Синтетические олигонуклеотидные праймеры и способ выявления генотипов для идентификации личности с помощью системы микросателлитных днк-маркеров y-хромосомы



Синтетические олигонуклеотидные праймеры и способ выявления генотипов для идентификации личности с помощью системы микросателлитных днк-маркеров y-хромосомы
Синтетические олигонуклеотидные праймеры и способ выявления генотипов для идентификации личности с помощью системы микросателлитных днк-маркеров y-хромосомы

 

C40B40/06 -
C40B40/06 -

Владельцы патента RU 2528742:

Федеральное государственное бюджетное учреждение "Научно-исследовательский институт медицинской генетики" Сибирского отделения Российской академии медицинских наук (ФГБУ "НИИМГ" СО РАМН) (RU)
Общество с ограниченной ответственностью "Геномная диагностика" (ООО "Геномная диагностика") (RU)

Изобретение относится к области биотехнологии, конкретно к набору синтетических олигонуклеотидных пар праймеров, и может быть использовано в судебно-медицинской идентификационной экспертизе. Заявленный набор состоит из пар праймеров, комплементарных соответствующим участкам пятнадцати микросателлитных локусов Y-хромосомы, которые представляют собой пары праймеров, из которых один имеет флуоресцентную метку, а второй является немеченым, при этом прямые праймеры для каждого из локусов несут на 5'-конце флуоресцентную метку: ТЕТ (4,7,2',7'-тетрахлоро-6-карбоксифлуоресцеин) для DYS385a/b, DYS390, DYS391, DYS426 и DYS439; FAM (6-карбоксифлуоресцеин) для DYS392, DYS393, DYS437 и DYS438; и HEX (4,7,2',4',5',7'-гексахлоро-6-карбоксифлуоресцеин) для DYS394, DYS388, DYS389I/II и DYS434. Изобретение относится также к способу выявления генотипов для идентификации личности в российской популяции с использованием вышеуказанных праймеров. Изобретение позволяет проводить идентификацию личности в российской популяции с высокой чувствительностью, специфичностью и точностью по сравнению с существующими аналогами. 2 н.п. ф-лы, 2 ил.

 

Изобретение относится к области молекулярной генетики и относится к наборам синтетических олигонуклеотидных пар праймеров, комплементарных участкам пятнадцати микросатиллитных локусов Y-хромосомы для выявления генотипов для идентификации личности в российской популяции и способам выявления генотипов.

Типирование ДНК является наиболее доказательным методом анализа биологического материала при производстве судебно-медицинской идентификационной экспертизы. Молекулярно-генетический идентификационный анализ позволяет исследовать особые участки ДНК, строго специфичные для каждого индивидуума, и получить, таким образом, уникальный генетический "паспорт" человека, которЫЙ нельзя скрыть, изменить или подделать. Индивидуализирующие признаки, определяемые на уровне ДНК, характеризуются почти абсолютной устойчивостью, то есть сохраняются в организме человека неизменными всю его жизнь.

В течение последнего десятилетия для целей генетической идентификации личности широко применяется изучение различных маркерных систем, локализованных на аутосомах, нерекомбинирующем участке Y-хромосомы и в митохондриальном геноме. Преимущество нерекомбинирующих линий Y-хромосомы заключается в том, что обладая достаточно высокой информативностью и для «общей» ДНК-идентификации, передаются строго от отца к сыну, что позволяет напрямую устанавливать родство [1, 2].

Среди мировых приоритетных направлений в области генетики человека и медицинской генетики в настоящее время на первый план выступают разработки тест-систем, направленных на создание высокотехнологичной услуги по определению генетического происхождения индивида по мужской линии; разработки новых или усовершенствования существующих генетических тест-систем, применяемых в судебной медицине для идентификации личности и определения отцовства [3, 4].

Полиморфизм, используемый в качестве основной системы генетического маркирования, применяемой в судебно-медицинской практике, возникает в результате изменения числа идентичных ДНК-повторов (STR) в пределах одного локуса. Преимущество STR для идентификации личности и оценки биологического родства заключается в возможности проведения успешного анализа даже при использовании сильно деградировавших образцов ДНК. Развитие технологий генотипирования позволяет легко автоматизировать генетический анализ микросателлитов.

ДНК-идентификация личности основывается на анализе частоты встречаемости маркеров аутосомных локусов, Y-хромосомы и мтДНК [6, 7]. Анализ Y-хромосомы и (или) мтДНК необходим в случаях, когда нужно установить родственные отношения по отцовской или материнской линиям; используется при работе с сильно деградированными образцами ДНК вследствие очень высокой копийности мтДНК, а также может быть альтернативой ДНК-идентификации по аутосомным локусам [9]. Ключевым моментом в ДНК-идентификации являются вероятностные расчеты совпадения генотипов, основанные на референтных частотах аллелей в популяции, из которой происходит исследуемый ДНК-профиль [10].

Преимущество STR для идентификации личности и оценки биологического родства заключается в возможности проведения успешного анализа даже при использовании сильно деградировавших образцов ДНК. Ранее судебно-медицинским стандартом являлся "минимальный гаплотип" из 7 YSTR, который позднее был вытеснен "расширенным гаплотипом" из 9 локусов. На сегодняшний день созданы YSTR-наборы, используемые для различных целей, в том числе и для идентификации личности.

В настоящее время разработаны и выпускаются наборы ДНК-маркеров Y-хромосомы, которые используются для ДНК-идентификации. Существует набор для ПЦР-амплификации для исследования коротких тандемных повторов AmpFlSTR® Yfiler Kit (фирмы Applied Biosystems), позволяющий амплифицировать 17 STR-локусов Y-хромосомы в одной ПЦР-реакции, который состоит из реакционной ПЦР-смеси, смеси праймеров, ДНК-полимеразы, контрольной ДНК и аллельного лэддера ().

Также существует набор для ПЦР-амплификации PowerPlex®Y23 System (фирмы Promega) для исследования коротких тандемных повторов, позволяющий амплифицировать 23 STR-локуса Y-хромосомы в одной ПЦР-реакции, который состоит из реакционной ПЦР-смеси, смеси праймеров, ДНК-полимеразы, контрольной ДНК, аллельного лэддера и деионизованой воды (identity) (Thompson, J.M. et al. The PowerPlex® Y23 System: A New Y-STR Multiplex for Casework and Database Applications. [Internet] 2012. http://www.promega.com/resources/articles/proriles-in-dna/2012/the-powerplex-y23-system-a-new-y-str-multiplex-for-casework-and-database-applications/).

Кроме того, известен набор Investigator Argus Y-12 QS Kit (фирмы Qiagen) для ПЦР-амплификации для исследования коротких тандемных повторов, позволяющий амплифицировать 12 STR-локусов Y-хромосомы в одной ПЦР-реакции, который состоит из реакционной ПЦР-смеси, смеси праймеров, ДНК-полимеразы, контрольной ДНК и аллельного лэддера (www.qiagen.com/InvestigatorIDKits.).

Наиболее близким к заявленному способу является способ и набор AmpFlSTR® Yfiler Kit (фирмы Applied Biosystems). Недостатком известного способа является то, что имеющиеся в настоящее время разработки наборов STR-маркеров Y-хромосомы не учитывают специфики популяционной структуры населения России (большое число этнических групп, специфические для различных этнических групп полиморфизмы, не учтенные в иностранных разработках). Для успешного применения Y-STR в криминалистике и судебной медицине необходима разработка методик генотипирования и наборов Y-STR, которая позволит максимально охватить генетическое разнообразие по этим локусам в российских популяциях. Кроме этого существенным недостатком существующих наборов является их значительная дороговизна. Из-за необходимости использования специальных дорогостоящих расходных материалов (специфических ДНК-полимераз и аллельных лэддеров) существенно ограничиваются возможности широкого применения существующих наборов в диагностических лабораториях. Для устранения указанных недостатков необходимым условием является повышение информативности предлагаемого набора и его экономичности.

Новая техническая задача - повышение чувствительности, точности и информативности способа и создание системы генетических маркеров охватывающей генетическое разнообразие по 15 локусам в российских популяциях.

Для решения поставленной задачи предложен набор синтетических олигонуклеотидных праймеров, комплементарных участкам пятнадцати микросателлитных локусов Y-хромосомы для выявления генотипов для идентификации личности в российской популяции, причем используют пары праймеров, один из которых имеет флуоресцентную метку, а второй является немеченым, при этом прямые праймеры для каждого из локусов несут на 5′-конце флуоресцентную метку: ТЕТ (4,7,2′,7′-тетрахлоро-6-карбоксифлуоресцеин) для DYS385a/b, DYS390, DYS391, DYS426 и DYS439; FAM (6-карбоксифлуоресцеин) для DYS392, DYS393, DYS437 и DYS438; HEX (4,7,2′,4′,5′,7′-гексахлоро-6-карбоксифлуоресцеин) для DYS394, DYS389I, DYS389II DYS388 и DYS434, также синтетические олигонуклеотидные праймеры имеют следующий нуклеотидный состав:

DYS385a/b F: 5′-TET-AGCATGGGTGACAGAGCTA-3′

DYS385a/b R: 5′-TGGGATGCTAGGTAAAGCTG-3′

DYS388 F: 5′-HEX-GAATTCCATGTGAAGTTAGCCGTTTAGC-3′

DYS388 R: 5′-GAGGCGGAGCTTTTAGTGAG--3′

DYS389 I/II F: 5′-HEX-CCAACTCTCATCTGTATTATCTATG-3′

DYS389 I/II R: 5′-TCTTATCTCCACCCACCAGA-3′

DYS390 F: 5′-TET-TATATTTTACACATTTTTGGGCC-3′

DYS390 R: 5′-TGACAGTAAAATGAACACATTGC-3′

DYS391 F: 5′-TET-CTATTCATTCAATCATACACCCA-3′

DYS391 R: GATTCTTTGTGGTGGGTCTG-3′

DYS392 F: 5′-FAM-TCATTAATCTAGCTTTTAAAAACAA-3′

DYS392 R: 5′-AGACCCAGTTGATGCAATGT-3′

DYS393 F: 5′-FAM-GTGGTCTTCTACTTGTGTCAATAC-3′

DYS393 R: 5′-AACTCAAGTCCAAAAAATGAGG-3′

DYS394 F: 5′-HEX-CTACTGAGTTTCTGTTATAGT-3′

DYS394 R: 5′-ATGGCATGTAGTGAGGACA-3′

DYS426 F: 5′-TET-CTCAAAGTATGAAAGCATGACCA-3′

DYS426 R: 5′-GGTGACAAGACGAGACTTTGTG-3′

DYS434 F: 5′-HEX-CACTCCCTGAGTGCTGGATT-3′

DYS434 R: 5′-GGAGATGAATGAATGGATGGA-3′

DYS437 F: 5′-FAM-GACTATGGGCGTGAGTGCAT-3′

DYS437 R: 5′-GAGACCCTGTCATTCACAGATGA-3′

DYS438 F: 5′-FAM-CCAAAATTAGTGGGGAATAGTTG-3′

DYS438 R: 5′-GATCACCCAGGGTCTGGAGTT-3′

DYS439 F: 5′-TET-TCGAGTTGTTATGGTTTTAGGTCT-3′

DYS439 R: 5′-GTGGCTTGGAATTCTTTTACCC-3′

В способе выявления генотипов для идентификации личности в российской популяции с помощью набора микросателлитных ДНК-маркеров Y-хромосомы используют вышеуказанные пары праймеров, при этом проводят генотипирование 15 коротких тандемных повторов, локализованных на нерекомбинирующем участке Y-хромосомы (YSTR), на генетическом ДНК-анализаторе с помощью капиллярного гель-электрофореза, с применением метода ПЦР и фрагментного анализа флуоресцентно меченых ДНК-ампликонов, используют образцы ДНК мужчин, выделенной из любого биологического материала в соответствии со стандартными методами, обеспечивающими качественную очистку ДНК от белков и примесей и предотвращающими деградацию материала в ходе выделения, при проведении капиллярного электрофореза фрагменты, синтезированные в ходе ПЦР, имеющие флуоресцентную метку TET (4,7,2′,7′-тетрахлоро-6-карбоксифлуоресцеин) в диапазоне длин 360-420 п.о., соответствуют аллелям 9-23 тандемных повтора в локусе DYS385 a/b, фрагменты, имеющие флуоресцентную метку TET в диапазоне длин 196-224 п.о., соответствуют аллелям 19-26 тандемных повторов в локусе DYS390, фрагменты, имеющие флуоресцентную метку TET в диапазоне длин 277-289 п.о., соответствуют аллелям 9-12 тандемных повторов в локусе DYS391, фрагменты, имеющие флуоресцентную метку TET в диапазоне длин 87-94 п.о., соответствуют аллелям 11-13 тандемных повторов в локусе DYS426, фрагменты, имеющие флуоресцентную метку TET в диапазоне длин 124-136 п.о., соответствуют аллелям 11-14 тандемных повторов в локусе DYS436, фрагменты, имеющие флуоресцентную метку TET в диапазоне длин 232-260 п.о., соответствуют аллелям 8-15 тандемных повторов в локусе DYS439, фрагменты, имеющие флуоресцентную метку FAM (6-карбоксифлуоресцеин) в диапазоне длин 243-259 п.о., соответствуют аллелям 10-15 тандемных повторов в локусе DYS392, фрагменты, имеющие флуоресцентную метку FAM в диапазоне длин 116-128 п.о., соответствуют аллелям 12-15 тандемных повторов в локусе DYS393, фрагменты, имеющие флуоресцентную метку FAM в диапазоне длин 174-190 п.о., соответствуют аллелям 6-10 тандемных повторов в локусе DYS437, фрагменты, имеющие флуоресцентную метку FAM в диапазоне длин 311-326 п.о., соответствуют аллелям 9-12 тандемных повторов в локусе DYS438, фрагменты, имеющие флуоресцентную метку HEX (4,7,2′,4′,5′,7′-гексахлоро-6-карбоксифлуоресцеин) в диапазоне длин 190-206 п.о., соответствуют аллелям 13-17 тандемных повторов в локусе DYS394, фрагменты, имеющие флуоресцентную метку HEX в диапазоне длин 242-262 п.о., соответствуют аллелям 7-12 тандемных повторов в локусе DYS389I, фрагменты, имеющие флуоресцентную метку HEX в диапазоне длин 360-382 п.о., соответствуют локусу DYS389II, аллели локуса DYS389II определяют вычитанием из значения длины фрагмента диапазона 360-382 значения длины фрагмента DYS389I, получаемый диапазон 110-134 п.о. соответствует 14-20 тандемным повторам, фрагменты, имеющие флуоресцентную метку HEX в диапазоне длин 151-175 п.о., соответствуют аллелям 11-19 тандемных повторов в локусе DYS388, фрагменты, имеющие флуоресцентную метку HEX в диапазоне длин 106-122 п.о., соответствуют аллелям 8-12 тандемных повторов в локусе и DYS434.

Предлагаемый способ заключается в генотипировании 15 STR-маркеров Y-хромосомы на генетическом ДНК-анализаторе с помощью капиллярного гель-электрофореза, с применением метода ПЦР и фрагментного анализа флуоресцентно меченых ДНК-ампликонов. Разработанная система генетических маркеров Y-хромосомы (YSTR) информативна для ДНК-идентификации в популяциях России и основана на мультиплексном генотипировании методом ПЦР и капиллярного гель-электрофореза.

Способ предназначен:

- для выявления генотипов микросателлитных (STR) локусов Y-хромосомы человека в образцах ДНК, полученных из биологического материала лиц мужского пола для генетической идентификации личности человека в медико-диагностических, судебно-медицинских и криминалистических лабораториях;

- для установления родственных связей, в том числе при исследовании случаев спорного отцовства;

- для научных исследований в области популяционной генетики человека и медицинской генетики.

Разработанный способ заключается в использовании специально подобранных высокоспецифичных флуоресцентно-меченых олигонуклеотидных праймеров для проведения полимеразной цепной реакции (ПЦР) по амплификации микросателлитных маркеров Y-хромосомы человека.

Предлагаемый способ позволяет получить комплексный генотип исследуемого образца ДНК человека по 15 микросателлитным маркерам нерекомбинирующей части Y-хромосомы: DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393 и DYS394 (DYS19), DYS385a, DYS385b, DYS388, DYS426, DYS434, DYS437, DYS438, DYS439. Генотипы представлены в виде размеров длин фрагментов соответствующих ампликонов в нуклеотидах. Именно этот набор YSTR наиболее подробно изучен в различных популяциях мира и является основным для проведения популяционно-генетических и криминалистических исследований. Оценка информативности выбранных маркеров по доступным литературным данным и генетическим базам данных показала высокий потенциал данного набора микросателлитных маркеров нерекомбинирующей части Y-хромосомы для генетической дифференциации популяций и индивидов.

При этом для молекулярно-генетической характеристики исследуемых образцов ДНК используются 15 локусов YSTR. Выбранные праймеры амплифицируют следующие локусы:

- "Минимальный европейский гаплотип" (DYS19, DYS385a/b, DYS389I/II, DYS390, DYS391, DYS392, DYS393).

- Рекомендуемые Научной рабочей группой по методам анализа ДНК (Scientific Working Group-DNA Analysis Methods) (SWGDAM) панели Y-STR (минимальный европейский галотип плюс DYS438 и DYS439).

- Дополнительные полиморфные локусы: DYS388, DYS426, DYS434, DYS437.

Способ осуществляют следующим образом.

Для работы используют образцы ДНК, выделенной из любого биологического материала человека в соответствии со стандартными методами, обеспечивающими качественную очистку ДНК от белков и примесей и предотвращающими деградацию материала в ходе выделения. Концентрация рабочего раствора тотальной недеградированной ДНК для проведения ПЦР должна быть не менее 2 нанограмм на микролитр.

Генотипирование микросателлитных ДНК-маркеров проводят в несколько этапов, включающих проведение подготовки образцов ДНК, полимеразной цепной реакции (ПЦР), пробоподготовки продуктов амплификации, капиллярный гель-электрофорез на автоматических ДНК-анализаторах, компьютерную программную обработку первичных данных и, собственно, получение итоговых генотипов исследуемых образцов.

Мультиплексное генотипирование включает в себя несколько последовательных шагов:

- получение ПЦР-продуктов, содержащих последовательности с изучаемыми YSTR у исследуемого образца;

- объединение в общей смеси ПЦР-продуктов всех исследуемых маркеров;

- очистка смеси ампликонов от минерального масла (если ПЦР проводилась с добавлением минерального масла в амплификаторах без нагревающейся крышки);

- приготовление смеси продуктов ПЦР с матричным стандартом длины и формамидом;

- денатурация продукта реакции в формамиде;

- капиллярный электрофорез на автоматическом генетическом анализаторе;

- получение итоговых генотипов исследуемых образцов в соответствии с требованиями производителя генетического анализатора.

Для амплификации выбранных YSTR-маркеров проводят полимеразную цепную реакцию. Для эффективного разделения всех продуктов в соответствии с их физическим размером на капиллярном гель-электрофорезе праймеры подобраны соответствующим образом. Предлагаемые праймеры, выбраны из множества вариантов для наиболее оптимального сочетания длин амплифицированных продуктов, разделения флуоресцентных меток, эффективной дифференциации близких по размеру аллелей разных локусов и сочетания красителей со стандартными наборами реагентов для оптической калибровки автоматических ДНК-анализаторов.

Каждый из используемых красителей имеет свою длину волны максимума флюоресценции (хотя спектры эмиссии перекрываются). Затем компьютерная программа анализирует интенсивность флюоресценции и распознает пики продуктов ПЦР, исходя из того, на какой длине волны имело место максимальное увеличение флюоресценции по сравнению с фоновым уровнем. Результаты в итоге представлены в виде разноцветных пиков (каждый из цветов соответствует определенному флуоресцентному красителю) - электрофореграммы, с обозначенным размером продуктов, который устанавливается по стандарту длины, добавляемому при пробоподготовке в каждый образец.

Праймеры на локусах DYS385 и DYS389 подобраны таким образом, что одновременно амплифицируется, соответственно, по два микросателлитных повтора - DYS385a, DYS385b, DYS389II, дающий фрагмент большей длины (353-385 п.н.), и DYS389I, которому соответствуют фрагменты длиной 239-263 п.н. (Cooper et al., 1996). Число повторов в локусе DYS389II определяют, вычитая из длины большего фрагмента длину меньшего.

ПЦР проводят в пробирках или плашках объемом 0,2 или 0,5 мл. Объем реакционной смеси может варьировать 10 до 50 мкл. Рекомендуемый объем 15 мкл. Реакционная смесь для ПЦР общим объемом 15 мкл включает в себя по 0,5-1,5 мкл специфических праймеров с концентрацией 1 о.е./мл; 0,2 мМ концентрацию каждого из четырех dNTP (обычно 1 мкл 8 мМ раствора, в том числе 2 мМ каждого dNTP); от 10 до 100 нг исследуемого образца геномной ДНК; буфер для Taq-полимеразы и 0,25-1,0 ед. Taq-ДНК-полимеразы. Реакцию проводят в специализированных термоциклерах (амплификаторах).

Подбор условий проведения полимеразной цепной реакции с использованием набора флуоресцентно меченых праймеров включал оценку количества и качества выхода продуктов амплификации всех пятнадцати STR-локусов, наличие неспецифической амплификации, наличие различных аберраций при проведении капиллярного электрофореза, различия в интенсивности высоты детектируемых пиков продуктов, количество праймеров, не включившихся в реакцию. Проведено сравнение различных буферов, различной концентрации ионов Mg++, концентрации смеси праймеров, концентрации dNTP и общего объема ПЦР-смеси. В результате были подобраны оптимальные условия для проведения ПЦР.

Рекомендуется использовать современные амплификаторы для 96-луночных тонкостенных плашек: Applied Biosystems, Forster Sity, США; Biometra, ФРГ; I-Cycler, BioRad, США. Схема полимеразной цепной реакции состоит из первичной денатурации ДНК-матрицы (4 минут при 94-95°C), затем 40 циклов, состоящих из денатурации (94°C), отжига праймеров при специфической для каждого полиморфизма температуре (обычно от 58°C до 62°C), элонгации цепи (при 72°C); реакцию завершает финальная элонгация цепи (5-10 минут при 72°C).

Программа для амплификации локусов DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS394 (DYS19), DYS385a, DYS385b, DYS388, DYS434, DYS439:

Начальная денатурация: 94°C - 4 мин.

40 циклов: 94°C-30 сек

58°C - 30 сек

72°C - 45 сек

Заключительная элонгация: 72°C - 4 мин.

Программа для амплификации локусов DYS426, DYS393:

Начальная денатурация: 94°C - 4 мин.

40 циклов: 94°C - 30 сек

60°C - 30 сек

72°C - 45 сек

Заключительная элонгация: 72°C - 4 мин.

Программа для амплификации локусов DYS437, DYS438:

Начальная денатурация: 94°C - 4 мин.

40 циклов: 94°C - 30 сек

62°C - 30 сек

72°C - 45 сек

Заключительная элонгация: 72°C - 4 мин.

Сравнительное тестирование различных ДНК-полимераз российского производства, рекомендованных производителями для проведения ПЦР, на возможность использования для работы с набором PowerPlex 16 System. Сравнивались четыре различные ДНК-полимеразы. Самые лучшие результаты по итогам всех испытаний получены с применением Hot Start Taq ДНК-полимеразы компании СибЭнзим (Новосибирск).

Полученные продукты ПЦР отдельных локусов объединяют в денатурирующем буфере. Для этого в отдельных пробирках (или плашках) смешивают равное количество продуктов ПЦР всех исследуемых YSTR-маркеров (амликонов). Рекомендуемый объем каждого маркера 5 мкл.

Все ПЦР-продукты разводят деионизованной водой до концентрации 10 пМ/мкл (10 кмкМ раствор). Исходная концентрация зависит от качества и концентрации исходной ДНК-матрицы, оптимизации ПЦР, применяемой полимеразы и расходных материалов. Относительные пропорции смешиваемых продуктов в условиях работы конкретной лаборатории могут потребовать коррекции, проводящейся опытным путем.

Реакция денатурации ПЦР-продуктов в формамиде ставится в общем объеме 10 мкл. В пробирки или плашки для автоматического анализатора переносят по 2 мкл смеси ПЦР-продуктов, 0,5 мкл маркера молекулярной массы (Gene-Scan-500 ROX size standart), 9 мкл Hi-Di формамида. Размерный стандарт представляет собой смесь искусственно синтезированных олигонуклеотидных фрагментов длиной от 35 до 500 пар оснований (35, 50, 75, 100, 139, 150, 160, 200, 250, 300, 340, 350, 400, 450, 490 и 500) с химически привитой флюоресцентной группой, находящейся в растворе, при облучении флюоресцирует в спектре красного цвета. Полученную смесь денатурируют 5 мин при 95°C, затем сразу охлаждают либо во льду, либо при 4°C (5 минут), после чего коротко центрифугируют.

Генотипирование микросателлитных локусов Y-хромосомы проводят с помощью капиллярного гель-электрофореза. Продукты ПЦР отдельных локусов объединяют в денатурирующем буфере и разделяют на генетических анализаторах Applied Biosystems (Applied Biosystems Genetic Analyzers). Автоматические ДНК-анализаторы представляют собой автоматизированную систему приборов, предназначенную для определения нуклеотидной последовательности, или размера и количества фрагментов ДНК. Генетический анализатор представляет собой систему капиллярного электрофореза с индуцированной лазером флуоресценцией. Образцы ДНК, меченные с использованием до 4 различных флуоресцентных красителей, собирают и помещают в автодозатор прибора. Электрофорез фрагментов ДНК, меченных красителем, происходит в полимере, в котором они разделяются в соответствии с их размерами. В процессе прохождения через капилляр меченные образцы проходят через специальное окно в капилляре и облучаются. Флуоресцентные красители, связанные с фрагментами ДНК, возбуждаются с помощью лазера и излучают свет при разных длинах волн, характерных для каждого красителя, разделяются в соответствии с длинами волн с помощью спектрографа. Они накапливаются в камере прибора с зарядовой связью (CCD), таким образом все 4 типа флуоресцентного излучения можно детектировать одновременно. С помощью программного обеспечения световые сигналы накапливаются по интенсивности с использованием фильтров, выбираемых программой (спектральные или волновые фильтры), и хранятся в виде электрических сигналов для последующей обработки данных. Результаты в итоге представлены в виде разноцветных пиков (каждый из цветов соответствует определенному флуоресцентному красителю) - электрофореграммы, с обозначенным размером продуктов, который устанавливается по стандарту длины, добавляемому при пробоподготовке в каждый образец. Поскольку генотипирование проводится только с использованием образцов ДНК мужчин, то наблюдаемые сочетания генотипов разных YSTR отражают их физическое расположение на Y-хромосоме конкретного индивида.

На Фиг.1 приведена электрофореграмма разделения стандарта длины ДНК (GeneScan500-ROX) - красные пики.

На фиг.2 приведена электрофореграмма разделения микросателлитных маркеров Y-хромосомы методом капиллярного гель-электрофореза у одного из индивидов.

Разработанный способ обеспечивает возможность получения амплификатов ДНК, содержащих не менее 90% объема специфичных фрагментов ДНК. Неспецифичные фрагменты ДНК допускаются в объеме, не превышающем 10% объема (оцениваемого как площадь под пиком соответствующих специфичных фрагментов ДНК). Точность генотипирования не менее 99%. Погрешность измерений длины фрагмента ДНК не более 1 пары нуклеотидов. Воспроизводимость результатов должна обеспечиваться точным соблюдением всех условий генотипирования.

Таким образом, в результате использования предложенного способа генотипирования YSTR-маркеров путем проведения ПЦР и фрагментного анализа исследуемых образцов ДНК возможно установить комплексный генотип исследуемого образца ДНК человека по 15 микросателлитным маркерам нерекомбинирующей части Y-хромосомы: DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393 и DYS394 (DYS19), DYS385a, DYS385b, DYS388, DYS426, DYS434, DYS437, DYS438, DYS439.

Предлагаемый способ отличается высокой чувствительностью, специфичностью, высокой точностью, обладает высоким дискриминирующим потенциалом и является более экономичным.

Источники информации

1. Jobling М.А. and Tyler-Smith С.New uses for new haplotypes the human Y chromosome, disease and selection // Trends in Genetics. - 2000. - V.16. - P.356-362.

2. Jobling M.A., Tyler-Smith C. Fathers and sons: the Y chromosome and human evolution // Trends in Genetics. - 1995. - V.11. - P.449-156.

3. Carracedo A., Bar W., Lincoln P., Mayr W., Morling N., Olaisen В., Schneider P., Budowle В., Brinkmann В., Gil P., Holland M., Tully G., Wilson M., DNA Commission of the International Society for Forensic Genetics: guidelines for mitochondrial DNA typing // Forensic Sci. Int. - 2000. Vol.110. - P.79-85.

4. Sanchez, JJ, Phillips, C, Borsting, С et al. (2006) A multiplex assay with 52 single nucleotide polymorphisms for human identification. Electrophoresis / 2006. V.27, (9). P.1713-1724.

5. Sanchez J.J., Borsting C, Balogh K.; Berger В., Bogus M., Butler J.M., Carracedo A., et al. Forensic typing of autosomal SNPs with a 29 SNP-multiplex-results of a collaborative EDNAP exercise // Forensic Science International. Genetics. 2008. Vol.2. P.176-183.

6. Butler J.M., Schoske R., Vallone P.M. et al. A novel multiplex for simultaneous amplification of 20 Y chromosome STR markers // Forensic Sci Int. 2002. V.129. P.10-24.

7. Zhivotovsky L.A., Akhmetova V.L., Fedorova S.A., Zhirkova V.V., Khusnutdininova E.K. Developing STR databases on structured populations: the native South Siberian population versus the Russian population.Forensic Sci Int; Genetics. 2009. V.3. P.111-116.

8. Nelson TM, Just RS, Loreille O, Schanfield MS, Podini D. Development of a multiplex single base extension assay for mitochondrial DNA haplogroup typing // Croat Med J. 2007. Vol.48. P.460-472.

9. Степанов B.A., Балановский О.П., Мельников А.В., Лаш-Завада А.Ю., Харьков В.Н., Тяжелова Т.В., Ахметова В.Л., Жукова О.В., Шнейдер Ю.В., Шильникова Н.Н., Боринская С.А., Марусин А.В., Спиридонова М.Г., Симонова К.В., Хитринская И.Ю., Раджабов М.О., Романов А.Г., Штыгашева О.В., Кошель СМ., Балановская Е.В., Рыбакова А.В., Хуснутдинова Э.К., Пузырев В.П., Янковский Н.К. Характеристика популяций Российской Федерации по панели пятнадцати локусов, используемых для ДНК-идентификации и в судебно-медицинской экспертизе.// Acta Naturae. 2011. Т.3. №2. С.59-71.

1. Набор синтетических олигонуклеотидных пар праймеров, комплементарных участкам пятнадцати микросателлитных локусов Y-хромосомы для выявления генотипов для идентификации личности в российской популяции, характеризующийся тем, что набор представляет собой пары праймеров, из которых один имеет флуоресцентную метку, а второй является немеченым, при этом прямые праймеры для каждого из локусов несут на 5'-конце флуоресцентную метку: ТЕТ (4,7,2',7'-тетрахлоро-6-карбоксифлуоресцеин) для DYS385a/b, DYS390, DYS391, DYS426 и DYS439; FAM (6-карбоксифлуоресцеин) для DYS392, DYS393, DYS437 и DYS438; и HEX (4,7,2',4',5',7'-гексахлоро-6-карбоксифлуоресцеин) для DYS394, DYS388, DYS389I/II и DYS434, где синтетические олигонуклеотидные праймеры имеют следующий нуклеотидный состав:
DYS385a/b F: 5' -ТЕТ-AGCATGGGTGACAGAGCTA-3',
DYS385a/b R: 5'-TGGGATGCTAGGTAAAGCTG-3',
DYS388 F: 5'-HEX-GAATTCCATGTGAAGTTAGCCGTTTAGC-3',
DYS388 R: 5'-GAGGCGGAGCTTTTAGTGAG-3',
DYS389I/II F: 5'-HEX-CCAACTCTCATCTGTATTATCTATG-3',
DYS389I/II R: 5'-ТСТТАТСТССАСССАССAGA-3',
DYS390 F: 5'-ТЕТ-ТАТАТТТТАСACATTTTTGGGCC-3',
DYS390 R: 5'-TGACAGTAAAATGAACACATTGC-3',
DYS391 F: 5'-ТЕТ-СТАТТСАТТСААТСАТАСАСССА-3',
DYS391 R: 5'-GATTCTTTGTGGTGGGTCTG-3',
DYS392 F: 5'-FAM-TCATTAATCTAGCTTTTAAAAACAA-3',
DYS392 R: 5'- AGACCCAGTTGATGCAATGT-3',
DYS393 F: 5'-FAM-GTGGTCTTCTACTTGTGTCAATAC-3',
DYS393 R: 5'-AACTCAAGTCCAAAAAATGAGG-3',
DYS394 F: 5'-HEX-CTACTGAGTTTCTGTTATAGT-3',
DYS394 R: 5'-ATGGCATGTAGTGAGGACA-3',
DYS426 F: 5'-TET-CTCAAAGTATGAAAGCATGACCA-3',
DYS426 R: 5'-GGTGACAAGACGAGACTTTGTG-3',
DYS434 F: 5'-HEX-CACTCCCTGAGTGCTGGATT-3',
DYS434 R: 5'-GGAGATGAATGAATGGATGGA-3',
DYS437 F: 5'-FAM-GACTATGGGCGTGAGTGCAT-3',
DYS437 R: 5'-GAGACCCTGTCATTCACAGATGA-3',
DYS438 F: 5'-FAM-CCAAAATTAGTGGGGAATAGTTG-3',
DYS438 R: 5'-GATCACCCAGGGTCTGGAGTT-3',
DYS439 F: 5'-TET-TCGAGTTGTTATGGTTTTAGGTCT-3',
DYS439 R: 5'-GTGGCTTGGAATTCTTTTACCC-3'.

2. Способ выявления генотипов для идентификации личности в российской популяции с помощью системы микросателлитных ДНК-маркеров Y-хромосомы, характеризующийся тем, что используют праймеры по п.1, при этом проводят генотипирование 15 коротких тандемных повторов, локализованных на нерекомбинирующем участке Y-хромосомы (YSTR), на генетическом ДНК-анализаторе с помощью капиллярного гель-электрофореза, с применением метода ПЦР и фрагментного анализа флуоресцентно меченых ДНК-ампликонов, используют образцы ДНК мужчин, выделенной из любого биологического материала в соответствии со стандартными методами, обеспечивающими качественную очистку ДНК от белков и примесей и предотвращающими деградацию материала в ходе выделения, где при проведении капиллярного электрофореза фрагменты, синтезированные в ходе ПЦР, имеющие флуоресцентную метку ТЕТ (4,7,2',7'-тетрахлоро-6-карбоксифлуоресцеин) в диапазоне длин 360-420 п.о., соответствуют аллелям 9-23 тандемных повтора в локусе DYS385a/b, фрагменты, имеющие флуоресцентную метку ТЕТ в диапазоне длин 196-224 п.о., соответствуют аллелям 19-26 тандемных повторов в локусе DYS390, фрагменты, имеющие флуоресцентную метку ТЕТ в диапазоне длин 277-289 п.о., соответствуют аллелям 9-12 тандемных повторов в локусе DYS391, фрагменты, имеющие флуоресцентную метку ТЕТ в диапазоне длин 87-94 п.о., соответствуют аллелям 11-13 тандемных повторов в локусе DYS426, фрагменты, имеющие флуоресцентную метку ТЕТ в диапазоне длин 232-260 п.о., соответствуют аллелям 8-15 тандемных повторов в локусе DYS439, фрагменты, имеющие флуоресцентную метку FAM (6-карбоксифлуоресцеин) в диапазоне длин 243-259 п.о., соответствуют аллелям 10-15 тандемных повторов в локусе DYS392, фрагменты, имеющие флуоресцентную метку FAM в диапазоне длин 116-128 п.о., соответствуют аллелям 12-15 тандемных повторов в локусе DYS393, фрагменты, имеющие флуоресцентную метку FAM в диапазоне длин 174-190 п.о., соответствуют аллелям 6-10 тандемных повторов в локусе DYS437, фрагменты, имеющие флуоресцентную метку FAM в диапазоне длин 311-326 п.о., соответствуют аллелям 9-12 тандемных повторов в локусе DYS438, фрагменты, имеющие флуоресцентную метку HEX (4,7,2',4',5',7'-гексахлоро-6-карбоксифлуоресцеин) в диапазоне длин 190-206 п.о., соответствуют аллелям 13-17 тандемных повторов в локусе DYS394, фрагменты, имеющие флуоресцентную метку HEX в диапазоне длин 242-262 п.о., соответствуют аллелям 7-12 тандемных повторов в локусе DYS389I, фрагменты, имеющие флуоресцентную метку HEX в диапазоне длин 360-382 п.о., соответствуют локусу DYS389II, при этом аллели локуса DYS389II определяют вычитанием из значения длины фрагмента диапазона 360-382 значения длины фрагмента DYS389I, получаемый диапазон 110-134 п.о. соответствует 14-20 тандемным повторам, фрагменты, имеющие флуоресцентную метку HEX в диапазоне длин 151-175 п.о., соответствуют аллелям 11-19 тандемных повторов в локусе DYS388, фрагменты, имеющие флуоресцентную метку HEX в диапазоне длин 106-122 п.о., соответствуют аллелям 8-12 тандемных повторов в локусе DYS434.



 

Похожие патенты:

Изобретение относится к биотехнологии и представляет собой способ оценки чувствительности клеток рака легкого к доксорубицину (IC50), а также набор для осуществления данного способа.

Изобретение относится к области медицины, в частности к клинической лабораторной диагностике. Предложен биологический микрочип для выявления и многопараметрического анализа противохолерных антител в сыворотке крови человека, содержащий массив дискретно нанесенных и иммобилизованных на поверхности подложки O-антигенов V.

Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для амплификации и последующего секвенирования ITS1-5.8S-ITS2 сосудистых растений, включающего проведение полимеразой цепной реакции с помощью универсальных праймеров со следующим нуклеотидным составом: primer ITS-for CGTAACAAGGTTTCCGTAG, primer ITS-rew GGAATCCTTGTAAGTTTCTTT.

Группа изобретений относится к области микробиологии и биотехнологии. Способ детекции живых клеток микроорганизма в тестируемом образце путем отличия живых клеток от мертвых клеток или поврежденных клеток предусматривает добавление в тестируемый образец средства, способного к ковалентному связыванию с ДНК или РНК при облучении светом с длиной волны от 350 нм до 700 нм; облучение тестируемого образца; амплификацию мишеневой области ДНК или РНК микроорганизма, содержащегося в тестируемом образце, способом амплификации нуклеиновых кислот в присутствии средства подавления действия вещества, ингибирующего амплификацию нуклеиновых кислот, соли магния, соли органической кислоты или соли фосфорной кислоты, без выделения нуклеиновых кислот из клеток и анализа продукта амплификации.

Изобретение относится к ветеринарной микробиологии и биотехнологии, а именно к генетической инженерии. Предложены синтетические олигонуклеотидные праймеры для идентификации штаммов и изолятов бактерии Pasteurella multocida серогруппы A у крупного рогатого скота и способ их применения.

Изобретение относится к области биотехнологии и касается видовой и штаммовой идентификации бифидобактерий филотипа Bifidobacterium longum. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейства RelBE и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора видо- и штаммоспецифичных олигонуклеотидов, ПЦР продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера.

Изобретение относится к иммунологии. Предложены варианты применения вариантов набора генов (фармакодинамических (ФД) маркеров) с повышенной регуляцией экспрессии или действия, индуцируемых интерфероном альфа (ИФНα).

Изобретение относится к области биотехнологии и касается способа идентификации лактобацилл. Представленный способ основан на комбинации и полиморфизме генов токсин-антитоксин суперсемейств RelBE и MazEF и характеризуется тем, что для идентификации проводят амплификацию геномных ДНК с использованием набора олегонуклеотидов определенной структуры, ПЦР-продукты анализируют в агарозном геле, а размер полученного фрагмента определяют с помощью ДНК-маркера.

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления видовой принадлежности родиолы четырехнадрезной {Rhodiola quadrifida (Pall.) Fisch.

Изобретение касается способа определения генотипов золотистого стафилококка. Представленный способ включает получение чистой культуры микроорганизмов на плотной питательной среде с последующим выделением и амплификацией ДНК возбудителя с помощью мультиплексной полимеразной цепной реакции (ПЦР) и с детекцией результатов методом электрофореза в агарозном геле.

Изобретение относится к биотехнологии и представляет собой способ оценки чувствительности клеток рака легкого к доксорубицину (IC50), а также набор для осуществления данного способа.

Изобретение относится к области генной инженерии и может быть использовано для регулирования проницаемости метан-продуцирующей клетки. Получают полипептид, который способен проникать в метан-продуцирующую клетку и повышать ее проницаемость, характеризующийся аминокислотной последовательностью SEQ ID NO:117, 118 или 119 или по меньшей мере 90% идентичностью к указанной последовательности или по меньшей мере 15 последовательно расположенными аминокислотами указанной последовательности.

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления видовой принадлежности родиолы четырехнадрезной {Rhodiola quadrifida (Pall.) Fisch.

Изобретение касается способа определения генотипов золотистого стафилококка. Представленный способ включает получение чистой культуры микроорганизмов на плотной питательной среде с последующим выделением и амплификацией ДНК возбудителя с помощью мультиплексной полимеразной цепной реакции (ПЦР) и с детекцией результатов методом электрофореза в агарозном геле.

Изобретение относится к области биотехнологии и касается набора для выявления Ку-лихорадки методом ПЦР-РВ. Охарактеризованный набор содержит синтетические олигонуклеотиды, ограничивающие фрагмент гена groEL: GroEL F 5′ CTTCTACTGTTATGACGCCTTCTTTGC 3′ GroEL R 5′ CGCAAGTAGGCACCATTTCTGC 3′, и флуоресцентный зонд: GroEL Probe 5′ FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3′.
Изобретение относится к области биотехнологии, конкретно к молекулярной биологии и онкологии, и может быть использовано для диагностики терминальных мутаций в гене RET, ассоциированных с наследственной предрасположенностью к раку щитовидной железы (РЩЖ).
Изобретение относится к области биотехнологии, конкретно к молекулярной биологии и онкологии, и может быть использовано для диагностики терминальных мутаций в гене RET, ассоциированных с наследственной предрасположенностью к раку щитовидной железы (РЩЖ).

Группа изобретений относится к области биотехнологии. Настоящее изобретение обеспечивает синтетические 5'UTR области, содержащие первый полинуклеотидный фрагмент в виде второго интрона гена кальциевой АТФазы саркоплазматического/эндоплазматического ретикулума и второй полинуклеотидный фрагмент, представленный частью 5' нетранслируемой области (5'UTR) гена казеина.

Изобретение относится к области биохимии, в частности к способу получения одноцепочечной кольцевой РНК. Способ включает синтез смысловой цепи и антисмысловой цепи, содержащих нуклеотидную последовательность с неспаренными нуклеотидами на 5'-конце и 3'-конце, и одновременно лигирование нуклеотида на 5'-конце нуклеотидной последовательности с неспаренными нуклеотидами в смысловой цепи с нуклеотидом на 3'-конце нуклеотидной последовательности с неспаренными нуклеотидами в антисмысловой цепи и, наоборот, с использованием лигазы.

Настоящее изобретение относится к области биотехнологии и касается способа амплификации и детекции нуклеотидных последовательностей в реакционной смеси и набору, используемому в этом способе.

Изобретение относится к области биотехнологии, конкретно к выявлению рака легкого с помощью аптамеров, и может быть использовано в диагностике. Аптамеры получают в результате селекции, включающей чередование раундов позитивной селекции аптамеров к измельченным опухолевым тканям легкого человека, забиравшимся после операции у онкологических больных, и негативной селекции к здоровым тканям легкого и цельной крови здоровых людей, с выявлением пула аптамеров с наибольшей аффинностью, его клонирования, секвенирования, проверки на специфичность связывания с опухолевыми клетками легкого. Полученные аптамеры обладают высокой чувствительностью к продуктам распада опухоли и циркулирующим раковым клеткам в периферической крови больных раком легкого, что позволяет повысить эффективность диагностики рака легкого человека. 2 з.п. ф-лы, 2 ил., 1 пр.
Наверх