, IFIT2, OAS3, USP18, EPSTI1; или RSAD2, IFI44, IFIT2, OAS3, USP18, BIRC4BP; или RSAD2, IFI44, IFIT2, OAS3, USP18, ген, выявленный зондом 229450_at; или RSAD2, IFI44, IFIT2, OAS3, USP18, ген, выявленный зондом 235276_at; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, DNAPTP6; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, LOC129607; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, EPSTI1; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, BIRC4BP; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, ген, выявленный зондом 229450_at; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, ген, выявленный зондом 235276_at; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, LOC129607; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, EPSTI1; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, BIRC4BP; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, ген, выявленный зондом 229450_at; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, ген, выявленный зондом 235276_at; или OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607; или OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, EPSTI1; или OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, BIRC4BP; или OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, ген, выявленный зондом 229450_at; или OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, ген, выявленный зондом 235276_at; или USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1; или USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, BIRC4BP; или USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, ген, выявленный зондом 229450_at; или USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, ген, выявленный зондом 235276_at; или SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP; или SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, ген, выявленный зондом 229450_at; или SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, ген, выявленный зондом 235276_at; или HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 229450_at; или HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 235276_at; или DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 229450_at, ген, выявленный зондом 235276_at. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии может также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать какие-либо по меньшей мере 7 генов, например: МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, ISG15; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, LAMP3; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, OASL; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, RSAD2; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFIT2; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, OAS3; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, USP18; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, SIGLEC1; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, HERC5; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, DNAPTP6; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, LOC129607; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, EPSTI1; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, BIRC4BP; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, ген, выявленный зондом 229450_at; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, ген, выявленный зондом 235276_at; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, LAMP3; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, OASL; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, RSAD2; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, IFI44; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, IFIT2; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, OAS3; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, USP18; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, SIGLEC1; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, HERC5; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, DNAPTP6; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, LOC129607; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, EPSTI1; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, BIRC4BP; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ген, выявленный зондом 229450_at; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ген, выявленный зондом 235276_at; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, OASL; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, RSAD2; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, IFI44; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, IFIT2; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, OAS3; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, USP18; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, SIGLEC1; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, HERC5; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, DNAPTP6; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LOCI 29607; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, EPSTI1; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, BIRC4BP; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, ген, выявленный зондом ген, выявленный зондом 229450_at; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, ген, выявленный зондом 235276_at; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, RSAD2; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, IFI44; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, IFIT2; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OAS3; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, USP18; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, SIGLEC1; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, HERC5; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, DNAPTP6; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, LOC129607; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, EPSTI1; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, BIRC4BP; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, ген, выявленный зондом 229450_at; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, ген, выявленный зондом 235276_at; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, IFI44; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, IFIT2; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, OAS3; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, USP18; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, SIGLEC1; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, HERC5; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, DNAPTP6; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, LOC129607; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, EPSTI1; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, BIRC4BP; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, ген, выявленный зондом 229450_at; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, ген, выявленный зондом 235276_at; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFIT2; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, OAS3; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, USP18; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, SIGLEC1; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, HERC5; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, DNAPTP6; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, LOC129607; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, EPSTI1; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, BIRC4BP; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, ген, выявленный зондом 229450_at; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, ген, выявленный зондом 235276_at; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, OAS3; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, USP18; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, SIGLEC1; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, HERC5; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, DNAPTP6; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, LOC129607; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, EPSTI1; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, BIRC4BP; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, ген, выявленный зондом 229450_at; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, ген, выявленный зондом 235276_at; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, USP18; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, SIGLEC1; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, HERC5; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, DNAPTP6; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, LOC129607; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, EPSTI1; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, BIRC4BP; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, ген, выявленный зондом 229450_at; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, ген, выявленный зондом 235276_at; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, SIGLEC1; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, HERC5; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, DNAPTP6; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, LOC129607; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, EPSTI1; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, BIRC4BP; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, ген, выявленный зондом 229450_at; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, ген, выявленный зондом 235276_at; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, HERC5; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, DNAPTP6; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, LOC129607; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, EPSTI1; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, BIRC4BP; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, ген, выявленный зондом 229450_at; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, ген, выявленный зондом 235276_at; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, DNAPTP6; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, LOC129607; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, EPSTI1; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, BIRC4BP; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, ген, выявленный зондом 229450_at; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, ген, выявленный зондом 235276_at; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, LOC129607; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, EPSTI1; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, BIRC4BP; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, ген, выявленный зондом 229450_at; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, ген, выявленный зондом 235276_at; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, EPSTI1; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, BIRC4BP; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, ген, выявленный зондом 229450_at; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, ген, выявленный зондом 235276_at; или OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1; или OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, BIRC4BP; или OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, ген, выявленный зондом 229450_at; или OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, ген, выявленный зондом 235276_at; или USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP; или USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, ген, выявленный зондом 229450_at; или USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, ген, выявленный зондом 235276 at; или SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 229450_at; или SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 235276_at; или HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 229450_at, ген, выявленный зондом 235276_at. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии может также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать какие-либо по меньшей мере 8 генов, например: МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, LAMP3; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, OASL; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, RSAD2; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, IFI44; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, IFIT2; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, OAS3; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, USP18; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, SIGLEC1; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, HERC5; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, DNAPTP6; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, LOC129607; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, EPSTI1; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, BIRC4BP; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ген, выявленный зондом 229450_at; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ген, выявленный зондом 235276_at; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, OASL; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, RSAD2; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, IFI44; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, IFIT2; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, OAS3; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, USP18; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, SIGLEC1; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, HERC5; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, DNAPTP6; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LOC129607; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, EPSTI1; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, BIRC4BP; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, ген, выявленный зондом 229450_at; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, ген, выявленный зондом 235276_at; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, RSAD2; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, IFI44; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, IFIT2; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OAS3; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, USP18; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, SIGLEC1; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, HERC5; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, DNAPTP6; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, LOC129607; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, EPSTI1; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, ген, выявленный зондом 229450_at; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, BIRC4BP; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, ген, выявленный зондом 235276_at; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, IFI44; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, IFIT2; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, OAS3; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, USP18; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, SIGLEC1; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, HERC5; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, DNAPTP6; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, LOC129607; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, EPSTI1; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, BIRC4BP; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, ген, выявленный зондом 229450_at; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, ген, выявленный зондом 235276_at; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFIT2; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, OAS3; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, USP18; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, SIGLEC1; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, HERC5; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, DNAPTP6; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, LOC129607; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, EPSTI1; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, BIRC4BP; или IFIT1, IFI6, IFI44L, ISG15, LAMPS, OASL, RSAD2, ген, выявленный зондом 229450_at; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, ген, выявленный зондом 235276_at; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, OAS3; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, USP18; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, SIGLEC1; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, HERC5; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, DNAPTP6; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, LOC129607; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, EPSTI1; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, BIRC4BP; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, ген, выявленный зондом 229450_at; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, ген, выявленный зондом 235276_at; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, USP18; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, SIGLEC1; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, HERC5; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, DNAPTP6; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, LOC129607; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, EPSTI1; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, BIRC4BP; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, ген, выявленный зондом 229450_at; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, ген, выявленный зондом 235276_at; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, SIGLEC1; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, HERC5; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, DNAPTP6; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, LOC129607; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, EPSTI1; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, BIRC4BP; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, ген, выявленный зондом 229450_at; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, ген, выявленный зондом 235276_at; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, HERC5; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, DNAPTP6; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, LOC129607; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, EPSTI1; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, BIRC4BP; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, ген, выявленный зондом 229450_at; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, ген, выявленный зондом 235276_at; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, DNAPTP6; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, LOC129607; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, EPSTI1; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, BIRC4BP; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, ген, выявленный зондом 229450_at; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, ген, выявленный зондом 235276_at; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, LOC129607; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, EPSTI1; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, ген, выявленный зондом 229450_at; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, BIRC4BP; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, ген, выявленный зондом 235276_at; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, EPSTI1; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, BIRC4BP; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, ген, выявленный зондом 229450_at; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, ген, выявленный зондом 235276_at; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, BIRC4BP; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, ген, выявленный зондом 229450_at; или IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, ген, выявленный зондом 235276_at; или OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP; или OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, ген, выявленный зондом 229450_at; или OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, ген, выявленный зондом 235276_at; или USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 229450_at; или USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 235276_at; или SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 229450_at, ген, выявленный зондом 235276_at. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать какие-либо по меньшей мере 12 генов, например: МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFIT2; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, OAS3; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, USP18; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, SIGLEC1; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, HERC5; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, DNAPTP6; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, LOC129607; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, EPSTI1; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, BIRC4BP; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, ген, выявленный зондом 229450_at; или МХ1, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, ген, выявленный зондом 235276_at; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, OAS3; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, USP18; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, SIGLEC1; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, HERC5; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, DNAPTP6; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, LOC129607; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, EPSTI1; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, BIRC4BP; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, ген, выявленный зондом 229450_at; или LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, ген, выявленный зондом 235276_at; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, USP18; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, SIGLEC1; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, HERC5; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, DNAPTP6; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, LOC129607; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, EPSTI1; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, BIRC4BP; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, ген, выявленный зондом 229450_at; или IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, ген, выявленный зондом 235276_at; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, SIGLEC1; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, HERC5; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, DNAPTP6; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, LOC129607; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, EPSTI1; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, BIRC4BP; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, ген, выявленный зондом 229450_at; или OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, ген, выявленный зондом 235276_at; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, HERC5; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, DNAPTP6; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, LOC129607; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, EPSTI1; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IPIT2, OAS3, USP18, BIRC4BP; иди IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, ген, выявленный зондом 229450_at; или IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, ген, выявленный зондом 235276_at; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, DNAPTP6; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, LOC129607; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, EPSTI1; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1. BIRC4BP; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, ген, выявленный зондом 229450_at; или IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, ген, выявленный зондом 235276_at; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, LOC129607; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, EPSTI1; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, BIRC4BP; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, ген, выявленный зондом 229450_at; или IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, ген, выявленный зондом 235276_at; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, EPSTI1; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, BIRC4BP; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, ген, выявленный зондом 229450_at; или ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, ген, выявленный зондом 235276_at; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, BIRC4BP; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, ген, выявленный зондом 229450_at; или LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, ген, выявленный зондом 235276_at; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, ген, выявленный зондом 229450_at; или OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, ген, выявленный зондом 235276_at; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 229450_at; или RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 229450_at; или IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, ген, выявленный зондом 229450_at ген, выявленный зондом 235276_at. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, МХ1, OAS2, OASL, CCL2, HERC5, OAS1. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, МХ1, МХ2, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 и FCHO2. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены SERPING1, IFIT2, IFIT3, IFI6, LY6E, МХ1, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1 и EPSTI1. ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут также включать по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28 и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены SERPING1, IFIT2, IFIT3, IFI6, LY6E, МХ1, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1, EPSTI1 и RSAD2. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены BCL2, ВАК1, BAD, BAX и BCL2L1. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены RTP4, RSAD2, HERC5, SIGLEC1, USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, МХ1, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 и ISG15. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, МХ1, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 и IFI27. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, МХ1, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1 и USP18. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, ИЛ1RN, СЕАСАМ1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены IFI6, RSAD2, IFI44, IFI44L, IFI27, МХ1, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1 и USP18. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены IFI6, RSAD2, IFI44, IFI44L, IFI27, МХ1, IFIT1, HERC5, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, LY6E, SIGLEC1 и USP18. ИФНα-индуцируемые ФД маркеры в таком профиле экспрессии могут дополнительно включать по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены IFI6, RSAD2, IFI44, IFI44L, IFI27, МХ1 и IFIT1. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены IFI6, RSAD2, IFI44, IFI44L и IFI27. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относится по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα в профиле экспрессии могут включать по меньшей мере гены IFI27, ИЛ-121R бета2, ИЛ-15R альфа, ИЛ-15, супрессор передачи сигнала цитокином 1 (SOCS1), янус-киназа 2, CXCL11 (Т-ТАС), ФНOSF13B (BAFF), TRAF-типа домен 1 (TRAFD1), SERPING1, CD274 (PD1-L), индоламин-2,3-диоксигеназа (INDO), ген 3 активации лимфоцитов (lymphocyte-activation - LAG3) и каспазы 5. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать по меньшей мере гены фактора B комплемента, инсулиноподобного фактора роста (IGF2BP3), циклина А1, нейропилина 2, комплемента IqB, комплемента IqC, CD80, CD47, ММР14, колокол-подобный рецептор 3 (TLR3), TLR адапторной молекулы 2 (TICAM2), рецептора-чистильщика-1 макрофагов (MSR1), десмоплакина, рецептора PDGR, CCL13 (МСР-4), CXCL13 (ВСА-1), CCL19 (CCR7), ИЛ-1 семейства 5, пуринэргического рецептора Р2Х7, IRS1, каспазы 3 и киназы, родственной циклин-зависимой киназе 1 (CDKL1). К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать изменения уровней одного или нескольких белков в сыворотке, а именно адипонектина, альфа-фетопротеина, аполипопротеина CIII, бета-2 микроглобулина, ракового антигена 125, ракового антигена 19-9, эотаксина, FABP, фактора VII, ферритина, ИЛ-10, ИЛ-12p70, ИЛ-16, ИЛ-18, ИЛ-1ra, ИЛ-3, МСР-1, ММР-3, миоглобина, SGOT, тканевого фактора, TIMP-1, ФНО RII, ФНО-альфа, VCAM-1, vWF, BDNK, комплемента 3, CD40 лиганда, EGF, ENA-78, ENRAGE, IGF-1, MDC, миелопероксидазы, RANTES или тромбопоэтина.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать изменения в каком-нибудь одном или нескольких уровнях в сыворотке белков, а именно адипонектина, альфа-фетопротеина, аполипопротеина CIII, бета-2 микроглобина, ракового антигена 125, ракового антигена 19-9, эотаксина, FABP, фактора VII, ферритина, ИЛ-10, ИЛ-12p70, ИЛ-16, ИЛ-18, ИЛ-1ra, ИЛ-3, МСР-1, ММР-3, миоглобина, SGOT, тканевого фактора, TIMP-1, ФНО RII, ФНО-альфа, VCAM-1 или vWF. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относится по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

ФД маркеры, индуцируемые ИФНα, в профиле экспрессии могут включать изменения в каком-нибудь одном или нескольких уровнях в сыворотке белков BDNK, комплемента 3, лиганда CD40, EGF, ENA-78, EN-RAGE, IGF-1, MDC, миелопероксидазы, RANTES или тромбопоэтина. К ФД маркерам, индуцируемым ИФНα, в таком профиле экспрессии могут также относиться по меньшей мере один или несколько генов, перечисленных в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30.

Профиль экспрессии ФД маркеров, индуцируемых ИФНα, может дополнительно включать гены, регуляция экспрессии или действия которых понижена в клетках, открытых до уровней, не соответствующих исходным уровням ИФНα. Гены, у которых понижена регуляция экспрессии или действия, могут быть какими-либо генами, представленными в табл.31. Гены могут включать какой-либо один или несколько генов из числа SLC4A1, PRSS33, FCER1A, ВАСН2, KLRB1, D4S234E, Т-клеточного рецепторного альфа локуса/Т-клеточного рецепторного дельта локуса, FEZ1, AFF3, CD160, АВСВ1, РТСН1, OR2W3, IGHD, NOG, NR3C2, TNS1, PDZK1IP1, SH2D1B, STRBP, ZMYND11, TMOD1, FCRLA, DKFZp761P0423, EPB42, NR6A1, LOC341333, MS4A1, IGHM, SIGLECP3, KIR2DS2, PKIA, BLR1, C5 or f4, MYLK, LOC283663, MAD1L1, CXCL5, D4S234E, FCRLA, KRT1, cl6 or f74, ABCB4 или GPRASP1. Некоторое число указанных генов может выступать в качестве ФД маркеров в профиле экспрессии ФД маркеров, индуцируемых ИФНα. Например, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 15, по меньшей мере 20, по меньшей мере 25, по меньшей мере 30, по меньшей мере 35, по меньшей мере 40, по меньшей мере 45, или по меньшей мере 50 генов с пониженной регуляцией может быть включено в профиль экспрессии ФД маркеров, индуцируемых ИФНα. К профилю экспрессии ФД маркеров, индуцируемых ИФНα, могут также относиться гены, перечисленные в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28.

Профиль экспрессии ФД маркеров, индуцируемых ИФНα, может включать ген FEZ1, или может включать гены FEZ1 и NOG, или может включать ген NOG, или может включать гены FEZ1, NOG и SLC4A1, или может включать ген SLC4A1, или может включать гены NOG и SLC4A1, или может включать гены FEZ1, NOG, SLC4A1 и D4S234E, или может включать гены FEZ1, NOG, SLC4A1, D4S234E и PRSS33. Профиль экспрессии ФД маркера, индуцированного ИФНα, может также включать гены, перечисленные в табл.19, и/или 20, и/или 21, и/или 22, и/или 23, и/или 24, и/или 26, и/или 28, и/или 30, и/или 31.

Гены с пониженной регуляцией могут обладать экспрессией или активностью с пониженной регуляцией, составляющей по меньшей мере 5%, по меньшей мере 10%, по меньшей мере 15%, по меньшей мере 20%, по меньшей мере 25%, по меньшей мере 30%, по меньшей мере 35%, по меньшей мере 40%, по меньшей мере 45%, по меньшей мере 50%, по меньшей мере 55%, по меньшей мере 60%, по меньшей мере 65%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98%, или по меньшей мере 99% от экспрессии или активности контрольных клеток, например клеток здоровых добровольцев, или клеток контрольных животных, или клеток, не подвергшихся воздействию ИФНα в культуре.

Повышенная или пониженная регуляция генной экспрессии или действия ФД маркеров, индуцированных ИФНα, может быть определена какими-либо средствами, известными в данной области. Например, повышенная или пониженная регуляция генной экспрессии может быть выявлена по определению уровней иРНК. Экспрессия иРНК может быть определена норзен-блоттингом, слот-блоттингом, количественной полимеразной цепной реакцией или методами гибридизации с генным чипом. См. US 5744305 и 5143854, например, получение последовательностей нуклеиновых кислот для методов гибридизации с генным чипом.

Повышенная или пониженная генная экспрессия или активность ФД маркеров, индуцируемых ИФНα, может быть определена по выявлению уровней белков. Ген с повышенной или пониженной регуляцией, чей уровень белка выявляют, может быть каким-либо одним, какими-либо двумя, какими-либо тремя, какими-либо четырьмя, какими-либо пятью, какими-либо шестью, какими-либо семью, какими-либо восьмью, какими-либо девятью, какими-либо десятью, какими-либо двенадцатью, какими-либо пятнадцатью, какими-либо двадцатью, какими-либо двадцатью пятью, какими-либо тридцатью, какими-либо тридцатью пятью или более из числа генов адипонектина, альфа-фетопротеина, аполипопротеина CIII, бета-2 микроглобулина, опухолевого антигена 125, опухолевого антигена 19-9, эотаксина, FABP, фактора VII, ферритина, ИЛ-10, ИЛ-12р70, ИЛ-16, ИЛ-18, ИЛ-1ra, ИЛ-3, МСР-1, ММР-3, миогобина, SGOT, тканевого фактора, TIMP-1, ФНО RII, ФНО-альфа, VCAM-1, vWF, BDNK, комплемента 3, лиганда CD40, EGF, ENA-78, EN-RAGE, IGF-1, MDC, миелопероксидазы, RANTES или тромбопоэтин. Способы выявления уровней экспрессии белка включают иммунологические методы, например ферментсвязанные иммуносорбентные исследования, вестерн-блоттинг, белковые матрицы и окрашивание серебром.

Профиль экспрессии ФД маркеров, индуцируемых ИФНα, может включать профиль активности белков. Повышенная или пониженная регуляция генной экспрессии или активности ФД маркеров, индуцируемых ИФНα, может быть определена по выявлению активности белков, включая, но не ограничиваясь ими, выявляемую активность по фосфорилированию, активность по дефосфорилированию или активность по расщеплению. Кроме того, повышенная или пониженная регуляция генной экспрессии или активности ФД маркеров, индуцируемых ИФНα, может быть определена по выявлению какой-либо комбинации уровней экспрессии или активности указанных генов.

Терапевтическое средство-кандидат для лечения ИФНα-опосредованных расстройств может быть выявлено способами, описанными в настоящем изобретении. Терапевтические средства-кандидаты могут быть какими-либо типами молекул, включая низкомолекулярные соединения или биологические агенты. Терапевтические средства-кандидаты, выявленные методами, описанными в настоящем изобретении, могут быть немедленно определены в качестве применимых терапевтических средств для лечения заболевания, расстройства или состояния. В другом варианте может потребоваться, чтобы терапевтические средства-кандидаты, выявленные методами, описанными в настоящем изобретении, были дополнительно исследованы и/или модифицированы до их выбора для лечения пациентов. В другом варианте терапевтические средства-кандидаты, выявленные методами, описанными в настоящем изобретении, могут после дополнительного исследования быть забракованы в качестве молекулы для лечения пациентов.

В способах, которые идентифицируют терапевтические средства-кандидаты, клетки, представляющие профиль экспрессии ФД маркеров, индуцируемых ИФНα, контактируют с агентом. Клетки могут быть клетками какого-либо типа, например, клетками коммерчески доступных линий бессмертных клеток, которые представляют профиль экспрессии ФД маркеров, индуцируемых ИФНα, клетками коммерчески доступных линий бессмертных клеток, которые обработаны ФД маркером, индуцируемым ИФНα, для индукции профиля экспрессии ФД маркеров, индуцируемых ИФНα, клетками, выделенными от пациента, обладающего профилем экспрессии ФД маркеров, индуцируемых ИФНα, или клетками, выделенными от здорового пациента и обработанными ИФНα для индукции профиля экспрессии ФД маркеров, индуцируемых ИФНα.

Наличие или отсутствие изменения в профиле экспрессии ФД маркеров, индуцируемых ИФНα, клеток выявляют после контакта клеток с агентом. Наличие изменения может быть каким-либо изменением в профиле экспрессии ФД маркеров, индуцируемых ИФНα, включающего по меньшей мере 10% снижение повышенной регуляции или активности по меньшей мере 1 гена с повышенной регуляцией в профиле экспрессии ФД маркеров, индуцируемых ИФНα, по меньшей мере 20% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 30% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 40% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 50% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 60% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 70% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 75% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 80% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 85% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 90% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 95% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 96% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 97% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 98% снижение по меньшей мере 1 гена с повышенной регуляцией, по меньшей мере 99% снижение по меньшей мере 1 гена с повышенной регуляцией, или 100% снижение по меньшей мере 1 гена с повышенной регуляцией. В другом варианте, или дополнительно, наличие изменения может быть каким-либо изменением в профиле экспрессии ИФНα-индуцируемых ФД маркеров, включающего по меньшей мере 10% повышение экспрессии или активности по меньшей мере 1 гена с пониженной регуляцией в профиле экспрессии ФД маркеров, индуцируемых ИФНα, по меньшей мере 20% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 30% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 40% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 50% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 60% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 70% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 75% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 80% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 85% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 90% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 95% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 96% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 97% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 98% повышение по меньшей мере 1 гена с пониженной регуляцией, по меньшей мере 99% повышение по меньшей мере 1 гена с пониженной регуляцией, или 100% снижение по меньшей мере 1 гена с пониженной регуляцией.

В способах мониторинга прогрессирования заболевания пациента образцы могут быть взяты у пациента до или после введения агента, например агента, который связывается и модулирует действие ИФН I типа или ИФНα, или агент, который связывается и не модулирует действия ИФН I типа или ИФНα, или комбинация агента, которая связывает и модулирует действие ИФН I типа или ИФНα. Профили экспрессии ФД маркеров, индуцированные ИФН I типа или ИФНα, устанавливают в образцах (до и после введения агента). Сравнивают профили экспрессии ФД маркеров, индуцированных ИФН I типа или ИФНα, в образцах. Сравнение может быть по числу ФД маркеров, индуцированных ИФН I типа или ИФНα, имеющихся в образцах, или может подсчитываться количество ФД маркеров, индуцированных ИФН I типа или ИФНα, содержащихся в образцах или в какой-либо их комбинации. Изменение, свидетельствующее об эффективности терапевтического агента, может быть установлено, если число или уровень (или их комбинация) ФД маркеров, индуцированных ИФН I типа или ИФНα, с повышенной регуляцией снижается в образце, полученном после введения терапевтического агента, относительно образца, полученного перед введением терапевтического агента. Число ФД маркеров, индуцированных ИФН I типа или ИФНα, с повышенной регуляцией может снизиться по меньшей мере на 1, по меньшей мере на 2, по меньшей мере на 3, по меньшей мере на 4, по меньшей мере на 5, по меньшей мере на 6, по меньшей мере на 7, по меньшей мере на 8, по меньшей мере на 9, или по меньшей мере, на 10. Уровень какого-либо данного ФД маркера, индуцированного ИФН I типа или ИФНα, может быть снижено по меньшей мере на 10%, по меньшей мере на 20%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 35%, по меньшей мере на 40%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 80%, по меньшей мере на 90%, или по меньшей мере, на 95%. Число ФД маркеров, индуцированных ИФН I типа или ИФНα, с пониженной регуляцией с пониженными уровнями может составлять по меньшей мере 1, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 15, по меньшей мере 20, по меньшей мере 25, по меньшей мере 30, или по меньшей мере 35. Какая-либо комбинация пониженного числа и пониженного уровня ФД макеров, индуцированных ИФН I типа или ИФНα, с повышенной регуляцией может проявить эффективность. Вариант, выявляющий эффективность терапевтического агента, может быть установлен, если число или уровень (или какая-либо их комбинация) ФД маркеров, индуцированных ИФН I типа или ИФНα, с пониженной регуляцией снижена в образце, полученном после введения терапевтического агента, по сравнению с образцом, полученным перед введением терапевтического агента. Число ФД маркеров, индуцированных ИФН I типа или ИФНα, с пониженной регуляцией может уменьшиться по меньшей мере на 1, по меньшей мере на 2, по меньшей мере на 3, по меньшей мере на 4, по меньшей мере на 5, по меньшей мере на 6, по меньшей мере на 7, по меньшей мере на 8, по меньшей мере на 9, или по меньшей мере на 10. Уровень какого-либо данного ФД маркера, индуцированного ИФН I типа или ИФНα, с пониженной регуляцией может повыситься по меньшей мере на 10%, по меньшей мере на 20%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 35%, по меньшей мере на 40%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 80%, по меньшей мере на 90%, или по меньшей мере на 95%. Число ИФН I типа- или ИФНα-индуцируемых ФД маркеров с пониженной регуляцией и повышенными уровнями может быть равно по меньшей мере 1, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 15, по меньшей мере 20, по меньшей мере 25, по меньшей мере 30, или по меньшей мере, 35. Какая-либо комбинация пониженного числа и повышенного уровня ФД маркеров, индуцированных ИФН I типа или ИФНα, с пониженной регуляцией может проявить эффективность.

Образец, полученный от пациента, может быть получен перед первым введением агента, т.е. ранее этот агент пациенту не вводили. В другом варианте образец, получаемый от пациента, может отбираться после введения агента на протяжении курса лечения. Например, агент может быть введен перед инициацией протокола мониторинга. После введения агента дополнительные образцы могут получать от пациента и сравнивать ФД маркеры, индуцированные ИФН I типа или ИФНα, в образцах. Образцы могут быть того же или другого типа, например, каждый полученный образец может быть образцом крови, или каждый полученный образец может образцом сыворотки. ИФН I типа- или ИФНα индуцируемые ФД маркеры, выявленные в каждом образце, могут быть теми же, могут существенно перекрываться или могут быть близкими.

Образцы могут быть получены в какое-либо время до или после введения терапевтического агента. Образец, полученный после введения терапевтического агента, может быть получен по меньшей мере на 2, по меньшей мере на 3, по меньшей мере на 4, по меньшей мере на 5, по меньшей мере на 6, по меньшей мере на 7, по меньшей мере на 8, по меньшей мере на 9, по меньшей мере на 10, по меньшей мере на 12, или по меньшей мере, на 14 сутки после введения терапевтического агента. Образец, полученный после введения терапевтического агента, может быть получен по меньшей мере через 2, по меньшей мере через 3, по меньшей мере через 4, по меньшей мере через 5, по меньшей мере через 6, по меньшей мере через 7, по меньшей мере через 8 недель после введения терапевтического агента. Образец, полученный после введения терапевтического агента, может быть получен по меньшей мере через 2, по меньшей мере через 3, по меньшей мере через 4, по меньшей мере через 5, по меньшей мере через 6 месяцев после введения терапевтического агента.

Дополнительные образцы могут быть получены от пациента после введения терапевтического агента. По меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 12, по меньшей мере 15, по меньшей мере 20, по меньшей мере 25 образцов может быть получено от пациента для мониторинга прогрессирования или регрессирования заболевания или расстройства на протяжении времени. Прогрессирование заболевания может быть подвергнуто мониторингу на протяжении периода, составляющего по меньшей мере 1 неделю, по меньшей мере 2 недели, по меньшей мере 3 недели, по меньшей мере 4 недели, по меньшей мере 5 недель, по меньшей мере 6 недель, по меньшей мере 7 недель, по меньшей мере 2 месяца, по меньшей мере 3 месяца, по меньшей мере 4 месяца, по меньшей мере 5 месяцев, по меньшей мере 6 месяцев, по меньшей мере 1 год, по меньшей мере 2 года, по меньшей мере 3 года, по меньшей мере 4 года, по меньшей мере 5 лет, по меньшей мере 10 лет, или на протяжении жизни человека. Дополнительные образцы могут быть получены от пациента с регулярными интервалами, например месячными, двухмесячными, ежеквартальными, проводимыми дважды в год или ежегодными. Образцы могут быть получены от пациента после введения агента с регулярными интервалами. Например, образцы могут быть получены от пациента через неделю после каждого введения агента, или через две недели после каждого введения агента, или через три недели после каждого введения агента, или через месяц после каждого введения агента, или через два месяца после каждого введения агента. В другом варианте множественные образцы могут быть получены от пациента после каждого введения агента.

Прогрессирование заболевания у пациента может быть подвергнуто мониторингу сходным образом в отсутствие введения агента. Образцы могут периодически отбираться у пациента с заболеванием или расстройством. Может быть идентифицировано прогрессирование заболевания, если число ФД маркеров, индуцируемых ИФН I типа или ИФНα, возрастает в образцах, полученных позднее по сравнению с предыдущим образцом. Число ФД маркеров, индуцируемых ИФН I типа или ИФНα, может возрасти по меньшей мере на 1, по меньшей мере на 2, по меньшей мере на 3, по меньшей мере на 4, по меньшей мере на 5, по меньшей мере на 6, по меньшей мере на 7, по меньшей мере на 8, по меньшей мере на 9, или по меньшей мере на 10. Прогрессирование заболевания может быть выявлено, если уровень каких-либо данных ФД маркеров, индуцируемых ИФН I типа или ИФНα, с повышенной регуляцией повышается по меньшей мере на 10%, по меньшей мере на 20%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 35%, по меньшей мере на 40%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 80%, по меньшей мере на 90% или по меньшей мере на 95%. Прогрессирование заболевания может быть выявлено, если уровень каких-либо данных ФД маркеров, индуцируемых ИФН I типа или ИФНα, с пониженной регуляцией понижается по меньшей мере на 10%, по меньшей мере на 20%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 35%, по меньшей мере на 40%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 80%, по меньшей мере на 90% или по меньшей мере на 95%. Число ФД маркеров, индуцируемых ИФН I типа или ИФНα, с повышенной регуляцией с повышенными уровнями может быть равно по меньшей мере 1, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 15, по меньшей мере 20, по меньшей мере 25, по меньшей мере 30 или по меньшей мере 35. Число ФД маркеров, индуцируемых ИФН I типа или ИФНα, с пониженной регуляцией с пониженными уровнями может быть равно по меньшей мере 1, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 15, по меньшей мере 20, по меньшей мере 25, по меньшей мере 30 или по меньшей мере 35. Какая-либо комбинация повышенного числа и повышенного уровня ФД маркера, индуцируемого ИФН I типа или ИФНα, с повышенной регуляцией может свидетельствовать о прогрессировании заболевания. В другом варианте или в комбинации, какая-либо комбинация пониженного числа и пониженного уровня ФД маркера, индуцируемого ИФН I типа или ИФНα, с пониженной регуляцией может свидетельствовать о прогрессировании заболевания. Регрессия заболевания также может быть установлена у пациента с заболеванием или расстройством, не подвергавшегося лечению агентом. В этом случае регрессия может быть выявлена, если число ФД маркеров, индуцируемых ИФН I типа или ИФНα, снижается в позднее отобранном образце относительно ранее полученного образца. Число ФД маркеров, индуцируемых ИФН I типа или ИФНα, может понизиться по меньшей мере на 1, по меньшей мере на 2, по меньшей мере на 3, по меньшей мере на 4, по меньшей мере на 5, по меньшей мере на 6, по меньшей мере на 7, по меньшей мере на 8, по меньшей мере на 9 или по меньшей мере на 10. Регрессия заболевания может быть выявлена, если какой-либо из данных ФД маркеров, индуцируемых ИФН I типа или ИФНα, с повышенной регуляцией понижается по меньшей мере на 10%, по меньшей мере на 20%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 35%, по меньшей мере на 40%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 80%, по меньшей мере на 90% или по меньшей мере на 95%. Регрессия заболевания может быть выявлена, если уровень какого-либо из данных ФД маркеров, индуцируемых ИФН I типа или ИФНα, с пониженной регуляцией повышается по меньшей мере на 10%, по меньшей мере на 20%, по меньшей мере на 25%, по меньшей мере на 30%, по меньшей мере на 35%, по меньшей мере на 40%, по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 80%, по меньшей мере на 90% или по меньшей мере на 95%. Число ФД маркеров, индуцируемых ИФН I типа или ИФНα, с пониженными уровнями может составлять по меньшей мере 1, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 15, по меньшей мере 20, по меньшей мере 25, по меньшей мере 30 или по меньшей мере 35. Число ФД маркеров, индуцируемых ИФН I типа или ИФНα, с пониженной регуляцией с повышенными уровнями может быть равно по меньшей мере 1, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 15, по меньшей мере 20, по меньшей мере 25, по меньшей мере 30 или по меньшей мере 35. Прогресс или регресс заболевания подвергают мониторингу путем получения образцов на протяжении какого-либо периода при каком-либо интервале. Прогресс или регресс заболевания могут быть подвергнуты мониторингу путем получения образцов на протяжении курса, длительностью по меньшей мере 1 неделя, по меньшей мере 2 недели, по меньшей мере 3 недели, по меньшей мере 4 недели, по меньшей мере 5 недель, по меньшей мере 6 недель, по меньшей мере 7 недель, по меньшей мере 2 месяца, по меньшей мере 3 месяца, по меньшей мере 4 месяца, по меньшей мере 5 месяцев, по меньшей мере 6 месяцев, по меньшей мере 1 год, по меньшей мере 2 года, по меньшей мере 3 года, по меньшей мере 4 года, по меньшей мере 5 лет, по меньшей мере 10 лет или на протяжении жизни пациента. Прогресс или регресс заболевания подвергают мониторингу путем получения образцов по меньшей мере ежемесячно, каждые два месяца, ежеквартально, дважды в год или ежегодно. Образцы не обязательно следует получать со строго определенными интервалами.

Настоящее изобретение также включает наборы и зонды. Зондами могут быть какие-либо молекулы, которые выявляют какую-либо экспрессию или действие какого-либо гена, который может быть включен в профиль экспрессии ФД маркера, индуцируемого ИФНα.

Настоящее изобретение также относится к способам обнаружения действия ИФН. Эти способы могут использовать клетки, включающие полинуклеотидную последовательность, содержащую репортерный ген под контролем элемента ответа, простимулированного интерфероном. Клетки, включающие полинуклеотидную последовательность, могут быть какими-либо клетками, способными к трансфекции или трансформации полинуклеотидной последовательностью и которые могут поддерживаться в культуре. К таким клеткам относятся клетки животных, бактерий, дрожжей, насекомых или растений. Эти клетки могут быть прикрепленными или могут расти в суспензии. Если клетки являются клетками животных, они могут быть клетками известных клеточных линий, например, HeLa, COS, NIH3T3, AGS, 293, CHO, Huh-7, HUVEC, MCF-7, C6, BHK-21, BNL CL 2, C2C12, HepG2 и ATDC5. Другие бесчисленные линии клеток известны и могут быть получены специалистами в данной области. Клетки в другом варианте могут быть первичными клетками, которые были или не были бессмертными.

Клетки могут включать полинуклеотидную последовательность, включающую репортерный ген под контролем элемента ответа, простимулированного интерфероном. Полинуклеотидная последовательность может быть стабильно интегрирована в ДНК клетки или может быть внехромосомальным элементом, постоянным или временным для клеток. Полинуклеотид может быть интродуцирован в клетки в качестве открытой полинуклеотидной молекулы, объединенной с липидами полинуклеотидной молекулы или другими молекулами, или полинуклеотида в вирусной частице.

Если полинуклеотид был интродуцирован в качестве открытой полинуклеотидной молекулы, полинуклеотид может быть линейной или кольцевой молекулой. Примерами кольцевых полинуклеотидных молекул являются плазмиды и искусственные хромосомы, но не только они. Эти векторы могут расщепляться ферментами, например, для выработки линейных полинуклеотидных молекул.

Кроме того, если полинуклеотид интродуцирован в качестве открытого полинуклеотида, он может быть интродуцирован в клетки каким-либо из многих хорошо известных в данной области методов. К этим методам относятся, но ими не ограничиваются, электропорация, микроинъекции и баллистическая доставка частиц. См., также, например, Loeffler и Behr, Meth. Enzymol. 217, 1993, сс. 599-618; Cohen и др., Meth. Enzymol. 217, 1993, сс. 618-644; Clin. Pharma. Ther. 29, 1985, сс. 69-92, кн.: Sambrook и др. «Molecular Cloning: A Laboratory Manual», 1989, 2-е изд., изд-во Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Нью-Йорк; кн.: «Current Protocols in Molecular Biology», 1987-2001, под ред. Ausubel и др., изд-во John Wiley & Sons, Inc., Нью-Йорк.

Хотя полинуклеотид интродуцируют в виде комплекса с липидами или липосомами, он также может быть интродуцирован одним из многих известных специалистам методов. Липиды и липосомы представляют смесь частиц жиров или липидов, которые связывают ДНК или РНК для формирования пузырька с гидрофобным покрытием для доставки. Соответствующие липосомы могут включать какие-либо из традиционных синтетических или природных фосфолипидных липосомных материалов, включая фосфолипиды из природных источников, например из яиц, растений или животных, например фосфатидилхолин, фосфатидилэтаноламин, фосфатидилглицерин, сфингомиелин, фосфатидилсерин или фосфатидилинозитол. Также могут применяться синтетические фосфолипиды, например димиристилфосфатидилхолин, диолеилфосфатидилхолин и соответствующие синтетические фосфатидилэтаноламины и фосфатидилглицерины. Липиды или липосомы, которые могут быть конъюгированы с вектором, коммерчески доступны. К примерам коммерчески доступных реагентов липидов или для липосомной трансфекции известны специалистам в данной области, в том числе продукт LIPOFECTAMINE™ (фирма Invitrogen), продукт GENEJUICE® (фирма Novagen), продукт GENEJAMMER® (фирма Stratagene), продукт FUGENE® HD (фирма Roche), продукт MEGAFECTIN™ (фирма Qbiogene), продукт SUPERFECT® (фирма Qiagen) и продукт EFFECTENE® (фирма Qiagen).

Если полинуклеотид был интродуцирован в качестве комплекса с другими молекулами, он может быть компактным или в виде наносферы. Компактные полинуклеотидные комплексы описаны в патентах US 5972901, 6008336 и 6077835. Наносферы описаны в патентах US 5718905 и 6207195. Такие компактные полинуклеотидные комплексы и наносферы, которые объединяют нуклеиновые кислоты, используют полимерные катионы. Типичные полимерные катионы включают желатин, поли-L-лизин и хитозан. В другом варианте полинуклеотид может быть объединен с DEAE-декстраном или трансфецирован, используя методы, например, соосаждения фосфатом кальция или соосаждения хлоридом кальция.

Если полинуклеотид был интродуцирован в ассоциации с вирусом, вирус может быть каким-либо известным соответствующим вирусом для высвобождения полинуклеотида. К примерам вирусов, которые могут применяться в качестве векторов, относятся аденовирусы, аденоассоциированный вирус, лентивирус, ретровирус, вирус герпеса (например, вирус герпес симплекс), вирус оспы, паповирус, вирус сендай, вирус SV40, респираторный синцитиальный вирус и др.

Полинуклеотидная последовательность может включать репортерный ген и элемент ответа, простимулированного интерфероном. Репортерный ген может быть каким-либо геном из числа генов люциферазы, хлорамфеникол-ацетил-трансферазы, β-галактозидазы, зеленого флуоресцирующего белка, β-глюкоронидазы или секретированной плацентарной щелочной фосфатазы. Вариации многих указанных репортерных генов, например зеленого флуоресцентного белка и люциферазы, известны и могут быть легко идентифицированы и/или получены специалистами в данной области. Другие репортерные гены в дополнение к тем, которые перечислены, также могут быть известны специалистам в данной области и доступны. Элементы ответа, простимулированные интерфероном, также известны специалистам в данной области. Они могут быть получены из коммерческих источников, например фирм Stratagene, Clonetech и Biomyx. Они также описаны, например, в работах Alcantara и др., Nuc. Acid. Res. 30, 2002, сс. 2068-2075, и Kirchhoff и др., Oncogene 18, 1999, сс. 3725-3736.

Клетки, используемые в исследовании, могут инкубироваться с образцом. Образец может быть получен от пациента, передан лечащим врачом пациента или может быть контрольным образцом, применяемым для калибровки или в качестве контроля. Если образец получен от пациента, он может быть какой-либо биологической жидкостью или тканью, например кровью, слюной, мочой, синовиальной жидкостью, костным мозгом, цереброспинальной жидкостью, выделением из носа, мокротой, амниотической жидкостью, бронхоальвеолярной промывной жидкостью, мононуклеарными клетками периферической крови, суммарными лейкоцитами, клетками лимфоузлов, клетками селезенки, клетками миндалин или кожей.

Экспрессию репортерного гена выявляют каким-либо известным в данной области методом. Экспрессия, даже если она «нулевая», показывает действие ИФН в образце. Специалист в данной области может также подсчитать какой-либо уровень экспрессии репортерного гена, который может коррелировать с уровнем действия ИФН в образце.

Заявители представляют ряд вариантов осуществления настоящего изобретения для описания некоторых объектов настоящего изобретения, причем указанные варианты не ограничивают настоящее изобретение.

Варианты осуществления настоящего изобретения

Варианты осуществления настоящего изобретения 1. Способ лечения пациента с заболеванием или расстройством, опосредованным ИФН I типа или ИФНα, который включает:

введение агента, который связывает и модулирует действие ИФН I типа или ИФНα;

причем пациент имеет профиль экспрессии ФД маркеров индуцируемых ИФН I типа или ИФНα;

и агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента.

Варианты осуществления настоящего изобретения 2. Способ варианта осуществления настоящего изобретения 1, дополнительно включающий выявление нейтрализации профиля экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента.

Варианты осуществления настоящего изобретения 3. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов МХ1, LY6E, IFI27, OAS1 IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2 и IFI44.

Варианты осуществления настоящего изобретения 4. Способ варианта осуществления настоящего изобретения 1, в котором агент является биологическим агентом.

Варианты осуществления настоящего изобретения 5. Способ варианта осуществления настоящего изобретения 4, в котором агент является антителом.

Варианты осуществления настоящего изобретения 6. Способ варианта осуществления настоящего изобретения 5, в котором антителом является антитело MEDI-545.

Варианты осуществления настоящего изобретения 7. Способ варианта осуществления настоящего изобретения 5, в котором антитело специфично в отношении одного или нескольких ИФН I типа или ИФНα подтипов, но не является антителом MEDI-545.

Варианты осуществления настоящего изобретения 8. Способ варианта осуществления настоящего изобретения 1, в котором введение агента облегчает один или несколько симптомов заболевания или расстройства.

Варианты осуществления настоящего изобретения 9. Способ по варианту осуществления настоящего изобретения 5, в котором антитело вводят в дозе, примерно составляющей 0,03-30 мг/кг.

Варианты осуществления настоящего изобретения 10. Способ по варианту осуществления настоящего изобретения 9, в котором антитело вводят в дозе, примерно составляющей 0,3-3 мг/кг.

Варианты осуществления настоящего изобретения 11. Способ по варианту осуществления настоящего изобретения 10, в котором антитело вводят в дозе 0,03-1 мг/кг.

Варианты осуществления настоящего изобретения 12. Способ по одному из вариантов осуществления настоящего изобретения 9-11, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента по меньшей мере на 10%.

Варианты осуществления настоящего изобретения 13. Способ варианта осуществления настоящего изобретения 12, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента по меньшей мере на 20%.

Варианты осуществления настоящего изобретения 14. Способ варианта осуществления настоящего изобретения 13, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента по меньшей мере на 30%.

Варианты осуществления настоящего изобретения 15. Способ варианта осуществления настоящего изобретения 14, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента по меньшей мере на 40%.

Варианты осуществления настоящего изобретения 16. Способ варианта осуществления настоящего изобретения 15, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента по меньшей мере на 50%.

Варианты осуществления настоящего изобретения 17. Способ варианта осуществления настоящего изобретения 1, в котором ИФН I типа- или ИФНα-опосредованное заболевание или расстройство является волчанкой, псориазом, васкулитом, саркоидозом, синдромом Шегрена или идиопатическим воспалительным миозитом.

Варианты осуществления настоящего изобретения 18. Способ варианта осуществления настоящего изобретения 17, в котором ИФН I типа- или ИФНα-опосредованное заболевание или расстройство является волчанкой.

Варианты осуществления настоящего изобретения 19. Способ варианта осуществления настоящего изобретения 17, в котором ИФН I типа- или ИФНα-опосредованное заболевание или расстройство является псориазом.

Варианты осуществления настоящего изобретения 20. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия по меньшей мере ИФНα подтипов 1, 2, 8 и 14.

Варианты осуществления настоящего изобретения 21. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает транскрипты генов ФД маркеров.

Варианты осуществления настоящего изобретения 22. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает полипептиды, экспрессированные с генов ФД маркера.

Варианты осуществления настоящего изобретения 23. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, представляет повышенную регуляцию экспрессии или действия генов IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, МХ1, OAS2, OASL, CCL2, HERC5, OAS1.

Варианты осуществления настоящего изобретения 24. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, МХ1, МХ2, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 и FCHO2.

Варианты осуществления настоящего изобретения 25. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов SERPING1, IFIT2, IFIT3, IFI6, LY6E, МХ1, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1 и EPSTI1.

Варианты осуществления настоящего изобретения 26. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов RTP4, RSAD2, HERC5, SIGLEC1, USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, МХ1, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 и ISG15.

Варианты осуществления настоящего изобретения 27. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, МХ1, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 и IFI27.

Варианты осуществления настоящего изобретения 28. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, МХ1, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 29. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, ИЛ1RN, СЕАСАМ1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1.

Вариант осуществления настоящего изобретения 30. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1.

Вариант осуществления настоящего изобретения 31. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов IFI6, RSAD2, IFI44, IFI44L, IFI27, МХ1, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 32. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов IFI6, RSAD2, IFI44, IFI44L и IFI27.

Вариант осуществления настоящего изобретения 33. Способ по варианту осуществления настоящего изобретения 32, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов МХ1 и IFIT1.

Вариант осуществления настоящего изобретения 34. Способ по варианту осуществления настоящего изобретения 33, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов OAS2 и OAS1.

Вариант осуществления настоящего изобретения 35. Способ по какому-либо одному из вариантов осуществления настоящего изобретения 3 или 23-33, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, дополнительно включает пониженную регуляцию экспрессии или действия генов NOG, SLC4A1, PRSS33 и FEZ1.

Вариант осуществления настоящего изобретения 36. Способ варианта осуществления настоящего изобретения 1, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает пониженную регуляцию экспрессии или действия генов NOG, SLC4A1, PRSS33 и FEZ1.

Вариант осуществления настоящего изобретения 37. Способ варианта осуществления настоящего изобретения 22, в котором выявляют повышенные уровни полипептида в сыворотке.

Вариант осуществления настоящего изобретения 38. Способ варианта осуществления настоящего изобретения 37, в котором к полипептидам относятся раковый антиген 125, ферритин, тканевый фактор и ММР-3.

Вариант осуществления настоящего изобретения 39. Способ варианта осуществления настоящего изобретения 22, в котором выявляют пониженные уровни полипептида в сыворотке.

Вариант осуществления настоящего изобретения 40. Способ варианта осуществления настоящего изобретения 39, в котором к полипептидам относятся EGF, тромбопоэтин и лиганд CD40.

Вариант осуществления настоящего изобретения 41. Способ лечения пациента с аутоиммунным заболеванием, включающего умеренный или выраженный профиль ИФН I типа или ИФНα ФД маркеров, содержащий:

введение агента, который связывает и модулирует действие ИФН I типа или ИФНα;

в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента.

Вариант осуществления настоящего изобретения 42. Способ варианта осуществления настоящего изобретения 41, дополнительно включающий выявление профиля экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента.

Вариант осуществления настоящего изобретения 43. Способ варианта осуществления настоящего изобретения 41, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов МХ1, LY6E, IFI27, OAS1 IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2 и IFI44.

Вариант осуществления настоящего изобретения 44. Способ варианта осуществления настоящего изобретения 41, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, МХ1, OAS2, OASL, CCL2, HERC5, OAS1.

Вариант осуществления настоящего изобретения 45. Способ варианта осуществления настоящего изобретения 41, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, МХ1, МХ2, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 и FCHO2.

Вариант осуществления настоящего изобретения 46. Способ варианта осуществления настоящего изобретения 41, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов SERPING1, IFIT2, IFIT3, IFI6, LY6E, МХ1, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1 и EPSTI1.

Вариант осуществления настоящего изобретения 47. Способ варианта осуществления настоящего изобретения 41, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов RTP4, RSAD2, HERC5, SIGLEC1, USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, МХ1, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 и ISG15.

Вариант осуществления настоящего изобретения 48. Способ варианта осуществления настоящего изобретения 41, в котором профиль экспрессии ФД-маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, МХ1, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 и IFI27.

Вариант осуществления настоящего изобретения 49. Способ варианта осуществления настоящего изобретения 41, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, МХ1, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 50. Способ варианта осуществления настоящего изобретения 41, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, ИЛ1RN, CEACAM1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1.

Вариант осуществления настоящего изобретения 51. Способ варианта осуществления настоящего изобретения 41, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1.

Вариант осуществления настоящего изобретения 52. Способ варианта осуществления настоящего изобретения 41, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов IFI6, RSAD2, IFI44, IFI44L, IFI27, МХ1, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 53. Способ варианта осуществления настоящего изобретения 41, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов IFI6, RSAD2, IFI44 и IFI27.

Вариант осуществления настоящего изобретения 54. Способ варианта осуществления настоящего изобретения 53, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, дополнительно включает повышенную регуляцию экспрессии или действия генов МХ1 и IFIT1.

Вариант осуществления настоящего изобретения 55. Способ варианта осуществления настоящего изобретения 41, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия меньшей мере ИФНα подтипов 1, 2, 8 и 14.

Вариант осуществления настоящего изобретения 56. Способ варианта осуществления настоящего изобретения 41, в котором агент является биологическим агентом.

Вариант осуществления настоящего изобретения 57. Способ варианта осуществления настоящего изобретения 41, в котором агент является антителом.

Вариант осуществления настоящего изобретения 58. Способ варианта осуществления настоящего изобретения 57, в котором антителом является антитело MEDI-545.

Вариант осуществления настоящего изобретения 59. Способ варианта осуществления настоящего изобретения 57, в котором антитело специфично в отношении одного или нескольких ИФН I типа или ИФНα подтипов, но не является антителом MEDI-545.

Вариант осуществления настоящего изобретения 60. Способ варианта осуществления настоящего изобретения 41, в котором введение агента облегчает один или несколько симптомов заболевания или расстройства.

Вариант осуществления настоящего изобретения 61. Способ варианта осуществления настоящего изобретения 57, в котором антитело вводят в дозе, примерно составляющей 0,03-30 мг/кг.

Вариант осуществления настоящего изобретения 62. Способ варианта осуществления настоящего изобретения 57, в котором антитело вводят в дозе, примерно составляющей 0,3-3 мг/кг.

Вариант осуществления настоящего изобретения 63. Способ варианта осуществления настоящего изобретения 57, в котором антитело вводят в дозе, примерно составляющей 0,03-1 мг/кг.

Вариант осуществления настоящего изобретения 64. Способ варианта осуществления настоящего изобретения 41, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, по меньшей мере на 10%.

Вариант осуществления настоящего изобретения 65. Способ варианта осуществления настоящего изобретения 64, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, по меньшей мере на 20%.

Вариант осуществления настоящего изобретения 66. Способ варианта осуществления настоящего изобретения 65, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, по меньшей мере на 30%.

Вариант осуществления настоящего изобретения 67. Способ варианта осуществления настоящего изобретения 66, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, по меньшей мере на 40%.

Вариант осуществления настоящего изобретения 68. Способ варианта осуществления настоящего изобретения 67, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, по меньшей мере на 50%.

Вариант осуществления настоящего изобретения 69. Способ варианта осуществления настоящего изобретения 41, в котором аутоиммунным заболеванием человека является волчанка, псориаз, васкулит, саркоидоз, синдром Шегрена или идиопатический воспалительный миозит.

Вариант осуществления настоящего изобретения 70. Способ варианта осуществления настоящего изобретения 69, в котором пациент болен волчанкой.

Вариант осуществления настоящего изобретения 71. Способ варианта осуществления настоящего изобретения 69, в котором пациентом является пациент с псориазом.

Вариант осуществления настоящего изобретения 72. Способ нейтрализации ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента, нуждающегося в этом, включающий:

введение агента, который связывает и модулирует ИФН I типа или ИФНα активность у пациента;

в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента.

Вариант осуществления настоящего изобретения 73. Способ варианта осуществления настоящего изобретения 72, дополнительно включающий нейтрализацию профиля экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента.

Вариант осуществления настоящего изобретения 74. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или действия генов МХ1, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2 и IFI44.

Вариант осуществления настоящего изобретения 75. Способ варианта осуществления настоящего изобретения 72, в котором агент является биологическим агентом.

Вариант осуществления настоящего изобретения 76. Способ варианта осуществления настоящего изобретения 75, в котором агент является антителом.

Вариант осуществления настоящего изобретения 77. Способ варианта осуществления настоящего изобретения 76, в котором антитело является антителом MEDI-545.

Вариант осуществления настоящего изобретения 78. Способ варианта осуществления настоящего изобретения 76, в котором антитело специфично в отношении одного или нескольких ИФН I типа или ИФНα подтипов, но не является антителом MEDI-545.

Вариант осуществления настоящего изобретения 79. Способ варианта осуществления настоящего изобретения 72, в котором введение агента облегчает один или несколько симптомов заболевания или расстройства.

Вариант осуществления настоящего изобретения 80. Способ варианта осуществления настоящего изобретения 76, в котором антитело вводят в дозе примерно 0,03-30 мг/кг.

Вариант осуществления настоящего изобретения 81. Способ варианта осуществления настоящего изобретения 80, в котором антитело вводят в дозе 0,3-3 мг/кг.

Вариант осуществления настоящего изобретения 82. Способ варианта осуществления настоящего изобретения 81, в котором антитело вводят в дозе 0,03-1 мг/кг.

Вариант осуществления настоящего изобретения 83. Способ по одному из вариантов осуществления настоящего изобретения 80-82, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, по меньшей мере на 10%.

Вариант осуществления настоящего изобретения 84. Способ варианта осуществления настоящего изобретения 83, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента по меньшей мере на 20%.

Вариант осуществления настоящего изобретения 85. Способ варианта осуществления настоящего изобретения 84, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента по меньшей мере на 30%.

Вариант осуществления настоящего изобретения 86. Способ варианта осуществления настоящего изобретения 85, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента по меньшей мере на 40%.

Вариант осуществления настоящего изобретения 87. Способ варианта осуществления настоящего изобретения 86, в котором агент нейтрализует профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, у пациента по меньшей мере на 50%.

Вариант осуществления настоящего изобретения 88. Способ варианта осуществления настоящего изобретения 72, в котором пациент болен волчанкой, псориазом, васкулитом, саркоидозом, синдромом Шегрена или идиопатическим воспалительным миозитом.

Вариант осуществления настоящего изобретения 89. Способ варианта осуществления настоящего изобретения 88, в котором пациент болен волчанкой.

Вариант осуществления настоящего изобретения 90. Способ варианта осуществления настоящего изобретения 88, в котором пациент болен псориазом.

Вариант осуществления настоящего изобретения 91. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ИФН I типа- или ИФНα-индуцируемых ФД маркеров представляет повышенную регуляцию экспрессии или действия по меньшей мере ИФНα подтипов 1, 2, 8 и 14.

Вариант осуществления настоящего изобретения 92. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ИФН I типа- или ИФНα-индуцируемых ФД маркеров включает транскрипты генов ФД маркеров.

Вариант осуществления настоящего изобретения 93. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ИФН I типа- или ИФНα-индуцируемых ФД маркеров включает полипептиды, экспрессированные с генов ФД маркеров.

Вариант осуществления настоящего изобретения 94. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ИФН I типа- или ИФНα-индуцируемых ФД маркеров включает повышенную регуляцию экспрессии или активности генов IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, МХ1, OAS2, OASL, CCL2, HERC5, OAS1.

Вариант осуществления настоящего изобретения 95. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ИФН I типа- или ИФНα-индуцируемых ФД маркеров включает повышенную регуляцию экспрессии или активности генов IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, МХ1, МХ2, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 и FCHO2.

Вариант осуществления настоящего изобретения 96. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ИФН I типа- или ИФНα-индуцируемых ФД маркеров включает повышенную регуляцию экспрессии или активности генов SERPING1, IFIT2, IFIT3, IFI6, LY6E, МХ1, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1 и EPSTI1.

Вариант осуществления настоящего изобретения 97. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ИФН I типа- или ИФНα-индуцируемых ФД маркеров включает повышенную регуляцию экспрессии или активности генов RTP4, RSAD2, HERC5, SIGLEC1, USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, МХ1, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 и ISG15.

Вариант осуществления настоящего изобретения 98. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или активности генов LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, МХ1, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 и IFI27.

Вариант осуществления настоящего изобретения 99. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или активности генов DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, МХ1, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 100. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или активности генов SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, ИЛ1RN, CEACAM1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1.

Вариант осуществления настоящего изобретения 101. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или активности генов SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1.

Вариант осуществления настоящего изобретения 102. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или активности генов IFI6, RSAD2, IFI44, IFI44L, IFI27, МХ1, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 103. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или активности генов IFI6, RSAD2, IFI44, IFI44L и IFI27.

Вариант осуществления настоящего изобретения 104. Способ варианта осуществления настоящего изобретения 103, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, включает повышенную регуляцию экспрессии или активности генов МХ1 и IFIT1.

Вариант осуществления настоящего изобретения 105. Способ по одному из вариантов осуществления настоящего изобретения 74 или 94-104, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, дополнительно включает пониженную регуляцию экспрессии или активности генов NOG, SLC4A1, PRSS33 и FEZ1.

Вариант осуществления настоящего изобретения 106. Способ варианта осуществления настоящего изобретения 72, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа или ИФНα, дополнительно включает пониженную регуляцию экспрессии или активности генов NOG, SLC4A1, PRSS33 и FEZ1.

Вариант осуществления настоящего изобретения 107. Способ варианта осуществления настоящего изобретения 93, в котором обнаруживают пониженные уровни полипептидов в сыворотке.

Вариант осуществления настоящего изобретения 108. Способ варианта осуществления настоящего изобретения 107, в котором к полипептидам относятся раковый антиген 125, ферритин, тканевый фактор и ММР-3.

Вариант осуществления настоящего изобретения 109. Способ варианта осуществления настоящего изобретения 93, в котором обнаруживают пониженные уровни полипептидов в сыворотке.

Вариант осуществления настоящего изобретения 110. Способ варианта осуществления настоящего изобретения 109, в котором к полипептидам относятся EGF, тромбопоэтин и лиганд CD40.

Вариант осуществления настоящего изобретения 111. Способ мониторинга или прогнозирования прогрессирования аутоиммунного заболевания у пациента, включающий:

получение первого профиля экспрессии маркеров, индуцируемых ИФНα, в первом образце пациента.

Вариант осуществления настоящего изобретения 112. Способ варианта осуществления настоящего изобретения 111, в котором первый профиль экспрессии ФД маркеров, индуцируемых ИФНα, является выраженным профилем и прогнозом для пациента является прогрессирование заболевания.

Вариант осуществления настоящего изобретения 113. Способ варианта осуществления настоящего изобретения 112, в котором аутоиммунным заболеванием является СКВ, а прогрессированием является обострение СКВ.

Вариант осуществления настоящего изобретения 114. Способ варианта осуществления настоящего изобретения 111, в котором первый профиль экспрессии ФД маркеров, индуцируемых ИФНα, является слабым профилем и прогнозом для пациента является регресс заболевания.

Вариант осуществления настоящего изобретения 115. Способ варианта осуществления настоящего изобретения 111, дополнительно включающий:

получение второго профиля экспрессии ФД маркеров, индуцируемых ИФНα, во втором образце, полученном от пациента;

причем повышение числа или уровней ФД маркеров, индуцируемых ИФН I типа- или ИФНα, во втором профиле экспрессии относительно первого профиля экспрессии прогнозирует прогрессирование заболевания; или

в котором снижение числа или уровня ФД маркеров, индуцируемых ИФН I типа- или ИФНα, во втором профиле экспрессии относительно первого профиля экспрессии прогнозирует регресс заболевания.

Вариант осуществления настоящего изобретения 116. Способ мониторинга прогрессирования заболевания у пациента, получающего лечение терапевтическим агентом, который связывает и модулирует действие ИФНα, включающий:

получение первого профиля экспрессии маркеров ФД маркеров, индуцируемых ИФНα, в первом образце пациента,

введение терапевтического агента, который связывает и модулирует действие ИФНα,

получение второго профиля экспрессии маркеров, индуцируемых ИФНα, во втором образце пациента, и

сравнение первого и второго профилей экспрессии маркеров, индуцируемых ИФНα,

в котором изменение в первом и втором профилях экспрессии маркеров, индуцируемых ИФНα, показывает уровень эффективности терапевтического агента, который связывает и модулирует действие ИФНα.

Вариант осуществления настоящего изобретения 117. Способ варианта осуществления настоящего изобретения 116, в котором первый профиль экспрессии маркеров, индуцируемых ИФНα, представляет повышенную регуляцию экспрессии или действия генов МХ1, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2 и IFI44.

Вариант осуществления настоящего изобретения 118. Способ варианта осуществления настоящего изобретения 116, в котором профиль экспрессии маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, МХ1, OAS2, OASL, CCL2, HERC5, OAS1.

Вариант осуществления настоящего изобретения 119. Способ варианта осуществления настоящего изобретения 116, в котором первый тип профиля экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, МХ1, МХ2, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 и FCHO2.

Вариант осуществления настоящего изобретения 120. Способ варианта осуществления настоящего изобретения 116, в котором первый тип профиля экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов SERPING1, IFIT2, IFIT3, IFI6, LY6E, МХ1, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1 и EPSTI1.

Вариант осуществления настоящего изобретения 121. Способ варианта осуществления настоящего изобретения 116, в котором первый тип профиля экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов RTP4, RSAD2, HERC5, SIGLEC1, USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, МХ1, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 и ISG15.

Вариант осуществления настоящего изобретения 122. Способ варианта осуществления настоящего изобретения 116, в котором первый тип профиля экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, МХ1, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 и IFI27.

Вариант осуществления настоящего изобретения 123. Способ варианта осуществления настоящего изобретения 116, в котором первый тип профиля экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, МХ1, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 124. Способ варианта осуществления настоящего изобретения 116, в котором первый тип профиля экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, ИЛ1RN, CEACAM1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1.

Вариант осуществления настоящего изобретения 125. Способ варианта осуществления настоящего изобретения 116, в котором первый тип профиля экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1.

Вариант осуществления настоящего изобретения 126. Способ варианта осуществления настоящего изобретения 116, в котором первый профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов IFI6, RSAD2, IFI44, IFI44L, IFI27, МХ1, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 127. Способ варианта осуществления настоящего изобретения 116, в котором первый профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов IFI6, RSAD2, IFI44, IFI44L и IFI27.

Вариант осуществления настоящего изобретения 128. Способ варианта осуществления настоящего изобретения 116, в котором изменение заключается в снижении уровней повышенной регуляции экспрессии или активности генов.

Вариант осуществления настоящего изобретения 129. Способ варианта осуществления настоящего изобретения 116, в котором заболевание является волчанкой, идиопатическим воспалительным миозитом, синдромом Шегрена, васкулитом, саркоидозом и псориазом.

Вариант осуществления настоящего изобретения 130. Способ варианта осуществления настоящего изобретения 131, в котором заболеванием является волчанка.

Вариант осуществления настоящего изобретения 131. Способ варианта осуществления настоящего изобретения 116, в котором терапевтический агент является низкомолекулярным соединением или биологическим агентом.

Вариант осуществления настоящего изобретения 132. Способ варианта осуществления настоящего изобретения 131, в котором биологический агент является антителом.

Вариант осуществления настоящего изобретения 133. Способ варианта осуществления настоящего изобретения 132, в котором антителом является антитело MEDI-545.

Вариант осуществления настоящего изобретения 134. Способ варианта осуществления настоящего изобретения 116, в котором первый профиль экспрессии ФД маркеров, индуцируемых ИФНα, получают до введения терапевтического агента.

Вариант осуществления настоящего изобретения 135. Способ варианта осуществления настоящего изобретения 116, в котором первый профиль экспрессии ФД маркеров, индуцируемых ИФНα, получают во время введения терапевтического агента.

Вариант осуществления настоящего изобретения 136. Способ варианта осуществления настоящего изобретения 116, в котором первым и вторым образцом является цельная кровь или сыворотка.

Вариант осуществления настоящего изобретения 137. Способ варианта осуществления настоящего изобретения 116, дополнительно включающий получение третьего профиля экспрессии ФД маркеров, индуцируемых ИФНα, в третьем образце, взятом у пациента.

Вариант осуществления настоящего изобретения 138. Способ варианта осуществления настоящего изобретения 137, дополнительно включающий получение четвертого профиля экспрессии ФД маркеров, индуцируемых ИФНα, в четвертом образце, взятом у пациента.

Вариант осуществления настоящего изобретения 139. Способ варианта осуществления настоящего изобретения 138, дополнительно включающий получение пятого профиля экспрессии ФД маркеров, индуцируемых ИФНα, в пятом образце, взятом у пациента.

Вариант осуществления настоящего изобретения 140. Способ варианта осуществления настоящего изобретения 139, дополнительно включающий получение шестого профиля экспрессии ФД маркеров, индуцируемых ИФНα, в шестом образце, взятом у пациента.

Вариант осуществления настоящего изобретения 141. Способ варианта осуществления настоящего изобретения 116, в котором второй образец получают по меньшей мере через неделю, по меньшей мере через 2 недели, по меньшей мере через три недели, по меньшей мере через месяц или по меньшей мере через два месяца после введения терапевтического агента.

Вариант осуществления настоящего изобретения 142. Способ варианта осуществления настоящего изобретения 137, в котором третий образец получают по меньшей мере через 2 суток, по меньшей мере через 5 суток, по меньшей мере через неделю, по меньшей мере через две недели, по меньшей мере через три недели, по меньшей мере через месяц или по меньшей мере через два месяца после получения второго образца.

Вариант осуществления настоящего изобретения 143. Способ варианта осуществления настоящего изобретения 138, в котором четвертый образец получают по меньшей мере через 2 суток, по меньшей мере через 5 суток, по меньшей мере через неделю, по меньшей мере через две недели, по меньшей мере через три недели, по меньшей мере через месяц или по меньшей мере через два месяца после получения третьего образца.

Вариант осуществления настоящего изобретения 144. Способ варианта осуществления настоящего изобретения 139, в котором пятый образец получают по меньшей мере через 2 суток, по меньшей мере через 5 суток, по меньшей мере через неделю, по меньшей мере через две недели, по меньшей мере через три недели, по меньшей мере через один месяц или по меньшей мере через два месяца после получения четвертого образца.

Вариант осуществления настоящего изобретения 145. Способ варианта осуществления настоящего изобретения 116, в котором изменение заключается в снижении повышенной регуляции экспрессии или действия гена.

Вариант осуществления настоящего изобретения 146. Способ варианта осуществления настоящего изобретения 145, в котором снижение составляет по меньшей мере 10%, по меньшей мере 20%, по меньшей мере 25%, по меньшей мере 30%, по меньшей мере 40%, по меньшей мере 45%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98%, по меньшей мере 99% или 100%.

Вариант осуществления настоящего изобретения 147. Способ идентификации пациента в качестве кандидата для лечения терапевтическим агентом, который связывает и модулирует действие ИФНα, включающий: выявление наличия или отсутствия профиля экспрессии ФД маркеров, индуцируемых ИФНα, в образце пациента,

причем выявление наличия профиля экспрессии ФД маркеров, индуцируемых ИФНα, характеризует пациента в качестве кандидата для лечения терапевтическим агентом, который связывает и модулирует действие ИФНα.

Вариант осуществления настоящего изобретения 148. Способ варианта осуществления настоящего изобретения 147, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышенную регуляцию экспрессии или действия генов МХ1, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2 и IFI44.

Вариант осуществления настоящего изобретения 149. Способ варианта осуществления настоящего изобретения 147, в котором профиль ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, МХ1, OAS2, OASL, CCL2, HERC5, OAS1.

Вариант осуществления настоящего изобретения 150. Способ варианта осуществления настоящего изобретения 147, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, МХ1, МХ2, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 и FCHO2.

Вариант осуществления настоящего изобретения 151. Способ варианта осуществления настоящего изобретения 147, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов SERPING1, IFIT2, IFIT3, IFI6, LY6E, МХ1, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1 и EPSTI1.

Вариант осуществления настоящего изобретения 152. Способ варианта осуществления настоящего изобретения 147, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов RTP4, RSAD2, HERC5, SIGLEC1, USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, MX1, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 и ISG15.

Вариант осуществления настоящего изобретения 153. Способ варианта осуществления настоящего изобретения 147, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, MX1, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 и IFI27.

Вариант осуществления настоящего изобретения 154. Способ варианта осуществления настоящего изобретения 147, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, MX1, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 155. Способ варианта осуществления настоящего изобретения 147, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, ИЛ1RN, CEACAM1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и MX1.

Вариант осуществления настоящего изобретения 156. Способ варианта осуществления настоящего изобретения 147, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и MX1.

Вариант осуществления настоящего изобретения 157. Способ варианта осуществления настоящего изобретения 147, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов IFI6, RSAD2, IFI44, IFI44L, IFI27, MX1, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 158. Способ варианта осуществления настоящего изобретения 147, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенную регуляцию экспрессии или действия генов IFI6, RSAD2, IFI44, IFI44L и IFI27.

Вариант осуществления настоящего изобретения 159. Способ варианта осуществления настоящего изобретения 147, в котором пациента диагностируют в качестве имеющего расстройство, выбранное из группы, включающей волчанку, идиопатический воспалительный миозит, синдром Шогрена, васкулит, саркоидоз и псориаз.

Вариант осуществления настоящего изобретения 160. Способ варианта осуществления настоящего изобретения 159, в котором расстройством является волчанка.

Вариант осуществления настоящего изобретения 161. Способ варианта осуществления настоящего изобретения 147, в котором терапевтическим агентом является низкомолекулярное соединение или биологический агент.

Вариант осуществления настоящего изобретения 162. Способ варианта осуществления настоящего изобретения 161, в котором биологический агент является антителом.

Вариант осуществления настоящего изобретения 163. Способ варианта осуществления настоящего изобретения 162, в котором антитело является антителом MEDI-545.

Вариант осуществления настоящего изобретения 164. Способ по одному из вариантов осуществления настоящего изобретения 148-158, в котором повышенная регуляция экспрессии или действия представляет по меньшей мере двухкратное увеличение экспрессии одного или нескольких генов.

Вариант осуществления настоящего изобретения 165. Способ по одному из вариантов осуществления настоящего изобретения 148-158, в котором повышенная регуляция экспрессии или действия представляет по меньшей мере трехкратное увеличение экспрессии одного или нескольких генов.

Вариант осуществления настоящего изобретения 166. Способ по одному из вариантов осуществления настоящего изобретения 148-158, в котором повышенная регуляция экспрессии или действия представляет повышение уровней иРНК одного или нескольких генов.

Вариант осуществления настоящего изобретения 167. Способ по одному из вариантов осуществления настоящего изобретения 148-158, в котором повышенная регуляция экспрессии или действия представляет повышение уровней белков одного или нескольких генов.

Вариант осуществления настоящего изобретения 168. Способ по одному из вариантов осуществления настоящего изобретения 148-158, в котором повышенная регуляция экспрессии или действия представляет повышение ферментативного действия белка, экспрессированного с одного или нескольких генов.

Вариант осуществления настоящего изобретения 169. Способ варианта осуществления настоящего изобретения 147, в котором образец является цельной кровью.

Вариант осуществления настоящего изобретения 170. Способ варианта осуществления настоящего изобретения 147, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет пониженную регуляцию экспрессии или действия генов NOG, SLC4A1, PRSS33 и FEZ1.

Вариант осуществления настоящего изобретения 171. Способ варианта осуществления настоящего изобретения 147, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет повышенные уровни в сыворотке полипептидов ракового антигена 125, ферритина, тканевого фактора и ММР-3.

Вариант осуществления настоящего изобретения 172. Способ варианта осуществления настоящего изобретения 147, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, представляет пониженные уровни в сыворотке полипептидов EGF, тромбопоэтина и лиганда CD40.

Вариант осуществления настоящего изобретения 173. Способ диагностики пациента в качестве пациента, имеющего расстройство, связанное с повышенными уровнями ИФНα, включающий:

выявление наличия или отсутствия профиля экспрессии ФД маркеров, индуцируемых ИФНα, в образце пациента,

причем выявление наличия профиля экспрессии ФД маркеров, индуцируемых ИФНα, характеризует пациента в качестве имеющего расстройство, ассоциированное с повышенными уровнями ИФНα.

Вариант осуществления настоящего изобретения 174. Способ варианта осуществления настоящего изобретения 173, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышенную регуляцию экспрессии или действия генов МХ1, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2 и IFI44.

Вариант осуществления настоящего изобретения 175. Способ варианта осуществления настоящего изобретения 173, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышенную регуляцию экспрессии или действия генов IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, МХ1, OAS2, OASL, CCL2, HERC5, OAS1.

Вариант осуществления настоящего изобретения 176. Способ варианта осуществления настоящего изобретения 173, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышенную регуляцию экспрессии или действия генов IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, МХ1, МХ2, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 и FCHO2.

Вариант осуществления настоящего изобретения 177. Способ варианта осуществления настоящего изобретения 173, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышенную регуляцию экспрессии или действия генов SERPING1, IFIT2, IFIT3, IFI6, LY6E, МХ1, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1 и EPSTI1.

Вариант осуществления настоящего изобретения 178. Способ варианта осуществления настоящего изобретения 173, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышенную регуляцию экспрессии или действия генов RTP4, RSAD2, HERC5, SIGLEC1, USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, МХ1, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 и ISG15.

Вариант осуществления настоящего изобретения 179. Способ варианта осуществления настоящего изобретения 173, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышенную регуляцию экспрессии или действия генов LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, MX1, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 и IFI27.

Вариант осуществления настоящего изобретения 180. Способ варианта осуществления настоящего изобретения 173, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышенную регуляцию экспрессии или действия генов DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, MX1, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 181. Способ варианта осуществления настоящего изобретения 173, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышенную регуляцию экспрессии или действия генов SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, ИЛ1RN, CEACAM1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и MX1.

Вариант осуществления настоящего изобретения 182. Способ варианта осуществления настоящего изобретения 173, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышенную регуляцию экспрессии или действия генов SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и MX1.

Вариант осуществления настоящего изобретения 183. Способ варианта осуществления настоящего изобретения 173, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышенную регуляцию экспрессии или действия генов IFI6, RSAD2, IFI44, IFI44L, IFI27, MX1, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 184. Способ варианта осуществления настоящего изобретения 173, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышенную регуляцию экспрессии или действия генов IFI6, RSAD2, IFI44, IFI44L и IFI27.

Вариант осуществления настоящего изобретения 185. Способ варианта осуществления настоящего изобретения 173, в котором расстройством является волчанка, идиопатический воспалительный миозит, синдромом Шегрена, васкулит, саркоидоз или псориаз.

Вариант осуществления настоящего изобретения 186. Способ варианта осуществления настоящего изобретения 185, в котором расстройством является волчанка.

Вариант осуществления настоящего изобретения 187. Способ по одному из вариантов осуществления настоящего изобретения 174-184, в котором повышенная регуляция экспрессии или действия представляет по меньшей мере двухкратное увеличение экспрессии или действия одного или нескольких генов.

Вариант осуществления настоящего изобретения 188. Способ варианта осуществления настоящего изобретения 187, в котором повышенная регуляция экспрессии или действия представляет по меньшей мере трехкратное увеличение экспрессии или действия одного или нескольких генов.

Вариант осуществления настоящего изобретения 189. Способ по одному из вариантов осуществления настоящего изобретения 174-184, в котором повышенная регуляция экспрессии или действия представляет повышение уровней иРНК одного или нескольких генов.

Вариант осуществления настоящего изобретения 190. Способ по одному из вариантов осуществления настоящего изобретения 174-184, в котором повышенная регуляция экспрессии или действия представляет повышение уровней белков одного или нескольких генов.

Вариант осуществления настоящего изобретения 191. Способ по одному из вариантов осуществления настоящего изобретения 174-184, в котором повышенная регуляция экспрессии или действия представляет повышение ферментативной активности белка, экспрессированного с одного или нескольких генов.

Вариант осуществления настоящего изобретения 192. Способ по одному из вариантов осуществления настоящего изобретения 174-184, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, дополнительно включает пониженную регуляцию экспрессии или действия генов NOGSLC4A1, PRSS33 и FEZ1.

Вариант осуществления настоящего изобретения 193. Способ по одному из вариантов осуществления настоящего изобретения 174-184, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, дополнительно включает повышенные уровни в сыворотке полипептидов ракового антигена 125, ферритина, тканевого фактора и ММР-3.

Вариант осуществления настоящего изобретения 194. Способ по одному из вариантов осуществления настоящего изобретения 174-184, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, дополнительно включает пониженные уровни в сыворотке полипептидов EGF, тромбопоэтина и лиганда CD40.

Вариант осуществления настоящего изобретения 195. Способ идентификации исследуемого терапевтического средства для лечения ИФНα-опосредованных расстройств, включающий:

контакт клеток, включающих профиль экспрессии ФД маркеров, индуцируемых ИФНα, с агентом, и

выявление наличия или отсутствия изменения в профиле экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, в клетках,

причем выявление наличие изменения включает снижение пониженной регуляции генов профиля экспрессии ФД маркеров, индуцируемых ИФНα, подтверждает, что агент является терапевтическим агентом-кандидатом.

Вариант осуществления настоящего изобретения 196. Способ варианта осуществления настоящего изобретения 195, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, включает повышенную регуляцию экспрессии или действия генов МХ1, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2 и IFI44.

Вариант осуществления настоящего изобретения 197. Способ варианта осуществления настоящего изобретения 195, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, включает повышенную регуляцию экспрессии или действия генов IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, МХ1, OAS2, OASL, CCL2, HERC5 и OAS1.

Вариант осуществления настоящего изобретения 198. Способ варианта осуществления настоящего изобретения 195, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, включает повышенную регуляцию экспрессии или действия генов IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, МХ1, МХ2, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 и FCHO2.

Вариант осуществления настоящего изобретения 199. Способ варианта осуществления настоящего изобретения 195, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, включает повышенную регуляцию экспрессии или действия генов SERPING1, IFIT2, IFIT3, IFI6, LY6E, МХ1, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1 и EPSTI1.

Вариант осуществления настоящего изобретения 200. Способ варианта осуществления настоящего изобретения 195, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, включает повышенную регуляцию экспрессии или действия генов RTP4, RSAD2, HERC5, SIGLEC1, USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, МХ1, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 и ISG15.

Вариант осуществления настоящего изобретения 201. Способ варианта осуществления настоящего изобретения 195, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, включает повышенную регуляцию экспрессии или действия генов LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, МХ1, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 и IFI27.

Вариант осуществления настоящего изобретения 202. Способ варианта осуществления настоящего изобретения 195, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, включает повышенную регуляцию экспрессии или действия генов DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, МХ1, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 203. Способ варианта осуществления настоящего изобретения 195, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, включает повышенную регуляцию экспрессии или действия генов SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, ИЛ1RN, CEACAM1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1.

Вариант осуществления настоящего изобретения 204. Способ варианта осуществления настоящего изобретения 195, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, включает повышенную регуляцию экспрессии или действия генов SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1.

Вариант осуществления настоящего изобретения 205. Способ варианта осуществления настоящего изобретения 195, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, включает повышенную регуляцию экспрессии или действия генов IFI6, RSAD2, IFI44, IFI44L, IFI27, МХ1, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1 и USP18.

Вариант осуществления настоящего изобретения 206. Способ варианта осуществления настоящего изобретения 195, в котором профиль экспрессии ФД маркеров, индуцируемых ИФНα, включает повышенную регуляцию экспрессии или действия генов IFI6, RSAD2, IFI44, IFI44L и IFI27.

Вариант осуществления настоящего изобретения 207. Способ варианта осуществления настоящего изобретения 195, в котором клетки, полученные от пациента, представляют расстройство, ассоциированное с повышенными уровнями ИФНα.

Вариант осуществления настоящего изобретения 208. Способ варианта осуществления настоящего изобретения 195, в котором клетки являются клетками, обработанными ИФНα для индукции профиля экспрессии ФД маркеров, индуцируемых ИФНα.

Вариант осуществления настоящего изобретения 209. Способ варианта осуществления настоящего изобретения 195, в котором повышенная регуляция генов профиля экспрессии ФД маркеров, индуцируемых ИФНα, составляет по меньшей мере двухкратное повышение экспрессии одного или нескольких генов профиля.

Вариант осуществления настоящего изобретения 210. Способ варианта осуществления настоящего изобретения 195, в котором повышенная регуляция генов профиля экспрессии ФД маркеров, индуцируемых ИФНα, составляет по меньшей мере трехкратное повышение экспрессии одного или нескольких генов профиля экспрессии ФД маркеров, индуцируемых ИФНα.

Вариант осуществления настоящего изобретения 211. Способ варианта осуществления настоящего изобретения 195, в котором повышенная регуляция генов профиля экспрессии ФД маркеров, индуцируемых ИФНα, составляет повышение уровней иРНК одного или нескольких генов профиля экспрессии ФД маркеров, индуцируемых ИФНα.

Вариант осуществления настоящего изобретения 212. Способ варианта осуществления настоящего изобретения 195, в котором повышенная регуляция генов профиля экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышение уровней белков одного или нескольких генов профиля экспрессии ФД маркеров, индуцируемых ИФНα.

Вариант осуществления настоящего изобретения 213. Способ варианта осуществления настоящего изобретения 195, в котором повышенная регуляция генов профиля экспрессии ФД маркеров, индуцируемых ИФНα, представляет повышение ферментативного действия белка, экспрессированного с одного или нескольких генов профиля экспрессии ФД маркеров, индуцируемых ИФНα.

Вариант осуществления настоящего изобретения 214. Способ по одному из вариантов осуществления настоящего изобретения 196-206, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, дополнительно включает пониженную регуляцию экспрессии или действия генов NOGSLC4A1, PRSS33 и FEZ1,

причем наличие изменения, представляющего повышение экспрессии или действия генов с пониженной регуляцией, свидетельствует о том, что агент является терапевтическим агентом-кандидатом.

Вариант осуществления настоящего изобретения 215. Способ по одному из вариантов осуществления настоящего изобретения 196-206, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, дополнительно включает повышенные уровни в сыворотке полипептидов ракового антигена 125, ферритина, тканевого фактора и ММР-3,

причем наличие изменения, представляющего понижение уровней в сыворотке полипептидов, свидетельствует о том, что агент является терапевтическим агентом-кандидатом.

Вариант осуществления настоящего изобретения 216. Способ по одному из вариантов осуществления настоящего изобретения 196-206, в котором профиль экспрессии ФД маркеров, индуцируемых ИФН I типа- или ИФНα, дополнительно включает пониженные уровни в сыворотке полипептидов EGF, тромбопоэтина и лиганда CD40,

причем наличие изменения, представляющего повышение уровней в сыворотке полипептидов, свидетельствует о том, что агент является терапевтическим агентом-кандидатом.

Вариант осуществления настоящего изобретения 217. Набор зондов, включающий:

полинуклеотиды, которые специфически выявляют экспрессию какого-либо из наборов генов:

(а) МХ1, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, и IFI44; или

(б) IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, МХ1, OAS2, OASL, CCL2, HERC5, OAS1; или

(в) IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, МХ1, МХ2, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 и FCHO2; или

(г) SERPING1, IFIT2, IFIT3, IFI6, LY6E, МХ1, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1 и EPSTI1; или

(д) RTP4, RSAD2, HERC5, SIGLEC1, USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, МХ1, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 и ISG15; или

(е) LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, МХ1, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 и IFI27; или

(ж) DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, МХ1, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1 и USP18; или

(з) SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, ИЛ1RN, СЕАСАМ1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1; или

(и) SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1; или

(к) IFI6, RSAD2, IFI44, IFI44L, IFI27, МХ1, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1 и USP18; или

(л) IFI6, RSAD2, IFI44, IFI44L и IFI27; или

(м) NOGSLC4A1, PRSS33 и FEZ1.

Вариант осуществления настоящего изобретения 218. Набор, включающий какой-либо из наборов зондов, указанных в варианте осуществления настоящего изобретения 217.

Вариант осуществления настоящего изобретения 219. Способ выявления действия ИФН в образце, включающий:

инкубирование клеток, включающих полинуклеотидную последовательность, содержащую репортерный ген под контролем элемента ответа, простимулированного интерфероном, с образцом; и

выявление экспрессия репортерного гена,

причем экспрессия репортерного гена свидетельствует о действии ИФН в образце.

Вариант осуществления настоящего изобретения 220. Способ варианта осуществления настоящего изобретения 219, в котором клетками являются клетки НЕК293Н.

Вариант осуществления настоящего изобретения 221. Способ варианта осуществления настоящего изобретения 219, в котором репортерный ген является геном люциферазы, хлорамфеникол-ацил трансферазы, β-галактозидазы, зеленого флуоресцирующего белка, β-глюкуронидазы или секретированной плацентарной щелочной фосфатазы.

Вариант осуществления настоящего изобретения 222. Способ варианта осуществления настоящего изобретения 221, в котором репортерный ген является геном люциферазы.

Вариант осуществления настоящего изобретения 223. Способ варианта осуществления настоящего изобретения 222, в котором люцифераза является люциферазой Gaussia princeps.

Вариант осуществления настоящего изобретения 224. Способ варианта осуществления настоящего изобретения 219, также включающий подсчет уровня экспрессии репортерного гена.

Вариант осуществления настоящего изобретения 225. Способ варианта осуществления настоящего изобретения 224, дополнительно включающий корреляцию уровня экспрессии репортерного гена с уровнем действия ИФН в образце.

Все публикации, патенты и патентные заявки, упоминаемые в настоящем описании, включены в настоящее изобретение в виде ссылки на их описание в той же степени, в какой каждая отдельная публикация, патент или патентная заявка была конкретно и специфически показана к включению в настоящее изобретение в виде ссылки.

По настоящей заявке испрашивается приоритет на основе предварительной заявки на патент США US 60/873008, поданной 6 декабря 2006 г., предварительной заявки на патент США 60/907762, поданной 16 апреля 2007 г., предварительной заявки на патент США 60/924219, поданной 3 мая 2007 г., предварительной заявки на патент США 60/924584, поданной 21 мая 2007 г., предварительной заявки на патент США 60/960187, поданной 19 сентября 2007 г., и предварительной заявки на патент США 60/996176, поданной 5 ноября 2007 г., сущность которых включена в настоящее изобретение для всех целей. По настоящей заявке также испрашивается приоритет на основе предварительной заявки на патент США US 924220, поданной 3 мая 2007 г., предварительной заявки, озаглавленной «Auto-Antibody Markers of Autoimmune Disease» и поданной 6 ноября 2007 г. (поверенный IA201P2), предварительной заявки US, озаглавленной «Auto-Antibody Markers of Autoimmune Disease», поданной 6 ноября 2007 (поверенный IА201Р3) и предварительной заявки US, озаглавленной «Auto-Antibody Markers of Autoimmune Disease», поданной 6 декабря 2007 (поверенный IА201Р3), включенной в настоящее изобретение в виде ссылки. По настоящей заявке также испрашивается приоритет на основе предварительной заявки на патент США US 60/907767, поданной 16 апреля 2007 г., на основе предварительной заявки на патент 60/996174, поданной 5 ноября 2007 г., и РСТ патентной заявки, озаглавленной «Methods of Treating Systemic Lupus Erythematosus», поданной 6 декабря 2007 г. (поверенный IА210РСТ), включенной в настоящее изобретение в виде ссылки.

Приводимые ниже примеры приводятся только в качестве иллюстрации и никоим образом не ограничивают рамок охвата настоящего изобретения.

Примеры

Пример 1а. Первоначальная идентификация генов с повышенной регуляцией у пациента с волчанкой

Определяют профиль генной экспрессии в цельной крови пяти пациентов с волчанкой (двух с кожной формой и трех с тяжелой формой) и пяти здоровых добровольцев, используя методику Affymetrix по выравниванию целого генома и подтверждение методом кПЦР. Кратность величин генной экспрессии определяют подсчетом разницы величин log2 сигнала интенсивности между образцами отдельных пациентов с волчанкой и средней величиной log2 сигнала интенсивности для 5 образцов здоровых доноров. 118 генов идентифицируют в качестве генов с повышенной регуляцией по меньшей мере в два раза, в цельной крови всех 5 пациентов с волчанкой относительно здоровых добровольцев.

Табл. 1 представляет суммарные сведения для 71 из 118 аннотированных генов, выявленных в качестве генов повышенной регуляции по меньшей мере в два раза, у всех пяти пациентов с волчанкой. Табл. 2 представляет кратность увеличения экспрессии подгруппы из 118 генов для каждого из пяти пациентов с волчанкой по сравнению со здоровыми добровольцами. Табл. 2 также представляет сравнение между величинами кратного изменения, определенными по двум уникальным платформам (Аffу GeneChip и TaqMan (т.е. кПЦР)).

Табл. 1.
Гены, идентифицированные по повышенной регуляции по меньшей мере двухкратной, в цельной крови больных волчанкой.
Таблица 2.
Повышенная регуляция генной экспрессии набора генов каждого из пяти пациентов, больных волчанкой.
Зонд ID Обозначение гена 129KHR. СКВ (Tag Man) 129KHR. СКВ (Affy) RH33XR. СКВ (Tag Man) RH33XR. СКВ (Affy) OJ9S SR (Tag Man) OJ9S SR (Affy) 4499R (Tag Man) 4499R (Affy) MI26CR (Tag Man) MI26CR (Affy)
228220_at FCHO2 3,24 39,86 3,30 76,15 33,05 84,86 22,36 35,07 17,77 10,61
205483_s_at G1P3 86,13 146,74 80,55 92,15 4,45 7,83 2,90 5,45 5,06 12,71
212195_at IL6ST 3,87 9,18 3,63 27,52 6,60 9,73 4,95 10,70 2,35 6,14
203275_at IRF2 8,10 6,46 5,00 4,80 5,07 6,54 4,12 4,32 2,44 4,66
1555643_s_at LILRA5 16,43 12,00 27,25 14,64 11,22 6,66 6,82 7,44 4,86 6,49
205170_at STAT2 11,55 8,67 9,74 2,25 8,08 2,16 6,37 2,92 4,12 2,62

Пример 1а. Определение генов, идентифицированных в качестве генов с повышенной регуляцией, у больных волчанкой

Для дальнейшей идентификации ФД маркеров - кандидатов для клинических исследований с применением моноклональных антител анти-ИФНα у больных СКВ, используют платформу выравнивания Affymetrix Human Genome U133 Plus 2.0 GeneChip® для получения профиля цельной крови 46 больных СКВ и цельной крови 24 пожилых и находящихся в детородном возрасте здоровых доноров. Было установлено, что наборы из 245 и 77 зондов проявляют повышенную регуляцию и пониженную регуляцию, соответственно, в цельной крови пациентов с СКВ, которых сравнивали с контролем - здоровыми донорами.

Из наборов 245 зондов с повышенной регуляцией в цельной крови больных СКВ 114 являются ИФН I типа-индуцируемыми. Табл. 30 приводит список 50 наборов зондов с наиболее повышенной регуляцией в цельной крови таких больных СКВ; из них 76% являются ИФН I типа-индуцируемыми. Табл. 30 также представляет преобладание сверхэкспрессии указанных генов в цельной крови больных СКВ. Большинство указанных генов сверхэкспрессируется по меньшей мере в два раза, у 65-80% профилированных пациентов. Крепкая и преобладающая сверхэкспрессия большого числа ИФН I типа-индуцируемых генов у больных СКВ означает, что они могут быть соответствующими ФД маркерами для клинических исследований, в которых изучают лечение с применением моноклональных антител анти-ИФНα для больных СКВ.

Таблица 30
50 зондов с наибольшей повышенной регуляцией в цельной крови пациентов с СКВ
ID зондов Генный продукт Обозначение гена log2fc Величина q (FDR) Распространенность
202411_at Интерферон альфа индуцируемый белок 27 IFI27 4,60 8,41E-07 73,91
219519_s_at Сиаловая кислота, связывающая Ig-подобный лектин 1, сиалоадгезин SIGLEC1 3,52 7,28E-07 65,22
214059_at Интерферон-индуцированный белок 44 IFI44 3,51 8,04E-07 73,91
213797_at Белок 2, содержащий домен радикал S-аденозилметионин RSAD2 3,29 9,86E-06 71,74
204415_at Интерферон альфа-индуцируемый белок 6 IFI6 3,21 2,25E-09 82,61
ID зондов Генный продукт Обозначение гена log2fc Величина q (FDR) Распространенность
242625_at Белок 2, содержащий домен радикал S-аденозилметионин RSAD2 3,19 1,55E-06 69,57
204439_at Белок, подобный интерферон-индуцированному белку 44 IFI44L 3,14 4,99E-06 71,74
219211_at Убиквитин-специфичная пептидаза 18 USP18 2,84 2,23E-06 67,39
214453_s_at интерферон-индуцированный белок 44 IFI44 2,72 1,07E-05 71,74
202145_at Комплекс лимфоцитарного антигена 6, локус Е LY6E 2,53 7,28E-07 63,04
207329_at Матриксная металлопептидаза 8 (коллагеназа нейтрофилов) ММР8 2,51 0,00111 60,87
202869_at 2′,5′-олигоаденилат синтетаза 1, 40/46 кДа OAS1 2,33 1,66E-06 69,57
222154_s_at ДНКполимераза-трансактивированный белок 6 DNAPTP6 2,32 1,14E-05 65,22
44673_at Сиаловая кислота, связывающая Ig-подобный лектин 1, сиалоадгезин SIGLEC1 2,31 2,23E-06 58,70
242234_at XIAP ассоциированный фактор-1 BIRC4BP 2,31 8,41E-07 65,22
203153_at Интерферон-индуцированный белок с тетратрикопептидными повторами 1 IFIT1 2,25 9,53E-05 67,39
218400_at 2′-5′-олигоаденилат синтетаза 3, 100 кДа OAS3 2,24 1,23E-05 67,39
212768_s_at Олфактомедин 4 OLFM4 2,23 0,00608 60,87
241869_at Аполипопротеин L, 6 APOL6 2,22 0,00045 80,43
235643_at Белок, родственный белку с доменом стерильного альфа мотива 9 SAMD9L 2,22 1,37Е-06 84,78
231688_at Транскрибированный локус - 2,22 0,00248 63,04
208470_s_at Гаптоглобин /// гаптоглобин-связанный белок HP /// HPR 2,20 2,48Е-05 80,43
239979_at Эпителиальное стромальное взаимодействие 1 (грудь) EPSTI1 2,20 5,44Е-06 65,22
206697_s_at Гаптоглобин HP 2,19 2,96Е-05 73,91
205552_s_at 2′,5′-олигоаденилат синтетаза 1, 40/46 кДа OAS1 2,18 4,98Е-07 65,22
205483_s_at Убиквитин-подобный модификатор ISG15 ISG15 2,16 2,73Е-06 65,22
227609_at Эпителиальное стромальное взаимодействие 1 (грудь) EPSTI1 2,15 4,99Е-06 67,39
1555643_s_at Лейкоцитарный типа иммуноглобулина рецептор, подсемейство A LILRA5 2,14 8,41Е-07 76,09
222816_s_at Цинковый палец, ССНС домен содержащий 2 ZCCHC2 2,09 5,43Е-05 80,43
205569_at Лизосомально-ассоциированный мембранный белок 3 LAMP3 2,08 2,74Е-06 65,22
226702_at Гипотетический белок LOC129607 LOC129607 2,07 5,96Е-05 67,39
ID зондов Генный продукт Обозначение гена log2fc Величина q (FDR) Распространенность
215838_at Лейкоцитарный типа иммуноглобулина рецептор, подсемейство A LILRA5 2,07 1,87E-05 71,74
219863_at hect домен и RLD 5 HERC5 2,03 1,53E-05 67,39
204747_at Интерферон-индуцированный белок с тетратрикопептидными повторами 3 IFIT3 2,01 1,55E-06 67,39
200986_at ингибитор серпиновой пептидазы, таксон G (ингибитор С1), представитель 1 SERPING1 1,98 0,00013 67,39
224225_s_at Вариант ets гена 7 (TEL2 онкоген) ETV7 1,98 2,48E-05 58,70
219684_at Рецепторный (хемосенсорный) транспортный белок 4 RTP4 1,96 2,74E-06 63,04
206133_at XIAP ассоциированный фактор-1 BIRC4BP 1,96 7,28E-07
206871_at Эластаза 2, нейтрофилы ELA2 1,95 0,00316 54,35
217502_at Интерферон-индуцированный белок с тетратрикопептидными повторами 2 IFIT2 1,95 4,86E-06 71,74
237340_at Семейство растворимых носителей 26, представитель 8 SLC26A8 1,93 6,68E-06 60,87
235276_at - - 1,93 6,44E-06 65,22
203757_s_at Молекула прилипания клетки 6, родственная карциноэмбриональному антигену СЕАСАМ6 1,91 0,00124 47,83
202086_at Устойчивость к миксовирусу (вирусу гриппа) 1, интерферон-индуцируемый белок р78 (мышь) МХ1 1,90 2,66E-05 67,39
241916_at Скрамблаза-1 фосфолипидов PLSCR1 1,89 4,86E-06 73,91
203595_s_at интерферон-индуцированный белок с тетратрикопептидными повторами 5 IFIT5 1,89 2,81E-08 69,57
205660_at Типа 2′-5′-олигоаденилат синтетазы OASL 1,89 1,94E-05 65,22
219352_at hect домен и RLD 6 HERC6 1,87 9,79E-06 63,04
211657_at Молекула прилипания клетки 6, родственная карциноэмбриональному антигену СЕАСАМ6 1,86 0,00667 60,87
228439_at базовый лейциновый зиппер фактора транскрипции, подобный ATF 2 BATF2 1,86 2,63E-05 63,04

Данные были получены от 46 больных СКВ и 24 здоровых контрольных субъектов, используя SAM и FDR в R (см. методы). ИФН I типа-индуцируемые гены выделены жирным шрифтом. FDR = степень ложных оценок (false discovery rate); SAM = значимость исследования микрочипов (significance analysis of microarrays); СКВ = системная красная волчанка.

Фиг.80 (верхняя панель) показывает heatmap экспрессии наборов 114 с повышенной регуляцией ИФН I типа-индуцируемых зондов у больных СКВ и здоровых субъектов (контроль). Из 46 профилированных больных СКВ 32 показывают существенную сверхэкспрессию подписи ИФН I типа генов. Чтобы подтвердить наблюдение, заключающееся в том, что ИФН I типа-индуцируемые гены сверхэкспрессируются в цельной крови больных СКВ, отбирают цельную кровь 54 больных СКВ в прогностическом исследовании. Фиг.81А показывает схему АГК 46 больных СКВ в первом исследовании, используя 114 сверхэкспрессированных ИФН I типа-индуцируемых зондов. Наблюдают четкое различие между больными СКВ, у которых сверхэкспрессия подписи ИФН I типа генов отличается от соответствующего показателя у здоровых доноров и больных СКВ, которые имеют слабую или невыявляемую подпись ИФН I типа генов в цельной крови. Фиг.81Б показывает схему АГК от 54 пациентов с СКВ в последующем исследовании, используя те же наборы идентифицированных 114 ИФН I типа-индуцируемых зондов. Сходное разделение пациентов с СКВ наблюдают, основываясь на подписи ИФН I типа генов, подобно представленному на фиг.81А. Распределение оценок подписи ИФН I типа генов в прогностическом исследовании также напоминает распределение в первом исследовании (данные не представлены). Способность использовать сверхэкспрессированные ИФН I типа-индуцируемые гены, выявленные для разделения больных СКВ на 2 разные группы пациентов - имеющих или не имеющих подпись генов ИФН I типа - подтверждает точность идентификации сверхэкспрессии подписи ИФН I типа генов в цельной крови больных СКВ.

Помимо сверхэкспрессии подписи ИФН I типа генов наблюдают сверхэкспрессию генной подписи, которая является показателем активации гранулоцитов в цельной крови больных СКВ. Генная подпись гранулоцитов включает (но ими не ограничивается) следующие гены: AZU, DEFA1, DEFA4, ELA2, ММР8, ММР9, PHKS2, МРО, CAMP, FCAR и CYBB (фиг.80, вторая панель). Генная подпись гранулоцитов имеется примерно у 50% профилированных больных СКВ.

Наборы 50 зондов с наиболее пониженной регуляцией, которые наблюдают в цельной крови больных СКВ, показаны в табл.31. Пониженную регуляцию генных подписей в клетках T, NK и B наблюдают в цельной крови пациентов с СКВ (фиг.80, панели три, четыре и пять, соответственно); это согласуется с наблюдением лимфопении у больных СКВ, о котором ранее сообщалось в литературе (Bennett L. и др., J Exp Med, 197(6), 2003, сс. 711-723; Rivero S.J. и др., Arthritis Rheum., 21(3), 1978, сс. 295-305).

Таблица 31
Топовые 50 транскриптов с наиболее пониженной регуляцией в цельной крови больных СКВ
ID зондов Название гена Обозначение гена log2fc Величина q (FDR) Распространение
1552713_a_at Растворимый носитель семейства 4, анионообменник, представитель 1 (эритроцитарный мембранный белок полосы 3, группа крови Диего) SLC4A1 - 1,82 0,00021 69,57
1552348_at Сериновая протеаза 33 PRSS33 - 1,71 0,00046 63,04
211734_s_at Fc фрагмент IgE, высокое сродство I, рецептор; альфа полипептид /// Fc фрагмент IgE, высокое сродство I, рецептор; альфа полипептид FCER1A - 1,59 0,00083 54,35
236307_at ВТВ и CNC гомология 1, базовый лейциновый зиппер фактора транскрипции 2 ВАСН2 - 1,51 0,00012 54,35
214470_at Лектин-подобные рецепторы клеток-киллеров, подсемейство B, представитель 1 /// Лектин-подобные рецепторы клеток-киллеров, подсемейство B, представитель 1 KLRB1 - 1,50 0,00000 58,70
209570_s_at ДНК сегмент на хромосоме 4 (уникальный) 234 экспрессированной последовательности D4S234E - 1,46 0,00000 65,22
217143_s_at Альфа локус рецептора T клеток /// Дельта локус рецептора T клеток TRA@ /// TRD@ - 1,38 0,00001 58,70
203562_at Белок фасцикуляции и элонгации зета 1 (зигин I) FEZ1 - 1,36 0,00028 89,13
227198_at AF4/FMR2 семейство, представитель 3 AFF3 - 1,35 0,00046 45,65
207840_at CD160 молекула CD160 - 1,34 0,00079 47,83
232286_at AF4/FMR2 семейство, представитель 3 AFF3 - 1,34 0,00003 56,52
ID зондов Название гена Обозначение гена log2fc Величина q (FDR) Распространение
209993_at АТФ-связывающая кассета, подсемейство B (MDR/TAP), представитель 1 АВСВ1 - 1,32 0,00002 63,04
209815_at Очажковый гомолог 1 (Drosophila) РТСН1 - 1,29 0,00003 54,35
241881_at Обонятельный рецептор, семейство 2, подсемейство W, представитель 3 OR2W3 - 1,29 0,01736 50,00
213674_x_at Константная область тяжелой цепи иммуноглобулина дельта IGHD - 1,29 0,01801 50,00
231798_at Фактор Noggin NOG - 1,28 0,00234 73,91
239673_at Ядерный рецептор, подсемейство 3, группа C, представитель 2 NR3C2 - 1,27 0,00004 56,52
221748_s_at Тензин 1 /// Тензин 1 TNS1 - 1,23 0,00953 50,00
218864_at Тензин 1 TNS1 - 1,22 0,00718 50,00
219630_at PDZK1 взаимодействующий белок 1 PDZK1IP1 - 1,20 0,00528 56,52
1553177_at SH2 домен содержащий 1B SH2D1B - 1,20 0,00187 47,83
229513_at Околоядерный РНК-связывающий белок сперматид STRBP - 1,20 0,00017 58,70
243054_at Цинковый палец, MYND содержащий домен 11 ZMYND11 - 1,20 0,00101 60,87
236796_at ВТВ и CNC гомология 1, базовый лейциновый зиппер фактора транскрипции 2 BACH2 - 1,20 0,00004 56,52
203661_s_at Тропомодулин 1 TMOD1 - 1,19 0,00675 50,00
239278_at Клон кДНК IМАGЕ:5301129 - - 1,17 0,00002 65,22
235400_at Белок, родственный Fc рецептору A FCRLA - 1,17 0,00099 52,17
240690_at Гомолог rat pragma белка Rnd2 DKFZp761P0423 - 1,17 0,00012 52,17
210746_s_at полоса мембранного белка эритроцитов 4.2 /// полоса мембранного белка эритроцитов 4.2 EPB42 - 1,16 0,00552 45,65
232478_at Ядерный рецептор, подсемейство 6, группа A, представитель 1 NR6A1 - 1,15 0,00004 47,83
ID зондов Название гена Обозначение гена log2fc Величина q (FDR) Распространение
243810_at Белок, сходный с гетерогенным ядерным рибонуклеопротеином А1 (спираль-дестабилизирующим белком) (белком, связывающим одноцепочечную РНК) (коровым белком гетерогенного ядерного рибонуклеопротеина (гяРНП) А1) LOC341333 - 1,15 0,00014 47,83
228599_at Протяженные в мембране 4 домена, подсемейство A, представитель 1 MS4A1 - 1,14 0,00454 45,65
212827_at Константный участок тяжелой цепи иммуноглобулина мю /// Константный участок тяжелой цепи иммуноглобулина мю IGHM - 1,14 0,00324 45,65
1552349_a_at Сериновая протеаза 33 PRSS33 - 1,13 0,02357 47,83
216191_s_at Локус T-клеточного рецептора альфа /// Локус T-клеточного рецептора дельта /// B-cell CLL/лимфома 11B (белок цинкового пальца) TRA@ /// TRD@ /// BCL11B - 1,12 0,01073 50,00
232686_at Лектин типа Ig, связывающего сиаловую кислоту, псевдоген 3 SIGLECP3 - 1,12 0,00003 58,70
211532_x_at Подобный иммуноглобулину рецептор клеток-киллеров, два домена, короткий цитоплазматический хвост, 2 KIR2DS2 - 1,10 0,04011 54,35
1563217_at Ингибитор альфа цАМФ-зависимой протеинкиназы PKIA - 1,10 0,00024 58,70
243798_at Лимфомы Беркитта рецептор 1, GTP-связывающий белок (рецептор хемокина (C-X-C мотив) 5) BLR1 - 1,10 0,00044 54,35
22075l_s_at Хромосома 5, открытая рамка считывания 4 C5 or f4 - 1,09 0,00531 50,00
202555_s_at Легкая цепь миозиновой киназы /// Легкая цепь миозиновой киназы MYLK - 1,09 0,00149 52,17
230245_s_at Гипотетический белок LOC283663 LOC283663 - 1,09 0,00977 47,83
233921_s_at Белок, типа недостаточного белка MAD1 по аресту мейоза 1 (дрожжи) MAD1L1 - 1,08 0,00001 41,30
ID зондов Название гена Обозначение гена log2fc Величина q (FDR) Распространение
214974_x_at Лиганд хемокина (C-X-C мотив) 5 CXCL5 - 1,08 0,00717 54,35
209569_x_at ДНК сегмент на хромосоме 4 (уникальный) 234 экспрессированной последовательности D4S234E - 1,08 0,00005 58,70
235401_s_at Белок,родственный Fc рецептору A FCRLA - 1,08 0,00173 50,00
205900_at Кератин 1 (эпидермолитический гиперкератоз) KRT1 - 1,08 0,04518 43,48
242509_at Хромосома 16, открытая рамка считывания 74 C16 or f74 - 1,08 0,00016 47,83
209994_s_at АТФ-связывающая кассета, подсемейство B (MDR/TAP), представитель 1 /// АТФ-связывающая кассета, подсемейство B (MDR/TAP), представитель 4 АВСВ1 /// АВСВ4 - 1,08 0,00000 56,52
204793_at Белок 1, сортирующий рецепторы, ассоциированные с G-белками GPRASP1 - 1,08 0,00026 45,65

Данные были получены от 46 больных СКВ и 24 здоровых контрольных субъектов, используя SAM и FDR в R (см. методы). FDR = степень ложных оценок (false discovery rate); SAM = значимость исследования микрочипов (significance analysis of microarrays); СКВ = системная красная волчанка.

Для дальнейшего подтверждения наблюдения об сверхэкспрессии ИФН I типа и гранулоцитных подписей и для идентификации других сигнальных метаболических путей, которые могут быть изменены у больных СКВ, проводят анализ метаболических путей и сети с программным обеспечением GeneGo (см. методы). Общий для СКВ анализ указанных метаболических путей подтверждает активирование ИФН I типа-метаболического пути наряду с активированием подписи гранулоцитов и пониженную экспрессию T-клеточного сигнального метаболического пути. Кроме того, у профилированных пациентов активирование ИЛ-10 сигнального пути происходит наряду с другими известными метаболическими путями, которые изменены. Это может заключаться в активировании B клеток и может проявляться в виде измененного апоптоза субпопуляций T-клеток у больных СКВ (Diaz-Alderete A, Crispin JC, Vargas-Rojas MI и Alcocer-Varela J., J Autoimmun. 23(4), 2004, сс. 379-383, Wang H, Xu J, Ji X и др.. Cell Immunol. 235(2), 2005, сс. 117-121).

Подтверждение сверхэкспрессии ИФН I типа-индуцируемых генов. Для подтверждения сверхэкспрессии ИФН I типа-индуцируемых генов у больных СКВ, которую наблюдают при анализе с помощью микрочипов, применяют массив с переменным числом элементов BioMarkTM 48.48 для осуществления высокопропускной реакции (high throughput - НТР) TaqMan КРВ-ПЦР на ИФН I типа-индуцируемые гены (выбранные, основываясь на их протяженности и преобладании сверхэкспрессии в цельной крови больных СКВ). Исследования TaqMan КРВ-ПЦР подтверждают сверхэкспрессию всех 40 генов в цельной крови 35 изначально профилированных 46 больных СКВ. Сверхэкспрессию 15 из 40 ИФН I типа-индуцируемых генов, используя анализ TaqMan, показывают на фиг.83А. Регуляция этих генов повышена в среднем в 8-92 раза и все они существенно сверхэкспрессированы (P<0,05). Эти наблюдения доказывают, что ИФН I типа-индуцируемые гены существенно сверхэкспрессированы у больных СКВ. Соответствие результатов микроматриц и TaqMan и строгая корреляция (коэффициент корреляции >0,98) между исследованиями микроматриц и TaqMan для 21 ИФН-индуцируемого гена в примере 2 у пациентов с СКВ (фиг.83б и 4в) свидетельствуют об их потенциале в качестве ФД и диагностических маркеров в клинических исследованиях анти-ИФН-α подходов к лечению СКВ.

Пример 2. Потенциал ФД маркеров, выбранных из генов с повышенной регуляцией у пациентов с волчанкой

Используя данные по профилированию целого генома, описанные в примере 1а, отбирают группу ФД маркеров-кандидатов. Указанные маркеры-кандидаты приводят в табл.3.

Таблица 3
ФД маркеры-кандидаты
ID зонда Обозначение гена Группа
204415_at HERC5 1
202411_at IFI27 1
214453_s_at IFI44 1
229450_at IFIT3 1
1555643_s_at LILRA5 1
205483_s_at G1P2 1
204439_at IFI44L 1
203153_at IFIT1 1
202145_at LY6E 1
ID зонда Обозначение гена Группа
202869_at OAS1 1
218400_at OAS3 1
242625_at RSAD2 1
228220_at FCHO2 2
205483_s_at G1P3 2
212195_at IL6ST 2
203275_at IRF2 2
1555643_s_at LILRA5 2
205170_at STAT2 2
208436_s_at IRF7 3
211967_at PORIMIN 3
226312_at AVO3 3
201669_s_at MARCKS 3
222846_at RAB8B 3

Пример 3. ФД маркеры-кандидаты проявляют минимальную вариацию у здоровых доноров

Проводят К-ПЦР на выбранной группе ФД маркеров-кандидатов, чтобы определить, проявляют ли они вариацию исходного уровня в цельной крови здоровых добровольцев. К-ПЦР показывает, что вариация исходного уровня минимальна. См. табл.4, которая представляет данные К-ПЦР исходного уровня (здоровые добровольцы показаны в заштрихованных колонках).

Таблица 4
Вариация исходных данных ФД маркеров-кандидатов
Ген 102-РАХ 129-РАХ 129KHR-SLE RH33XR-SLE
CDC42SE1 0,589 1,000 2,622 1,996
FCHO2 0,872 1,000 3,235 3,298
G1P3 2,059 1,000 86,130 80,545
HERC5 3,638 1,000 638,073 159,621
IFI27 0,246 1,000 508,346 14,012
IFI44 5,194 1,000 636,965 338,921
IFIT3 1,413 1,000 104,166 59,344
IL6ST 0,337 1,000 3,873 3,628
IRF2 1,486 1,000 8,096 4,998
LILRA5 1,48177 1,000 16,433182 27,248745
BAFF 0,433 1,000 2,478 4,679
GIP2 0,571 1,000 22,168 13,634
IFI44L 2,581 1,000 407,035 259,517
IFIT1 4,018 1,000 128,164 151,301
LY6E 0,442 1,000 10,095 5,181
OAS1 0,817 1,000 16,650 10,379
OAS3 2,517 1,000 75,542 32,355
RSAD2 2,425 1,000 310,575 217,885
STAT2 1,526 1,000 11,551 9,735

Пример 4. ИФНα стимулирует повышенную регуляцию экспрессии ФД маркеров-кандидатов в цельной крови здоровых добровольцев

Исследование проводят, чтобы определить, может ли ИФНα стимулировать экспрессию ФД маркеров-кандидатов в цельной крови здоровых добровольцев. Цельную кровь здоровых добровольцев отбирают в гепаринизированные пробирки, переносят в соответствующие лунки 6-луночных планшетов, инкубируют с лейкоцитарным ИФН в дозах 3, 30, 100 и 300 МЕд и затем инкубируют в течение 4 ч при 37°C в атмосфере 5% СO2. Кратное изменение ФД маркеров-кандидатов генов FI44, IRF2, RSAD2, G1P3 и HERC5 определяют, используя РНК, выделенную из МКПК (мононуклеарных клеток периферической крови) с применением набора PHKeasy kit фирмы Qiagen. В табл.5 (IFI44 и IRF2), табл.6 (RSAD2) и табл.7 (G1P3 и HERC5) показано, что ИФН вызывает повышенную регуляцию экспрессии каждого из указанных ФД маркеров-кандидатов. См. также графический анализ указанных результатов экспрессии ФД маркеров-кандидатов на фиг.1 (IFI44), фиг.2 (IRF2), фиг.3 (RSAD2), фиг.4 (G1P3) и фиг.5 (HERC5).

Суммарное иерархическое кластерирование всех образцов, используя 1384 генов, по-разному регулируемых ИФН I типа, тип-II ИФН или ФНОα, полученных в отдельном эксперименте, показано на фиг.17. Heatmap с суммарным иерархическим кластерированием также получают для 689 ИФН I типа-индуцируемых наборов зондов, примененных к образцам цельной крови от здоровых доноров ex vivo, которые были простимулированы ИФН I типа, тип-II ИФН или ФНОα. См. фиг.64.

Таблица 5
Индуцированная экспрессия генов IFI44 и IRF2 после стимуляции лейкоцитарным интерфероном цельной крови здоровых добровольцев.
Образец Ген Среднее значение Стандартное отклонение
63А Среда IFI44 1,00
63А ИФН3 IFI44 8,58 0,16
63А ИФН30 IFI44 8,27 0,07
63А ИФН100 IFI44 15,12 0,50
63А ИФН300 IFI44 12,42 0,04
Образец Ген Среднее значение Стандартное отклонение
63А Среда IRF2 1,00
Образец Ген Среднее значение Стандартное отклонение
63А ИФН3 IRF2 2,25 0,08
63А ИФН30 IRF2 1,96 0,06
63А ИФН100 IRF2 2,19 0,06
63А ИФН300 IRF2 3,75 0,10
Таблица 6
Индуцированная экспрессия гена RSAD2 после стимуляции лейкоцитарным интерфероном цельной крови здоровых добровольцев
Образец Ген Среднее значение Стандартное отклонение
63А Среда RSAD2 1,00
63А ИФН3 RSAD2 10,85 0,11
63А ИФН30 RSAD2 11,14 0,21
63А ИФН100 RSAD2 14,96 0,12
63А ИФН300 RSAD2 25,50 0,50
Таблица 7
Индуцированная экспрессия генов G1P3 и HERC5 после стимуляции лейкоцитарным интерфероном цельной крови здоровых добровольцев
Образец Ген Среднее значение Стандартное отклонение
63А Среда G1P3 1,00
63А ИФН3 G1P3 42,88 1,03
63А ИФН30 G1P3 25,76 0,10
63А ИФН100 G1P3 21,72 0,48
63А ИФН300 G1P3 16,02 0,06
Образец Ген Среднее значение Стандартное отклонение
63А Среда HERC5 1,00
63А ИФН3 HERC5 14,17 0,12
63А ИФН30 HERC5 13,74 0,12
63А ИФН100 HERC5 18,51 0,58
63А ИФН300 HERC5 23,55 0,54

Пример 5. Антитело против ИФНα нейтрализует экспрессию ИФНα-индуцируемых ФД маркеров-кандидатов в цельной крови здоровых добровольцев

Источник интерферона = ИФНα2а

Поскольку обработка цельной крови здоровых добровольцев ИФНα приводит к индукции экспрессии ФД - маркеров-кандидатов, исследуют, может ли антитело против ИФНα, MEDI-545, нейтрализовать индукцию экспрессии этих маркеров.

Кровь собирают от каждого из трех доноров в пробирки с гепарином. Аликвоты отобранной крови объемом 2,5 мл вносят в каждую из 4 лунок 6- или 24-луночных планшетов для обработки крови. Схема обработки по 4 лункам следующая: (а) кровь + растворитель, (б) кровь + 100 МЕд. ИФНα2а, (в) кровь + 100 МЕд. ИФНα2а + MEDI-545 (антитело против ИФНα) и (г) кровь + 100 МЕд. ИФНα2а + R347 (контрольное антитело).

Лунки, содержащие подвергаемую обработке антителом кровь, сначала инкубируют или с антителом MEDI-545 (антитело против ИФНα, лунка (в)), или с антителом R347 (контрольное антитело, лунка (г)), в течение 30 мин. После обработки антителом добавляют растворитель (лунка (а)) или ИФНα2а (лунки (б), (в) и (г)) в соответствующие лунки и затем инкубируют еще дополнительно 4 ч при 37°C в атмосфере 5% СО2. Затем образцы переносят в пробирки PAXgene и инкубируют при комнатной температуре в течение 2 ч. После 2 ч инкубирования пробирки хранят при -80°C.

Затем при инкубировании по меньшей мере в течение ночи при -80°C получают суммарную РНК клеток по протоколу фирмы PAXgene. Первую и вторую цепь кДНК приготовляют методами Affy GRP и TaqMan на образцах кДНК.

Экспрессия по меньшей мере 11 ФД маркеров-кандидатов, ранее идентифицированных в качестве ФД маркеров с повышенной регуляцией у пациентов с волчанкой, может быть нейтрализована антителом MEDI-545 в цельной крови, простимулированной ИФНα2а. См. табл.8 (RAB8B), табл.9 (IRF7), табл.10 (MARCKS), табл.11 (IL6ST), табл.12 (LY6E), табл.13 (IFIT3), табл.14 (IFIT1), табл.15 (HERC5), табл.16 (OAS1), табл.17 (OAS3) и табл.18 (RSAD2), в которых представлен количественный анализ генной экспрессии для каждого из указанных 11 генов в цельной крови каждого из 3 здоровых добровольцев.

Таблица 8
ИФНα2а-индуцированная экспрессия гена RAB8B нейтрализуется антителом MEDI-545
Образец Ген Среднее значение Стандартное отклонение
107 РАСТВОРИТЕЛЬ RAB8B 1,00
107 ИФН RAB8B 3,45 0,31
107 ИФН + 545 RAB8B 1,30 0,04
107 ИФН + R347 RAB8B 3,15 0,03
Образец Ген Среднее значение Стандартное отклонение
163 РАСТВОРИТЕЛЬ RAB8B 0,70 0,01
163 ИФН RAB8B 2,20 0,04
107 ИФН + 545 RAB8B 1,18 0,01
107 ИФН + R3437 RAB8B 3,71 0,02
175 РАСТВОРИТЕЛЬ RAB8B 0,64 0,01
175 ИФН RAB8B 2,63 0,04
107 ИФН + 545 RAB8B 1,15 0,02
107 ИФН + R347 RAB8B 2,51 0,05
Таблица 9
ИФНα2а-индуцированная экспрессия гена IRF7 нейтрализуется антителом MEDI-545
Образец Ген Среднее значение Стандартное отклонение
107 РАСТВОРИТЕЛЬ IRF7 1,00
107 ИФН IRF7 18,53 3,32
107 ИФН + 545 IRF7 3,42 0,33
107 ИФН + R347 IRF7 19,48 1,67
163 РАСТВОРИТЕЛЬ IRF7 0,91 0,02
163 ИФН IRF7 17,16 1,39
107 ИФН + 545 IRF7 2,92 0,22
107 ИФН + R3437 IRF7 23,28 1,46
175 РАСТВОРИТЕЛЬ IRF7 1,25 0,10
175 ИФН IRF7 24,65 0,80
107 ИФН + 545 IRF7 2,43 0,08
107 ИФН + R347 IRF7 26,34 8,61
Таблица 10
ИФНα2а-индуцированная экспрессия гена MARCKS нейтрализуется антителом MEDI-545
Образец Ген Среднее значение Стандартное отклонение
107 РАСТВОРИТЕЛЬ MARCKS 1,00
107 ИФН MARCKS 3,97 0,09
107 ИФН + 545 MARCKS 1,30 0,08
107 ИФН + R347 MARCKS 2,99 0,10
163 РАСТВОРИТЕЛЬ MARCKS 0,56 0,01
Образец Ген Среднее значение Стандартное отклонение
163 ИФН MARCKS 2,59 0,12
107 ИФН + 545 MARCKS 1,55 0,05
107 ИФН + R3437 MARCKS 4,42 0,07
175 РАСТВОРИТЕЛЬ MARCKS 0,41 0,01
175 ИФН MARCKS 2,59 0,06
107 ИФН + 545 MARCKS 0,55 0,02
107 ИФН + R347 MARCKS 3,38 0,05
Таблица 11
ИФНα2а-индуцированная экспрессия гена IL6ST нейтрализуется антителом MEDI-545
Образец Ген Среднее значение Стандартное отклонение
107 РАСТВОРИТЕЛЬ IL6ST 1,00
107 ИФН IL6ST 3,54 0,60
107 ИФН + 545 IL6ST 2,62 0,16
107 ИФН + R347 IL6ST 8,19 0,54
163 РАСТВОРИТЕЛЬ IL6ST 2,50 0,58
163 ИФН IL6ST 7,69 0,47
107 ИФН + 545 IL6ST 4,18 0,44
107 ИФН + R3437 IL6ST 13,24 0,12
175 РАСТВОРИТЕЛЬ IL6ST 1,37 0,09
175 ИФН IL6ST 7,62 0,56
107 ИФН + 545 IL6ST 2,95 0,38
107 ИФН + R347 IL6ST 23,91 2,77
Таблица 12
ИФНα2а-индуцированная экспрессия гена LY6E нейтрализуется антителом MEDI-545
Образец Ген Среднее значение Стандартное отклонение
107 РАСТВОРИТЕЛЬ LY6E 1,00
107 ИФН LY6E 19,09 0,03
107 ИФН + 545 LY6E 3,50 0,15
107 ИФН + R347 LY6E 12,54 0,20
107 РАСТВОРИТЕЛЬ LY6E 1,02 0,04
107 ИФН LY6E 13,52 0,35
107 ИФН + 545 LY6E 4,80 0,18
Образец Ген Среднее значение Стандартное отклонение
107 ИФН + R347 LY6E 22,56 0,35
107 РАСТВОРИТЕЛЬ LY6E 1,61 0,15
107 ИФН LY6E 19,32 0,68
107 ИФН + 545 LY6E 3,74 0,00
107 ИФН + R347 LY6E 15,57 0,44
Таблица 13
ИФНα2а-индуцированная экспрессия гена IFIT3 нейтрализуется антителом MEDI-545
Образец Ген Среднее значение Стандартное отклонение
107 РАСТВОРИТЕЛЬ IFIT3 1,00
107 ИФН IFIT3 38,43 0,78
107 ИФН + 545 IFIT3 6,78 0,14
107 ИФН + R347 IFIT3 42,59 0,75
163 РАСТВОРИТЕЛЬ IFIT3 0,62 0,01
163 ИФН IFIT3 25,94 0,57
163 ИФН + 545 IFIT3 4,58 0,08
163 ИФН + R347 IFIT3 44,83 0,44
175 РАСТВОРИТЕЛЬ IFIT3 1,32 0,02
175 ИФН IFIT3 35,02 0,48
175 ИФН + 545 IFIT3 5,28 0,05
175 ИФН + R347 IFIT3 29,71 0,79
Таблица 14
ИФНα2а-индуцированная экспрессия гена IFIT1 нейтрализуется антителом MEDI-545
Образец Ген Среднее значение Стандартное отклонение
107 РАСТВОРИТЕЛЬ IFIT1 1,00
107 ИФН IFIT1 80,21 3,44
107 ИФН + 545 IFIT1 13,14 0,02
107 ИФН + R347 IFIT1 86,44 0,57
163 РАСТВОРИТЕЛЬ IFIT1 0,92 0,03
163 ИФН IFIT1 51,65 1,21
163 ИФН + 545 IFIT1 7,60 0,05
163 ИФН + R347 IFIT1 86,63 2,67
Образец Ген Среднее значение Стандартное отклонение
175 РАСТВОРИТЕЛЬ IFIT1 1,47 0,17
175 ИФН IFIT1 82,98 2,94
175 ИФН + 545 IFIT1 8,40 0,24
175 ИФН + R347 IFIT1 58,50 1,47
Таблица 15
ИФНα2а-индуцированная экспрессия гена HERC5 нейтрализуется антителом MEDI-545
Образец Ген Среднее значение Стандартное отклонение
107 РАСТВОРИТЕЛЬ HERC5 1,00
107 ИФН HERC5 41,12 2,87
107 ИФН + 545 HERC5 6,29 0,49
107 ИФН + R347 HERC5 55,04 0,69
163 РАСТВОРИТЕЛЬ HERC5 1,05 0,07
163 ИФН HERC5 75,81 0,50
163 ИФН + 545 HERC5 7,83 0,00
163 ИФН + R347 HERC5 95,44 7,79
175 РАСТВОРИТЕЛЬ HERC5 1,19 0,06
175 ИФН HERC5 74,58 5,79
175 ИФН + 545 HERC5 6,89 0,13
175 ИФН + R347 HERC5 98,15 19,40
Таблица 16
ИФНα2а-индуцированная экспрессия гена OAS1 нейтрализуется антителом MEDI-545
Образец Ген Среднее значение Стандартное отклонение
107 РАСТВОРИТЕЛЬ OAS1 1,00
107 ИФН OAS1 15,11 4,27
107 ИФН + 545 OAS1 3,45 1,03
107 ИФН + R347 OAS1 17,82 3,93
163 РАСТВОРИТЕЛЬ OAS1 0,77 0,22
163 ИФН OAS1 14,19 3,14
163 ИФН + 545 OAS1 3,05 0,75
163 ИФН + R347 OAS1 22,44 3,49
175 РАСТВОРИТЕЛЬ OAS1 1,62 0,38
Образец Ген Среднее значение Стандартное отклонение
175 ИФН OAS1 22,09 0,97
175 ИФН + 545 OAS1 4,04 0,45
175 ИФН + R347 OAS1 15,22 4,48
Таблица 17
ИФНα2а-индуцированная экспрессия гена OAS3 нейтрализуется антителом MEDI-545
Образец Ген Среднее значение Стандартное отклонение
107 РАСТВОРИТЕЛЬ OAS3 1,00
107 ИФН OAS3 49,04 13,74
107 ИФН + 545 OAS3 7,03 0,84
107 ИФН + R347 OAS3 76,8817,82 13,69
163 РАСТВОРИТЕЛЬ OAS3 0,49 0,06
163 ИФН OAS3 42,01 10,01
163 ИФН + 545 OAS3 14,60 4,53
163 ИФН + R3437 OAS3 52,60 7,04
175 РАСТВОРИТЕЛЬ OAS3 1,27 0,14
175 ИФН OAS3 37,87 3,57
175 ИФН + 545 OAS3 3,92 0,06
175 ИФН + R347 OAS3 34,91 2,07
Таблица 18
ИФНα2а-индуцированная экспрессия гена RSAD2 нейтрализуется антителом MEDI-545
Образец Ген Среднее значение Стандартное отклонение
107 РАСТВОРИТЕЛЬ RSAD2 1,00
107 ИФН RSAD2 109,64 36,65
107 ИФН + 545 RSAD2 9,88 0,32
107 ИФН + R347 RSAD2 107,32 35,38
163 РАСТВОРИТЕЛЬ RSAD2 0,56 0,11
163 ИФН RSAD2 71,47 21,17
163 ИФН + 545 RSAD2 4,39 0,60
163 ИФН + R347 RSAD2 114,51 28,63
175 РАСТВОРИТЕЛЬ RSAD2 1,88 0,43
175 ИФН RSAD2 126,27 22,95
Образец Ген Среднее значение Стандартное отклонение
175 ИФН + 545 RSAD2 8,43 0,36
175 ИФН + R347 RSAD2 90,97 7,42

См. также фиг.6 (RAB8B), фиг.7 (IRF7), фиг.8 (MARCKS), фиг.9 (IL6ST), фиг.10 (LY6E), фиг.11 (IFIT3), фиг.12 (IFIT1), фиг.13, (HERC5), фиг.14 (OAS1), фиг.15 (OAS3) и фиг.16 (RSAD2) для графических представлений данных по экспрессии генов для каждого из 11 генов.

Источник интерферона = сыворотка больных СКВ

(а) Нейтрализация ИФН I типа-индуцированных генов антителом MEDI-545 также установлена в цельной крови здоровых добровольцев, которая была простимулирована сывороткой, полученной от больных волчанкой. Образцы сыворотки получают от больных СКВ, которых анализировали в ИФН биоанализе. Цельную кровь отбирают у здоровых доноров в гепаринизированные вакуумные пробирки и МКПК выделяют, используя градиентное центрифугирование Ficoll. Клетки МКПК ресуспендируют в количестве 1×107 клеток/мл в среде RPMI с 10% фетальной сывороткой теленка (ФСТ) и по 125 мкл суспензии клеток вносят в каждую лунку 24-луночного плоскодонного планшета (1,25×106 клеток/лунку). Сыворотку больных СКВ предварительно инкубируют в течение одного часа с антителом MEDI-545 (0,1, 1, 10 мкг/мл), анти-ИФН-γ антителом (1 мкг/мл) или контрольным антителом (10 мкг/мл). Сыворотку больных СКВ вносят к МКПК до конечной концентрации 25% (62,5 мкл/лунку). Дополнительный объем среды RPMI+10% ФСТ вносят в лунки для получения конечного объема 250 мкл/лунку. Планшеты инкубируют при 37°C в течение 4 или 18 ч. После инкубирования РНК собирают внесением 750 мкл Trizol LS в каждую лунку. Образцы замораживают при -70°C до проведения выделения РНК. Табл.21 представляет блокаду антителом MEDI-545 74 ИФН I типа генов в цельной крови здоровых добровольцев после стимуляции ex vivo сывороткой больных СКВ.

Таблица 21
Антитело MEDI-545 блокирует сверхэкспрессию ИФН I типа генов в цельной крови здоровых добровольцев после стимуляции ex vivo сывороткой больных волчанкой
ID зонда D1 002 545.10 D1 004 545.10 D1 17021 545.10 UniGene ID Обозначение гена
219211_at -3,1949 -4,9995 -4,0543 Hs.38260 USP18
217502_at -3,1886 -4,2648 -3,0247 Hs.437609 IFIT2
218400_at -3,1235 -4,3204 -3,9594 Hs.528634 OAS3
213797_at -3,0752 -3,3250 -2,5795 Hs.17518 RSAD2
203153_at -2,8862 -4,6545 -4,7890 Hs.20315 IFIT1
242625_at -2,8104 -2,9506 -2,2214 Hs.17518 RSAD2
204747_at -2,7900 -3,6590 -2,9676 Hs.47338 IFIT3
205483_s_at -2,5237 -2,9955 -3,1566 Hs.458458 ISG15
204439_at -2,5133 -3,5887 -3,5926 Hs.389724 IFI44L
202145_at -2,4809 -3,0198 -3,5950 Hs.521903 LY6E
202869_at -2,4582 -3,5402 -3,2304 Hs.524760 OAS1
235643_at -2,4535 -3,3586 -2,9115 Hs.489118 SAMD9L
219352_at -2,4496 -3,5983 -3,8692 Hs.529317 HERC6
204415_at -2,4417 -2,5228 -2,3149 Hs.523847 IFI6
219684_at -2,4167 -2,8965 -2,1421 Hs.43388 RTP4
236156_at -2,4160 -2,5440 -2,8885 Hs.127445 LIPA
205552_s_at -2,3880 -3,3679 -2,7561 Hs.524760 OAS1
206133_at -2,3139 -3,0772 -2,4787 Hs.441975 BIRC4BP
214453_s_at -2,2965 -3,1707 -3,3204 Hs.82316 IFI44
1556643_at -2,2666 -2,0429 -1,7120 Hs.515243 LOC93343
228607_at -2,2597 -2,1659 -2,3234 Hs.414332 OAS2
218943_s_at -2,2563 -2,4118 -2,6600 Hs.190622 DDX58
242020_s_at -2,2542 -2,6436 -1,7975 Hs.302123 ZBP1
204959_at -2,2501 -1,3731 -1,5559 Hs.153837 MNDA
226757_at -2,2481 -2,9288 -2,3984 Hs.437609 IFIT2
219863_at -2,2465 -3,0980 -3,8114 Hs.26663 HERC5
229450_at -2,2281 -3,2200 -2,2151 - -
214059_at -3,2929 -3,5281 Hs.82316 IFI44
232517_s_at -2,1925 -2,2750 -2,4569 Hs.517180 PRIC285
232666_at -2,1925 -1,9206 -1,4938 Hs.528634 OAS3
230036_at -2,1654 -3,0256 -2,4879 Hs.489118 SAMD9L
227609_at -2,1548 -2,5608 -1,1577 Hs.546467 EPSTI1
226702_at -2,1420 -3,0150 -3,0155 Hs.7155 LOC129607
226603_at -2,1183 -2,8672 -2,4103 Hs.489118 SAMD9L
210397_at -2,1095 -0,5687 -2,0322 Hs.32949 DEFB1
204994_at -2,0685 -3,2727 -3,6132 Hs.926 MX2
202086_at -2,0661 -3,2741 -3,6406 Hs.517307 MX1
228617_at -2,0596 -2,5832 -2,3139 Hs.441975 BIRC4BP
219364_at -2,0583 -2,3774 -2,4651 Hs.55918 LGP2
209417_s_at -2,0364 -2,5262 -2,4132 Hs.632258 IFI35
222154_s_at -2,0330 -2,4542 -2,6425 Hs.120323 DNAPTP6
228230_at -2,0323 -2,9621 -3,0255 Hs.517180 PRIC285
242234_at -2,0161 -3,0047 -3,1633 Hs.441975 BIRC4BP
219519_s_at -2,0077 -2,2596 -3,1621 Hs.31869 SIGLEC1
207713_s_at -1,9940 -1,0134 -1,6345 Hs.247280 C20 or fl8
218974_at -1,8904 -2,5122 -2,5244 Hs.445244 FLJ10159
1552309_a_at -1,8820 -2,4284 -2,7221 Hs.632387 NEXN
210873_x_at -1,8424 -1,2891 -1,2710 Hs.348983 APOBEC3A
ID зонда D1 002 545.10 D1 004 545.10 D1 17021 545.10 UniGene ID Обозначение гена
243271_at -1,8388 -2,2657 -2,0595 Hs.489118 SAMD9L
202411_at -1,8385 -0,1345 -2,4757 Hs.532634 IFI27
222793_at -1,8137 -2,4540 -2,6576 Hs.190622 DDX58
235276_at -1,8007 -2,6121 -1,4780 - -
203236_s_at -1,7926 -1,9069 -2,6425 Hs.81337 LGALS9
225291_at -1,7801 -2,0167 -2,4613 Hs.388733 PNPT1
44673_at -1,7547 -0,1337 -2,3913 Hs.31869 SIGLEC1
213294_at -1,7361 -2,4393 -2,5907 Hs.546523 -
211122_s_at -1,7296 -3,0816 -1,5743 Hs.632592 CXCL11
224701_at -1,6827 -1,7880 -1,2356 Hs.583792 PARP14
230314_at -1,6795 -2,2159 -2,3476 Hs.112420 -
218986_s_at -1,6648 -2,1615 -2,0204 Hs.591710 FLJ20035
205569_at -1,6647 -2,5741 -2,6878 Hs.518448 LAMP3
219691_at -1,6420 -1,8434 -1,8310 Hs.65641 SAMD9
20421l_x_at -1,6244 -2,0612 -2,3379 Hs.131431 EIF2AK2
220146_at -1,6033 -2,7419 -1,7471 Hs.443036 TLR7
241916_at -1,6026 -1,5906 -1,3802 Hs.130759 PLSCR1
229350_x_at -1,5906 -1,7395 -1,3577 Hs.348609 PARP10
1555464_at -1,5866 -1,7397 -1,3101 Hs.163173 IFIH1
204972_at -1,5822 -2,8402 -2,8355 Hs.414332 OAS2
204698_at -1,5277 -1,5978 -1,6553 Hs.459265 ISG20
203595_s_at -1,4853 -1,8724 -1,5442 Hs.252839 IFIT5
220576_at -1,4834 -1,7834 -1,0040 Hs.229988 PGAP1
1555491_a_at -1,4739 -1,0165 -1,4991 - FLJ11286
1565752_at -1,4418 -0,0040 -1,0835 Hs.509664 FGD2
203596_s_at -1,4389 -2,0356 -1,9284 Hs.252839 IFIT5

Анализ генов, однозначно активируемых через 18 ч, выявляет повышенную регуляцию генов, участвующих во врожденном иммунном ответе (TLR, NFкB), адаптивном иммунном ответе (NFAT, ИЛ-1/ИЛ-6), активации комплемента, а также хемотаксисе лейкоцитов и адгезии. Возможно, что нейтрализация тип ИФН метаболического пути обладает возможностью модифицировать расположенные ниже метаболические пути, которые могут существенно повлиять на патогенез СКВ.

Также проводят анализ Heatmap для изучения индукции ИФН I типа подписи в МКПК здорового донора под воздействием сыворотки больного СКВ и нейтрализации ИФН I типа подписи антителом MEDI-545. См. фиг.67. Обработка анти-ИФН-α моноклональным антителом (линии 4-6) показывает строгую нейтрализацию большого числа генов, стимулируемых сывороткой больного СКВ. Кроме того, нейтрализация анти-ИФН-α моноклональным антителом является доза-зависимой, что означает, что эти гены могут быть хорошими кандидатами для ФД. Контрольное моноклональное антитело само ингибирует сверхэкспрессию некоторых генов, регуляция которых повышается при обработке сывороткой больного СКВ; некоторые из них идентифицированы в качестве ИФН типа I-индуцируемых генов. Однако эффект анти-ИФН-α моноклонального антитела намного шире и обладает сильной нейтрализацией, наблюдаемой на большом количестве генов, на которые ни контрольное моноклональное антитело, ни анти-ИФН-γ моноклональное антитело, не проявили какого-либо существенного воздействия (линия 2, линии 4-6). Следует отметить, что лечение анти-ИФН-αR моноклональным антителом (дорожка 7) вызывает большую нейтрализацию, по сравнению с анти-ИФНα моноклональным антителом, что означает наличие других представителей ИФН I типа семейства в сыворотке больных СКВ помимо ИФН-α.

(б) Проводят дополнительное исследование для идентификации ранних и поздних ответов в виде транскрипции в клетках МКПК здоровых доноров после стимуляции сывороткой больного СКВ. В этом исследовании четыре образца сыворотки больных СКВ с различными уровнями действия ИФНα используют для стимуляции МКПК, выделенных от здорового донора. Варьирующие уровни действия ИФНα в четырех образцах сыворотки больных СКВ определяют методом с применением репортерного гена люциферазы согласно описанию в примере 20. Вкратце, клетки НЕК293Н стабильно трансфецируют конструкцией люциферазы (Gaussia princeps) под контролем стимулируемого интерфероном элемента ответа (IFN-stimulated response element - ISRE). Трансфецированные клетки инкубируют с 50% сывороткой пациента, и активность люциферазы выявляют в супернатантах культур через 24 ч. Образцы, генерирующие сигнал выше, чем 1,5Х в лунках отрицательного контроля (нормальная сывортка человека), оценивают в качестве положительных. Чтобы определить, какой класс ИФН I типа ответственен за положительный ответ, клетки обрабатывают моноклональными антителами против ИФН I типа и тип-II ИФН. Фиг.70а показывает диапазон уровней активности ИФН I типа в каждом из четырех образцов сыворотки больных СКВ.

Каждый из образцов сыворотки четырех пациентов с СКВ инкубируют совместно с мононуклеарными клетками периферической крови (МКПК), выделенными от здорового добровольца. МКПК от здорового добровольца (ранее определенного в качестве обладающего отрицательной ИФН-подписью) выделяют, используя центрифугирование в градиенте плотности Ficoll. Выделенные МКПК инкубируют с 25% сыворотки пациента с СКВ или с 25% аутологической сыворотки пациента (в качестве отрицательного контроля). После инкубирования клетки собирают с помощью Trizol LS и хранят при -70°C для выделения РНК. Общую РНК экстрагируют, причем чистоту и концентрацию РНК определяют спектрофотометрически (260/280>1,9). Выработку и гибридизацию меченой биотином амплифицированной комплементарной РНК (кРНК) проводят по инструкциям производителя (фирма Affymetrix, Санта-Клара, Калифорния). Данные получают путем разграничения по трехкратной (повышенная регуляция) экспрессии при стимуляции сывороткой больных СКВ по сравнению с аутологическими контрольными образцами сыворотки (величина q≤0,05). Фиг.70б показывает ряд зондов, выявленных по повышенной регуляции в 3 раза или более в МКПК здоровых волонтеров под воздействием каждого из четырех образцов сыворотки больных СКВ. Число зондов, выявленных в качестве повышенной в три раза или более регуляции под воздействием сыворотки больного СКВ, соответственно повышает уровень действия ИФН I типа, обнаруживаемый в образце сыворотки пациента с СКВ.

Затем исследовали роль интерферонов I типа в индукции повышенной регуляции (в три раза или более) зондов с помощью образцов сыворотки больных СКВ. Клетки МКПК, выделенные от здорового добровольца, описанные выше, инкубировали с 25% сыворотки пациентов с СКВ в присутствии или отсутствие нейтрализующих антител против ИФН-α, или несоответствующих моноклональных антител, в течение 4 или 18 ч. В качестве отрицательного контроля МКПК инкубируют с 25% аутологической сыворотки пациента. После инкубирования клетки собирают с помощью Trizol LS и хранят при -70°C для выделения РНК. Общую РНК экстрагируют, а чистоту и концентрацию РНК определяют спектрофотометрически (260/280>1,9). Выработку и гибридизацию меченной биотином амплифицированной комплементарной РНК (кРНК) проводят по инструкциям производителя (фирма Affymetrix, Санта-Клара, Калифорния). Программное обеспечение ArrayAssist® Lite используют для подсчета суммарных данных по уровням зондов, полученных по файлам интенсивности матриц и R пакетов, используемых для выявления иным образом регулируемых генов (трехкратная или более повышенная регуляция экспрессии после стимуляции сывороткой больного СКВ по сравнению с контрольными образцами аутологичной сыворотки (величина q≤0,05); фирма R Development Core Team, Новая Зеландия). Затем определяют процент нейтрализации подсчетом процента изменения для каждого зонда повышенной регуляции, после обработки анти-ИФНα антителом и без такой обработки. Фиг.71а представляет heatmap, показывающие процент нейтрализации зондов, которые были выявлены по повышенной регуляции после обработки анти-ИФНα для ИФН I типа генов (689 зондов) и не-ИФН I типа генов (зонды, индуцированные сывороткой больного СКВ и не входящие в список ИФН I типа генов) после 4 и 18 ч инкубации. Фиг.71б показывает для каждого из четырех образцов сыворотки больных СКВ процент зондов с ИФН I типа генной подписью или не-ИФН I типа генной подписью, нейтрализованных обработкой анти-ИФНα, после 4 и 18 ч инкубации. Установлено, что большинство генов, нейтрализованных обработкой анти-ИФНα, в клетках МКПК здоровых добровольцев, обработанных сывороткой больного СКВ, через 4 ч после инкубации относятся к ИФН I типа генам, хотя большинство генов, нейтрализованных обработой анти-ИФНα, в клетках МКПК здоровых добровольцев, обработанных сывороткой больного СКВ, через 18 ч после инкубации не относятся к ИФН I типа генам.

Гены, будь то ИФН I типа гены или не ИФН I типа гены, регуляция которых была повышена и нейтрализована обработкой анти-ИФНα через 18 ч, но не была повышена регуляция через 4 ч (т.е. «уникальные гены»), идентифицируют для каждого образца сыворотки от больных СКВ. Фиг.72 представляет (а) ИФН I типа гены и (б) не-ИФН I типа гены, которые были выявлены в качестве уникальных генов. Затененные области показывают более 50% нейтрализации анти-ИФНα в данном образце пациента.

Метаболические пути и процессы в клетке, нейтрализованные обработкой анти-ИФНα через 18 ч, вовлечены в сигнальные метаболические пути цитокинов и хемокинов, иммунную регуляцию, клеточную адгезию и выживание клеток. См. фиг.73, которая представляет таблицу, показывающую анализ метаболического пути измененных генов и белков через 18 ч. Метаболические пути, отмеченные желтым цветом, также существенно изменены в образцах сыворотки больных СКВ. Метаболические пути и процессы в клетке, нейтрализованные обработкой анти-ИФНα через 18 ч, анализируют с помощью интегрированного программного обеспечения MetaCore фирмы GeneGo, Inc., используя идентифицированные уникальные гены. Только метаболические пути с величинами p≤0,05 оценивают в качестве существенных. Показанные метаболические пути были изменены по меньшей мере в 2 из 4 образцов сыворотки пациентов с СКВ.

Пример 6. Введение продукта MEDI-545 пациентам с волчанкой нейтрализует шаблон экспрессии ИФНα-индуцируемых ФД-маркеров-кандидатов

Цельную кровь больных волчанкой, получавших плацебо, 0,3 мг/кг, 1,0 мг/кг и 3,0 мг/кг MEDI-545, анализируют на экспрессию ИФНα-индуцируемых ФД маркеров на протяжении курса длительностью 28 суток. Цельную кровь (~2,5 мл) отбирают в пробирки PAXgene для РНК и обрабатывают, согласно описанному выше. При повышении доз антитела MEDI-545 нейтрализуется повышенная регуляция экспрессии 25 топовых ФД маркеров. См. фиг.18, фиг.23 и фиг.24, которые представляют графически нейтрализацию указанных топовых 25 ФД маркеров после введения варьирующих концентраций MEDI-545 ИФНα антитела на протяжении различного времени. Топовые 25 ФД маркеров, измеренные в настоящем исследовании, представлены в табл.19.

Таблица 19
25 топовых ИФН-индуцированных ФД маркеров у больных волчанкой
ID зонда UniGene ID Генный продукт Обозначение гена
202086_at Hs.517307 Устойчивость к миксовирусу (вирусу гриппа) 1, интерферон-индуцируемый белок p78 (мышь) МХ1
202145_at Hs.521903 Комплекс лимфоцитарного антигена 6, локус Е LY6E
202411_at Hs.532634 Интерферон альфа-индуцируемый белок 27 IFI27
202869_at Hs.524760 2′,5′-олигоаденилат синтетаза 1, 40/46 кДа OAS1
203153_at Hs.20315 Интерферон-индуцированный белок с тетратрикопептидными повторами 1 IFIT1
204415_at Hs.523847 Интерферон альфа-индуцируемый белок 6 IFI6
204439_at Hs.389724 Белок, подобный интерферон-индуцированному белку 44
205483_s_at Hs.458485 ISG15 убиквитин-подобный модификатор ISG15
205569_at Hs.518448 Лизосомально-ассоциированный мембранный белок 3 LAMP3
205660_at Hs.118633 Белок, подобный 2′-5′-олигоаденилат синтетазе OASL
213797_at Hs.17518 Белок 2, содержащий домен радикал S-аденозилметионин RSAD2
214059_at Hs.82316 Интерферон-индуцированный белок 44 IFI44
ID зонда UniGene ID Генный продукт Обозначение гена
217502_at Hs.437609 Интерферон-индуцированный белок с тетратрикопептидными повторами 2 IFIT2
218400_at Hs.528634 2′-5′-олигоаденилат синтетаза 3, 100 кДа OAS3
219211_at Hs.38260 Убихинон-специфичная пептидаза 18 USP18
219519_s_at Hs.31869 Связывающий сиаловую кислоту Ig-подобный лектин 1, сиалоадгезин SIGLEC1
219863_at Hs.26663 hect домен и RLD 5 HERC5
222154_s_at Hs.120323 ДНКполимераза-трансактивированный белок 6 DNAPTP6
226702_at Hs.7155 Гипотетический белок LOC129607 LOC129607
227609_at Hs.546467 Эпителиально-стромальное взаимодействие 1 (грудь) EPSTI1
229450_at - - -
235276_at - - -
239979_at Hs.546467 Эпителиально-стромальное взаимодействие 1 (грудь) EPSTI1
242234_at Hs.441975 XIAP ассоциированный фактор-1 BIRC4BP
44673_at Hs.31869 Связывающий сиаловую кислоту Ig-подобный лектин 1, сиалоадгезин SIGLEC1

Нейтрализацию ИФН-индуцированных ФД маркеров антителом MEDI-545 у нескольких больных волчанкой исследуют и представляют результаты на фиг.19-21. Фиг.19 и 20 представляют heatmap по нейтрализации топовых 25 ФД маркеров (см. табл.19) для двух конкретных больных волчанкой (фиг.19, больной 1541 и фиг.20, больной 1449). Каждый из указанных больных волчанкой получал 3 мг/кг MEDI-545. Каждый проявляет нейтрализацию 25 топовых индуцируемых ФД маркеров на 7 и 14 сутки после лечения антителом MEDI-545.

Также исследуют нейтрализацию топовых 25 ИФН I типа-индуцируемых генов в цельной крови больных СКВ, подвергшейся обработке высокой дозой (30 мг/кг) антитела MEDI-545. Heatmap нейтрализации топовых 25 ИФН-I типа индуцируемых генов на 1, 4, 7 и 14 сутки после введения антитела MEDI-545 представлена на фиг.25(а). Нейтрализацию всех генов можно наблюдать после введения MEDI-545. Фиг.25(б) представляет АГК целевое модулирование, основанное на топовых 25 ИФН типа I-индуцируемых генах. Диаграмма АГК показывает прогрессирование больного СКВ после лечения от состояния, прямо противоположного состоянию нормальных здоровых доноров до введения антитела MEDI-545, до состояния, при котором он концентрируется со здоровыми донорами после введения MEDI-545.

Нейтрализация 165 ФД маркеров с помощью антитела MEDI-545 исследуют у дополнительных больных волчанкой, которым вводят пониженную дозу антитела (0,3 мг/кг). См. фиг.21. Антитело MEDI-545 нейтрализует большинство из 165 ФД маркеров-кандидатов у больных волчанкой. 165 ФД маркеров-кандидатов показано в качестве первых 165 в табл.20.

Нейтрализация ИФН I типа-индуцируемых наборов зондов не установлена у больных СКВ, которых лечили плацебо в качестве контроля. Сравнение графиков АГК больных СКВ до (а) и после (б) дозирования плацебо на фиг.26. Таким образом, нейтрализация ИФН I типа ФД маркеров осуществляется антителом MEDI-545.

Табл. 22 представляет перечень 63 ИФН I типа-индуцируемых зондов, регуляция которых повышена в цельной крови больных волчанкой и нейтрализована с помощью MEDI-545 или плацебо по меньшей мере на 30% на 7 сутки, 14 сутки или 28 сутки после введения. В каждом наборе колонок представлены данные по нейтрализации каждого из указанных генов на 7, 14 и 28 сутки после введения. Первый набор колонок представляет процент нейтрализации каждого из индикаторных генов у больных волчанкой, имеющих ИФН I типа подпись, и тех, которые были обработаны антителом MEDI-545. Можно отметить, что у каждого из указанных генов нейтрализация варьирует от 30% до 68% на 7 сутки после введения. В то же время на 7 сутки в группе применения плацебо нейтрализация тех же генов варьирует от 0% до 27%.

Таблица 22
Нейтрализация 63 ИФН I типа-индуцируемых зондов в цельной крови больных волчанкой с помощью антитела MEDI-545
Обозначение Гена (ИФН I типа-индуцируемых) ID зонда Образцы больных волчанкой с ИФН Все образцы больных волчанкой Образцы больных волчанкой без ИФН Образцы, получавшие плацебо
7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки
IFI44 214059_at 0,6871 0,6276 0,5047 0,3433 0,2657 0,2357 -0,0799 -0,2278 -0,0088 -0,1325 -1,91 -0,4185
IFI44L 204439_at 0,6621 0,6193 0,5515 0,6662 0,5561 0,492 0,6713 0,4698 0,4379 0,007 -2,1816 0,0035
RSAD2 213797_at 0,6547 0,631 0,5213 0,6023 0,4611 0,4464 0,5377 0,2294 0,3783 -0,2332 -5,0172 -0,9617
G1P2 205483_s_at 0,6395 0,5954 0,5703 0,5404 0,4781 0,4148 0,4185 0,3181 0,2734 0,0423 -0,944 0,1706
RSAD2 242625_at 0,6359 0,6123 0,4946 0,5607 0,541 0,3443 0,4681 0,4437 0,2077 -0,3537 -2,7176 -0,2632
USP18 219211_at 0,6305 0,6269 0,5577 0,4322 0,4423 0,4082 0,1882 0,1907 0,2723 -0,4424 -2,4219 -0,4972
IFI44 214453_s_at 0,626 0,5875 0,4223 0,4956 0,2741 0,2298 0,3352 -0,1532 0,0547 -0,2833 -1,0524 -2,4005
IFIT1 203153_at 0,6224 0,6093 0,5376 0,5442 0,4586 0,4182 0,448 0,2532 0,3097 -0,1604 -1,1565 -0,436
IFIT3 204747_at 0,6213 0,5676 0,5638 0,5212 0,4174 0,3854 0,398 0,2124 0,2232 -5,9101 -9,7543 -7,4011
SERPING1 200986_at 0,617 0,6214 0,5974 0,4617 0,4294 0,3673 0,2706 0,1676 0,1582 -0,5973 -2,7824 -0,4193
HERC6 219352_at 0,5996 0,531 0,5352 0,3581 0,3678 0,4335 0,0609 0,1452 0,341 -0,9901 -4,4468 -1,6832
DNAPTP6 222154_s_at 0,5973 0,6223 0,5016 0,345 0,3819 0,2244 0,0345 0,0543 -0,0276 0,028 -1,947 0,007
OASL 210797_s_at 0,5968 0,5529 0,5815 0,4715 0,3853 0,4208 0,3174 0,1569 0,2748 -0,1014 -1,6808 -0,1344
HERC5 219863_at 0,5948 0,5552 0,4997 0,4651 0,4521 0,3816 0,3054 0,3115 0,2742 -0,0955 -0,9446 -0,1306
Обозначение Гена (ИФН I типа-индуцируемых) ID зонда Образцы больных волчанкой с ИФН Все образцы больных волчанкой Образцы больных волчанкой без ИФН Образцы, получавшие плацебо
7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки
OAS3 218400_at 0,589 0,5792 0,5062 0,4846 0,4039 0,3562 0,3065 0,311 -0,0945 -1,1786 -0,1744
IFRG28 219684_at 0,581 0,5218 0,4955 0,3014 0,3035 0,2441 -0,0427 0,0058 0,0155 -2,1401 -2,8445 -3,3644
МХ1 202086_at 0,5807 0,5329 0,5073 0,512 0,4831 0,4001 0,4273 0,4152 0,3026 -0,0951 -0,7789 0,01
OAS1 202869_at 0,5761 0,5148 0,5652 0,4345 0,429 0,4373 0,2603 0,3119 0,3211 0,0389 -0,6246 0,0692
OASL 205660_at 0,5681 0,5549 0,5494 0,4814 0,4415 0,4046 0,3746 0.2868 0,2729 -0,0675 -0,9765 0,0773
OAS1 205552_s_at 0,5678 0,5193 0,56 0,4796 0,4115 0,4196 0,3711 0,2644 0,292 -0,1562 -1,7918 -0,395
LAMP3 205569_at 0,5531 0,6796 0,4871 0,3427 0,4182 0,2854 0,0838 0,0618 0,1021 0,007 -1,4332 0,045
MGC20410 228439_at 0,535 0,5085 0,5093 0,359 0,2949 0,332 0,1424 0,0036 0,1709 -1,1629 -2,0558 -0,5523
SN 219519_s_at 0,5321 0,5639 0,5307 0,307 0,3711 0,212 0,03 0,1081 -0,0778 -0,1736 -4,8297 0,1133
HSXIAPAF1 228617_at 0,5317 0,503 0,4707 0,3942 0,3604 0,266 0,2249 0,1659 0,0799 -0,2206 -0,7607 -0,1053
IFIT5 203596_s_at 0,5257 0,4922 0,3314 0,3004 0,1997 0,0723 0,023 -0,1991 -0,1633 0,0791 -0,2048 -0,1939
IRF7 208436_s_at 0,5183 0,494 0,4717 0,4318 0,3509 0,301 0,3253 0,1557 0,1459 0,1162 -0,2791 0,2159
EPST11 227609_at 0,517 0,5298 0,4999 0,3142 0,2662 0,2798 0,0646 -0,0932 0,0797 0,0161 -1,0185 -0,1578
EPST11 239979_at 0,5074 0,4803 0,553 0,3738 0,3527 0,3674 0,2093 0,1786 0,1987 -0,6502 -1,8449 -0,4975
ETV7 224225_s_at 0,5057 0,5101 0,3596 0,2965 0,2389 0,0985 0,039 -0,1308 -0,1389 -0,5808 -1,3814 -0,6834
Обозначение Гена (ИФН I типа-индуцируемых) ID зонда Образцы больных волчанкой с ИФН Все образцы больных волчанкой Образцы больных волчанкой без ИФН Образцы, получавшие плацебо
7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки
IFIT5 203595_s_at 0,5056 0,4731 0,2902 0,2482 0,2263 0,028 -0,0685 -0,1102 -0,2105 -0,1956 -0,4059 -0,6195
HES4 227347_x_at 0,4998 0,4746 0,4266 0,3377 0,3141 0,2703 0,1383 0,0953 0,1283 0,0775 -0,3688 0,2619
ZC3HDC1 218543_s_at 0,4812 0,4274 0,4076 0,3058 0,2935 0,2109 0,0898 0,1109 0,0321 0,055 -0,1726 0,1826
C7orf6 230036_at 0,4636 0,4665 0,4025 0,3114 0,2848 0,2299 0,1241 0,037 0,073 0,0287 -0,4023 -0,002
C7orf6 226603_at 0,4578 0,4242 0,3425 0,264 0,1555 0,1794 0,0253 -0,211 0,0312 -0,2153 -0,8023 -0,4988
OAS3 232666_at 0,4557 0,3628 0,4828 0,3165 0,2457 0,3356 0,1452 0,086 0,2018 -0,3754 -1,0637 -0,0014
OAS2 204972_at 0,4532 0,4503 0,3889 0,2963 0,3106 0,2084 0,1032 0,1202 0,0444 -0,1067 -0,9025 -0,1084
IFIT2 217502_at 0,4514 0,4519 0,1899 0,0857 -0,039 -0,4306 -0,3643 -0,7083 -0,9948 -0,7316 -0,9653 -4,4123
CXCL10 204533_at 0,4476 0,4647 0,262 0,1834 0,1911 0,1282 -0,1418 -0,1819 0,0066 -0,1664 -0,9562 -0,1939
LY6E 202145_at 0,4463 0,4582 0,4113 0,3404 0,3294 0,2612 0,21 0,1536 0,1247 -0,4715 -1,729 -0,5955
HERC6 239988_at 0,4449 0,3726 0,3596 0,2951 0,2402 0,2433 0,1108 0,0596 0,1376 0,2771 -0,098 0,0584
G1P3 204415_at 0,4421 0,3914 0,1018 0,152 0,3129 -0,3045 -0,205 0,2058 -0,6738 -0,3862 -0,3826 -0,4763
C7orf6 24327l_at 0,4419 0,4279 0,401 0,2663 0,2445 0,2165 0,0501 -0,0055 0,0488 1,00Е-04 -0,2487 0,116
OAS2 206553_at 0,4377 0,3721 0,2965 0,3008 0,2379 0,1882 0,1323 0,0548 0,0897 -0,0861 -1,1845 -0,2322
APOL6 241869_at 0,4264 0,063 0,4352 -0,0787 -0,5482 -0,2042 -0,7003 -1,3816 -0,7855 -1,0548 -2,225 0,0949
ZBP1 242020_s_at 0,4232 0,406 0,3729 0,0761 0,1281 0,2718 - - 0,1799 0,0954 - -
Обозначение Гена (ИФН I типа-индуцируемых) ID зонда Образцы больных волчанкой с ИФН Все образцы больных волчанкой Образцы больных волчанкой без ИФН Образцы, получавшие плацебо
7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки
0,3512 0,2508 0,6879 0,0275
PLSCR1 202446_s_at 0,4022 0,3948 0,2996 0,1919 0,1973 0,1063 -0,0668 -0,0719 -0,0694 0,0049 -0,5041 -0,1826
OAS2 228607_at 0,3989 0,3655 0,3374 0,2712 0,2174 0,1639 0,114 0,0155 0,0061 -0,026 -0,5978 -0,0611
TRIM6 223599_at 0,3896 0,3464 0,2669 0,2285 0,1987 0,1119 0,0303 -0,0027 -0,0289 -0,4333 -1,2181 -0,76
ZCCHC2 233425_at 0,3891 0,4249 0,3925 0,2541 0,2965 0,2822 0,088 0,1213 0,182 -0,1376 -0,4844 -0,075
PLSCR1 202430_s_at 0,3847 0,3858 0,2706 -0,2032 -0,0283 -0,1714 -0,9268 -0,5931 -0,5733 -0,091 -0,5114 -0,3841
CLEC4D 1552773_at 0,3782 0,2012 0,1293 -0,5127 -0,9029 -0,5568 -1,6091 -2,4085 -1,1806 -0,0151 -0,298 -0,9965
ECGF1 204858_s_at 0,3778 0,2403 0,2971 0,3178 0,1699 0,0019 0,244 0,0741 -0,2665 0,0637 -0,2711 0,1519
C7orf27 233880_at 0,3658 0,3508 0,2804 0,2913 0,2599 0,108 0,1996 0,136 -0,0488 -0,4266 -0,7606 -0,4247
SN 44673_at 0,3642 0,3373 0,3736 0,2344 0,2522 0.1405 0,0747 0,1362 -0,0714 -0,321 -1,2105 0,1766
PRIC285 228230_at 0,3636 0,4131 0,3363 0,2701 0,2731 0,1074 0,155 0,0822 -0,1008 -0,5711 -0,6313 -0,1671
PARP14 22470l_at 0,3611 0,3765 0,3718 0,2737 0,2855 0,2267 0,1662 0,1614 0,0947 -0,0715 -0,3247 0,0835
DNAPTP6 241812_at 0,3448 0,3672 0,2896 0,2048 0,2134 0,108 0,0325 0,0037 -0,0571 -0,134 -0,5147 0,0613
HSXIAPAF1 242234_at 0,3371 0,3793 0,1084 0,1586 0,1796 -0,2285 -0,0612 -0,0927 -0,5347 -0,4102 -0,7359 0,0295
TNFAIP6 206025_s_at 0,336 0,3559 0,3269 0,1913 0,1909 0,1164 0,0133 -0,034 -0,0751 -0,3457 -0,7114 -0,2343
LGALS3BP 200923_at 0,331 0,27 0,2644 - 0,1764 0,1032 -0,512 0,0487 - 0,111 - 0,3187
Обозначение Гена (ИФН I типа-индуцируемых) ID зонда Образцы больных волчанкой с ИФН Все образцы больных волчанкой Образцы больных волчанкой без ИФН Образцы, получавшие плацебо
7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки 7 сутки 14 сутки 28 сутки
0,0457 0,0434 0,2857
CKS2 204170_s_at 0,3215 0,0604 0,0634 -0,2323 -0,5787 -1,1884 -0,914 -1,4502 -2,3265 -0,3697 0.1034 -1,5141
STAT2 205170_at 0,3176 0,1781 0,1852 0,1643 -0,0318 -0,051 -0,0245 -0,318 -0,2657 0,0708 -0,6738 -0,8915
EIF2AK2 204211_x_at 0,3094 0,3621 0,2577 0,2165 0,286 0,1441 0,1021 0,1822 0,0408 -0,2044 -0,3038 -0,2554

Табл. 33 представляет результаты отдельного исследования, которое показывает топовых 50 генов, нейтрализованных в цельной крови больного СКВ через 7 суток после лечения антителом MEDI-545. Только три гена из 50 генов, ZCCHC2, REC8L1 и GCLM, не относятся к ИФН-α/β-индуцируемым генам.

Таблица 33
Тоновые 50 зондов, нейтрализованных через 7 суток после дозирования у больных СКВ, которых лечили MEDI-545
ID зонда UniGene ID Название гена Обозначение гена Стандартное расположение зондов (по % нейтрализации) Итоговое расположение зондов
219352_at Hs.529317 hect домен и RLD 6 HERC6 2277,0 1
208436 s at Hs.166120 Фактор регуляции активности интерферона 7 IRF7 2497,5 2
210797 s at Hs.118633 Белок, подобный 2′-5′-олигоаденилат синтетазе OASL 2708,2 3
205483 s at Hs.458485 ISG15 убиквитин-подобный модификатор ISG15 2735,7 4
204439_at Hs.389724 Белок, подобный интерферон-индуцированному белку 44 IFI44L 3194,9 5
219211 at Hs.38260 Убихинон-специфичная пептидаза 18 USP18 3458,6 6
218543 sat Hs.12646 Семейство поли (АДФ-рибоза) полимеразы, представитель 12 PARP12 3472,3 7
205241_at Hs.567405 SCO цитохром оксидазы недостаточный гомолог 2 (дрожжи) SCO2 3825,7 8
204747 at Hs.47338 Интерферон-индуцированный белок с тетратрикопептидными повторами 3 IFIT3 3987,2 9
219519 s at Hs.31869 Связывающий сиаловую кислоту Ig-подобный лектин 1, сиалоадгезин SIGLEC1 4207,2 10
228230_at Hs.517180 Рецептор A, активируемый пролифератором пероксисом, взаимодействующего комплекса 285 PRIC285 4373,1 11
235276 at - - 4438,7 12
214059_at Hs.82316 Интерферон-индуцированный белок 44 IFI44 4477,4 13
222154 s at Hs.120323 ДНКполимераза-трансактивированный белок 6 DNAPTP6 4531,3 14
ID зонда UniGene ID Название гена Обозначение гена Стандартное расположение зондов (по % нейтрализации) Итоговое расположение зондов
202145 at Hs.521903 Комплекс лимфоцитарного антигена 6, локус Е LY6E 4618,6 15
223849_s_at Hs.514941 Mov10, вирус лейкоза Молони 10, гомолог (мышиный) MOV10 4691,0 16
219364 at Hs.55918 Предположительно ортолог гена D111gp2 мыши LGP2 4717,4 17
224503 s at Hs.114191 Цинковый палец, ССНС содержащий домен 2 ZCCHC2 4926,5 18
228617_at Hs.441975 XIAP ассоциированный фактор-1 BIRC4BP 4942,0 19
53720 at - Гипотетический белок FLJ11286 FLJ11286 5046,2 20
218400 at Hs.528634 2′-5′-олигоаденилат синтетаза 3, 100 кДа OAS3 5136,7 21
235508_at Hs.526464 Промиелоцитный лейкоз PLM 5328,7 22
232155_at Hs.514554 KIAA1618 KIAA1618 5344,5 23
202086_at Hs.517307 Устойчивость к миксовирусу (вирусу гриппа) 1, интерферон-индуцируемый белок p78 (мышь) МХ1 5484,4 24
242625 at Hs.17518 Белок 2, содержащий домен радикал S-аденозилметионин RSAD2 5522,4 25
209417 s at Hs.632258 Интерферон-индуцированный белок 35 IFI35 5529,4 26
228439_at Hs.124840 базовый лейциновый зиппер фактора транскрипции, подобный ATF 2 BATF2 5563,0 27
221766 s at Hs.10784 Семейство с последовательностью, близкой 46, представитель A FAM46A 5607,1 28
202446 s at Hs.130759 Скрамблаза фосфолипидов 1 PLSCR1 5911,3 29
205660_at Hs.118633 Белок, подобный 2′-5′-олигоаденилат синтетазе OASL 6001,3 30
205875 s at Hs.344812 Репарирующая экзонуклеаза с 3′-конца 1 TREX1 6062,0 31
34689 at Hs.344812 Репарирующая экзонуклеаза с 3′-конца 1 TREX1 6097,0 32
202869 at Hs.524760 2′,5′- олигоаденилат синтетаза 1, 40/46 кДа OAS1 6101,5 33
ID зонда UniGene ID Название гена Обозначение гена Стандартное расположение зондов (по % нейтрализации) Итоговое расположение зондов
214453 s at Hs.82316 Интерферон-индуцированный белок 44 IFI44 6210,4 34
1555491_s_at - Гипотетический белок FLJ11286 FLJ11286 6235,7 35
230036 at Hs.489118 Белок, родственный белку с доменом стерильного альфа мотива 9 SAMD9L 6254,1 36
222217 s at Hs.438723 Семейство 27 растворимых носителей (переносчики жирных кислот), представитель 3 SLC27A3 6257,9 37
201641_at Hs.118110 Антиген стромальных клеток костного мозга 2 BST2 6371,4 38
218599 at Hs.419259 REC8-подобный (дрожжи) REC8L1 6423,3 39
238327 at Hs.531314 Глютамат-цистеиновая лигаза, модифицирующая субъединица GCLM 6500,4 40
225291_at Hs.388733 Полирибонуклеотид нуклеотидилтрансфераза 1 PNPT1 6537,6 41
208581 x at Hs.374950 Металлотионеин 1X МТ1Х 6541,4 42
212380_at Hs.520102 KIAA0082 KIAA0082 6547,1 43
227347 x at Hs.154029 Белок класса hairy/enhancer of split 4 (дрозофила) HES4 6557,3 44
1557116 at Hs.257352 Аполипопротеин L, 6 APOL6 6571,1 45
231769_at Hs.464419 F-box белок 6 FBXO6 6683,0 46
200986 at Hs.384598 Ингибитор серпин пептидазы, таксон G (C1 ингибитор), представитель 1, (ангионевротический отек, наследственный) SERPING1 6688,7 47
33304 at Hs.459265 Простимулированный интерфероном ген экзонуклеазы 20 кДа ISG20 6853,8 48
209593_s_at Hs.252682 Семейство торсина 1, представитель B (торсин B) TOR1B 6866,4 49
202307 s at Hs.352018 Переносчик 1, АТФ-связывающая кассета, подсемейство B, (MDR/TAP) ТАР1 6909,0 50

Пример 7. Большинство пациентов с волчанкой проявляет ИФН I типа-индуцируемый вариант экспрессии ФД маркеров

С помощью наборов 169 зондов для выявления экспрессии ряда ФД маркеров анализируют генную экспрессию в образцах цельной крови 35 пациентов с волчанкой, используя анализ главных компонент (АГК). Анализ главных компонент относится к статистическим методам упрощения совокупности данных путем снижения многомерных баз данных для понижения размеров для анализа. Проводят АГК по отфильтрованным данным (наборы 169 зондов), используя средство статистического анализа Spotfire. Результат анализа АГК показывает, что 24 из 35 пациентов с волчанкой обладают статистически значимой подписью ФД маркера. См. результаты анализа АГК на фиг.22. Наборы 169 зондов, применяемых в указанном анализе АГК, приводят в табл.20.

Таблица 20
Генная экспрессия, выявляемая с помощью наборов 169 зондов у 35 пациентов с СКВ
ID зонда UniGene ID Название гена Обозначение гена
1552772_at Hs.351811 C-тип домена лектина, семейство 4, представитель D CLEC4D
1554343_a_at Hs.435579 BCR расположенный ниже по цепи передающий сигнал 1 BRDG1
1555464_at Hs.163173 интерферон-индуцированный с доменом C1 геликазы IFIH1
1555728_a_at Hs.325960 Закрепленные в мембране 4-домены, подсемейство A, представитель 4 MS4A4A
1556643_at Hs.515243 Гипотетический белок ВС011840 LOC93343
1557236_at Hs.257352 Аполипопротеин L, 6 APOL6
1559585_at Hs.535011 Гипотетический белок FLJ31033 FLJ31033
200887_s_at Hs.565365 Переносчик сигнала и активатор транскрипции 1, 91 кДа STAT1
200923_at Hs.514535 Лектин, галактозид-связывающий, растворимый, 3 связывающий белок LGALS3BP
200986_at Hs.384598 Ингибитор серпин пептидазы, таксон G (C1 ингибитор), представитель 1, (ангионевротический отек, наследственный) SERPING1
201015_s_at Hs.514174 связанный плакоглобин JUP
201324_at Hs.436298 Белок эпителиальной мембраны 1 ЕМР1
201641_at Hs.118110 Антиген стромальных клеток костного мозга 2 BST2
201646_at Hs.349656 Рецепторы-«мусорщики» класса B, представитель 2 SCARB2
201761_at Hs.469030 Метилентетрагидрофолат дегидрогеназа (NADP + зависимая) 2, метенилтетрагидрофолат циклогидролаза MTHFD2
202086_at Hs.517307 Устойчивость к миксовирусу (вирусу гриппа) 1, интерферон-индуцируемый белок p78 (мышь) МХ1
202145_at Hs.521903 Комплекс лимфоцитарного антигена 6, локус Е LY6E
ID зонда UniGene ID Название гена Обозначение гена
202270_at Hs.62661 Гуанилат связывающий белок 1, интерферон-индуцируемый, 67 кДа GBP1
202411_at Hs.532634 Интерферон альфа-индуцируемый белок 27 IFI27
202430_s_at Hs.130759 Скрамблаза-1 фосфолипидов PLSCR1
202446_s_at Hs.130759 Скрамблаза-1 фосфолипидов PLSCR1
202759_s_at Hs.591908 Протеин 2 анкера киназа PRKA белок PALM2-АКАР2 АКАР2 PALM2-AKAP2
202863_at Hs.369056 Ядерный антиген SP100 SP100
202869_at Hs.524760 2′,5′-олигоаденилат синтетаза 1, масса 40/46 кДа OAS1
203153_at Hs.20315 Интерферон-индуцированный белок с тетратрикопептидными повторами 1 IFIT1
203595_s_at Hs.252839 Интерферон-индуцированный белок с тетратрикопептидными повторами 5 IFIT5
203596_s_at Hs.252839 Интерферон-индуцированный белок с тетратрикопептидными повторами 5 IFIT5
203771_s_at Hs.488143 Биливердин редуктаза A BLVRA
204211_x_at Hs.131431 Эукариотический фактор 2 инициации трансляции-альфа киназа 2 EIF2AK2
204224_s_at Hs.86724 ГТФ циклогидролаза 1 (дофа-чувствительная дистония) GCH1
204326_x_at Hs.374950 металлотионеин 1X МТ1Х
204415_at Hs.523847 Интерферон альфа-индуцируемый белок 6 IFI6
204439_at Hs.389724 Белок, подобный интерферон-индуцированному белку 44 IFI44L
204533_at Hs.632586 Лиганд хемокина (мотив C-X-C) 10 CXCL10
204747_at Hs.47338 Интерферон-индуцированный белок с тетратрикопептидными повторами 3 IFIT3
204972_at Hs.414332 2′-5′-олигоаденилат синтетаза 2, 69/71 кДа OAS2
204994_at Hs.926 Устойчивость к миксовирусу (вирусу гриппа) 2 (мышь) МХ2
205098_at Hs.301921 Рецептор 1 хемокина (C-C мотив) CCR1
205099_s_at Hs.301921 Рецептор 1 хемокина (C-C мотив) CCR1
205170_at Hs.530595 Переносчик сигнала и активатор транскрипции 2, 113 кДа STAT2
205241_at Hs.567405 SCO цитохром оксидазы недостаточный гомолог 2 (дрожжи) SCO2
205483_s_at Hs-458485 ISG15 убиквитин-подобный модификатор ISG15
205552_s_at Hs.524760 2′,5′-олигоаденилатсинтетаза 1, 40/46 кДа OAS1
205569_at Hs.518448 Лизосомально-ассоциированный мембранный белок 3 LAMP3
205660_at Hs.118633 Белок, подобный 2′-5′-олигоаденилат синтетазе OASL
206025_s_at Hs.437322 Фактор некроза опухолей, альфа-индуцированный белок 6 TNFAIP6
206026_s_at Hs.437322 Фактор некроза опухолей, альфа-индуцированный белок 6 TNFAIP6
206133_at Hs.441975 XIAP ассоциированный фактор-1 BIRC4BP
206332_s_at -- интерферон гамма-индуцируемый белок 16 IFI16
206513_at Hs.281898 Отсутствует при меланоме 2 AIM2
206553_at Hs.414332 2′,5′-олигоаденилат синтетаза 2, 69/71 кДа OAS2
206576_s_at Hs.512682 Молекула прилипания клетки, родственная карциноэмбриональному антигену 1 (гликопротеин желчи) СЕАСАМ1
ID зонда UniGene ID Название гена Обозначение гена
206715_at Hs.125962 Фактор транскрипции ЕС TFEC
208087_s_at Hs.302123 Z-ДНК- связывающий белок 1 ZBP1
208436_s_at Hs.166120 Фактор регуляции активности интерферона 7 IRF7
208581_x_at Hs.374950 металлотионеин 1X МТ1Х
208653_s_at Hs.591335 Молекула CD164, сиаломуцин CD164
208966_x_at - Интерферон гамма-индуцируемый белок 16 IFI16
209417_s_at Hs.632258 интерферон-индуцированный белок 35 IFI35
209498_at Hs.512682 Молекула прилипания клетки, родственная карциноэмбриональному антигену 1 (гликопротеин желчи) СЕАСАМ1
209593_s_at Hs.252682 Семейство торсина 1, представитель B (торсин B) TOR1B
210001_s_at Hs.50640 Супрессор 1 внутриклеточной передачи сигнала SOCS1
210705_s_at Hs.370515 Белок 5, содержащий трехраздельный мотив TRIM5
210797_s_at Hs.118633 Белок, подобный 2′-5′-олигоаденилат синтетазе OASL
210873_x_at Hs.348983 Фермент-каталитический полипептид, корректирующий иРНК апопротеина B, родственный каталитический полипептид 3A АРОВЕСЗА
210985_s_at Hs.369056 SP100 ядерный антиген SP100
211012_s_at Hs.498345 Промиелоцитный лейкоз /// Гипотетический белок LOC161527 /// Родственен белковой изоформе 9 промиелоцитного изоформе белка 9 PML /// LOC161527/// LOC652671
211456_x_at - Гипотетический белок LOC650610 LOC650610
211889_x_at Hs.512682 Молекула прилипания клетки, родственная карциноэмбриональному антигену 1 (гликопротеин желчи) СЕАСАМ1
212185_x_at Hs.534330 Металлотионеин 2A МТ2A
212657_s_at Hs.81134 Антагонист рецептора интерлейкина 1 IL1RN
212659_s_at Hs.81134 Антагонист рецептора интерлейкина 1 IL1RN
212845_at Hs.98259 Белок с доменом стерильного альфа мотива 4A SAMD4A
213293_s_at Hs.501778 Белок 22, содержащий трехраздельный мотив TRIM22
213294_at Hs.546523 Полной длины клон кДНК CS0DK002YF13 клеток HeLa Cot 25-нормализованных Homo sapiens (человек) -
213361_at Hs.193842 TUDOR домен содержащий 7 TDRD7
213469_at Hs.229988 GPI деацилаза PGAP1
213797_at Hs.17518 Белок 2, содержащий домен радикал S-аденозилметионин RSAD2
214059_at Hs.82316 Интерферон-индуцированный белок 44 IFI44
214329_x_at Hs.478275 Надсемейство фактора некроза опухоли (лиганд), представитель 10 ФНОSF10
214453_s_at Hs.82316 Интерферон-индуцированный белок 44 IFI44
214511_x_at Hs.534956 Fc фрагмент IgG, высокое сродство Iа, рецептор (CD64) /// Fc-гамма рецептор I B2 /// близок Fc-гамма рецептору I B2, изоформе b FCGR1A /// LOC440607 /// LOC652758
216243_s_at Hs.81134 Антагонист рецептора интерлейкина 1 IL1RN
216598_s_at Hs.303649 Лиганд хемокина 2 (мотив C-C) CCL2
217165_x_at Hs.513626 Металлотионеин 1F (функциональный) MT1F
217502_at Hs.437609 Интерферон-индуцированный белок с тетратрикопептидными повторами 2 IFIT2
ID зонда UniGene ID Название гена Обозначение гена
217933_s_at Hs.570791 Лейцин аминопептидаза 3 LAP3
218400_at Hs.528634 2′-5′-олигоаденилат синтетаза 3, 100 кДа OAS3
218543_s_at Hs.12646 Семейство поли(АДФ-рибоза)полимеразы, представитель 12 PARP12
218943_s_at Hs.190622 DEAD (Asp-Glu-Ala-Asp) box полипептид 58 DDX58
218986_s_at Hs.591710 Гипотетический белок FLJ20035 FLJ20035
219062_s_at Hs.631682 Цинковый палец, ССНС домен содержащий 2 ZCCHC2
219209_at Hs.163173 интерферон-индуцированный с доменом 1 геликазы С IFIH1
219211_at Hs.38260 Убиквитин-специфичная пептидаза 18 USP18
219352_at Hs.529317 hect домен и RLD 6 HERC6
219364_at Hs.55918 Предположительно ортолог D11lgp2 мыши LGP2
219519_s_at Hs.31869 Связывающий сиаловую кислоту Ig-подобный лектин 1, сиалоадгезин /// Связывающий сиаловую кислоту Ig-подобный лектин 1, сиалоадгезин SIGLEC1
219607_s_at Hs.325960 Протяженные в мембране 4 домена, подсемейство A, представитель 4 MS4A4A
219684_at Hs.43388 Рецепторный транспортный белок 4 RTP4
219691_at Hs.65641 Белок с доменом стерильного альфа мотива 9 SAMD9
219863_at Hs.26663 hect домен и RLD 5 HERC5
219885_at - Семейство шлафен, представитель 12 SLFN12
220059_at Hs.435579 BCR расположенный ниже по цепи передающий сигнал 1 BRDG1
220576_at Hs.229988 GPI деацилаза PGAP1
221680_s_at Hs.272398 Вариант ets гена 7 (TEL2 онкоген) ETV7-
221816_s_at Hs.369039 PHD-фингерный белок 11 PHF11
222154_s_at Hs.120323 ДНКполимераза-трансактивированный белок 6 DNAPTP6
222631_at Hs.443733 Фосфатидилинозитол 4-киназа тип 2 бета PI4K2B
222793_at Hs.190622 DEAD (Asp-Glu-Ala-Asp) box полипептид 58 DDX58
222816_s_at Hs.631682 Цинковый палец, ССНС домен содержащий 2 ZCCHC2
223167_s_at Hs.473370 Убиквитин-специфичная пептидаза 25 USP25
223220_s_at Hs.518200 Семейство поли(АДФ-рибоза)полимеразы, представитель 9 PARP9
223434_at - Гуанилат связывающий белок 3 GBP3
223501_at - - --
223849_s_at Hs.514941 Mov10, вирус лейкоза Молони 10, гомолог (мышиный) MOV10
224225_s_at Hs.272398 Вариант ets гена 7 (TEL2 онкоген) ETV7
224701_at Hs.583792 Семейство поли(АДФ-рибоза)полимеразы, представитель 14 PARP14
225291_at Hs.388733 Полирибонуклеотид нуклеотидилтрансфераза 1 PNPT1
225415_at Hs.518201 deltex 3-like (Drosophila) DTX3L
225636_at Hs.530595 Переносчик сигнала и активатор транскрипции 2, 113 кДа STAT2
225834_at Hs.599880 Гипотетический белок LOC652689 /// Семейство с последовательностью, близкой 72, представитель A /// Близость к семейству с последовательностью, близкой 72, представитель A /// Близость к семейству с последовательностью, близкой 72, представитель A LOC652689 /// FAM72A /// LOC653594 /// LOC653820
ID зонда UniGene ID Название гена Обозначение гена
225869_s_at Hs.502989 unc-93 гомолог Bl (C. elegans) UNC93B1
226103_at Hs.632387 Нексилин (F актин-связывающий белок) NEXN
226603_at Hs.489118 Белок с доменом стерильного альфа мотива 9 SAMD9L
226702_at Hs.7155 Гипотетический белок LOC129607 LOC129607
226757_at Hs.437609 Интерферон-индуцированный белок с тетратрикопептидными повторами 2 IFIT2
227458_at - - --
227609_at Hs.546467 Эпителиально-стромальное взаимодействие 1 (грудь) EPSTI1
227697_at Hs.527973 Супрессор передачи сигнала цитокина 3 SOCS3
228152_s_at Hs.535011 Гипотетический белок FLJ31033 FLJ31033
228230_at Hs.517180 Рецептор A, активируемый пролифератором пероксисом, взаимодействующего комплекса 285 PRIC285
228439_at Hs.124840 Базовый лейциновый зиппер фактора транскрипции, подобный ATF 2 BATF2
228531_at Hs.65641 Белок с доменом стерильного альфа мотива 9 SAMD9
228607_at Hs.414332 2′,5′-олигоаденилат синтетаза 2, 69/71 кДа OAS2
228617_at Hs-441975 XIAP-ассоциированный фактор-1 BIRC4BP
229450_at - - -
230036_at Hs.489118 Белок с доменом стерильного альфа мотива 9 SAMD9L
230314_at Hs.112420 Транскрибированный локус, близкородственный ХР_511805.1 Предположительно гипотетический белок ХР_511805 [шимпанзе обыкновенный - Pan troglodytes] -
231769_at Hs.464419 F-box белок 6 FBXO6
232034_at Hs.599821 Гипотетический белок LOC203274 LOC203274
232155_at Hs.514554 KIAA1618 KIAA1618
232375_at Hs.565365 Переносчик сигнала и активатор транскрипции 1, 91 кДа STAT1
232666_at Hs.528634 2′-5′-олигоаденилат синтетаза 3, 100 кДа OAS3
233425_at Hs.631682 Цинковый палец, ССНС домен содержащий 2 ZCCHC2
233880_at Hs.195642 Хромосома 17, открытая рамка считывания 27 C17orf27
235061_at Hs.291000 Протеинфосфатаза 1К (содержащая домен РР2С) РРМ1К
235112_at Hs.533491 KIAA1958 KIAA1958
235157_at Hs.583792 Семейство поли(АДФ-рибоза)полимеразы, представитель 14 PARP14
235276_at - - -
235643_at Hs.489118 Белок с доменом стерильного альфа мотива 9 SAMD9L
236156_at Hs.127445 Липаза A, лизосомальная кислота, холестеринэстераза (болезнь Вольмана) LIPA
236692_at - - -
238439_at Hs.217484 Домен из 22 анкириновых повторов ANKRD22
238581_at Hs.513726 Гуанилат-связывающий белок 5 GBP5
238743_at Hs.546523 Полной длины клон кДНК CS0DK002YF13 клеток HeLa Cot 25-нормализованных Homo sapiens (человек) -
239196_at Hs.217484 Домен из 22 анкириновых повторов ANKRD22
239277_at - - -
239979_at Hs.546467 Эпителиально-стромальное взаимодействие 1 (грудь) EPSTI1
ID зонда UniGene ID Название гена Обозначение гена
241812_at Hs.120323 ДНКполимераза-трансактивированный белок 6 DNAPTP6
241916_at Hs.130759 Скрамблаза фосфолипидов 1 PLSCR1
242020_s_at Hs.302123 Z-ДНК связывающий белок 1 ZBP1
242234_at Hs.441975 XIAP-ассоциированный фактор 1 BIRC4BP
242625_at Hs.17518 Белок 2, содержащий домен радикал S-аденозилметионин RSAD2
242898_at - - -
243271_at Hs.489118 Белок с доменом стерильного альфа мотива 9 SAMD9L
44673_at Hs.31869 Связывающий сиаловую кислоту Ig-подобный лектин 1, сиалоадгезин SIGLEC1
AFFX-HUMISGF3A/ M97935_3_at Hs.565365 Переносчик сигнала и активатор транскрипции 1, 91 кДа STAT1
AFFX-HUMISGF3A/ M97935_5_at Hs.565365 Переносчик сигнала и активатор транскрипции 1, 91 кДа STAT1
AFFX-HUMISGF3A/ M97935_MB_at Hs.565365 Переносчик сигнала и активатор транскрипции 1, 91 кДа STAT1

Сходным образом, используя 25 с высоким повышением регуляции ИФН-индуцируемых генов, экспрессия в образцах цельной крови пациентов с волчанкой и нормальных здоровых доноров исследуют, используя АГК (анализ главных компонент). С помощью АГК установили примерно 66% пациентов, больных волчанкой, имеющих сильную/умеренную ИФН I типа-индуцируемую подпись. См. на фиг.68а результаты анализа АГК и на фиг.68б для 25 генов, используемых в АГК.

Сверхэкспрессия генов ИФН I типа в цельной крови большего числа пациентов с СКВ, выявленная с помощью целого набора генома Affymetrix, показана в табл.23. Табл.23 и фиг.65 предоставляют дополнительное доказательство того, что высокий процент пациентов с СКВ проявляет по меньшей мере двухкратную сверхэкспрессию каждого отдельного гена ИФН I типа.

Таблица 23
Сверхэкспрессия ИФН I типа генов в цельной крови пациентов с волчанкой.
ID зонда Название гена Обозначение гена Число образцов, изменение в которых ≥2 % образцов Средний log2 величины кратности изменения
222816_s_at Цинковый палец, ССНС домен содержащий 2 ZCCHC2 70 79,55 2,124
204415_at Интерферон альфа индуцируемый белок 6 IFI6 67 76,14 3,007
217502_at Интерферон-индуцированный белок с тетратрикопептидными повторами 2 IFIT2 65 73,86 1,913
235643_at Белок с доменом стерильного альфа мотива 9 SAMD9L 65 73,86 2,020
213797_at Белок 2, содержащий домен радикал S-аденозилметионин RSAD2 62 70,45 2,978
214059_at Интерферон-индуцированный белок 44 IFI44 61 69,32 3,050
202411_at Интерферон альфа-индуцируемый белок 27 IFI27 60 68,18 3,937
204439_at Белок, подобный интерферон-индуцированному белку 44 IFI44L 60 68,18 2,847
242625_at Белок 2, содержащий домен радикал S-аденозилметионин RSAD2 59 67,05 2,861
214453_s_at Интерферон-индуцированный белок 44 IFI44 59 67,05 2,463
203153_at Интерферон-индуцированный белок с тетратрикопептидными повторами 1 IFIT1 59 67,05 2,034
242234_at XIAP ассоциированный фактор-1 BIRC4BP 59 67,05 2,066
203595_s_at интерферон-индуцированный белок с тетратрикопептидными повторами 5 IFIT5 59 67,05 1,603
202086_at Устойчивость к миксовирусу (вирусу гриппа) 1,интерферон-индуцируемый белок p78 (мышь) МХ1 58 65,91 1,777
206133_at XIAP ассоциированный фактор-1 BIRC4BP 58 65,91 1,803
216243_s_at Антагонист рецептора интерлейкина 1 IL1RN 58 65,91 1,278
219863_at hect домен и RLD 5 HERC5 57 64,71 1,795
202869_at 2′,5′- олигоаденилат синтетаза 1, 40/46 кДа OAS1 56 63,64 2,057
ID зонда Название гена Обозначение гена Число образцов, изменение в которых ≥2 % образцов Средний log2 величины кратности изменения
226702_at Гипотетический белок LOC129607 LOC129607 56 63,64 1,797
205483_s_at ISG15 убиквитин-подобный модификатор ISG15 56 63,64 1,979
204747_at Интерферон-индуцированный белок с тетратрикопептидными повторами 3 IFIT3 56 63,64 1,675
1555464_at Интерферон индуцированный с доменом 1 геликазы C IFIH1 56 63,64 1,532
218400_at 2′-5′-олигоаденилат синтетаза 3, 100 кДа OAS3 55 62,50 1,932
227609_at Эпителиально-стромальное взаимодействие 1 (грудь) EPSTI1 55 62,50 1,788
200986_at ингибитор серпиновой пептидазы, таксон G (ингибитор C1), SERPING1 55 62,50 1,503
202145_at Комплекс лимфоцитарного антигена 6, локус Е LY6E 54 61,36 2,242
239979_at Эпителиально-стромальное взаимодействие 1 (грудь) EPSTI1 54 61,36 1,895
205552_s_at 2′,5′-олигоаденилат синтетаза 1, 40/46 кДа OAS1 54 61,36 1,945
225929_s_at Хромосома 17, открытая рамка считывания 27 C17orf27 54 61,36 1,054
222l54_s_at ДНКполимераза-трансактивированный белок 6 DNAPTP6 53 60,23 2,030
205569_at Лизосомально-ассоциированный мембранный белок 3 LAMP3 53 60,23 1,813
205660_at Типа 2′-5′-олигоаденилат синтетазы OASL 53 60,23 1,677
219352_at hect домен и RLD 6 HERC6 52 59,09 1,663
210797_s_at Типа 2′-5′-олигоаденилат синтетазы OASL 52 59,09 1,548
241916_at Скрамблаза фосфолипидов 1 PLSCR1 52 59,09 1,396
208087_s_at Z-ДНК связывающий белок 1 ZBP1 52 59,09 1,438
243271_at Белок, родственный белку с доменом стерильного альфа мотива 9 SAMD9L 52 59,09 1,126
219519_s_at Сиаловая кислота, связывающая Ig-подобный лектин 1, сиалоадгезин SIGLEC1 51 57,95 3,019
228617_at XIAP ассоциированный фактор-1 BIRC4BP 51 57,95 1,473
202446_s_at Скрамблаза фосфолипидов 1 PLSCR1 51 57,95 1,307
ID зонда Название гена Обозначение гена Число образцов, изменение в которых ≥2 % образцов Средний log2 величины кратности изменения
232095_at SPLIT-ROBO Rho ГТФаза активирующий белок 2 SRGAP2 50 56,82 1,155
232666_at 2′-5′-олигоаденилат синтетаза 3, 100 кДа OAS3 49 55,68 1,862
204972_at 2′,5′-олигоаденилат синтетаза 2, 69/71 кДа OAS2 49 55,68 1,642
202430_s_at Скрамблаза фосфолипидов 1 PLSCR1 49 55,68 1,209
224701_at Семейство поли(АДФ-рибоза) полимераз, представитель 14 PARP14 49 55,68 1,098
219211_at Убиквитин-специфичная пептидаза 18 USP18 48 54,55 2,365
206553_at 2′,5′-олигоаденилат синтетаза 2, 69/71 кДа OAS2 48 54,55 1,582
219684_at Рецепторный (хемосенсорный) транспортный белок 4 RTP4 48 54,55 1,534
230000_at Хромосома 17, открытая рамка считывания 27 C17orf27 47 53,41 0,936
44673_at Сиаловая кислота, связывающая Ig-подобный лектин 1, сиалоадгезин SIGLEC1 47 53,41 1,975
203596_s_at Интерферон-индуцированный белок с тетратрикопептидными повторами 5 IFIT5 47 53,41 1,327
218986_s_at Гипотетический белок FLJ20035 FLJ20035 47 53,41 1,091
242020_s_at Z-ДНК связывающий белок 1 ZBP1 47 53,41 1,195
212659_s_at Антагонист рецептора интерлейкина 1 IL1RN 47 53,41 1,196
228439_at Базовый лейциновый зиппер фактора транскрипции, подобный ATF2 BATF2 46 52,27 1,180
226757_at Интерферон-индуцированный белок с тетратрикопептидными повторами 2 IFIT2 46 52,27 0,882
225291_at Полирибонуклеотид нуклеотидилтрансфераза 1 PNPT1 46 52,27 0,957
206026_s_at Фактор некроза опухоли, альфа-индуцированный белок 6 TNFAIP6 46 52,27 0,942
222858_s_at Двойной адаптер фосфотирозина и 3-фосфоинозитидов DAPP1 46 52,27 1,055
208436_s_at Фактор регуляции активности интерферона 7 IRF7 45 51,14 1,146
ID зонда Название гена Обозначение гена Число образцов, изменение в которых ≥2 % образцов Средний log2 величины кратности изменения
217933_s_at Лейциновая аминопептидаза 3 LAP3 45 51,14 0,807
228152_s_at Гипотетический белок FLJ31033 FLJ31033 45 51,14 0,834
230036_at Белок, родственный белку с доменом стерильного альфа мотива 9 SAMD9L 44 50,00 1,097
228607_at 2′,5′-олигоаденилат синтетаза 2, 69/71 кДа OAS2 44 50,00 1,113
218543_s_at Семейство поли(АДФ-рибоза)полимеразы, представитель 12 PARP12 44 50,00 1,111
226603_at Белок, родственный белку с доменом стерильного альфа мотива 9 SAMD9L 44 50,00 1,033
204211_x_at Эукариотический фактор 2 инициации трансляции-альфа киназа 2 EIF2AK2 44 50,00 1,050
235157_at Семейство поли(АДФ-рибоза)полимераз, представитель 14 PARP14 44 50,00 0,940
209417_s_at Интерферон-индуцированный белок 35 IFI35 44 50,00 0,957

Основываясь на наблюдениях разных сверхэкспрессируемых ИФН I типа генов у пациентов с СКВ, описанных выше, 21 ИФН I типа ген в цельной крови пациентов с волчанкой определяют в качестве потенциально применимых. См. табл.24.

Таблица 24
Двадцать один потенциально сверхэкспрессируемый ИФН I типа ген, применимый в качестве ФД маркера.
Образец IFI44 IFI27 IFI44L ONAPTP6 LAMP3 LY6E RSAD2 HERC5 IF16 ISG15 OAS3 S1GLEC1 OAS2 USP18 RTP4 IFIT1 MX1 OAS1 EPSTM PLSCR1 IFRG28
А_37329 А13 23,67 3,34 23,45 7,63 6,75 7,25 28,21 8,12 5,53 7,47 4,82 5,16 5,22 7,14 3,94 15,26 4,98 7,75 6,57 3,69 3,71
А_37330 А13 5,31 4,33 6,28 2,80 4,23 1,44 8,14 2,76 2,39 3,44 3,48 2,26 2,63 2,12 1,82 4,83 2,77 2,06 2,48 3,65 2,17
А_37343 А13 10,70 1,41 10,31 2,51 2,23 2,94 11,76 2,52 1,25 1.97 2,63 0,96 2,38 2,85 2,73 7,39 2,82 3,78 2,97 2,12 2,89
А_37345 А16 37,55 30,71 28,86 5,28 3,94 4,30 35,61 1,88 1,85 3,73 2,26 0,92 3,03 2,54 3,70 21,92 2,66 4,51 10,06 2,48 3,92
А_373б0 А13 10,72 4,62 7,36 2,42 1,34 3,38 14,35 2,07 3,34 2,46 2,55 2,81 2,17 2,01 1,12 13,79 2,32 2,30 3,51 1,40 1,29
А_37361 А13 4,19 0,83 5,32 2,51 4,13 1,27 7,01 3,64 4,67 3,08 4,16 6,38 2,97 2,43 1,46 4,55 2,40 2,02 2,40 2,43 1,41
А_37365 А13 24,79 8,25 26,45 15,76 18,11 11,33 54,51 13,72 15,37 16,02 10,79 10,33 8,85 9,57 7,07 23,56 8,22 11,56 16,51 5,93 7,49
А_37473 А13 0,88 0,96 0,53 0,63 0,65 0,85 0,27 0,39 0,48 0,70 0,25 0,26 0,50 0,96 1,35 0,31 0,77 0,68 0,59 1,45 1,48
А_37475 All 0,85 0,17 0,67 0,89 0,14 0,36 0,36 0,32 0,18 0,27 0,42 0,12 0,73 0,43 0,69 0,32 0,23 0,92 0,50 2,97 0,82
А_37476А15 1,25 4,20 0,83 2,71 2,19 2,82 0,95 1,97 0,70 1,78 0,93 0,45 2,15 2,94 4,70 0,49 1,76 1,54 1,01 7,92 4,96
А_37477 All 0,78 17,78 0,54 0,37 0,40 2,26 0,11 0,28 0,65 1,99 0,28 0,57 0,35 1,18 3,44 0,23 0,96 1,65 0,51 2,05 3,50
А_37478 А14 1,53 5,56 0,98 1,90 2,24 1,89 0,82 1,65 0,71 2,89 0,50 1,00 1,64 1,86 4,20 0,39 1,73 2,40 1,23 8,18 4,51
С_001 8,93 162,67 16,29 41,43 4,13 35,49 14,75 10,03 5,34 31,98 5,95 13,14 6,35 15,81 13,08 0,65 18,84 10,75 9,42 8,16 14,58
С_002 30,64 136,38 53,11 15,25 6,78 7,33 20,98 4,88 6,52 8,78 6,28 6,49 5,58 23,17 6,56 15,64 6,73 9,22 7,10 3,62 6,68
С_004 25,99 220,81 71,18 18,13 8,48 9,94 51,74 8,77 4,32 12,04 7,00 6,60 7,87 32,60 11,21 21,06 9,69 8,07 11,63 7,62 10,31
С_005 11,39 324,78 63,12 44,63 6,71 14,93 50,68 11,58 7,46 22,37 11,03 23,05 11,90 63,56 10,70 19,74 17,43 14,42 9,62 5.59 9,02
С_006b 0,48 0,57 0,47 0,55 0,25 0,73 0,27 0,33 1,20 0,70 0,21 0,31 0,34 0,38 0,81 0,33 0,38 0,52 0,60 0,37 0,67
С_007 63,08 498,86 71,47 31,25 9,75 25,15 124,43 17,26 12,01 30,68 4,98 4,68 11,92 37,94 14,21 32,73 13,92 12,20 14,28 14,36 11,18
С_009 30,12 209,75 46,29 15,45 6,63 11,07 32,35 8,07 4,71 10,17 6,77 8,67 9,57 21,00 8,07 14,25 9,04 9,53 8,01 7,83 7,49
С_010 24,31 85,83 42,22 21,61 10,78 15,14 49,98 12,94 7,29 19,29 10,90 7,34 10,34 18,34 7,80 12,47 8,32 11,58 12,30 7,21 7,03
С_011 26,17 160,53 30,34 57,41 32,45 29,58 45,36 35,18 2,66 14,93 44,32 25,28 27,10 51,74 26,85 9,19 15,63 17,96 15,00 19,29 28,84
С_012 48,84 131,90 85,63 15,28 7,85 10,17 57,95 8,19 5,21 8,71 7,76 4,55 10,17 31,27 10,46 27,35 8,32 7,66 12,35 6,33 9,08
С_013 3,14 2,21 4,97 1,84 1,79 0,73 6,65 2,66 1,34 1,02 1,85 0,74 1,41 2,45 2,69 3,55 2,14 1,32 3,19 2,30 2,31
С_017 21,09 256,30 48,34 18,49 5,74 9,18 35,38 7,79 4,91 13,13 6,54 4,77 6,67 16,58 4,91 18,66 5,69 10,37 8,29 5,62 5,43
Образец IFI44 IFI27 IFI44L ONAPTP6 LAMP3 LY6E RSAD2 HERC5 IF16 ISG15 OAS3 S1GLEC1 OAS2 USP18 RTP4 IFIT1 MX1 OAS1 EPSTM PLSCR1 IFRG28
С_018 71,14 177,60 97,17 41,72 11,95 28,82 98,76 16,75 10,97 27,33 18,71 9,84 16,48 75,02 18,41 44,09 23,41 12,66 18,71 12,52 15,63
С_019 75,89 362,67 158,96 30,47 16,33 17,58 113,44 17,70 16,63 29,09 7,39 5,29 15,13 61,50 21,00 22,61 21,25 19,06 18,93 12,46 19,78
С_020 49,27 149,00 96,50 40,29 13,89 23,41 77,48 16,52 10,21 30,40 6,26 5,92 11,57 48,59 13,57 34,76 13,99 11,76 13,89 8,63 13,38
С_10721 100,31 153,10 123,21 46,69 25,19 19,63 95,12 17,61 8,08 42,37 3,38 8,45 14,21 58,15 12,60 20,80 14,95 2032 23,72 13,22 13,85
С_10722b 7,05 3,09 4.15 2,50 3,07 1,82 2,62 1,75 0,61 1,29 0,40 0,58 1,55 5,30 1,56 3,31 1,98 1,87 4,22 3,40 1,54
С_129141 49,92 189,36 47,56 32,63 11,84 24,45 50,62 15,98 15,19 50,39 12,14 6,27 13.98 26,94 12,80 33,17 10,47 17,41 16,85 8,43 13,63
С_19171 32,06 8,24 26,46 13,54 9,78 6,63 41,14 12,40 5,23 10,87 7,65 8,53 8,22 12,46 5,35 25,74 11,90 5,68 8,13 6,33 5,56
С_325532 77,48 163,43 90,25 236,52 162,67 30,05 73,47 26,40 25,86 193,45 35,73 130.31 28,23 71,63 23,96 33,26 13,14 20.71 25,62 12,29 27,39
С_45311 5,39 0,81 2,19 1,36 0,54 1,08 1,15 0,79 1,05 1,42 0,17 0,30 0,88 1,08 2,50 1,43 1,29 2,19 2,02 2,20 2,80
С_71277 16,15 7,55 19,03 7,33 3,59 6,35 14,39 3,88 1,82 4,88 3,85 3,76 4,75 7,64 3,43 7,76 4,15 3,10 6,32 2,90 3,76
С_72371 86,57 51,95 89,42 96,06 18,37 28,43 110,34 24,75 12,09 45,54 24,29 12,46 25,62 54,29 17,10 51,00 13,86 21,64 25,98 14,28 17,42
Среднее 23,67 30,71 26,46 15,25 6,63 7,33 32,35 8,07 4,71 8,78 4,98 5,16 6,35 12,16 5,35 14,25 6,73 7,75 8,13 5,93 5,56
Стандартное 28,22 101,10 40,00 25,02 12,14 11,37 38,03 9,19 5,94 18,76 7,62 9,39 8,07 22,10 8,17 15,62 7,95 8,32 9,27 6,55 8,16

Сверхэкспрессию указанных генов, выявленную первоначально с помощью матриц Affymetrix, подтверждают с помощью матриц Fluidigm dynamic. См. фиг.69.

Пример 8. Антитело MEDI-545 существенно нейтрализует ИФН I типа генную подпись у больных СКВ, обладающих от сильной до умеренной ИФН I типа генной подписью

В клиническом исследовании пациентов выявляют в качестве имеющих сильную/умеренную ИФН I типа генную подпись, слабую ИФН I типа генную подпись, или не имеющих ИФН I типа генной подписи. Этих пациентов распределяют по указанным группам, основываясь на 149 генах. Табл.25 показывает число пациентов, больных волчанкой, включенных в клиническое исследование, которые были определены в каждую из этих трех групп, и показывает протокол лечения, по которому они были получены.

Таблица 25
Распределение пациентов по ИФН I типа генной подписи перед лечением.
Группа Сильная и умеренная подпись Слабая подпись Нет подписи
РВО 10 5 2
0,3 мг/кг 5 0 1
1 мг/кг 2 2 2
3 мг/кг 3 2 1
10 мг/кг 4 3 0
30 мг/кг 3 2 1
Всего 27 14 7

Пациенты с СКВ, у которых установили наличие сильных и умеренных ИФН I типа генных подписей, все имеют в среднем 4-кратное повышение экспрессии топовых 25 с наибольшей повышенной регуляцией ИФН I типа генов; среднее 2-кратное увеличение экспрессии топовых 50 ИФН I типа генов с наибольшей повышенной регуляцией и процент итоговых генов исследованного заболевания, являющихся ИФН I типа индуцируемыми, 3,8. Среднее кратное увеличение топовых 25 ИФН I типа-индуцируемых генов для каждого пациента, обладающего сильной/умеренной ИФН I типа подписью или слабой подписью в исследовании, представлено на фиг.28.

Лечение пациентов с СКВ из таких разных групп позволило установить, что нейтрализация ИФН I типа генной подписи антителом MEDI-545 является специфической. Фиг.29(а) показывает, что группа пациентов с СКВ, обладающих ИФН I типа генной подписью, практически все топовые 39 генов, нейтрализованных на 14 сутки после обработки антителом MEDI-545, являются генами ИФН I типа подписи (см. гены, выделенные желтым цветом; процент подавления генов ИФН I типа подписи варьирует в диапазоне 30,5-64,7). Напротив, ни один из топовых 39 нейтрализованных генов у пациентов с СКВ, получавших плацебо, не является геном ИФН I типа подписи. См. фиг.29(в). Пациенты с СКВ, которые утратили ИФН I типа подпись и были обработаны антителом MEDI-545, проявляют промежуточный вариант нейтрализации, при котором некоторые гены ИФН I типа подписи нейтрализованы. (См. фиг.29(б); желтым цветом отмечены гены ИФН I типа подписи, которые были нейтрализованы на 19%-44,9%).

Проводят дальнейшее деление больных СКВ по сильной, умеренной и слабой ИФН I типа генной подписи. Вкратце, исследуют 25 наиболее высоко сверхэкспрессируемых генов, индуцируемых ИФН I типа, у отдельных пациентов с СКВ, полученных из ex vivo цельной крови здорового донора, простимулированной сывороткой больного СКВ, и среднее сратное изменение этих 25 генов используют для конструирования оценки ИФН I типа генной подписи для каждого пациента с СКВ. Фиг.84 показывает распределение оценок ИФН I типа генных подписей 46 профилированных больных СКВ. Пациентов с СКВ разделяют на 3 группы, основываясь на оценке их ИФН I типа генной подписи: высокой ИФН I типа генной подписи (оценка >10), умеренной ИФН I типа генной подписи (оценка 4-10) и слабой ИФН I типа генной подписи (оценка <4).

Выбор панели 21 ИФН I типа-индуцируемых генов в цельной крови пациентов с СКВ

Для отбора малой устойчивой панели генов, индуцируемых ИФН I типа, которые могут быть использованы для анализа НТР, генную панель сокращают до 21 гена. Для идентификации 21 потенциального ФД и диагностического маркера 807 ИФН-α/β-индуцируемых зондов, выявленных с помощью стимуляции ех vivo цельной крови здоровых доноров с помощью десяти подтипов ИФН-α (2a, 4б, 5, 6, 7, 8, 10, 14, 16 и 17) и ИФН-β, используют в качестве стартовой точки маркеров-кандидатов. Образцы цельной крови в общей сложности от 46 пациентов с СКВ, полученные из коммерческого источника, и 24 от здоровых нормальных контрольных субъектов используют для определения ИФН I типа-индуцируемых зондов, регуляция которых повышена в цельной крови пациентов, больных СКВ. 114 сверхэкспрессированных зондов (q≤0,05; кратность изменения ≥2) обнаруживают в цельной крови больных СКВ, являются ИФН I типа-индуцируемыми, используя SAM и FDR.

Для того чтобы определить, действительно ли сверхэкспрессируемые ИФН I типа-индуцируемые гены в цельной крови пациентов с СКВ могут быть нейтрализованы анти-ИФНα моноклональным антителом, мононуклеарные клетки периферической крови (МКПК) одного из здоровых доноров стимулируют ex vivo сывороткой от шести конкретных пациентов с СКВ. Здоровых доноров предварительно исследуют, чтобы исключить тех доноров, у которых может быть вирусная инфекция. Регуляция 161 ИФН I типа-индуцируемых зондов повышена в 2 раза или более в МКПК здорового донора после стимуляции ≥1 сывороткой пациента, больного СКВ, у которых сверхэкспрессия этих генов супрессирована ≥50% и ≥70% действием анти-ИФНα моноклонального антитела и анти-ИФНαR моноклонального антитела, соответственно.

Пересечение между указанным списком из 161 зонда и ранее описанным списком из 114 зондов составляет 80 зондов. Каждый из указанных 80 зондов ранжируют и по величине кратного среднего изменения по всем больным СКВ, и по процентам пациентов, проявляющих изменение в 2 или более раз. В целом, 21 наиболее распространенный сверхэкспрессируемый ИФН I типа-индуцируемый ген (эти гены являются уникальными по применению NetAffx аннотационного файла для анализа Affymetrix U133 2,0 plus array; EST исключают) из указанного ранжирования оставляют для статистического перечня зондов, используемых для измерения ФД. Оценку ИФН I типа подписи затем производят по среднему значению этих генов (21 ген).

По указанному 21 гену необходимо пересчитать пороговые значения, которые были ранее установлены для классификации больных СКВ по ответам ИФН I типа генных подписей (сильной, умеренной или слабой, основываясь на Affymetrix) для понижения плотности платформы (анализ на основе TaqMan). Метод оценки требуется для конверсии оценки ИФН I типа подписи, основанной на топовых 25 по-разному экспрессируемых генах (отдельно для каждого больного СКВ) на платформе Affymetrix для оценки ИФН I типа подписи, основанной на 21 гене, выбранном для анализа TaqMan. Этот способ используют для компенсации 3 основных различий между двумя платформами: (1) числом зондов, используемых для ИФН I типа подписи (25 генов, динамически определенных для каждого пациента на платформе Affymetrix, против перечня 21 статистического гена в исследовании на основе TaqMan), (2) различия чувствительности между 2 платформами, и (3) шкал динамического ранжирования для каждой платформы. Во-первых, рассчитывают величины кратности изменения (по шкале log2) для 155 тип I-индуцируемых зондов между 35 случайным образом отобранных пациентов с СКВ и стандартной величиной набора нормальных здоровых контролей. Гены с топовыми в 25 раз увеличенными величинами определяют для каждого пациента по платформе Affymetrix (этот набор генов позволяет варьировать от пациента к пациенту, в зависимости от того, какой ИФН I типа-индуцируемых генов экспрессируется на наиболее высоком уровне). Затем среднее кратное изменение подсчитывают от топовых 25 генов для каждого пациента с СКВ. Такой же подсчет проводят с теми же пациентами, используя статистический 21 ген по исследованию, основанному на TaqMan-based. Такой набор генов выявляют для каждого пациента, и среднее кратное изменение подсчитывают, предпочтительно основываясь на 21 гене, а не на 25 динамических генах по платформе Affymetrix. Затем создают простую модель регрессии, используя эти два вектора равной длины (35 величин кратного изменения), и коэффициенты этой модели используют для подсчета фактора конверсии (из платфрмы Affymetrix для исследования на основе TaqMan) для величин порогового ответа, на основании которых больных СКВ разделяют на категории ИФН I типа генных подписей: сильную (>10 по Affymetrix; >5,53 по TaqMan), умеренную (между 4 и 10 по Affymetrix; между 1,91 и 5,53 по TaqMan) или слабую (<4 по Affymetrix; <1,91 по TaqMan). Используя указанные разделяющие пороговые значения для стратификации больных, подписи (т.е. средние кратные изменения), которые были подсчитаны по 21 гену методом на основе TaqMan, сопоставляют с такой же величиной от топовых 25 с повышенной регуляцией ИФН I типа-индуцируемых генов.

Преобладание и кратное изменение (выраженное в log2) 21 ИФН α/β-индуцируемого гена в цельной крови у 111 пациентов с СКВ представлены ниже в табл.32.

Таблица 32
Распространение и кратность изменения экспрессии 21 гена, индуцируемого ИФНα/β, в цельной крови пациентов с СКВ
Зонд Величина Q Кратность Распространение Название гена Обозначение гена
204415_at qv<1e-16 9,38 78,20 Интерферон альфа индуцируемый белок 6 IFI6
213797_at 2.67E-12 8,27 71,80 Белок 2, содержащий домен радикал S-аденозилметионин RSAD2
214059_at 7.18E-14 7,93 70,90 Интерферон-индуцированный белок 44 IFI44
204439_at 5.85E-12 6,45 69,10 Белок, близкий интерферон-индуцированному белку 44 IFI44L
20241l_at 6.35E-12 14,42 67,30 Интерферон альфа индуцируемый белок 27 IFI27
202086_at 1.09E-09 3,26 66,40 Устойчивость 1 миксовируса (вируса гриппа), интерферон-индуцируемый белок p78 (мышь) МХ1
203153_at 3.90E-07 3,52 65,50 Интерферон-индуцированный белок с тетратрикопептидными. повторами 1 IFIT1
219863_at 8.05E-11 3,27 64,50 hect домен и RLD 5 HERC5
205483_s_at 1.23E-13 3,71 63,60 ISG15 убиквитин-подобный модификатор ISG15
205569_at qv<le-16 3,91 62,70 Лизосомально-ассоциированный мембранный белок 3 LAMP3
218400_at 1.01E-10 3,65 62,70 2′-5′-олигоаденилат синтетаза 3, 100 кДа OAS3
202869_at 4.95E-11 3,77 61,80 2′,5′-олигоаденилат синтетаза 1, 40/46кДа OAS1
227609_at 7.41E-10 3,16 60,90 Эпителиально-стромальное взаимодействие 1 (грудь) EPSTI1
204747_at 9.78E-11 3,04 60,90 Интерферон-индуцированный белок с тетратрикопептидными повторами 3 IFIT3
202145_at qv<le-16 4,65 60,90 Комплекс лимфоцитарного антигена 6, локус Е LY6E
204972_at qv<le-16 3,06 58,20 2′,5′-олигоаденилат синтетаза 2, 69/71 кДа OAS2
241916_at 6.29E-07 2,46 56,40 Фосфолипидная скрамблаза 1 PLSCR1
44673_at qv<le-16 3,91 55,50 Связывающий сиаловую кислоту Ig-подобный лектин 1, сиалоадгезин SIGLEC1
Зонд Величина Q Кратность Распространение Название гена Обозначение гена
219211_at 2.54E-13 4,83 55,50 Убиквитин-специфичная пептидаза 18 USP18
219684_at 2.75E-07 2,47 50,00 Рецепторный (хемосенсорный) транспортный белок 4 RTP4
241812_at 5.25E-07 1,84 38,20 ДНКполимераза-трансактивированный белок 6 DNAPTP6

Указанный 21 ген нейтрализуют доза-зависимым способом с помощью антитела MEDI-545. См. фиг.86 и 89. Heatmap (фиг.87а) и АГК расчеты (фиг.87б) с применением указанного 21 гена показывают нейтрализацию повышенной регуляции ИФН α/β генной подписи у пациентов с СКВ после применения MEDI-545 в количестве 30 мг/кг, но не у пациентов с СКВ после применения плацебо (фиг.88). Таким образом, доказано, что указанные гены могут применяться в качестве набора ФД маркеров.

Разделение 35 пациентов по интенсивности ИФН I типа генной подписи, используя 21 ген

Фиг.85 показывает разделение 35 пациентов с СКВ на группы с высокими (20 пациентов), умеренными (8 пациентов) и слабыми (7 пациентов) ИФН I типа генными подписями, основанное на распределении величин кратности изменения (шкала log2) всех 21 ИФН I типа-индуцируемых генов и разделенное на каждую группу по среднему кратному изменению указанного распределения 21 гена у каждого пациента (вертикальные пунктирные линии), по измерениям динамическим анализом Fluidigm. Из фиг.85 следует, что распределение у каждого пациента проявляет небольшое отличие в линии наклона и в основной форме, что отражает разнообразие уровней разной тяжести больных СКВ, основанное на отобранном 21 тип ИФН-индуцируемом гене. В графике АГК для всех больных СКВ, профилированных в настоящем исследовании (n=100), и для 24 контрольных образцов от здоровых индивидуумов, используя 21 ИФН I типа-индуцируемый ген, наблюдают четкое различие между больными СКВ со сверхэкспрессируемой ИФН I типа генной подписью и со слабой или невыявляемой ИФН I типа генной подписью (фиг.82в). Кроме того, пациентов с СКВ со слабыми и невыявляемыми ИФН I типа генными подписями объединяют вместе со здоровыми донорами. Важно, что разделение между указанными группами, используя панель из 21 гена ИФН I типа-индуцируемых генов, схоже с разделением, получаемым с более крупным набором, состоящим из 114 генов (фиг.81а и 81б).

Пример 9. Множественные ИФН I типа подтипы обладают повышенной регуляцией в цельной крови больных СКВ

Для идентификации подтипов ИФН I типа, ответственных за индукцию ИФН I типа подписи больных СКВ, измеряют уровни иРНК ИФН I типа генов в цельной крови больного СКВ.

Анализ генной экспрессии проводят, используя TaqMan Low Density Array (TLDA) фирмы Applied Biosystems. Экспрессию подтипов ИФН I типа α 1, 2, 5, 6, 7, 8, 14, 17 и 21 подвергают мониторингу и сравнивают в цельной крови у пациентов с СКВ относительно здоровых добровольцев.

Двухнитевую кДНК каждого образца пациента предварительно амплифицируют, используя набор TaqMan PreAmp Master Mix kit (фирма Applied Biosystems). Предварительно амплифицируют кДНК, проводя 10 циклов ПЦР в каждом из образцов, полученных от пациентов, используя объединенный раствор праймеров, пару для каждого гена, исследуемого на чипе. Предварительно амплифицированную кДНК разводят 1:5 в ТЕ. Объем 50 мкл разведенной предварительно амплифицированной кДНК вносят в 50 мкл смеси 2× TaqMan Universal PCR Master Mix (фирма Applied Biosystems) и перемешивают. Чип нагружают смесью, используя стандартные методы, и нагруженный чип пропускают через быструю систему реального времени ПЦР 7900НТ (фирма Applied Biosystems). Анализ данных получаемых величин Ct проводят с применением программного продукта SDSv2.2.2 (фирма Applied Biosystems).

Фиг.27 показывает относительную сверхэкспрессию иРНК девяти подтипов ИФНα в цельной крови пациентов с волчанкой относительно здоровых добровольцев. Регуляция многих из подтипов ИФНα повышена на уровне иРНК в цельной крови пациентов с СКВ.

Фиг.66 показывает, что гены ИФНβ, ИФНω и ИФНAR1 и ИФНAR2 также сверхэкспрессируются в цельной крови пациентов с волчанкой относительно здоровых добровольцев.

Фиг.82 показывает, что регуляция транскриптов ФНО-α, ИФН-γ, ИФН-γR1 и ИФН-γR2 также повышена в цельной крови пациентов с СКВ (фиг.82). Однако относительное значение сверхэкспрессии указанных транскриптов меньше значения представителей ИФН I типа семейства, особенно подтипов ИФН-α.

Пример 10. Ex vivo ИФН-простимулированная цельная кровь и кератиноциты здоровых индивидуумов выявляют панель ИФН I типа-индуцируемых генов, важных для псориаза.

Для идентификации ИФН I типа-индуцируемых генов, сверхэкспрессированных в кератиноцитах из повреждений у пациентов с псориазом, цельную кровь и кератиноциты здоровых доноров стимулируют ех vivo с панелью подтипов ИФНα, а также ИФНβ, ИФНγ и ФНОα.

Цельная кровь

Цельную кровь собирают от здоровых доноров в пробирки с гепарином. Общий объем крови, полученный от каждого донора, помещают в одну культуральную колбу, и 3 мл от общего объема вносят в отдельную лунку 6-луночного планшета для культивирования. Отдельные лунки с кровью затем подвергают различной обработке, включая: растворитель (1х ФСБ), панель подтипов ИФНα (ИФНα2a, -4b, -5, -6, -7, -8, -10, -16, -17), ИФНβ, ИФНω, ИФНλ, ИФНγ, лейкоцитарный ИФН, или ФНОα. После обработки кровь мягко перемешивают пипеткой и инкубируют при 37°C в атмосфере 5% СО2 в течение 4 ч (обработку ФНОα проводят в течение и 2 ч, и 4 ч). После периода инкубирования 2,5 мл цельной крови переносят в пробирку PAXgene RNA и переворачивают 8-10 раз. Пробирки PAXgene инкубируют при комнатной температуре в течение двух ч и затем замораживают (-20°C в течение ночи, -70°C для длительного хранения) до следующего применения. Индукцию генной экспрессии условиями обработки проводят, используя чипы Affymetrix GeneChip® human genome U133 plus v2.0.

Различные ИФНα подтипы и ИФНβ 900-1200 зонды установлены по повышенной регуляции по меньшей мере в 2 раза. Из них у 689 наборов зондов (примерно 1,3% от всех наборов зондов на чипе Affymetrix human genome U133 plus v2.0) однородно повышена регуляция по меньшей мере в 2 раза у всех доноров всеми десятью ИФНα подтипами и ИФНβ. Используя тот же подход, 336 наборов зондов выявляют по сниженной регуляции ИФНα/β в простимулированной ex vivo цельной крови.

Изменения генной экспрессии в цельной крови здоровых пациентов, простимулированной ФНОα, также наблюдают и через 2 ч, и через 4 ч. Всего регуляция у всех 234 и 72 наборов зондов повышена и понижена, соответственно по меньшей мере в два раза у всех доноров. Кроме того, ИФНγ проба цельной крови за 4 ч индуцирует повышенную регуляцию 304 наборов зондов и пониженную регуляцию 52 наборов зондов по меньшей мере в 2 раза. Небольшое наложение наблюдают в наборах зондов, регуляция которых повышена ИФНα/β и ФНОα (40 зондов). Напротив, повышенное наложение наблюдают в наборах зондов, регуляция которых повышена ИФНα/β и ИФНγ. Регуляция 198 зондов повышается по меньшей мере в 2 раза под воздействием и ИФНα/β, и ИФНγ. Из 198 зондов, регуляция которых повышена по меньшей мере в 2 раза под воздействием и ИФНα/β, и ИФНγ, величина повышенной регуляции под действием ИФНα/β выше примерно для 2/3 этих зондов (величина p меньше 0,05) по сравнению с ИФНγ.

Фиг.30 показывает иерархическое кластерирование 1384 наборов зондов, по-разному регулировавшихся или ИФНα/β, или ИФНγ, или ФНОα в простимулированной ех vivo цельной крови. Из такого иерархического кластерирования сходный ответ цельной крови на введение ИФНα подтипов и ИФНβ может быть легко установлен, поскольку может быть близкий, но резко отличный эффект ИФНγ от ИФНα/β и резко отличный эффект ФНОα от ИФНα/β.

Фиг.31а показывает иерархическое кластерирование относительной экспрессии только топовых 25 ИФН I типа-индуцируемых наборов зондов, выявленных в цельной крови, стимулированной ех vivo.

Кератиноциты

Нормальные кератиноциты человека (EpiDerm system, фирма MatTek, Inc.) выращивают в отсутствии сыворотки по инструкциям производителя. Вкратце, кератиноциты поддерживают на вставках культуры тканей на поверхности воздух-жидкость для поддержания многослойного, полностью дифференцированного эпителиального фенотипа. Кератиноциты стимулируют лейкоцитарным ИФН человека (15, 50, 150, МЕд/мл, фирма PBL Biomedical Labs), ИФНα2а человека (15-350 МЕд/мл, фирма PBL Biomedical Labs), рекомбинантным ФНОα человека (0,1 нг/мл, фирма R+D Systems) или рекомбинантным ИФНγ человека (3 нг/мл, фирма R+D Systems). Эпидермальные культуры собирают через 2, 4 или 18 ч после лечения для анализа транскриптов. Более 100 наборов зондов выявляют в качестве сверхэкспрессированных в культурах кератиноцитов, стимулированных ИФНα2а и лейкоцитарным ИФН человека.

Фиг.31б показывает иерархическое кластерирование относительной экспрессии 25 ИФН I типа-индуцируемых генов в простимулированных ex vivo кератиноцитах. 25 ИФН I типа-индуцируемых наборов зондов используют для получения иерархического кластерирования топовых 25 ИФН I типа-индуцируемых зондов, выявленных в простимулированной ех vivo цельной крови (см. фиг.31а). Многие из топовых 25 ИФН I типа-индуцируемых наборов зондов в ех vivo простимулированной цельной крови также индуцируются в простимулированных ех vivo кератиноцитах. См., например, МХ1, IFI27, OAS1, IFI6, IF144L, etc.

Кроме того, многие из указанных генов содержатся среди наиболее сверхэкспрессированных генов в поврежденной коже у пациентов, больных псориазом. См. обсуждение в примере 11 ниже.

Пример 11. Профилирование матрицы целого генома выявляет ИФНα/β сигнальный метаболический путь в качестве наиболее существенно активированного метаболического пути в поврежденной коже у пациентов, больных псориазом.

Проводят сравнение профилей генной экспрессии в образцах кожи от здоровых доноров и парных неповрежденных/поврежденных образцах кожи пациентов с псориазом для идентификации подписи генной экспрессии, индуцированной тип-1 интерфероном, ассоциированной с повреждениями кожи при псориазе. Вкратце, получают образцы кожи от 21 нормального здорового контрольного донора (5 образцов, полученных от фирмы Biochain, 14 полученных от фирмы ILSbio, и 2 из лаборатории доктора James Krueger) и 26 парных неповрежденных/поврежденных образцов кожи от 24 пациентов с псориазом (21 пара, полученная от фирмы Asterand, и 5 из лаборатории доктора James Krueger). Получают три дополнительных образца поврежденной кожи от трех пациентов с псориазом. Указанные 3 дополнительные образца поврежденной кожи утратили неповрежденный парный образец кожи, поскольку образец неповрежденной кожи или не дает достаточного количества кРНК для гибридизации, или сканирующая матрица для образца неповрежденной кожи обладает высоким коэффициентом пересчета, превышающим стандартный в более чем три раза.

Суммарную РНК из образцов экстрагируют, используя набор Qiagen RNAeasy-Mini (Hilden, Германия). Чистоту и концентрацию экстрагированной РНК определяют спектрофотометрически (260/280>1,9). Качество РНК оценивают на анализаторе Agilent 2100 Bioanalyzer, используя РНК 6000 Nano LabChip®. Получение меченой биотином амплифицированной кРНК из 2 мкг суммарной РНК проводят, используя набор для синтеза кДНК Affymetrix GeneChip® One-Cycle и набор для нанесения метки the Affymetrix GeneChip® IVT. Концентрацию и чистоту продукта кРНК определяют спектрофотометрически.

20 мкг каждой меченой биотином кРНК фрагментируют для гибридизации на матрицах Affymetrix GeneChip® human genome U133 plus v2.0. Фрагментированную кРНК приготовляют для гибридизации согласно указаниям в руководстве Affymetrix GeneChip®. Гибридизацию проводят в течение ночи в модели 320 ротационной печи для гибридизации, установленной на температуру 45°C. Все GeneChip® промывают и окрашивают на установке Affymetrix Model 450 Fluidics station. Матрицы сканируют на сканнере Affymetrix GeneChip® Scanner 3000. Сбор данных и первоначальную оценку состояния матрицы проводят с помощью программного обеспечения GeneChip Operating Software (GCOS).

Программное обеспечение ArrayAssist® Lite фирмы Stratagene (La Jolla, Калифорния) используют для подсчета суммарных уровней зондов (алгоритм нормализации GC-RMA) по файлам матриц CEL. Пакеты R (группа разработки R) samr & qvalue используют для выработки по-разному регулируемых генов. АГК и иерархическое кластерирование проводят с помощью и SpotFire, и R (группа разработки R). SAM & FDR используют для выбора по-разному регулируемых генов (парное сравнение между поврежденной и неповрежденной кожей, поврежденной и нормальной кожей, и неповрежденной и нормальной кожей). Наборы зондов, с кратным изменением по меньшей мере в два раза, и величина q, меньше или равная 0,05, рассматривают в качестве по-разному регулируемых. АГК и иерархическое кластерирование проводят и в SpotFire, и в bioconductor R.

В целом регуляция 1408 наборов зондов повышена и 1465 наборов зондов понижена в поврежденной коже по сравнению с кожей без язв. Хотя гены с пониженной регуляцией превышают по численности гены с повышенной регуляцией в поврежденной коже, величина дифференциальной регуляции генов с повышенной регуляцией намного выше в целом. Например, регуляция 318 наборов зондов повышена по меньшей мере в четыре раза в поврежденной коже, хотя регуляция только 84 наборов зондов понижена по меньшей мере в 4 раза в поврежденной коже. Среди них регуляция 96 наборов зондов повышена по меньшей мере в восемь раз в поврежденной коже, хотя регуляция только шести наборов зондов понижена по меньшей мере в восемь раз.

463 наборов зондов также с повышенной регуляцией и 489 наборов зондов с пониженной регуляцией в неповрежденной коже по сравнению с нормальной кожей. Фиг.45 показывает диаграмму Венна наборов зондов с повышенной (или пониженной) регуляцией в поврежденной коже и в неповрежденной коже по сравнению с нормальной кожей здоровых людей. Только 70 из 1408 наборов зондов с повышенной регуляцией в поврежденной коже также обладают повышенной регуляцией в неповрежденной коже. При этом только 43 из 1465 наборов зондов с пониженной регуляцией в поврежденной коже также обладают пониженной регуляцией в неповрежденной коже. Эти данные означают, что молекулярные процессы и биологические изменения, произошедшие в поврежденой коже по сравнению с неповрежденной кожей, существенно отличаются от молекулярных процессов и биологических изменений, которыми отличаются нормальная кожа относительно неповрежденной кожи.

Для идентификации наиболее статистически значимых метаболических путей, измененных при псориазе, перечень по-разному регулируемых генов подвергают GeneGo для анализа метаболического пути и сети. Вкратце, анализ метаболического пути и сети проводят с интегрированным программным обеспечением MetaCore™ от фирмы GeneGo, Inc. (Сант-Джозеф, Мичиган). Значимость, полученная для определенного метаболического пути и сети, почти соответствует по гипергеометрическому распределению, причем p-величина в существенной степени соответствует вероятности случайного картирования определенного набора генов, получая число генов в наборе всех генов на картах метаболических путей, генов по карте определенного метаболического пути и генов в эксперименте.

Пятьдесят семь сигнальных метаболических путей существенно изменены в повреждениях кожи по сравнению с неповрежденной кожей, большинство из которых участвует в иммунном ответе и клеточном цикле. Сигнальный метаболический путь ИФНα/β наибольшим образом изменен в поврежденной коже с величиной p=3,8×10-13. Представители сигнального метаболического пути ИФНα/β, например, ИФНα, ИФНβ, ИФНAR1, ИФНAR2, STAT1, IRF1, MPL, ISG15, IFI6, все были в значительной степени сверхэкспрессированы в поврежденной коже по сравнению с незатронутой кожей.

В целом, 22 сигнальных метаболических пути активированы и 37 сигнальных метаболических путей ингибированы (p<0,05) в поврежденной коже по сравнению с неповрежденной кожей. Все активированные предполагаемые сигнальные метаболические пути являются или цитокин-, или хемокин-опосредованными сигнальными метаболическими путями или вовлечены в иммунные ответы. Например, сигнальные метаболические пути ИФНγ, ФНОα и онкостатина М активируются в поврежденной коже пациентов с псориазом. Из всех сигнальных метаболических путей, измененных в поврежденной коже и в неповрежденной коже, сигнальный метаболический путь ИФНα/β возглавляет перечень с величиной p=6,6×10-26 (фиг.46). Компоненты метаболического пути, например, подтипы ИФНα, а также ИФНβ, ИФНAR1, ИФНAR2, STAT1, IRF1, MPL, ISG15, IFI6 в существенной степени сверхэкспрессируются в поврежденной коже по сравнению с неповрежденной кожей пациентов с псориазом.

Используя перечень наборов зондов, для которых установлено, что они ИФН I типа-индуцируемые, в цельной крови и в кератиноцитах в исследованиях по стимуляции ex vivo (пример 10), 164 из 1408 (примерно 11,7%) наборов зондов с повышенной регуляцией в поврежденной коже относительно неповрежденной кожи выявляют в качестве ИФН I типа-индуцируемых. Точный критерий Фишера подсчитывает величину p (односторонний критерий t-теста), составляющую менее 0,0001, следовательно наблюдаемая сверхэкспрессия ИФН I типа генов в поврежденной коже пациентов с псориазом является статистически значимой. ИФН I типа индуцированные гены также являются многими из генов с наибольшей повышенной регуляцией в поврежденной коже относительно неповрежденной кожи при псориазе. 19% топовых 100 и 200 наборов зондов с наиболее повышенной регуляцией в поврежденной коже относительно неповрежденной кожи являются генами ИФН I типа. См. фиг.47а и б для топовых 100 наборов генов с повышенной регуляцией в поврежденной коже. Эти гены включают STAT1, ключевой компонент при формировании комплекса ISGF3; IRF7, главный регулятор ИФНα/β опосредованного иммунного ответа; ген MYD88, который направляет индукцию CD8+ T-клеточных ответов с IRF7; IRF1, активатор транскрипции генов ИФН I типа; представители OAS1, OAS2, OAS3 семейства OAS, медиаторы устойчивости к вирусной инфекции; ISG15, убиквитин-подобный белок, который становится конъюгированным со многими клеточными белками при активировании под действием ИФНα/β; и представители сигнальных метаболических путей ISG15, например, USP18, UBE2L6 и HERC5. Такое расширение ИФН I типа генов представляет их в качестве наиболее сверхэкспрессированных генов в поврежденной коже пациентов с псориазом.

Табл.26 перечисляет в порядке уменьшения 50 топовых 50 ИФН индуцированных зондов в поврежденной коже по сравнению с неповрежденной кожей у больных псориазом. Табл.26 не только сравнивает кратное изменение на основе log2 (log2 fc) и величину q для каждого из 50 с наибольшей повышенной регуляцией ИФН I типа-индуцируемых генов в поврежденной коже относительно неповрежденной кожи у пациентов с псориазом, но также сравнивает основанное на log2 кратное изменение и величину q для указанных 50 генов в неповрежденной коже пациентов с псориазом относительно здоровых контрольных пациентов.

Таблица 26
Частота повышенной регуляции топовых 50 ИФН I типа индуцированных зондов в поврежденной коже по сравнению с неповрежденной кожей у пациентов с псориазом
ID зонда Unigen ID Название гена Обозначение гена Сравнение поврежденной кожи с неповрежденной Сравнение неповрежденной кожи с нормальной
Log2 fc Величина q Log2 fc Величина q
ID зонда Unigen ID Название гена Обозначение гена Сравнение поврежденной кожи с неповрежденной Сравнение неповрежденной кожи с нормальной
Log2 fc Величина q Log2 fc Величина q
219403_s_at Hs.44227 Гепараназа HPSE 4,598 4.46E-22 0,226 0,23589
204972_at Hs.414332 2′,5′-олигоаденилат синтетаза 2, 69/71 кДа OAS2 4,098 8.57E-14 0,096 0,28896
205660_at Hs. 118633 Типа 2′-5′-олигоаденилат синтетазы OASL 4,030 1.34E-12 0,029 0,20341
227609_at Hs.546467 Эпителиальное стромальное взаимодействие 1 (грудь) EPSTI1 4,002 1.14E-14 -0,254 0,10796
227458_at - - - 3,859 9,31E-14 -0,591 0,05449
219352_at Hs.529317 hect домен и RLD 6 HERC6 3,842 9,49E-16 -0,460 0,04810
216834_at Hs.75256 Регулятор передачи сигнала G-белка 1 RGS1 3,809 2,47E-17 -5,269 0,00000
204533_at Hs.632586 Лиганд хемокина (мотив C-X-C) 10 CXCL10 3,697 2,97E-12 0,338 0,13024
226702_at Hs.7155 Гипотетический белок LOC129607 LOC129607 3,572 2,37E-16 -0,156 0,26500
242625_at Hs.17518 Белок 2, содержащий домен радикал S-аденозилметионин RSAD2 3,403 1,65E-12 -0,070 0,31309
213797_at Hs.17518 Белок 2, содержащий домен радикал S-аденозилметионин RSAD2 3,243 3,36E-10 0,004 0,36209
202086_at Hs.517307 Устойчивость к миксовирусу (вирусу гриппа) 1, интерферон-индуцируемый белок p78 (мышь) МХ1 3,235 5,28E-14 0,050 0,33453
205552_s_at Hs.524760 2′,5′-олигоаденилат синтетаза 1, масса 40/46 кДа OAS1 3,222 2,41E-14 0,328 0,13669
210797_s_at Hs.l 18633 Типа 2′-5′-олигоаденилат синтетазы OASL 3,216 1,63E-09 0,005 0,34940
204439_at Hs.389724 Белок, подобный интерферон-индуцированному белку 44 IFI44L 3,205 4,73E-13 0,120 0,30073
202411_at Hs.532634 Интерферон альфа-индуцируемый белок 27 IFI27 3,165 4,81E-12 -0,154 0,26878
202869_at Hs.524760 2′,5′-олигоаденилат синтетаза 1, масса 40/46 кДа OAS1 3,150 2,47E-14 0,248 0,21403
205483_s_at Hs.458485 ISG15 убиквитин-подобный модификатор ISG15 3,088 4,37E-13 -0,273 0,11013
209969_s_at Hs.565365 Переносчик сигнала и активатор транскрипции 1, 91 кДа STAT1 2,993 7,95E-17 0,199 0,20072
22853l_at Hs.65641 Белок с доменом стерильного альфа мотива 9 SAMD9 2,846 5,24E-14 -0,033 0,35359
204415_at Hs.523847 Интерферон альфа-индуцируемый белок 6 IFI6 2,769 7,23E-09 -0,045 0,29074
ID зонда Unigen ID Название гена Обозначение гена Сравнение поврежденной кожи с неповрежденной Сравнение неповрежденной кожи с нормальной
Log2 fc Величина q Log2 fc Величина q
214453_s_at Hs.82316 Интерферон-индуцированный белок 44 IFI44 2,679 1,94E-12 0,086 0,32618
222838_at Hs.517265 Представитель 7 семейства SLAM SLAMF7 2,659 1,60E-16 -0,046 0,31222
219684_at Hs.43388 Рецепторный (хемосенсорный) транспортный белок 4 RTP4 2,649 3,73E-11 0,497 0,04912
203127_s_at Hs.435661 Сериновая пальмитоилтрансфераза, субъединица длинной цепи основания 2 SPTLC2 2,628 1,04E-20 -1,016 0,00017
205569_at Hs.518448 Лизосомально-ассоциированный мембранный белок 3 LAMP3 2,569 2,64E-09 0,293 0,22865
219691_at Hs.65641 Белок с доменом стерильного альфа мотива 9 SAMD9 2,559 1,30E-13 0,011 0,37349
223220_s_at Hs.518200 Семейство поли(АДФ-рибоза)полимеразы, представитель 9 PARP9 2,553 1,08E-15 0,069 0,31416
AFFX-HUMISG Hs.565365 Переносчик сигнала и активатор транскрипции 1, 91кДа STAT1 2,525 1,64E-10 0,706 0,03338
212268_at Hs.381167 Ингибитор серпиновой пептидазы, таксон B (овальбумин), представитель 1 SERPINB1 2,510 3,02E-15 -0,605 0,07749
216202_s_at Hs.435661 Сериновая пальмитоилтрансфераза, субъединица длинной цепи основания 2 SPTLC2 2,507 1,17E-13 -0,682 0,01693
229450_at - - - 2,492 1,50E-14 0,224 0,20674
208436_s_at Hs.166120 Фактор регуляции активности интерферона 7 IRF7 2,448 6,90E-15 -0,578 0,01612
AFFX-HUMISG Hs.565365 Переносчик сигнала и активатор транскрипции 1, 91 кДа STAT1 2,444 3,03E-10 0,516 0,05854
204747_at Hs.47338 Интерферон-индуцированный белок с тетратрикопептидными повторами 3 IFIT3 2,424 2,15E-14 0,365 0,07219
229390_at Hs.381220 Гипотетический белок LOC441168 RP1-93H18.5 2,400 2,59E-12 -0,369 0,11426
218400_at Hs.528634 2′-5′-олигоаденилат синтетаза 3, 100 кДа OAS3 2,397 3,83E-14 0,179 0,11631
235276_at - - - 2,386 3,61E-15 0,057 0,32771
203153_at Hs.20315 Интерферон-индуцированный белок с тетратрикопептидными повторами 1 IFIT1 2,351 1,17E-10 0,054 0,34454
210873_x_at Hs.348983 Фермент-каталитический АРОВЕС3А 2,348 1,35E-07 -0,048 0,30119
ID зонда Unigen ID Название гена Обозначение гена Сравнение поврежденной кожи с неповрежденной Сравнение неповрежденной кожи с нормальной
Log2 fc Величина q Log2 fc Величина q
полипептид, корректирующий иРНК апопротеина B, родственный каталитический полипептид 3А
204698_at Hs.459265 Простимулированный интерфероном ген экзонуклеазы 20 кДа ISG20 2,337 1,50E-12 -0,644 0,05052
232666_at Hs.528634 2′-5′-олигоаденилат синтетаза 3, 100 кДа OAS3 2,236 4,50E-10 0,077 0,04816
222881_at Hs.44227 Гепараназа HPSE 2,230 3,47E-15 0,221 0,17127
205241_at Hs-567405 SCO цитохром оксидазы недостаточный гомолог 2 (дрожжи) SCO2 2,208 1,90E-17 -0,285 0,08517
AFFX-HUMISG Hs.5653675 Переносчик сигнала и активатор транскрипции 1, 91 кДа STAT1 2,205 5,29E-10 0,397 0,10218
206553_at Hs.414332 2′,5′-олигоаденилат синтетаза 2, 69/71 кДа OAS2 2,183 1,34E-09 0,043 0,14755
207387_s_at Hs.1466 Глицеринкиназа GK 2,160 9,38E-14 0,014 0,37488
219716_at Hs.257352 Аполипопротеин L, 6 APOL6 2,123 3,03E-11 -0,126 0,19251
202270_at Hs.62661 Гуанилат связывающий белок 1, интерферон-индуцируемый, 67 кДа GBP1 2,113 4,67E-14 -0,053 0,31367

Удаление EST, гипотетических белков и дупликаций генов в результате идентификации наборами множественных зондов представлено в табл.27. Табл.27 представляет в понижающемся порядке топовые 50 генов с наибольшей повышенной регуляцией ИФН I типа в поврежденной коже по сравнению с неповрежденной кожей. Для генов, идентифицированных более чем одним набором зондов, приводят только набор зондов, выявленных в качестве обладающих самой высокой регуляцией.

Таблица 27
Топовых 50 ИФН I типа индуцированных генов в поврежденной коже по сравнению с неповрежденной кожей у пациентов с псориазом
ID зонда Unigen ID Название гена Обозначение гена Log2 fc Величина q (fdr) % превалирования
219403_s_at Hs.44227 Гепараназа HPSE 4,60 4.46E-22 100
204972_at Hs.414332 2′,5′-олигоаденилат синтетаза 2, 69/71 кДа OAS2 4,10 8,57E-14 96,15
205660_at Hs.118633 Фермент, родственный 2′-5′-олигоаденилат синтетазе OASL 4,03 1.34E-12 96,15
ID зонда Unigen ID Название гена Обозначение гена Log2 fc Величина q (fdr) % превалирования
2276099_at Hs.546467 Эпителиальное стромальное взаимодействие 1 (грудь) EPSTI1 4,00 1.14E-14 92,31
219352_at Hs.529317 hect домен и RLD 6 HERC6 3,84 9,49E-16 96,15
216834_at Hs.75256 Регулятор передачи сигнала G-белка 1 RGS1 3,81 2,47E-17 100,00
204533_at Hs.632586 Лиганд хемокина (мотив C-X-C) 10 CXCL10 3,70 2,97E-12 100,00
242625_at Hs.17518 Белок 2, содержащий домен радикал S-аденозилметионин RSAD2 3,40 1,65E-12 88,46
202086_at Hs.517307 Устойчивость к миксовирусу (вирусу гриппа) 1, интерферон-индуцируемый белок p78 (мышь) МХ1 3,24 5,28E-14 92,31
205552_s_at Hs.524760 2′,5′-олигоаденилат синтетаза 1, масса 40/46 кДа OAS1 3,22 2,41E-14 96,15
204439_at Hs.389724 Белок, подобный интерферон-индуцированному белку 44 IFI44L 3,21 4,73E-13 88,46
202411_at Hs.532634 интерферон альфа-индуцируемый белок 27 IFI27 3,17 4,81E-12 92,31
205483_s_at Hs.458485 ISG15 убиквитин-подобный модификатор ISG15 3,09 4,73E-13 92,31
209969_s_at Hs.565365 Переносчик сигнала и активатор транскрипции 1, 91кДа STAT1 2,99 7,95E-17 96,15
228531_at Hs.65641 Белок с доменом стерильного альфа мотива 9 SAMD9 2,85 5,42E-14 92,31
204415_at Hs.523847 интерферон альфа-индуцируемый белок 6 IFI6 2,77 7,23E-09 84,62
214453_s_at Hs.82316 Интерферон-индуцированный белок 44 IFI44 2,68 1,94E-12 92,31
222838_at Hs.517265 Представитель 7 семейства SLAM SLAMF7 2,66 1,60E-16 92,31
219684_at Hs.43388 Рецепторный транспортный белок 4 RTP4 2,65 3,73E-11 88,46
203127_s_at Hs.435661 Сериновая пальмитоилтрансфераза, субъединица длинной цепи основания 2 SPTLC2 2,63 1,04E-20 100,00
205569_at Hs.518448 Лизосомально-ассоциированный мембранный белок 3 LAMP3 2,57 2,64E-09 96,15
223220_s_at Hs.518200 Семейство поли(АДФ-рибоза) полимеразы, представитель 9 PARP9 2,55 1,08E-15 88,46
ID зонда Unigen ID Название гена Обозначение гена Log2 fc Величина q (fdr) % превалирования
212268_at Hs.381167 Ингибитор серпиновой пептидазы, таксон B (овальбумин), представитель 1 SERPINB1 2,51 3,02E-15 88,46
208436_s+at Hs.166120 Фактор регуляции активности интерферона 7 IRF7 2,45 6,90E-15 96,15
204747_at Hs.47338 Интерферон-индуцированный белок с тетратрикопептидными повторами 3 IFIT3 2,42 2,15E-14 92,31
218400_at Hs.528634 2′-5′-олигоаденилат синтетаза 3, 100 кДа OAS3 2,40 3,83E-14 100,00
203153_at Hs.20315 Интерферон-индуцированный белок с тетратрикопептидными повторами 1 IFIT1 2,35 1,17E-10 84,62
210873_x_at Hs.348983 Фермент-каталитический полипептид, корректирующий иРНК апопротеина B, родственный каталитический полипептид 3A APOBEC3A 2,35 1,35E-07 80,77
204698_at Hs.459265 Простимулированный интерфероном ген экзонуклеазы 20 кДа ISG20 2,34 1,50E-12 92,31
205241_at Hs.567405 Гомолог, недостаточный по синтезу цитохром оксидазы 2 (дрожжи) SCD2 2,21 1,90E-17 96,15
207387_s_at Hs.1466 Глицеринкиназа GK 2,16 9,38E-14 92,31
219716_at Hs.257352 Аполипопротеин L, 6 APOL6 2,12 3,03E-11 92,31
202270_at Hs.62661 Гуанилат связывающий белок 1, интерферон-индуцируемый, 67 кДа GBP1 2,11 4,67E-14 92,31
229625_at Hs.513726 Гуанилат-связывающий белок 5 GBP5 2,07 7,52E-10 88,46
228617_at Hs.441975 XIAP ассоциированный фактор-1 BIRC4BP 2,05 3,41E-12 84,62
206513_at Hs.281898 Отсутствует при меланоме 2 AIM2 2,04 2,32E-08 76,92
218943_s_at Hs.190622 DEAD (Asp-Glu-Ala-Asp) box полипептид 58 DDX58 2,00 1,39E-10 88,46
203148_s_at Hs.575631 Белок 14, содержащий трехраздельный мотив TRIM14 1,94 2,17E-17 96,15
213293_s_at Hs.501778 Белок 22, содержащий трехраздельный мотив TRIM22 1,89 1,36E-12 88,46
214838_at - SFT2 домен-содержащий белок 2 SFT2D2 1,88 5,30E-17 92,31
231769_at Hs.464419 F-box белок 6 FBXO6 1,86 6,34E-14 88,46
227697_at Hs.527973 Супрессор передачи сигнала цитокина 3 SOCS3 1,82 4,55E-10 88,46
ID зонда Unigen ID Название гена Обозначение гена Log2 fc Величина q (fdr) % превалирования
206632_s_at Hs.226307 Фермент-каталитический полипептид, корректирующий иРНК апопротеина B, родственный каталитический полипептид 3A APOBEC3B 1,81 9,42E-10 92,31
201649_at Hs.425777 Убикветин-конъюгирующий фермент E2L 6 UBE2L6 1,81 2,15E-13 84,62
204702_s_at Hs.404741 Подобный ядерному фактору (эритроидному деривату 2) 3 NFE2L3 1,80 1,71E-16 96,15
202531_at Hs.436061 Фактор регуляции активности интерферона 1 IRF1 1,79 2,13E-13 80,77
204994_at Hs.926 Устойчивость к миксовирусу (вирусу гриппа) 2 (мышь) МХ2 1,75 7,99E-09 69,23
215966_x_at ' Псевдоген глицеринкиназы 3 GKP3 1,73 3,33E-11 80,77
207655_s_at Hs.444049 B-клеточный линкер BLNK 1,71 2,28E-14 96,15
216598_s_at Hs.303649 Лиганд хемокина 2 (мотив C-C) CCL2 1,71 4,80E-07 65,38

Кратность изменений (fold changes - log2 fc) рассчитывают, основываясь на соотносительных уровнях транскрипции между парными образцами поврежденной и неповрежденной кожи. Величины q рассчитывают, основываясь на степени ложных оценок (false discovery rate - FDR). Доминирование представлено в виде процентного соотношения 26 парных образцов поврежденной и неповрежденной кожи по меньшей мере двухкратную сверхэкспрессию генов, перечисленных в таблице.

Указанные топовые 50 ИФН I типа-индуцированные гены в поврежденной коже относительно неповрежденной кожи у больных псориазом сверхэкспрессируются, в среднем, больше от 3,2 раз (CCL2 и BLNK) до 24 раз (HPSE) в поврежденной коже. Кроме того, у всех генов, представленных в таблице, за исключением CCL2 и AIM2, была повышена регуляция по меньшей мере у 84% биопсийных парных образцов поврежденной/неповрежденной кожи (23 из 26 пар) от пациентов с псориазом. Такая сильная повышенная регуляция крупной панели ИФН I типа генов в образцах поврежденной кожи относительно образцов неповрежденной кожи больных псориазом предоставляют весомый довод для их применения в качестве ФД маркеров.

Выше вкратце было указано, что повышенную регуляцию тип-I интерферон-индуцируемых генов устойчиво наблюдают у пациентов с псориазом. Табл.28 представляет стандартное и среднее кратное изменение топовых 25 с наибольшей повышенной регуляцией ИФН I типа наборов зондов для каждой пары образцов поврежденной/неповрежденной кожи. Топовые 25 с наибольшей повышенной регуляцией ИФН I типа наборов зондов постоянно наблюдают при выявлении повышенной генной экспрессии в поврежденной коже относительно неповрежденной кожи каждого отдельного больного псориазом.

Таблица 28
Стандартные и средние кратные величины изменения топовых 25 с наибольшей повышенной регуляцией ИФН I типа-индуцируемых генов в 26 парах поврежденной кожи по сравнению с поврежденной кожей
ID зонда UniGene ID Обозначение гена Номера пар
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26
219403_s_at Hs.44227 HPSE 67,78 24,31 35,28 27,94 37,31 28,56 236,24 128,77 10,29 7,12 19,62 25,78 30,21 24,01 56,80 10,70 35,20 11,42 5,86 12,73 25,78 30,81 32.26 24,58 48,50 105,13
204972_at Hs.414332 OAS2 12,60 21,22 1,19 2,44 49,33 48,03 33,22 43,96 13,92 71,36 28,17 4,04 24,63 79,34 15,84 96,99 10,27 30,28 9,26 30,11 16,38 24,27 60,43 25,32 132,09 9,07
205660_at Hs.118633 OASL 7,19 13,48 4,51 9,03 62,19 50,23 31,12 54,05 9,72 9,94 1,10 2,31 24,75 44,70 11,91 45,98 17,46 14,66 33,60 17,27 84,97 24,22 92,12 46,44 54,96 39,66
2276099_at Hs.546467 EPSTI1 11,25 20,34 -1,43 1,38 57,01 32,14 14,40 23,42 10,53 55,80 32,87 8,86 59,54 47,71 33,84 78,12 14,34 25,86 33,41 12,06 19,24 17,86 28,12 22,43 78,03 10,90
227458_at - - 16,69 10,94 19,35 3,11 54,31 23,30 30,76 10,59 3,25 40,43 41,37 6,70 26,83 23,19 37,88 70,78 75,98 19,04 26,19 49,50 5,43 24,89 24,13 11,45 26,05 9,87
219352_at Hs.529317 HERC6 7,86 15,70 2,38 1,46 49,25 51:01 11,64 19,63 20,95 21,72 15,84 5,82 10,58 23,06 30,42 113,47 11,03 26,94 9,90 16,46 19,06 33,32 27,98 19,08 26,56 8,66
216834_at Hs.75256 PGS1 27,92 8,50 17,90 6,81 58,42 16,25 4,97 20,52 10,02 24,32 19,50 9,91 94,41 14,83 23,00 15,64 13,95 31,90 100,03 8,02 2,44 13,49 15,83 22,64 29,15 14,83
204533_at Hs.632586 CXCL10 3,92 3,01 8,72 3,91 249,60 13,12 13,37 15,14 4,75 69,86 56,31 22,30 12,75 8,30 16,61 28,11 12,95 30,79 66,10 17,72 11,89 12,12 41,27 10,90 30,14 5,86
226702_at Hs.7155 LOC129607 3,59 5,77 3,10 1,27 60,00 12,76 14,72 22,00 9,53 58,99 27,55 2,99 5,99 39,75 25,66 225,99 19,79 30,96 4,88 45,30 14,42 7,91 32,87 14,50 19,85 3,13
242625_at Hs.17518 RSAD2 4,57 6,19 1,79 1,24 66,13 51,91 19,28 23,36 4,02 32,04 8,80 1,76 5,64 16,36 15,97 94,85 9,47 14,58 4,64 33,67 16,26 10,67 68,96 20,21 40,57 5,99
213797_at Hs.17518 RSAD2 8,33 7,37 1,16 1,00 78,64 33,08 11,98 25,13 1,86 21,73 8,43 2,73 3,23 31,91 12,04 49,52 8,11 12,61 11,92 24,02 25,00 10,04 75,04 17,36 28,33 6,29
202086_at Hs.517307 MX1 5,03 9,17 1,25 1,08 20,97 39,08 14,63 23,54 11,33 18,56 11,71 3,08 8,93 20,03 8,68 86,72 11,04 19,60 7,24 4,00 12,05 10,63 28,80 11,08 27,74 5,68
205552_s_at Hs.524760 OAS1 5,93 11,05 1,19 2,76 21,03 29,00 11,76 27,37 7,71 19,23 20,14 3,49 2,82 37,85 21,91 39,43 6,13 24,10 5,86 2,63 4,18 13,46 21,42 9,30 32,15 16,09
210797_s_at Hs.118633 OASL 2,04 6,90 1,32 1,34 45,94 31,06 16,86 66,61 9,25 1,69 1,73 1,20 19,00 23,73 1,62 43,88 11,71 10,30 26,36 2,27 78,51 15,88 65,78 33,47 35,32 18,92
204439_at Hs.389724 IFI44L 4,52 6,71 -3,59 -1,06 14,49 58,16 9,25 32,21 6,68 37,49 31,82 3,96 19,43 16,66 23,81 253,56 6,81 20,34 3,18 17,90 12,16 7,60 18,42 4,52 25,93 1,12
202411_at Hs.532634 IFI27 10,97 15,52 1,94 2,66 12,02 38,87 14,83 27,63 17,02 17,22 17,69 5,81 9,36 26.00 15,85 38,94 2,01 30,69 4,59 -4,73 3,46 10,59 22,17 7,00 50,18 7,37
202S69_at Hs.524760 OAS1 5,34 7,99 2,04 2,09 16,23 32,48 13,29 30,47 12,75 49,00 10,15 5,52 2,31 18,94 19,52 36,57 4,58 16,19 4,81 8,96 4,73 11,05 11,67 7,13 18,20 7,39
205483_s_at Hs.458485 ISG15 5,64 4,37 1,65 1,10 19,82 40,24 8,30 13,89 7,00 12,18 14,49 4,47 6,78 19,24 10,65 57,01 3,67 12,65 2,96 2,57 11,30 5,71 34,41 18,06 30,48 5,07
209969_s_at Hs.565365 STAT1 6,14 6,12 285 2,00 38,39 16,50 10,35 7,10 12,90 17,32 12,41 3,77 14,31 7,49 25,00 18,73 5,45 9,63 9,18 17,30 7,10 9,27 11,03 10,91 12,91 4,37
228531_at Hs.65641 SAMD9 5,07 5,24 2,52 1,79 12,56 12,67 5,76 15,63 9,88 12,94 20,85 1,97 4,70 24,24 15,22 20,12 10,49 10,39 5,60 14,30 6,80 6,38 16,24 12,46 13,49 6,75
204415_at Hs.523847 IFI6 1,62 6,53 -2,01 1,00 13,90 25,74 5,59 16,88 4,66 11,65 6,45 3,30 5,43 30,76 3,29 38,93 4,08 20,01 2,08 1,00 49,45 16,05 58,43 17,95 52,57 6,86
214453_s_at Hs.82316 IFI44 2,60 6,23 -2,89 1,22 14,76 10,55 4,43 9,99 2,67 12,32 25,67 3,66 8,26 18,22 2,57 61,65 6,49 20,83 8,32 10,76 4,93 5,66 13,27 8,02 26,71 2,03
222838_at Hs.517265 SLAMF7 5,26 7,36 1,70 1,97 10,55 8,75 5,56 9,97 6,78 10,62 15,91 5,44 19,09 5,39 14,93 6,86 10,10 8,89 15,42 7,99 4,69 5,06 5,92 5,61 11,22 9,01
219684_at Hs.43388 RTP4 3,11 13,02 -3,07 -1,11 13,95 18,00 6,50 10,09 3,48 30,25 23,69 8,83 6,66 16,47 10,87 18,65 3,40 17,36 5,96 1,92 5,90 8,90 4,55 4,92 28.75 3,91
203127_s_at Hs.435661 SPTLC2 6,06 5,07 4,11 3,50 8,18 5,50 11,49 8,25 2,73 4,53 6,24 5,57 5,61 11,38 8,26 7,73 10,92 7,32 4,82 3,64 9,24 5,35 9,32 13,11 11,00 12,89
Стандартное кратное изменение 0,04 9,92 4,12 3,20 43,40 29,08 22,41 27,45 8,55 26,73 19,14 6,13 17,25 25,18 18,49 63,16 13,02 19,09 16,49 14,30 18,21 13,65 32,82 15,94 35,61 13,07
Среднее кратное изменение 5,93 7,37 1,79 1,79 37,31 29,00 11,98 22,00 9,25 19,23 17,69 4,04 9,36 23,06 15,85 43,88 10,27 19,04 7,24 12,06 11,89 10,67 27,98 13,11 28,75 7,37

Фиг.32 представляет график распределения стандартных и средних кратных изменений среди разных пар поврежденной и неповрежденной кожи. Распространенная и однородная повышенная регуляция большинства сверхэкспрессированных ИФН I типа генов в поврежденной коже больных псориазом подтверждает их применение в качестве ФД маркеров.

Семнадцать наборов зондов также были отмечены в качестве недостаточно экспрессированных в поврежденной коже и также их регуляция была понижена под действием ИФНα/β в исследованиях по стимуляции ex vivo, описанных в примере 10. К этим генам относятся гены CYP1B1, TGST1, RRAGD, IRS2, MGST1, TGFBR3 и RGS2.

Пример 12. Экспрессия ИФН I типа генов существенно не изменена в нормальной коже по сравнению с неповрежденной кожей больных псориазом.

Хотя массив данных, полученных в примере 11, показывает сверхэкспрессию различных генов, индуцируемых ИФН I типа в поврежденной коже по сравнению с неповрежденной кожей, выявляют только 5 наборов зондов, сверхэкспрессированных в неповрежденной коже по сравнению с нормальной контрольной кожей. Величина p точного критерия Фишера (двухнаправленный t-тест) составляет 0,581, что подтверждает, что сверхэкспрессия ИФН I типа генов не является статистически значимой в неповрежденной коже больных псориазом относительно здоровой кожи.

В табл.26 (пример 11) показано, что большинство генов, выявленных в качестве 50 топовых ИФН I типа-индуцированных генов в поврежденной коже по сравнению с неповрежденной кожей, сопоставимо экспрессируются в неповрежденной коже относительно нормальной контрольной кожи (несколько генов, например, RGS1 и SPTLC2, обладают пониженной регуляцией в неповрежденной коже по сравнению с нормальной кожей). Фиг.33 представляет графически относительную экспрессию трех генов, индуцируемых ИФН I типа (HPSE, OASL и HERC6; индуцированы в качестве топовых 50 ИФН I типа-индуцированных наборов зондов в поврежденной коже по сравнению с неповрежденной кожей), и 1 ген, не относящийся к ИФН I типа-индуцируемому гену (SERPINB4), и в (а) поврежденной коже по сравнению с неповрежденной кожей, и (б) в неповрежденной коже по сравнению с нормальной кожей. Сверхэкспрессия генов HPSE, OASL и HERC6 в поврежденной коже по сравнению с неповрежденной кожей статистически значима (что доказывает очень малая величина p) и крупномасштабна (стандартная сверхэкспрессия имеет кратность 12-250). Сверхэкспрессия гена SERPINB4 в неповрежденной коже примерно в 3-4 раза больше по сравнению с нормальной кожей, но больше примерно в 200 раз в поврежденной коже по сравнению с неповрежденной кожей.

Анализ образцов нормальной здоровой, поврежденной при псориазе и неповрежденной при псориазе кожи с применением 164 наборов зондов, идентифицированных в примере 11 в качестве ИФН I типа индуцируемых, показывает скопление образцов поврежденной при псориазе кожи и скопление образцов неповрежденной при псориазе кожи и нормальной здоровой кожи. Фиг.34а представляет heatmap неконтролируемого иерархического скопления всех поврежденных, неповрежденных и нормальных образцов кожи, профилированных с применением 164 ИФН I типа-индуцируемых наборов зондов в поврежденной коже по сравнению с неповрежденной кожей у пациентов с псориазом. Показано, что почти все (кроме трех) образцы поврежденной кожи кластерированы вместе, а также примерно все образцы неповрежденной и нормальной кожи кластерированы вместе. Фиг.34б представляет план АГК образцов кожи, используя те же 164 с повышенной регуляцией ИФН I типа-индуцируемые наборы зондов. Кроме того, нормальные образцы кожи и неповрежденные образцы кожи преимущественно кластерированы вместе, показывая сходные уровни экспрессии 164 генов. Кроме того, большинство образцов поврежденной кожи отделено от образцов нормальной и неповрежденной кожи, свидетельствуя, что образцы поврежденной кожи проявляют отличительную сверхэкспрессию ИФН I типа-индуцируемых генов, которые были отделяемы от уровней генной экспрессии нормальных и неповрежденных образцов кожи.

Указанные наблюдения дополнительно подтверждают анализом метаболического пути гена. Анализ GeneGo показывает, что возможность изменения в ИФНα/β сигнальном метаболическом пути неповрежденной кожи больных псориазом относительно нормальной кожи имеет величину p, близкую к 1. Отличительное разделение образцов поврежденной кожи от образцов неповрежденной кожи и образцов нормальной кожи наблюдают даже в том случае, если кластерирование образцов основано на профиле транскрипции целой последовательности генома. См. фиг.47.

Пример 13. Подтверждение повышенной регуляции ИФН I типа-индуцируемого гена в поврежденной коже больных псориазом методами taqMan-based

Динамическую совокупность BioMark 48,48 (метод, основанный на taqMan) фирмы Fluidigm используют для подтверждения результатов исследований чипов генома человека Affymetrix GeneChip® human genome U133 plus v2.0, результаты показывают, что повышена регуляция генов ИФН I типа в поврежденной коже при псориазе относительно неповрежденной кожи при псориазе или нормальных образцов кожи.

Восемнадцать пар поврежденных и неповрежденных образцов кожи от 18 пациентов, больных псориазом, используют для анализа генной экспрессии. Двадцать девять из числа указанных генов являются ИФН I типа индуцируемыми генами, хотя 11 генов были с высоко повышенной регуляцией в поврежденной коже, но они не являются ИФН-индуцируемыми генами, например, S100A9, S100A12, SERPINGB4 и KLK13. Каждый ген отбирают, основываясь на преобладании и существенной сверхэкспрессии в поврежденной коже. Сверхэкспрессию всех генов в поврежденной коже подтверждают методом taqMan КРВ-ПЦР, большинство этих генов показывает очень хорошую корреляцию между микроматрицей и taqMan анализами. Фиг.35 показывает taqMan данные по сверхэкспрессии каждого из десяти (OAS2, OASL, EPSTI1, МХ1, IFI44L, IFI44, HERC6, HPSE, ISG15 и STAT1) ИФН I типа-индуцируемых генов в поврежденной коже в 18 парных образцах поврежденной/неповрежденной кожи.

В целом, результаты анализа на основе taqMan и анализа матрицы Affymetrix хорошо коррелируют, подтверждая, что гены, выбраны в качестве сверхэкспрессированных ИФН I типа-индуцированных генов в поврежденной коже больных псориазом. Распределение коэффициентов корреляции между анализом на основе taqMan и анализом матрицы Affymetrix для 40 сверхэкспрессированных генов представлены на фиг.36а. У девятнадцати сверхэкспрессированных генов коэффициенты корреляции превышают 0,85, подтверждая корреляцию между микроматрицей и анализом, основанном на taqMan. Другие 17 генов обладают высокими коэффициентами корреляции между микроматрицей и анализом, основанном на taqMan, равными 0,5-0,85. Фиг.36б показывает распределение коэффициентов корреляции между анализом на основе taqMan и анализом матрицы Affymetrix для 29 ИФН I типа-индуцированных генов 18 пациентов с псориазом. Кроме того, многие из генов обладают высокими коэффициентами корреляции, превышающими величину 0,90. Наряду с другими к этим генам относятся гены IFI27, CXCL10, ISG15 и МХ1.

Фиг.37а-37г и 38 показывают детальные данные по генной экспрессии, полученные из исследований на основе микрочипов и taqMan для нескольких ИФН I типа-индуцируемых генов в парных образцах поврежденной/неповрежденной кожи. Эти данные доказывают, что сходные уровни сверхэкспрессии ИФН I типа-индуцированных генов в поврежденной коже больных псориазом выявляют между иследованиями методом на основе taqMan и методом с применением микрочипов и, следовательно, высокие коэффициенты корреляции, обсуждавшиеся выше. Фиг.37а и 37б показывают сходную сверхэкспрессию ISG15 в каждом из 18 парных образцов кожи с повреждениями/без повреждений по определению методом на основе taqMan (37а) и с применением микрочипов (37б). Фиг.37в и 37г показывают сверхэкспрессию МХ1 в каждом из 18 парных образцов кожи с повреждением/без повреждения по определению методом taqMan (37в) и с применением микрочипов (37г). Коэффициент корреляции между методом на основе taqMan и методом с применением микрочипов составляет 0,9735 для ISG15 и 0,9836 для МХ1. Фиг.38 показывает измерение близкой сверхэкспрессии ИФН I типа-индуцируемых генов IFI27 и CXCL10 методом на основе taqMan и методом с применением микрочипов в каждой из 18 пар образцов поврежденной/неповрежденной кожи.

Коэффициент корреляции между результатами, полученными методом на основе taqMan и методом с применением микрочипов, для IFI27 и CXCL10 составляет 0,9456 и 0,9455, соответственно.

Пример 14. ИФНα антитело нейтрализует генную экспрессию, индуцированную ИФНα I типа, в ex vivo простимулированных кератиноцитах здоровых добровольцев.

Выделяют кератиноциты здоровых добровольцев и стимулируют ех vivo возрастающими дозами ИФНα2а и лейкоцитарного ИФН для индукции варианта возрастающей ИФН I типаα-индуцированной генной экспрессии. Анти-ИФНα антитело может нейтрализовать вариант ИФН I типаα-индуцированной генной экспрессии доза-зависимым образом.

Нормальные кератиноциты человека (EpiDerm system, MatTek, Inc.) выращивают в условиях без сыворотки по инструкциям производителя. Вкратце, кератиноциты поддерживают на вставках культуры ткани на поверхности воздуха-жидкости для поддержания многослойного полностью дифференцированного эпителиального фенотипа. Кератиноциты стимулируют лейкоцитарным ИФН человека (15-150 МЕд/мл, фирма PBL Biomedical Labs) и ИФНα2а человека (15-350 МЕд/мл, фирма PBL Biomedical Labs). В некоторые лунки добавляют гуманизированное анти-человеческий ИФНα моноклональное антитело (0,01-100 мкг/мл; продукт MEDI-545, фирма MedImmune, Inc) или изотипическое подобранное контрольное антитело несоответствующей специфичности (продукт R347, фирма MedImmune, Inc) одновременно со стимулирующим воздействием цитокина. Эпидермальные культуры собирают через 2, 4 или 18 ч после обработки для анализа транскрипции. Экспрессию генов, индуцированную ИФН I типа, измеряют, используя BioMark™ 48.48 dynamic array.

Регуляцию экспрессии большинства ИФН I типа-индуцированных генов повышают в ИФНα2а- и лейкоцитарный интерферон-стимулированных кератиноцитах доза-зависимым образом. Такая повышенная регуляция ИФН I типа-индуцированных генов, или ИФНα2а, или лейкоцитарным интерфероном, подобным образом ингибируется доза-зависимым образом с помощью ИФНα моноклональным антителом (MEDI-545). Контрольное антитело R347 не имеет существенного воздействия на нейтрализацию ИФН I типа-индуцированных генов.

Доза-зависимая нейтрализация трех генов, индуцированных ИФН I типа (ISG15, USP18 и IFIT2), антителом MEDI-545 в кератиноцитах, простимулированных ИФНα2а или лейкоцитарным ИФН, представлена на фиг.39. Фиг.39 (а), (в) и (д) показывают, что MEDI-545 нейтрализует сверхэкспрессию генов ISG15, USP18 и IFIT2, индуцируемых ИФН I типа, соответственно, в кератиноцитах, простимулированных 350 МЕд/мл ИФНα2а. Каждый из этих генов нейтрализован на 100% с помощью MEDI-545. Фиг.39 (б), (г) и (е) показывает, что MEDI-545 нейтрализует сверхэкспрессию генов ISG15, USP18 и IFIT2, индуцированных ИФН I типа соответственно, в кератиноцитах, простимулированных с помощью 150 МЕд./мл лейкоцитарного ИФН. Нейтрализация этих генов с помощью MEDI-545 составляет 70-100%, что неудивительно, поскольку which лейкоцитарный ИФН содержит и ИФНα, и ИФНβ. MEDI-545 эффективно нейтрализует большинство подтипов ИФНα, но не ИФНβ. Эти данные по нейтрализации представляют дополнительное доказательство того, что ИФН I типа-индуцируемые гены в цельной крови и кератиноцитах, простимулированных ex vivo (пример 10), являются ИФН I типа-индуцированными генами. Они также подтверждают повышенную регуляцию экспрессии указанных генов в поврежденной псориазом коже относительно неповрежденной кожи из-за индукции ИФН I типа.

Пример 15. Повышена регуляция различных ИФН I типа подтипов в поврежденной коже у пациентов, больных псориазом.

Для идентификации подтипов ИФН I типа, ответственных за индукцию подписи ИФН I типа в повреждениях кожи у пациентов с псориазом, измеряют уровни иРНК генов ИФН I типа в псориатических повреждениях кожи.

Анализ генной экспрессии проводят, используя a TaqMan Low Density Array (TLDA) фирмы Applied Biosystems. Экспрессию 23 генов, включая подтипы 1, 2, 5, 6, 7, 8, 14, 17 и 21 ИФНα I типа; интерфероны - I типа ИФНβ, к и ω; ИФНγ; ИФНα рецепторы ИФНAR1 и ИФНAR2; ИФНγ рецепторы ИФНGR1 и ИФНGR2; ИФНα I типа индуцируемые гены RSAD2, OAS3, IFI44, МХ1 и CXCL10; и ФНОα подвергают мониторингу и сравнивают в парах поврежденной и неповрежденной кожи 18 пациентов с псориазом.

Двухнитевую кДНК образца каждого пациента предварительно амплифицируют, используя набор TaqMan PreAmp Master Mix kit (фирма Applied Biosystems). Предварительно амплифицированную в 10 циклах ПЦР кДНК в образце каждого пациента, используя объединенный раствор праймеров, пару для каждого гена анализируют на матрице. Предварительно амплифицированную кДНК разводят 1:5 в ТЕ. 50 мкл разбавленной предварительно амплифицированной кДНК добавляют к 50 мкл 2х смеси TaqMan Universal PCR Master Mix (фирма Applied Biosystems) и перемешивают. Матрицу нагружают смесью с помощью стандартных процедур, и загруженную матрицу исследуют в системе быстрой ПЦР реального времени 7900НТ (фирма Applied Biosystems). Анализ данных получаемых величин Ct проводят с программным обеспечением SDSv2.2.2 (фирма Applied Biosystems).

Фиг.40а показывает относительную сверхэкспрессию иРНК девяти подтипов ИФНα в поврежденной коже по сравнению либо с неповрежденной кожей, либо с нормальной кожей. За исключением ИФНα5 (регуляция повышена примерно в 4,6 раз; средняя кратность изменения, p<0,001), ни у одного из подтипов ИФНα не был существенно изменен уровень иРНК в неповрежденной коже по сравнению с тем же показателем в нормальной коже (p<0,05). Однако повышена регуляция всех подтипов ИФНα на уровне иРНК в поврежденной коже по сравнению с иРНК в нормальной коже (или неповрежденной коже) при статистически значимой сверхэкспрессии ИФНα1, ИФНα5, ИФНα8, ИФНα14, ИФНα17, ИФНα21 (p<0,05). Фиг.40б показывает сверхэкспрессию других представителей ИФН I типа семейства, ИФНβ, -к и -ω иРНК в поврежденной коже по сравнению либо с неповрежденной кожей, либо с нормальной кожей. Изменения иРНК ИФНβ и ИФНω в неповрежденной коже являются несущественными. Однако повышенная регуляция указанных иРНК существенна в поврежденной коже по сравнению с нормальной кожей (величины p 0,022 и 0,049 соответственно). Повышена регуляция ИФНк иРНК примерно в 1,6 раза (среднее кратное изменение, p=0,03) в неповрежденной коже, причем регуляция резко повышается в 62,6 раза (среднее кратное изменение) в поврежденной коже по сравнению с нормальной кожей (p<0,001). Кроме того, рецепторы для ИФН I типа, ИФНAR1 и ИФНAR2 также существенно сверхэкспрессируются в поврежденной коже пациентов с псориазом на уровне транскрипции (величины p<0,001; фиг.40в). Хотя повышенная регуляция ИФНAR2 существенна в неповрежденной коже, для ИФНAR1 это не так (фиг.40в). В совокупности представленные данные убедительно доказывают, что уровни иРНК представителей семейства ИФН I типа сопоставимы между неповрежденной кожей и здоровой нормальной кожей (за исключением ИФНα5 и ИФНк) и однородно сверхэкспрессированы в поврежденной коже больных псориазом.

Табл.29 перечисляет коэффициенты корреляции сверхэкспрессии молекул иРНК представителя ИФН I типа семейства (ИФН I типаα подтипы 1, 2, 5, 6, 7, 8, 14, 17 и 21; и ИФНβ, ИФНк и ИФНω) в поврежденной коже по сравнению с неповрежденной кожей больных псориазом. Из 12 измеренных представителей семейства ИФН I типа сверхэкспрессия ИФНα1, 2, 8 и 14 в поврежденной коже коррелирует наиболее согласованно со сверхэкспрессией других представителей семейства ИФН I типа за исключением ИФНα5, который показывает самую слабую корреляцию с другими представителями семейства ИФН I типа.

Табл.29
Коэффициент корреляции сверхэкспрессии представителей семейства ИФН I типа в кожных язвах у пациентов с псориазом
ИФНА1 ИФНА2 ИФНА5 ИФНА6 ИФНА7 ИФНА8 ИФНА14 ИФНА17 ИФНА21 ИФНВ1 ИФНK ИФНW1
ИФНА1 1
ИФНА2 0,66 1
ИФНА5 0,11 0,20 1
ИФНА6 0,45 0,47 -0,01 1
ИФНА7 0,77 0,79 0,09 0,68 1
ИФНА8 0,64 0,99 0,19 0,49 0,84 1
ИФНА14 0,84 0,94 0,28 0,44 0,72 0,94 1
ИФНА17 1,00 0,96 0,15 0,07 0,77 0,97 0,94 1
ИФНА21 0,71 0,49 0,50 0,42 0,81 0,49 0,61 0,75 1
ИФНВ1 0,54 0,86 0,28 0,33 0,69 0,96 0,80 0,93 0,54 1
ИФНK 0,78 0,73 0,09 0,59 0,27 0,73 0,77 0,03 0,22 0,54 1
ИФНW1 0,73 0,72 0,44 0,22 0,75 0,70 0,77 0,93 0,90 0,73 0,26 1

Пример 16. Совместная сверхэкспрессия ИФН I типа, тип-II ИФН и ФНОα и их генные подписи в поврежденной коже или у пациентов с псориазом

Участие ИФНγ и ФНОα иРНК сигнальных метаболических путей также оценивают в парных образцах поврежденной/неповрежденной кожи больных псориазом и здоровых людей. Выше в примере 15 обсуждали, что TLDA фирмы Applied Biosciences используют для измерения ИФНγ, ИФНRG1, ИФНGR2 и ФНОα иРНК в поврежденной и неповрежденной коже больных псориазом и в нормальной коже здоровых людей.

В отличие от наблюдений уровней экспрессии ИФН I типа иРНК, ИФНγ, уровни ИФНGR1, ИФНGR2 и ФНОα иРНК существенно сверхэкспрессируются в неповрежденной коже по сравнению с нормальной кожей здоровых людей (фиг.41; величины p 0,02, <0,001, <0,001 и <0,001 соответственно). Повышена регуляция ФНОα иРНК примерно в 5,7 раза, а регуляция молекул иРНК ИФНγ, ИФНGR1 и ИФНGR2 повышена примерно в 1,5, 2,2 и 2,8 раз по сравнению с регуляцией в нормальной коже (средняя кратность изменения; фиг.41). Однако, подобно интерферонам первого типа (ИФН I типа), повышена регуляция указанных генов в поврежденной коже по сравнению с либо неповрежденной кожей (величины p 0,04, 0,01, 0,001 и 0,007 соответственно), либо с нормальной кожей (величины p<0,001 для всех указанных генов; фиг.41). У молекул иРНК ФНОα, ИФНγ, ИФНGR1 и ИФНGR2 повышена регуляция примерно в 33,5, 116,7, 11,6 и 8,4 раза в поврежденной коже по сравнению с указанным показателем в нормальной коже. Такие наблюдения свидетельствуют, что варианты экспрессии иРНК для ИФНγ и ФНОα отличаются от вариантов экспрессии представителей семейства ИФН I типа, которые соизмеримы у здоровой и неповрежденной кожи (за исключением ИФНα5 и ИФНк), о регуляция которых повышена в поврежденной коже по сравнению с неповрежденной кожей у пациентов, больных псориазом.

Пример 17. Идентификация генов, индуцированных тип-II ИФН и ФНОα, в простимулированной ex vivo цельной крови, которые индуцируются в кожных повреждениях у больных псориазом

Подобно описанию в примере 10 цельную кровь здоровых доноров стимулируют ех vivo панелью подтипов ИФНα, а также ИФНβ, ИФНγ и ФНОα. Стимулирование цельной крови ех vivo с помощью ИФНγ или ФНОα выявляют наборы зондов, связанных с потенциальными ИФНγ- или ФНОα-индуцируемыми генами. Наборы трехсот четырех зондов идентифицируют на основании по меньшей мере 2-кратного повышения регуляции под действием ИФНγ четыре часа после стимуляции. Наборы двухсот тридцати четырех зондов идентифицируют на основании по меньшей мере 2-кратного повышения регуляции под действием ФНОα и два часа, и четыре часа после стимуляции.

Наборы зондов, выявленные ex vivo в качестве связанных с индукцией ИФНγ или ФНОα, сравнивают с общим набором 1408 зондов (пример 11), для которых была установлена повышенная регуляция в поврежденной коже относительно неповрежденной кожи больных псориазом. С помощью указанного метода наборы 106 и 35 зондов, включаемых в общее число 1408 зондов повышенной регуляции в поврежденной коже, выявляют в качестве ИФНγ- или ФНОα-индуцируемых, соответственно (фиг.42). Наборы 106 зондов, выявленных в качестве индуцированных ИФНγ, показаны на фиг.49. Наборы 35 зондов, выявленных в качестве индуцированных ФНОα, показаны на фиг.50. Наборы 164 зондов, показанных на фиг.42 в качестве выявленных ИФН I типа-индицированных, показаны на фиг.51. Точный тест Фишера показывает, что обе величины p (односторонний критерий - t-тест) сверхэкспрессии ИФНγ или ФНОα индуцируемых генов в поврежденной коже меньше 0,0001. Сверхэкспрессия ИФНγ и ФНОα индуцируемых генов является существенной.

Также используя перечень наборов зондов, о которых стало известно в исследованиях ех vivo, что они индуцируются ИФН I типа, ИФНγ и ФНОα, устанавливают, что ИФН I типа-, ИФНγ- и ФНОα-индуцируемые гены, регуляция которых повышена по меньшей мере в 2 раза в каждом из образцов поврежденной кожи относительно образцов неповрежденной кожи. Фиг.43 показывает число ИФН I типа-, ИФНγ- и ФНОα-индуцируемых генов с повышенной регуляцией в каждом из 26 парных образцов поврежденной и неповрежденной кожи. Повышенное число ИФН I типа-индуцируемых генов с повышенной регуляцией в определенном биопсийном образце поврежденной кожи обычно приводит к повышению сверхэкспрессии большего числа ИФНγ- и ФНОα-индуцируемых генов в одном и том же биопсийном образце поврежденной кожи. Это наблюдение подтверждается строгой корреляцией в совместной активации этих трех наборов генов с коэффициентами корреляции 0,9811, 0,9179 и 0,9372, используя двухсторонний парный критерий - t-тест, для сравнения повышенной регуляции ИФН I типа- и ИФНγ-, ИФН I типа- и ФНОα-, и ИФНγ- и ФНОα-индуцируемых генов в поврежденной коже по сравнению с неповрежденной кожей (фиг.43а).

Сходный анализ проводят для генов с пониженной регуляцией в поврежденной коже по сравнению с неповрежденной кожей больных псориазом (фиг.42). Из общего числа 1465 зондов, регуляция которых понижена в поврежденной коже относительно неповрежденной кожи, только 17, 5 и 5 индуцируются ИФН I типа, ИФНγ и ФНОα. Хотя установлено, что повышена регуляция молекул ИФНγ и ФНОα иРНК в коже без повреждений у пациентов, больных псориазом, при сравнении с нормальной кожей здоровых людей, ИФНγ-и ФНОα-индуцируемые гены не проявляют существенной сверхэкспрессии в неповрежденной коже (фиг.42). Отсутствие генетических подписей ИФН I типа, ИФНγ и ФНОα-индуцируемых генов в неповрежденной коже по сравнению с нормальной кожей, даже если молекулы иРНК ИФНγ и ФНОα сверхэкспрессируются в неповрежденной коже, означают, что и ИФНγ, и ФНОα белки не были образованы в неповрежденной коже, или другие сигнальные молекулы могут оказывать подавляющий эффект на метаболические пути ИФНγ и ФНОα в неповрежденной коже пациентов, больных псориазом.

Пример 18. Иммуногистохимический анализ биопсийных образцов поврежденной кожи больных псориазом, неповрежденной кожи больных псориазом и кожи здоровых доноров показывает повышенные белковые уровни генов, индуцированных ИФН I типа.

Чтобы установить, приводит ли высокая сверхэкспрессия ИФН I типа-индуцируемых генов в пораженной псориазом коже к сходным изменениям в экспрессии белков, иммуногистохимические анализы проводят для оценки наличия белков STAT1 и ISG15 в коже. Кроме того, анализ клеточных инфильтратов (pDC, mDC и CD4-положительных клеток) выполняют для сравнения числа типов ИФН-продуцируемых клеток и воспалительных клеток в биопсийных образцах поврежденной кожи по сравнению с неповрежденной и здоровой кожей.

Мгновенно замороженные биопсийные образцы поврежденной при псориазе, неповрежденной при псориазе и нормальной кожи делят на две части. Половину каждого образца погружают в О.С.Т., нарезают на части размером 5 мкм, помещают на «плюс» стекла и фиксируют в холодном ацетоне. Нарезанные образцы инкубируют с первичными антителами (специфичными в отношении BDCA2, CD83, CD4, STAT1 и ISG15) в течение 4 ч и промывают ФСБ. Срезы затем инкубируют с полимером, меченным пероксидазой, конъюгированным с козьим анти-мышиным иммуноглобулиновым антителом (система Envision+; фирма Dakocytomation, Carpenteria, Калифорния) в течение 30 мин и промывают Трис-буферным физиологическим буфером, pH 7,2. Выявление проводят с применением 3,3′-диаминобензидинтетрагидрохлоридом (препаратом DAB+; фирма DakoCytomation) в качестве хромогена. Срезы промывают dH2O, заново окрашивают гематоксилином, обезвоживают и накрывают покровным стеклом.

У всех пациентов с псориазом, у которых можно оценить пары образцов поврежденной/неповрежденной кожи, поврежденная кожа содержит повышенное количество клеточных инфильтратов pDC и/или mDC, повышенное число CD4+ клеток, а также белки STAT-1 и ISG15 со значительным повышением регуляции в эпидермисе и собственно коже (дерме) по сравнению с неповрежденными биопсийными образцами. Напротив, биопсийные образцы кожи от здоровых доноров не содержат ощутимого количества pDC, mDC или не показывают окрашивания для STAT-1 и ISG15. См. фиг.44, например, иммуногистохимические срезы.

Пример 19. Иммуногистохимический анализ и анализ генной экспрессии биопсийных образцов из кожных повреждений пациентов с СКВ показывают пониженную экспрессию генов, индуцированных ИФН I типа, на уровне белков и транскриптов после лечения продуктом MEDI-545

Чтобы определить, могут ли транскрипты топовых 25 ИФН I типа-индуцируемых генов в кожных повреждениях пациента с СКВ быть нейтрализованы с помощью MEDI-545, были исследованы биопсийные образцы от пациентов после обработки MEDI-545 в количестве 10 мг/кг. Heatmap нейтрализации топовых 25 ИФН I типа-индуцируемых генов в повреждениях кожи на 0 и 14 сутки после лечения приводятся на фиг.58(а). Все из топовых 25 генов нейтрализуют через 14 суток после введения MEDI-545. Диаграмма АГК целевого модулирования, основанного на указанных топовых 25 ИФН I типа-индуцируемых генах, показана на фиг.58(б). Диаграмма АГК показывает прогрессирование пациента с СКВ, подвергнутого лечению, от состояния, прямо противоположного состоянию нормальных здоровых доноров перед введением антитела MEDI-545, до состояния, близкого к состоянию здоровых доноров через 14 суток после введения MEDI-545.

Для определения, могут ли уровни некоторых белков, экспрессированных с указанных высоко сверхэкспрессируемых 1 ИФН I типа-индуцируемых генов, также понижаться за счет лечения продуктом MEDI-545 в количестве 10 мг/кг, иммуногистохимические анализы проводят для выявления HERC5, ISG15 и белка IP10 в кожных повреждениях больных СКВ, подвергавшихся лечению MEDI-545 и плацебо. Кроме того, анализ клеточных инфильтратов (pDC, mDC и CD4-положительных клеток) проводят для сравнения ряда типов ИФН-продуцирующих клеток и воспалительных клеток в биопсийных образцах кожных повреждений больных СКВ при лечении MEDI-545 и в контрольных образцах от людей, обработанных плацебо.

Мгновенно замороженные биопсийные образцы поврежденной кожи больных СКВ, подвергшихся лечению антителом MEDI-545, и больных СКВ, подвергшихся обработке плацебо, делят пополам. Половину каждого образца погружают в О.С.Т., разрезают на слои толщиной 5 мкм, помещают на «плюс» стекла и фиксируют в холодном ацетоне. Нарезанные образцы инкубируют с первичными антителами (специфичными в отношении BDCA2, CD83, CD4, STAT1 и ISG15) в течение 4 ч и промывают ФСБ. Срезы затем инкубируют с полимером, меченным пероксидазой, конъюгированным с козьим антимышиным иммуноглобулиновым антителом (система Envision+; фирма Dakocytomation, Carpenteria, Калифорния) в течение 30 мин и промывают Трис-буферным физиологическим буфером, pH 7,2. Выявление проводят с применением 3,3′-диаминобензидинтетрагидрохлоридом (препаратом DAB+; фирма DakoCytomation) в качестве хромогена. Срезы промывают dH2O, заново окрашивают гематоксилином, обезвоживают и накрывают покровным стеклом.

У больных СКВ, обработанных плацебо, и клеточные инфильтраты, и уровни белков, экспрессированных со сверхэкспрессированных ИФН I типа-индуцируемых генов, повышены (или ухудшены) на протяжении курса длительностью 14 суток. См. фиг.52, которая показывает повышение (ухудшение) mDC (CD83 окрашивание) и T-клеточной (CD4 окрашивание) инфильтрации в кожных повреждениях. Фиг.52 также показывает отсутствие изменения в pDC (окрашивание BDCA2) инфильтрации в поврежденной коже пациента с СКВ, которого лечили плацебо, на протяжении 14 суток. См. также фиг.53, которая показывает повышение окрашивания для белков, экспрессированных со сверхэкспрессированных ИФН I типа-индуцированных генов HERC и IP10. Отсутствуют изменения в окрашивании для ISG15.

Напротив, у пациентов, обработанных продуктом MEDI-545 в количестве 10 мг/кг, уровни инфильтратов и белков, экспрессированных со сверхэкспрессированных ИФН I типа-индуцируемых генов, снижаются в разной степени. См. фиг.54 и 55, которые предоставляют иммуногистохимические данные первого пациента с СКВ, обработанного продуктом MEDI-545, и фиг.56 и 57, которые предоставляют иммуногистохимические данные второго пациента с СКВ, обработанного продуктом MEDI-545.

Пример 20. Анализ чувствительности обнаружения тип-I и тип-II ИФН

Для разработки исследования чувствительности обнаружения ИФН I типа и тип-II ИФН, клонируют конструкции, содержащие ген фермента люциферазы, выделенный из морского организма Gaussia princeps (фирма Targeting Systems; Santee, Калифорния) под контролем элемента ответа, простимулированного интерфероном (interferone-stimulated response element - ISRE) (TAGTTTCACTTTCCC)5; фирма Biomyx; Сан-Диего, Калифорния). Клетки НЕК293Н стабильно трансфецируют конструкцией и полученные клетки используют для методов выявления ИФН.

25000 стабильно трансфецированных клеток НЕК293Н высевают в лунку в 50 мкл клеточной культуральной среды и помещают в инкубатор в атмосферу СО2 на ночь. На следующий день образцы сыворотки пациента (или нормальную объединенную сыворотку человека, инъецированную с различными подтипами ИФН-альфа или ИФН-бета, ИФН-омега, ИФН-гамма) подвергают скринингу для выявления различных подтипов ИФН путем добавления 50 мкл неразведенной сыворотки пациента или инъецированной сыворотки в исследуемые лунки, содержащие высеянные клетки (конечная концентрация 50% сывороток пациентов в лунках в течение 24 ч). ИФН-индуцированную люциферазную активность выявляют на следующие сутки путем наблюдения химиолюминесценции в надосадочной жидкости культур. Химиолюминесценцию наблюдают путем переноса 5 мкл супернатанта из лунок в B&W Isoplate, добавляя 50 мкл химиолюминесцентного субстрата и выявляя химиолюминесценцию через 6 мин. Образцы, вырабатывающие сигнал, который более чем в 1,5 раза превышает сигнал в лунках отрицательного контроля в каждой планшетке, классифицируют в качестве позитивного по активности ИФН. См. фиг.59 а-г, которые предоставляют выявленные уровни тип-I и тип-II ИФН активности в ИФН биоанализе для разных высеянных клеток, обработанных сывороткой пациента и инъецированной контрольной сывороткой. Каждая из панелей а-г показывает, что повышенная доза ИФН в исследовании приводит к повышенному выявлению действия ИФН.

В образцах, в которых выявлена активность ИФН, антитела, которые специфически нейтрализуют различные тип-I и тип-II ИФН, могут затем использоваться, чтобы определить, какой ИФН ответственен за положительный ответ. Анти-ИФН-тип-специфические антитела предварительно инкубируют либо с положительными образцами (образцом) сыворотки (в случае антитела MEDI 545, анти-ИФН бета, анти-ИФН-гамма и анти-ИФН-омега, которые сами связываются с ИФН лигандом), либо с клетками (в случае MEDI 546, который связывает рецептор интерферона I типа на клетках НЕК293Н) с последующим добавлением образцов к клеткам и определения интенсивности флуоресценции согласно описанному выше. Инъецированные образцы, которые показывают пониженную химиолюминесценцию после обработки специфическим антителом, оценивают в качестве положительных по наличию определенного интерферона (интерферонов), который нейтрализуется ИФН-специфическими антителами.

Фиг.60(а) показывает, что повышение дозы MEDI-545 в обработанных лунках повышенно нейтрализует действие ИФН по мере увеличения дозы антитела MEDI-546 (фиг.60б). Фиг.61-63 показывает, что ИФНγ, ИФНω и ИФНβ, соответственно, нейтрализуются антителами, специфичными в отношении ИФНγ, ИФНω и ИФНββ, что соответствует предположению.

Пример 21. Изменения уровней растворимых белков в сыворотке пациентов, больных волчанкой

Сыворотку отбирают у пациентов с СКВ (n=40) и CLE (n=5), у которых история болезни включает по меньшей мере 4 из 11 положительных критериев классификации ACR, и которые выраженно проявляют признаки заболевания на момент отбора образца. Девяносто пять процентов составляют женщины, средний возраст которых равен 41±15 лет ± стандартное отклонение. Семьдесят шесть процентов в настоящее время получают пероральные кортикостериоды в дозах, варьирующих от 1 мг/сутки до 30 мг/сутки преднизона, а 2 пациента с СКВ также получают внутривенно пульсовым введением стероиды. 59% получают по меньшей мере 1 активно модифицирующий болезнь лекарственный агент, отличный от кортикостероидов. Luminex xMAP технологию применяют для выявления изменений в 89 исследуемых образцах и по правилам Rules Based Medicine (см. в Интернете по домену «rulesbasedmedicine. com»). Результаты по каждому анализируемому соединению сравнивают со средним значением панели нормальной сыворотки человека (n=17) и значимость определяют, используя спаренный критерий Стьюдента. Фиг.74 показывает агенты, уровни которых достаточно (а) повышены или (б) понижены относительно средних значений в нормальной сыворотке (p величина ≥0,05). Существенные изменения уровней цитокинов, хемокинов, метаболических белков и других растворимых медиаторов выявляют в сыворотке пациентов, больных волчанкой.

Пример 22. Другой вариант анализа, анализа Panomics OuantiGenePlex, выверяет результаты исследования ИФН-индуцированной генной экспрессии

Анализ QuantiGenePlex в первую очередь проводят для оценки способности QuantiGenePlex обнаружить 22 ИФН-индуцируемых транскриптов в цельной крови после стимулирования с помощью ИФНα2b. 22 ИФН-индуцируемых транскрипта, обнаруженных с помощью указанного первоначального анализа QuantiGenePlex, отбирают, основываясь на их устойчивой повышенной регуляции у пациентов с СКВ, и показывают по x-оси графиков, показанных на фиг.75 и 76.

Стимулирование цельной крови проводят путем инкубирования свежей отобранной Na-EDTA цельной крови от 5 здоровых доноров с 20 МЕд/мл ИФНα2b в течение 4 ч. После инкубирования 2,5 мл простимулированной цельной крови добавляют в пробирки PAXgene, перемешивают и выдерживают ночь при комнатной температуре. После ночи инкубирования образцы замораживают при -80°C. Эти выполняемые вручную методики выбирают для подражания тем, которые используют во время клинических исследований.

PAXgene кровь анализируют для определения экспрессии уровней ИФН-индуцируемых транскриптов. Кровь в пробирках PAXgene (500 мкл) осаждают центрифугированием и затем лизируют в 139 мкл буфера по протоколу лизиса крови QuantiGenePlex PAXgene. Процессированную кровь каждого донора в повторах вносят в лунки и гибридизируют в течение ночи с множественным набором зондов для 22 ИФН-индуцируемых генов. Генную экспрессию оценивают на следующий день, используя прибор Luminex 100 с программным обеспечением BioRad BioPlex. Оценивают кратность изменений для каждого индивидуума, основанную на повышении сигнала, наблюдаемом между лунками, в которых была стимуляция ИФН, и лунками, в которых была стимуляция ФСБ. Фиг.75 показывает кратность изменения экспрессии каждого из 22 ИФН-индуцируемых генов после стимуляции с помощью каждого из 5 образцов цельной крови от здоровых добровольцев. Пунктирная линия показывает двухкратное изменение относительно контрольных образцов, которые стимулировали ФСБ.

Цельную кровь одного добровольца дополнительно стимулируют выше диапазона доз 0,2-200 МЕд/мл ИФНα2b чтобы определить, является ли повышенная регуляция ИФН-индуцируемых генов с применением ИФНα2b доза-зависимой и может ли она быть выявлена методом QuantiGenePlex. Для каждого из 22 транскриптов установлена доза-зависимая индукция. См. фиг.76, который представляет кратное изменение экспрессии для каждого из 22 транскриптов для каждой дозы ИФНα2b. Максимальная индукция транскрипта примерно в 100 раз установлена для генов RSAD2, IFIT3 и МХ1. Используя двухкратное превышение исходного уровня в качестве пограничной величины, 19/22 генов выявляют в образцах, обработанных 2 МЕд/мл ИФН, и 5/22 выявляют в образцах, обработанных 0,2 МЕд/мл ИФН. Экспрессия SIGLEC1, LY6E, SERPING1, OAS3 и IFI27 транскриптов слабо индуцируется стимулированием ИФНα2b. Такие низкие уровни индукции могут свидетельствовать о потере чувствительности анализа к указанным мишеням или о различиях в генной экспрессии между реальным заболеванием СКВ (от пациента с этим заболеванием указанная панель транскриптов была выбрана) и стимуляцией ex vivo одним подтипом ИФНα - ИФНα2b. Прерывистая линия показывает двухкратное изменение относительно контрольных образцов, простимулированных ФСБ.

Затем анализ QuantiGenePlex используют для выявления уровней ИФН-индуцируемых транскриптов в цельной крови пациентов с СКВ. 20 из 22 зондов из фирменного набора QuantiGenePlex, представленных на фиг.75 и 76, удерживаются в анализе QuantiGenePlex, используемом для оценки этих данных.

Два зонда, HSXIAPAF1 и GIP3, замещают другими зондами, XAF1 и IFI6. Используя такую панель из 22 зондов, устанавливают исходную базовую подпись, основываясь на образцах цельной крови от десяти здоровых доноров (синий цвет в каждой панели). Исходную генную подпись, основанную на образцах цельной крови здоровых доноров, сравнивают с (1) генной подписью больного СКВ, у которого выявляемая активность ИФН в сыворотке, и (2) генной подписью больного СКВ, у которого нет выявляемой активности ИФН в сыворотке. Действие ИФН сыворотки определяют в образцах сыворотки больных СКВ, используя анализ, описанный в примере 20. Фиг.77а показывает сравнение генной подписи больного СКВ (красный цвет), у которого нет выявляемой активности в сыворотке ИФНα (т.е. активность сывороточного ИФН<2,5 МЕд/мл), с базовым уровнем генной подписи (синий цвет). За исключением гена LAMP3, уровни всех транскриптов устанавливают в качестве повышенных в крови больного СКВ, у которого нет в сыворотке активности ИФН. Фиг.77б показывает сравнение генной подписи больного СКВ с высокими уровнями активности в сыворотке ИФНα (красный цвет) относительно исходной генной подписи (синий цвет). Все транскрипты повышены по меньшей мере в 2 раза в крови пациента с высокой активностью ИФН в сыворотке, при максимальной индукции примерно в 80 раз для IFI27.

Данные, полученные методом QuantiGenePlex, затем оценивают на сопоставимость с данными, полученными методом Fluidigm Real-Time PCR. Каждый из методов, QuantiGenePlex и Fluidigm, используют для анализа и сравнения уровней транскрипции в сохраняемых в пробирках PAXgene образцах цельной крови от 16 пациентов, больных СКВ, участвующих в первой фазе клинического исследования (моноклональное антитело против ИФНα) относительно срединной смешанной генной оценки 10 здоровых доноров. Анализы Fluidigm проводят, используя смесь методов TaqMan генной экспрессии, включая 4 референсных контрольных гена, приготовленных с помощью набора TaqMan PreAmp Master Mix Kit (фирма Applied Biosystems). Динамические матрицы нагружают, используя контроллер NanoFlex 4-IFC (фирма Fluidigm Corp), и реакции ПНР реального времени проводят, используя систему ПЦР реального времени BioMark. Результаты анализируют, используя программное обеспечение BioMark Real-Time PCR Analysis. Величины дельта- дельта Ct (DDCt) подсчитывают, используя среднее значение 4 референсных генов (GAPDH, TFRC, b2М и 18S) и значение калиброванного образца. Результаты, полученные с применением образцов цельной крови от пациентов с СКВ, показывают высокую степень корреляции между методиками QuantiGenePlex и ПЦР реального времени по выявлению профилей генной экспрессии, связанных с заболеванием. Фиг.78 показывает (а) составную срединную и (б) средние кратные изменения всех генов в панелях, которые были подсчитаны и сопоставлены с помощью анализа корреляции Пирсона. Существенную корреляцию наблюдают между результатами QuantiGenePlex и Fluidigm при срединных (p=0,0002) и средних (p<0,0001) кратных изменениях при сравнении с панелью генов.

Данные, полученные методами QuantiGenePlex и ПЦР реального времени Fluidigm, затем сравнивают по способности выявлять изменения в уровнях транскрипции в образцах от пациентов с СКВ на протяжении курса лечения в клиническом исследовании. Для такого сравнения образцы от больных СКВ собирают непосредственно в пробирки PAXgene на «0» сутки (до дозирования) и многократно в разное время после введения одной дозы анти-ИФНα моноклонального антитела или плацебо. Для каждого образца рассчитывают общее среднее кратное изменение по панели 22 генов и сравнивают с образцом от того же пациента, взятым до дозирования. Фиг.79а показывает изменения в генной подписи для пациентов, которых обрабатывали плацебо или антителом, используя технологию Fluidigm. Фиг.79б показывает изменения в генной подписи для пациентов, которых обрабатывали плацебо или антителом, используя методику QuantiGenePlex. У каждого субъекта, не обработанного плацебо, снижение ИФН генной подписи наблюдают в течение 24 ч после введения лекарственного средства, и оно согласуется между данными Fluidigm и QuantiGenePlex. Изменения в уровнях транскрипции после введения, выявленные методами QuantiGenePlex и Fluidigm, также в высокой степени схожи.

1. Применение набора генов с повышенной регуляцией экспрессии или действия MX1, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2 и IFI44 для идентификации SLE пациента для получения MEDI 545.

2. Применение по п.1, где повышенная регуляция экспрессии или действие включает
(а) повышенную по меньшей мере в 2 раза экспрессию одного или более генов;
(б) повышенную по меньшей мере в 3 раза экспрессию одного или более генов;
(г) повышенные уровни мРНК одного или более генов или
(д) повышенные уровни протеина одного или более генов.

3. Способ идентификации SLE пациента для получения MEDI 545, включающий: обнаружение присутствия или отсутствия профиля экспрессии ИФНα-индуцируемых ФД маркеров фармакодинамических маркеров (ФД маркеров) в образце пациента,
при котором обнаружение присутствия профиля экспрессии ИФНα-индуцируемых ФД маркеров позволяет идентифицировать пациента в качестве кандидата для MEDI 545, и при котором профиль экспрессии ИФН I типа- или ИФНα-индуцируемых ФД маркеров включает набор генов с повышенной регуляцией экспрессии или действия IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, МХ1, МХ2, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 и FCHO2.

4. Способ идентификации SLE пациента для получения MEDI 545, включающий: обнаружение присутствия или отсутствия профиля экспрессии ИФНα-индуцируемых ФД маркеров фармакодинамических маркеров (ФД маркеров) в образце пациента,
при котором обнаружение присутствия профиля экспрессии ИФНα-индуцируемых ФД маркеров позволяет идентифицировать пациента в качестве кандидата для MEDI 545, и при котором профиль экспрессии ИФН I типа- или ИФНα-индуцируемых ФД маркеров включает набор генов с повышенной регуляцией экспрессии или действия RTP4, RSAD2, HERC5, SIGLEC1, USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, МХ1, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 и ISG15.

5. Способ идентификации SLE пациента для получения MEDI 545, включающий: обнаружение присутствия или отсутствия профиля экспрессии ИФНα-индуцируемых ФД маркеров фармакодинамических маркеров (ФД маркеров) в образце пациента,
при котором обнаружение присутствия профиля экспрессии ИФНα-индуцируемых ФД маркеров позволяет идентифицировать пациента в качестве кандидата для MEDI 545, и при котором профиль экспрессии ИФН I типа- или ИФНα-индуцируемых ФД маркеров включает набор генов с повышенной регуляцией экспрессии или действия DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, МХ1, OAS1, OAS2, OAS3, PLSCR1, PSAD2, RTP4, SIGLEC1 и USP18.

6. Способ идентификации SLE пациента для получения MEDI 545, включающий: обнаружение присутствия или отсутствия профиля экспрессии ИФНα-индуцируемых ФД маркеров фармакодинамических маркеров (ФД маркеров) в образце пациента,
при котором обнаружение присутствия профиля экспрессии ИФНα-индуцируемых ФД маркеров позволяет идентифицировать пациента в качестве кандидата для MEDI 545, и при котором профиль экспрессии ИФН I типа- или ИФНα-индуцируемых ФД маркеров включает набор генов с повышенной регуляцией экспрессии или действия SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, IL1RN, СЕАСАМ1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP1 и МХ1.

7. Способ по любому из пп.3-6, где повышенная регуляция экспрессии или действие включает
(а) повышенную по меньшей мере в 2 раза экспрессию одного или более генов;
(б) повышенную по меньшей мере в 3 раза экспрессию одного или более генов;
(г) повышенные уровни мРНК одного или более генов или
(д) повышенные уровни протеина одного или более генов.

8. Применение набора генов с повышенной регуляцией экспрессии или действия IFI6, RSAD2, IFI44, IFI44L, IFI27, МХ1, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1 USP18 для идентификации SLE пациента для получения MEDI 545.

9. Применение набора генов с повышенной регуляцией экспрессии или действия IFI6, RSAD2, IFI44, IFI44L и IFI27 для идентификации SLE пациента для получения MEDI 545.

10. Применение по п.8 или 9, где повышенная регуляция экспрессии или действия включает
(а) повышенную по меньшей мере в 2 раза экспрессию одного или более генов;
(б) повышенную по меньшей мере в 3 раза экспрессию одного или более генов;
(г) повышенные уровни мРНК одного или более генов или
(д) повышенные уровни протеина одного или более генов.



 

Похожие патенты:

Изобретение относится к области биотехнологии и касается способа идентификации лактобацилл. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейств RelBE и MazEF и характеризуется тем, что для идентификации проводят амплификацию геномных ДНК с использованием набора олегонуклеотидов определенной структуры, ПЦР-продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера.

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления видовой принадлежности родиолы четырехнадрезной {Rhodiola quadrifida (Pall.) Fisch.

Изобретение касается способа определения генотипов золотистого стафилококка. Представленный способ включает получение чистой культуры микроорганизмов на плотной питательной среде с последующим выделением и амплификацией ДНК возбудителя с помощью мультиплексной полимеразной цепной реакции (ПЦР) и с детекцией результатов методом электрофореза в агарозном геле.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченого зонда для видоспецифичной экспресс-идентификации РНК вируса Хунин методом полимеразной цепной реакции в реальном времени.

Изобретение касается набора олигонуклеотидных праймеров и флуоресцентномеченного зонда для видоспецифичной экспресс-идентификации РНК вируса Мачупо методом полимеразной цепной реакции в реальном времени.

Изобретение относится к биотехнологии и может быть использовано для дифференцированного определения числа жизнеспособных актинобактерий рода Rhodococcus, иммобилизованных в нерастворимом гелевом носителе.

Изобретение относится к биотехнологии. Предложенный способ предусматривает получение образцов высокоочищенной ДНК, фрагментацию выделенной ДНК эндонуклеазой рестрикции, не имеющей сайта узнавания в амплифицируемом районе, гидролиз фрагментированной ДНК метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI или ее изошизомером, лигирование универсального олигонуклеотидного адаптера к гидролизованной ДНК с последующей амплификацией в реальном времени с использованием праймера и зонда, комплементарных исследуемой ДНК и гибридного праймера, 3' конец которого комплементарен не менее 3 нуклеотидам 3' конца ДНК у исследуемого места гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и составление заключения на основании флуоресцентного сигнала о наличии последовательности Pu(5mC)GPy.

Изобретение относится к биотехнологии, конкретно к определению восприимчивости к внутрибольничной инфекции пациента с септическим шоком, и может быть использовано в медицине.

Изобретение относится к области биотехнологии и касается набора для выявления Ку-лихорадки методом ПЦР-РВ. Охарактеризованный набор содержит синтетические олигонуклеотиды, ограничивающие фрагмент гена groEL: GroEL F 5′ CTTCTACTGTTATGACGCCTTCTTTGC 3′ GroEL R 5′ CGCAAGTAGGCACCATTTCTGC 3′, и флуоресцентный зонд: GroEL Probe 5′ FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3′.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения наличия у пациента повышенного риска обладания сердечно-сосудистым заболеванием или нарушением по полиморфным вариантам генов.

Настоящее изобретение относится к иммунологии и биотехнологии. Предложено IL-1β-связывающее антитело или его IL-1β-связывающий фрагмент, включающее вариабельную область тяжелой цепи и легкой цепи.

Настоящее изобретение относится к иммунологии и биотехнологии. Предложены варианты выделенного моноклонального антитела, специфичного к hGM-CSF, где каждый вариант характеризуется тяжелой и легкой цепью.

Группа изобретений относится к способам получения препарата антитела против IL-18 или его антигенсвязывающей части со сниженным содержанием белка клетки-хозяина (БКХ) из образца смеси, содержащей антитело против IL-18 или его антигенсвязывающую часть, и по меньшей мере один БКХ.

Группа изобретений относится к биотехнологии, генной и белковой инженерии, конкретно к рекомбинантной плазмидной ДНК pG1-Rm7, обеспечивающей в клетках Escherichia coli синтез гибридного белка G1-Rm7, способного связывать фактор некроза опухолей и обладающего биолюминесцентной активностью люциферазы Renilla muelleri, где указанная плазмидная ДНК включает нуклеотидную последовательность SEQ ID NO: 1, и может быть использована в медицине.

Изобретение относится к области биотехнологии и иммунологии. Предложено моноклональное антитело и его антиген-связывающие части, которые специфически связывают C-концевую или центральную область фактора ингибирования миграции макрофагов (MIF).

Изобретение относится к области иммунологии. Представлены два антитела против IL-21 человека.
Настоящее изобретение относится к области иммунологии. Предложены вариабельные домены тяжелых (VH) и легких (VL) цепей мышиного антитела против фактора некроза опухоли альфа (ФНО-α) человека, а также антигенсвязывающий фрагмент Fab, которые селективно связываются с ФНО-α человека и нейтрализуют его.
Изобретение раскрывает полностью человеческие моноклональные антитела (IgG аутоантитела), которые связываются с человеческим IL-1α. Антитело содержит тяжелую цепь, ковалентно связанную с легкой цепью, для которых определены аминокислотные последовательности.

Изобретение относится к области биотехнологии и медицины. Описан иммуноген, для индукции иммунного ответа на IgE.
Изобретение относится фармацевтической промышленности, а именно к иммуномодулирующей композиции для инъекционного введения млекопитающему. Иммуномодулирующая композиция для инъекционного введения млекопитающему, содержащая гидролизат, полученный с помощью кислотного и/или ферментативного гидролиза одного или более биоресурсов, выбранных из группы, включающей двустворчатых моллюсков, кольчатых червей, пиявок; и воду, взятые в определенном соотношении.
Наверх