Способ получения персонифицированного аутопробиотического продукта и способ лечения синдрома раздраженной кишки с использованием этого продукта

Группа изобретений относится к биотехнологии. Предложен способ получения персонифицированного аутопробиотического продукта в виде молочнокислой закваски на основе аутоштаммов лактобактерий и способ лечения синдрома раздраженной кишки, сопровождающегося дисбиозом кишечника, с его использованием. Указанный продукт получают забором пробы нативного материала, посевом и выращивание бактерий из фекалий пациента на селективной питательной среде, идентификацией и отбором типичных для лактобактерий колоний, получением чистой культуры, уточнением видовой принадлежности с использованием ПЦР, ее депонированием в криохранилище при температуре не выше -75оС со сроком хранения не более 1 года и приготовлением из полученной культуры молочнокислой закваски. В качестве лактобактерий используют аутоштаммы Lactobacillus spp. Для ПЦР используют специфичные для определенных видов лактобацилл праймеры. Молочнокислую закваску готовят из чистой культуры полученных штаммов с титром не менее 1×108 KOE/мл. Полученный продукт назначают субъекту в дозе не менее 50 мл с кратностью приема не менее 2 раз в сутки через 30-40 мин после еды в течение не менее 10 дней. Группа изобретений позволяет повысить длительность стойкого лечения и его эффективность. 2 н.п. ф-лы, 5 табл.

 

Изобретение относится к области микробиологии и медицины и касается получения пробиотического продукта, содержащего аутоштаммы лактобактерий, который может быть использован при лечении больных с синдромом раздраженной толстой кишки (СРК), сопровождающимся дисбиозом кишечника.

СРК является наиболее частым функциональным расстройством желудочно-кишечного тракта. Симптомы СРК могут существовать длительное время, часто сочетаются с другими функциональными расстройствами и способны серьезно ухудшать качество жизни пациентов.

Известно [1-5] использование пробиотиков в комплексном лечении СРК. Пробиотики оказывают положительное воздействие на выраженность вздутия и других симптомов СРК посредством восстановления нормального состава и метаболической активности кишечной микрофлоры, что обеспечивает улучшение пищеварения и моторики кишечника, а также уменьшение газообразования.

Известно [6] использование инактивированного пробиотического штамма L. acidophilus (штамм LB) в лечении синдрома раздраженной толстой кишки. В этом исследовании участвовали 18 больных, которые в течение 6 недель получали пробиотик в виде капсул, содержащих 5×109 КОЕ, или плацебо с последующим 2-недельным периодом "очищения" и повторением 6-недельного цикла терапии. Клиническое состояние больных оценивалось при помощи опросника. Пробиотический продукт продемонстрировал статистически значимый терапевтический эффект у 50% больных. Однако известный пробиотический продукт содержит инактивированные промышленные штаммы лактобацилл (в данном случае L. Acidophilus), что не позволяет достичь колонизации лактобактериями слизистой оболочки. Использование инактивированных штаммов обладает лишь иммуногенным свойством и длительность терапевтического эффекта лечения ограничена длительностью приема препарата.

Известно [7-8] использование фруктового напитка, содержащего L. plantarum (штамм 99V) при лечении больных с СРК. Все больные (40 человек), получавшие активный продукт, отмечали облегчение абдоминальных болей. Улучшение общих симптомов СРК наблюдали у 95% больных в группе, получавшей лактобациллы, и у 15% больных в контрольной группе, получавшей плацебо. Однако известный активный продукт содержит промышленные штаммы лактобацилл, что в силу их чужеродности делает невозможным внедрение в биопленку конкретного человека. Кроме того, использование промышленных пробиотических штаммов у ослабленных больных может привести к генерализации штаммов и развитию лактобациллярного сепсиса.

Известно [9] использование пробиотического продукта Активиа, содержащего Bifidobacterium animalis DN-173 010 (коммерческое название ActiRegularis). Исследование, в котором приняли участие 274 человека в возрасте от 18 до 65 лет, было проведено в 35 медицинских центрах Франции. Все участники страдали легкими и среднетяжелыми формами СРК. Основным критерием эффективности сравниваемых продуктов являлась динамика гастроинтестинальных симптомов СРК (вздутие, боли в брюшной полости, дискомфорт, частота и характер стула) и качества жизни. Как показали результаты исследования, доля участников, отметивших улучшение самочувствия по общему показателю абдоминального дискомфорта, на 3-й неделе исследования оказалась значительно выше в группе Активиа по сравнению с группой плацебо (65,2 и 47,7% соответственно; р=0,003). Однако использование пробиотического продукта Активиа также сопряжено с использованием промышленных штаммов бактерий, что не позволяет персонифицировать терапию и получить стойкий терапевтический эффект.

Известно [10, 11] использование лактобацилл в качестве пробиотиков для коррекции различных состояний, сопровождающихся дисбиотическими изменениями. До настоящего времени, с этой целью использовались промышленные штаммы лактобацилл.

Микробы, выращенные искусственно, являются чужеродными, как чужеродны пересаживаемые человеку органы и ткани других людей - доноров, или животных. Промышленные штаммы микроорганизмов подвергаются элиминации вследствие биологической несовместимости. Биотехнологические пробиотики не имеют возможности внедряться внутрь биопленки кишечника, и поэтому пребывают в нем транзиторно как микрофлора пищи. Это признают производители пробиотиков, подтверждая, что их продукт не восполняет дефицит соответствующих содержимому пробиотика микроорганизмов, но стимулируют рост облигатной микрофлоры [12-13]. Все это не позволяет получить высоких и стабильных клинических результатов при лечении больных с СРК.

Известен [14] способ получения пробиотического продукта, наиболее близкий по решаемой задаче к заявляемому способу и принятый в качестве прототипа по первому независимому пункту формулы изобретения. В известном способе описано получение аутопробиотического продукта, содержащего аутоштаммы лактобактерий, в частности апатогенные штаммы Enterococcus faecium, представителя индигенной микрофлоры кишечника хозяина. Штаммы энтерококков выделяют из пробы нативного материала посредством посева фекалий пациента на селективную питательную среду и выращиванием культуры в селективной питательной среде, идентификацией и отбором типичных для лактобактерий колоний, получением чистой культуры, уточнением видовой принадлежности и отбором апатогенных штаммов Enterococcus faecium с использованием полимеразной цепной реакции, депонированием полученных штаммов в криохранилище при температуре не выше -75°С со сроком хранения не более 1 года и приготовлением из полученной культуры молочнокислой закваски.

Недостатком известного способа получения пробиотического продукта является ограниченная область применения полученного продукта в ситуации дисбиоза, поскольку известный аутопробиотический продукт, содержащий апатогенные штаммы Enterococcus faecium, эффективен преимущественно в ситуации дисбиоза, характеризующегося синдром избыточного бактериального роста. Кроме того, в описанном способе молекулярно-генетическое исследование (полимеразная цепная реакция) используется только для детекции генов патогенности полученных штаммов энтерококков, а для идентификации микроорганизмов используется только культуральный метод, что может быть причиной ошибки при получении пробиотической культуры, основы аутопробиотического продукта.

Техническим результатом заявленного способа получения аутопробиотического продукта является расширение области воздействия полученного продукта, поскольку продукт, полученный заявленным способом, эффективен не только в ситуации дисбиоза, характеризующегося синдромом избыточного бактериального роста, но и в условиях дефицита аутохтонной микрофлоры, что особенно важно при синдроме раздраженной толстой кишки.

Указанный технический результат достигается тем, что в способе получения персонифицированного аутопробиотического продукта в виде молочнокислой закваски на основе аутоштаммов лактобактерий, характеризующимся забором пробы нативного материала, посевом бактерий из фекалий пациента на селективную питательную среду и выращиванием культуры в селективной питательной среде, идентификацией и отбором типичных для лактобактерий колоний, получением чистой культуры, уточнением видовой принадлежности с использованием полимеразной цепной реакции, ее депонированием в криохранилище при температуре не выше -75°C со сроком хранения не более 1 года, и приготовлением из полученной культуры молочнокислой закваски, в соответствии с первым пунктом заявленного изобретения, в качестве лактобактерий используют аутоштаммы Lactobacillus spp, полимеразную цепную реакцию используют после отбора типичных для лактобактерий колоний для выделения штаммов, пригодных в качестве пробиотиков, с использованием праймеров, сконструированных на основании специфицеских последовательностей, соответствующих генам, кодирующим белки, специфичные для определенных видов лактобацилл, а молочнокислую закваску готовят из чистой культуры полученных штаммов с содержанием в ней не менее 1×108 КОЕ/мл.

Известен [15] способ лечения или предупреждения нежелательной воспалительной активности или воспалительного заболевания у субъекта, наиболее близкий к заявленному изобретению по второму независимому пункту формулы изобретения. Известный способ состоит в том, что субъекту вводят штамм Lactobacillus salivarius NCIMB 41044, или штамм Lactobacillus salivarius NCIMB 41045, или штамм Lactobacillus salivarius NCIMB 41047, или штамм Lactobacillus salivarius NCIMB 41093, или штамм Lactobacillus salivarius NCIMB 41094, причем нежелательной воспалительной активностью является воспалительная активность в желудочно-кишечном тракте, воспалительное заболевание кишечника, такое как болезнь Крона или неспецифический язвенный колит; синдром раздраженного кишечника; резервуарный илеит; и/или постинфекционный колит. В известном способе лечения синдрома раздраженного кишечника описано использование вариантов штаммов Lactobacillus salivarius, выделенных из резецированного и отмытого кишечника человека, явившегося по сути донором этих штаммов лактобацилл.

Недостатком известного способа лечения синдрома раздраженного кишечника является недостаточная длительность и стойкость эффекта лечения за счет того, что при таком лечении используются, хоть и полученные от человека, но чужеродные для конкретного индивидуума штаммы бактерий, которые не способны колонизировать слизистую оболочку и внедряться в сформированные микробные консорциумы конкретного человека, а следовательно, не позволяет достичь длительного стойкого эффекта.

Техническим результатом заявленного способа по второму независимому пункту является существенное повышение длительности стойкого лечения и его эффективности, что достигается использованием при лечении СРК с терапевтической целью персонифицированного аутопробиотического продукта, полученного по первому независимому пункту формулы заявляемого изобретения.

Указанный технический результат достигается тем, что в способе лечения синдрома раздраженной кишки, сопровождающегося дисбиозом кишечника, в соответствии со вторым заявленным пунктом формулы изобретения, лечение включает прием полученного (по первому независимому пункту формулы заявленного изобретения) персонифицированного аутопробиотического продукта на основе штаммов Lactobacillus spp., который назначают в дозе не менее 50 мл с кратностью приема не менее 2 раз в сутки через 30-40 минут после еды в течение не менее 10 дней.

Получение индивидуального пробиотика на основе аутоштамма Lactobacillus - обитателя желудочно-кишечного тракта конкретного пациента, позволяет провести персонифицированную терапию с получением высоких эффективных и стойких клинических результатов.

Способ отличается тем, что молочнокислая закваска создается на основе штаммов лактобацилл, изолированных от отдельных пациентов для приготовления аутопробиотического продукта индивидуального пользования. Новизна предлагаемого способа приготовления молочнокислой закваски заключается в том, что предлагаемый продукт получают из собственного (аутопробиотического) штамма Lactobacillus spp.- обитателя желудочно-кишечного тракта конкретного пациента. После отбора характерных по морфологии колоний и перед непосредственно получением продукта осуществляют полимеразную цепную реакцию (ПЦР) с определением вида лактобациллы. Использованные в ПЦР праймеры сконструированы на основании нуклеотидных последовательностей, доступных в базах данных Genbank NCBI и Human Microbioma. Праймеры были сконструированы на основании специфических последовательностей, соответствующих генам, кодирующим белки, специфичные для определенных видов лактобацилл. Результаты ПЦР с использованием сконструированных праймеров для определения видов лактобацилл были подтверждены секвенированием участков, кодирующих 16S рРНК соответсвующих видов лактобацилл. Данный способ обеспечивает абсолютную безопасность готового продукта для человека. Способ отличается высокой скоростью получения готовой закваски (7-10 суток с момента взятия материала).

Сущность изобретения состоит в том, что для выделения индигенных лактобацилл из фекалий для создания аутопробиотических молочнокислых заквасок необходимо:

1) осуществить высев лактобацилл из фекалий пациента,

2) идентифицировать выделенные штаммы до рода,

3) осуществить ПЦР для определения вида лактобацилл и отбора пробиотических штаммов,

4) получить готовый продукт - аутопробиоитческую молочнокислую закваску.

Ниже приводится полное описание по каждой из названных процедур заявленного способа.

1. Посев материала для выделения Lactobacillus spp.

Для выделения аутопробиотических лактобацилл из фекалий осуществляют забор материала у пациентов. Для этого необходимо не менее 0,5 г материала (желательно - 5,0 г), при жидком стуле - слой не менее 1-2 см от дна посуды. Доставку в бактериологическую лабораторию осуществляют не позднее 2 часов после забора материала. Затем в стерильных условиях к 1 г материала добавляют 9 мл стерильного фосфатного буфера (физиологический раствор хлорида натрия с добавлением фосфатов натрия двух- и однозамещенных, смешанных в пропорции, необходимой для создания рН 7,4). Суспензию фекалий в разведении 1:10 высевают в количестве 100 мкл на селективную среду для лактобацилл (МРС-4, НИЦФ, Санкт-Петербург). Культивируют в течение 24-48 часов при 37°С в анаэробных или микроаэрофильных условиях.

2. Идентификация чистой культуры Lactobacillus spp.

Идентификацию отдельных колоний осуществляют на основании

морфологических свойств колоний и клеток изолированных микроогранизмов. Выбирают типичные для Lactobacillus spp.отдельные колонии и отсевают их на новую чашку Петри со средой МРС-4 секторами с целью получения чистой культуры. Культивируют в течение 24-48 часов при 37°C в анаэробных или микроаэрофильных условиях. При световой микроскопии при окрашивании по методу Грама клетки лактобацилл приобретают темно-синий цвет, имеют форму палочек и располагаются в виде цепочек или отдельных клеток. Чистые культуры направляют на генетический анализ.

3. Определение видовой принадлежности Lactobacillus spp. при помощи ПЦР

Для оценки молекулярно-генетических характеристик штаммов из индивидуальных колоний лактобацилл экспресс-методом выделяют хромосомную ДНК, после чего производят ПЦР. Для предлагаемого экспресс-выделения ДНК используют чистую бактериальную культуру. Суспензию клеток центрифугируют при 10 тыс.об./мин в течение 5 минут. Осадок используют для выделения ДНК с помощью коммерческого набора ДНК сорб-В (ФГУН ЦНИИЭ Роспотребнадзора, Россия) согласно прилагаемой инструкции. Выделенную ДНК хранят при 4°С.

Нативную ДНК бактерии используют для ПЦР (30 циклов при температуре отжига 57°C). Праймеры для проведения ПЦР были созданы на основе имеющихся в базах данных GenBank NCBI и Human Microbioma последовательностей ДНК лактобацилл с использованием программы Primer-3 и BLAST. Праймеры были сконструированы на основании последовательностей, соответствующих генам, кодирующим белки, специфичные для определенных видов лактобацилл. Результаты ПЦР с использованием сконструированных праймеров для определения видов лактобацилл были подтверждены секвенированием участков, кодирующих 16S рРНК соответсвующих видов лактобацилл.

Праймеры представлены в таблице 1. Сконструированные праймеры позволяют идентифицировать следующие виды лактобацилл: L.casei, L.paracasei, L.delbrueckii, L.johnsonii, L.fermentum, L.plantarum, L.rhamnosus, L.crispatus, L.reuteri, L.ruminis, L.gasseri, L. acidophilus, L.salivarius, L.helveticus.

Детекцию результатов ПЦР осуществляют с помощью электрофореза в 1% агарозном геле. Соответственно, для подготовки аутопробиотиков отбирают бактериальные клоны, относящиеся к одному из вышеперечисленных видов лактобацилл.

4. Получение готового продукта аутопробиотической молочнокислой закваски.

После определения вида лактобацилл один или несколько идентифицированных штаммов используют для получения молочнокислой закваски. Для этого 1 колонию чистой культуры засевают в стерильное молоко (10 мл) и инкубируют при 37°С 24-48 часов в анаэробных или микроаэрофильных условиях. Выбирают одну пробирку с более быстрым ростом культуры, определяя это по образованию сгустка в молоке.

Полученный сгусток переносят в 1 л стерильного молока, подогретого до 37°C. Инкубируют при 37°C 24-48 часов в анаэробных или микроаэрофильных условиях.

Таблица 1
Праймеры, использованные для определения вида лактобацилл
Название праймера Последовательность Размер
LactoF gaaactttgtttagttttgag 500+
LactoR tgacttgtacacaccgcccgt >1000
L1F ctagcgtccaacaaatcaccc 137
L1R gattcaagtttgaaaggcggc
L2F gtaaatctgttagttccgctcgct 133
L2R aagcagatcgcatgatcagct
L3F agttgagtttctctctcttctcg 279
L3R tcccaagtagcggcgagcga
L4F ccatgttgaatctcggtgc 116
L4R ctaataccgcatagatccaagaacc
L5F caaaattaaatcaagatgcaagca 121
L6F gcattcggtgtaagaaagtttcg 1400
L7F tcatgatgcaagcaccaatcaatac 1536
L7R tagttttgagagatttaact
L8F aacaatgacttgagcatccctt 499
L8R tccaaaactgctttgagtagga
L9F ccaagttacctaaaccaccagc 295
L9R taagcttcatgtcaccttgtgg
L10F tatcactgtggtcttggcaaac 396
L10R gttagtcatggcgaggatcttt
L11F tcgtcatcgtcaataatccgta 502
L11R gtatcacgatttgctgctttca
L12F ttaacgcgtggtaaggtgattc 800
L12R cctgtccatcggctaattcata
L13F tcaaaaccaatgtcaaatgcat 603
L13R cagcacttggaatacgaacaag
L14F atttcttggatcgccttcaaat 700
L14R tgaacgcatttcaagacgagta

После получения молочнокислой закваски продукт хранят до использования при 4°C не более 7 дней

Полученный молочнокислый продукт с содержанием выделенного штамма Lactobacillus не менее 108 КОЕ/мл пациент принимает в дозе не менее 50 мл 2 раза в сутки через 30-40 минут после еды в течение не менее 10 дней.

Заявляемое изобретение было апробировано в лабораторных и клинических условиях в Институте экспериментальной медицины РАМН, на кафедре терапии и клинической фармакологии Северо-Западного Медицинского университета имени И.И. Мечникова, Санкт-Петербургского бюджетного учреждения «Городская больница №26».

Результаты апробации иллюстрируется следующими клиническими примерами, полученными в режиме реального времени с конкретными пациентами.

Пациент С., 36 лет, обратился с жалобами на практически постоянное ощущение вздутия живота (3 балла), боли в животе ноющего характера средней интенсивности (2 балла), связанные с актом дефекации, учащение стула в дневное время до 3-4 раз с отхождением кашецеобразных масс (6 тип стула по Бристольской шкале). Отмечал ухудшение общего самочувствия в виде общей слабости, снижения трудоспособности (общее самочувствие не очень хорошее - 1 балл). Яркой психосоматической жалобой явилась боязнь замкнутых пространств (не мог находиться в метро, не мог перемещаться в транспорте). Ранее пациент прошел обследование по поводу вышеописанных жалоб, появившихся впервые. Был установлен диагноз синдрома раздраженного кишечника. Получал неоднократно курсы пробиотической терапии (Линекс, Бифиформ, Энтерол) на фоне терапии спазмалитиками (дицител), психокоррегирующей терапии с незначительным терапевтическим эффектом. Было принято решение провести курс аутопробиотической терапии (молочнокислый продукт с содержанием выделенного штамма Lactobacillus). Пациент отметил приятный вкус и консистенцию аутопробиотического продукта, что повысило его приверженность к лечению.

Перед проведением лечения по заявленному изобретению пациент был обследован. При клиническом и биохимическом исследовании отклонений от нормы выявлено не было. При посеве кала на кишечную микрофлору был выявлен дисбиоз 2 степени: уменьшение количества бифидобактерий до 106, лактобактерий - до 105, выявлен рост условно-патогенной флоры (цитробактер до 104). Пациенту была проведена терапия молочнокислым продуктом, содержащим 108 КОЕ/мл выделенного аутоштамма Lactobacillus sp., в дозе 100 мл/сутки - по 50 мл 2 раза в день в течение 10 дней. Улучшение в состоянии пациента наблюдалось с четвертого дня терапии аутопробиотиком: было отмечено снижение выраженности метеоризма и болей в животе, появилась тенденция к нормализации стула. Через 10 дней лечения отмечено значительное улучшение общего самочувствия (хорошее - 0 баллов), исчезновение абдоминального болевого синдрома (0 баллов), нормализовалась частота стула (2 раза в сутки) и его форма (3 тип по Бристольской шкале). При исследовании кишечной микрофлоры выявлено увеличение количества лактобактерий и бифидобактерий (до 108 КОЕ/мл), рост условно-патогенной флоры не выявлен. К окончанию курса лечения пациент отметил уменьшение выраженности фобического синдрома (на контрольный осмотр приехал самостоятельно на общественном транспорте).

Для изучения эффективности заявленного изобретения было проведено сравнительное клиническое исследование, в котором пациенты с СРК (n=34) методом случайной выборки были поделены на 2 группы.

Первая группа пациентов (16 человек) получала персонифицированную терапию по заявленному изобретению. Пациенты принимали молочнокислый продукт, содержащий 108 КОЕ/мл аутоштамма Lactobacillus sp., в дозе 100 мл/сутки - по 50 мл 2 раза в день через 30-40 минут после еды в течение 10 дней.

Вторая группа пациентов (18 человек) получала терапию пробиотиком, содержащим промышленный штамм Lactobacillus sp.в виде молочнокислой закваски в титре 10 КОЕ/мл в дозе 100 мл/сутки - по 50 мл 2 раза в день через 30-40 минут после еды в течение 10 дней.

В исследовании применялись следующие методы:

1. Клинический.

Полуколичественно (с помощью баллирования) оценивались клинические симптомы СРК:

- выраженность боли в животе: 0 - отсутствие боли, 1 - слабые болевые ощущения, 2 - умеренная боль, 3 - сильная боль;

- общее самочувствие: 1 - плохое, 2 - удовлетворительное, 3 - хорошее;

- метеоризм: 0 - отсутствует, 1 - легкий, 2 - умеренный, 3 - выраженный.

Оценивалась частота стула (количество дефекаций в сутки) и форма стула по Бристольской шкале.

2. Лабораторный.

- Биохимическое исследование крови (при помощи биохимического полностью автоматического анализатора Aeroset Toshiba, США). Определяли следующие показатели: АЛТ, ACT, амилаза, креатинин, холестерин, гаммаглютаминтранспептидаза, глюкоза, железо, билирубин, белок.

- Клинический анализ крови.

3. Микробиологический.

Исследование микробиоты кишечника, выделение чистой культуры и идентификация лактобацилл, получение молочнокислых заквасок на основе монокультур (аутоштаммов) Lactobacillus spp.

Схема обследования представлена в таблице 2.

Таблица 2.
Схема обследования пациентов с СРК
Вид исследований Сроки проведения исследования
Клиническое наблюдение Наблюдения с первого дня использования молочнокислой закваски в течение 10 дней
Клинический анализ крови Первый и 11-й день получения молочнокислой закваски
Биохимический анализ сыворотки крови Первый и 11-й день получения молочнокислой закваски
Анализ кала на дисбиоз До получения закваски (10 дней) и после окончания ее введения

Статистическая обработка данных производилась с использованием программы STATISTICA 8.0.

Результаты исследования

Значимых отклонений от нормальных значений при лабораторном обследовании испытуемых выявлено не было. Статистически достоверных различий биохимических показателей и показателей гемограммы до лечения и после лечения в обеих группах наблюдения и между группами лечения выявлено не было (табл.3, 4).

Таблица 3
Динамика показателей гемограммы в группах наблюдения
Показатель Группа лактобацилл (N=14) Группа аутопробиотика (N=10) p
До лечения После лечения До лечения После лечения
Гемоглобин, г/л 138,63±24,53 137,27±24,71 143,44±7,92 144,38±9,30 >0,5
Эритроциты, 109 4,95±0,63 4,82±0,64 4,79±0,22 4,89±0,23 >0,5
Лейкоциты, 109 6,22±1,74 5,89±1,30 6,57±1,41 6,24±1,36 >0,5
Нейтрофилы, 10% 3,20±1,10 3,12±0,92 3,40±0,81 3,26±0,65 >0,5
Палочкоядерные, % 2,64±0,67 2,36±1,57 2,13±1,13 2,42±0,98 >0,5
Сегментоядерные, % 49,45±5,28 51,82±6,26 51,25±3,92 50,43±5,88 >0,5
Лимфоциты, % 35,18±6,43 33,00±4,73 35,13±4,45 34,88±3,72 >0,5
Эозинофилы, % 2,64±1,75 2,27±1,19 1,46±1,22 2,38±2,33 >0,5
Базофилы, % 0,18±0,40 0,45±0,52 0,26±0,43 0,13±0,35 >0,5
Тромбоциты, 109 285,91±121,68 288,55±109,14 231,67±35,43 225,13±32,56 >0,5
СОЭ, мм/ч 9,36±8,37 10,0±7,68 5,56±2,40 6,50±3,96 >0,5
Таблица 4
Динамика биохимических показателей плазмы в группах наблюдения
Показатель Группа лактобацилл Группа аутопробиотика p
До лечения После лечения До лечения После лечения
Амилаза, U/L 66,31±17,18 85,48±38,17 64,20±26,55 61,79±25,11 >0,5
АЛТ, U/L 26,75±14,41 26,17±20,07 22,60±11,70 21,26±9,85 >0,5
ACT, U/L 35,70±23,30 35,18±16,66 28,32±12,68 31,88±15,15 >0,5
Креатинин, mmo1/1 64,80±14,17 64,56±14,38 62,31±9,02 62,83±8,93 >0,5
Холестерин, mmo1/1 5,05±1,06 5,22±1,11 5,41±1,63 5,68±1,68 >0,5
ГГТП, U/L 32,69±18,45 27,59±14,37 23,87±14,91 25,23±17,42 >0,5
Глюкоза, mmo1/1 5,04±0,67 5,28±0,58 5,24±0,59 5,24±0,80 >0,5
Железо, мкмоль/л 20,34±5,65 15,79±7,75 18,39±8,79 18,31±6,15 >0,5
Билирубин, mmo1/1 9,68±3,08 7,99±3,06 9,48±5,85 8,96±4,59 >0,5
Белок, г/л 74,49±5,45 73,67±5,49 73,94±3,36 73,79±3,85 >0,5

При анализе динамики клинических проявлений СРК после курса пробиотической терапии было отмечено достоверное улучшение состояния больных как в группе аутопробиотической терапии, так и в группе получавших биотехнологические штаммы лактобацилл (табл.5).

Таблица 5
Динамика клинических показателей в группах наблюдения
Показатель, баллы Группа лактобацилл Группа аутопробиотика p между группами
До лечения После лечения До лечения После лечения
Боль в животе 2,09±0,30 0,91±0,70** 1,89±0,93 1,00±0,87* >0,5
Частота стула 2,41±1,02 1,57±0,99 2,61±1,32 1,33±0,83* >0,5
Форма стула 5,40±1,09 4,00±1,00* 5,67±1,41 3,11±0,78** <0,01
Метеоризм 2,64±0,50 2,00±0,45* 2,54±0,73 0,89±0,60** <0,001
Общее самочувствие 1,82±0,40 2,36±0,67* 1,89±0,33 2,62±0,44* >0,5

Достоверно уменьшилась выраженность болевого синдрома, выраженность метеоризма, изменилась форма стула к более плотной консистенции в обеих группах наблюдения. В группе получавших молочнокислую закваску с аутолактобациллами достоверно уменьшилась частота стула.

При проведения сравнительного анализа выраженности клинических проявлений СРК после курса терапии выявлено, в группе пациентов, получавших аутопробиотик, достоверно меньше был выражен метеоризм и достоверно более плотная консистенция стула.

Таким образом, предложенный способ лечения пациентов с СРК с применением пробиотика на основе аутоштамма Lactobacillus spp позволяет достоверно уменьшить выраженность клинических проявлений заболевания и улучшить состояние больного в сравнении с терапией пробиотиками на основе промышленных штаммов того же микроорганизма.

Использованные источники информации

1. Ручкина И.Н., Парфенов А.И., Осипов А.Г. Особенности комплексной терапии постинфекционного синдрома раздраженного кишечника // Гастроэнтерология Санкт-Петербурга. 2007. №1-2. С.94.

2. Симаненков В.И., Лутаенко Е.А. Лечение синдрома раздраженной толстой кишки с позиций доказательной медицины. - Санкт-Петербург, 2009. - 108 стр.

3. Gade J, Thorn P. Paraghurt for patients with irritable bowel syndrome: a controlled clinical investigation from general practice. Scand J Prim Health Care 1989;7:23-26.

4. Nobaek S, Johansson ML, Molin G, et al. Alteration of intestinal microflora is associated with reduction in abdominal bloating and pain in patients with irritable bowel syndrome. Am J Ga-stroenterol 2000;95:1231-38.

5. O'Sullivan MA, O'Morain CA. Bacterial supplementation in the irritable bowel syndrome: a randomized double-blind placebo-controlled crossover study. Dig Liver Dis 2000;32:294-301

6. Halpern G.M., Prindiville Т., Blankenburg M., Hsia T. Treatment of irritable bowel syndrome with Lacteol Fort: a randomized, double-blind, cross-over trial. Am. J. Gastroenterology 1996; 91: 1579-85

7. Tack J, Fried M, Houghton LA et al. Systematic review: the efficacy of treatments for irritable bowel syndrome - a European perspective. Aliment Pharmacol Ther 2006; 24: 183-205

8. Quigley EM. The use of probiotics in functional bowel disease. Gastroenterol Clin North Am 2005; 34: 533^15

9. Guyonnet D, Chassany O, Ducrotte P et al. Effect of a fermented milk containing Bifidobacterium animalis dn-173 010 on the health-related quality of life and symptoms in irritable bowel syndrome in adults in primary care: a multicentre, randomized, double-blind, controlled trial. Aliment Pharmacol Ther 2005; 26: 475-86

10. Суворов A.H. Применение пробиотиков для профилактики и лечения различных заболеваний. - Санкт-Петербург, 2004. - 32 с.

11. Ушкалова Е.А. Роль пробиотиков в гастроэнтерологии // Фарматека. 2007. №6. С.16-23.

12. Шендеров Б.А. Медицинская микробная экология и функциональное питание. Том I: Микрофлора человека и животных и ее функции. М.: ГРАНТЪ, 1998

13. Шендеров Б.А. «Медицинская микробная экология и функциональное питание», Том III, Москва, 2001 г.

14. Суворов А.Н., Симаненков В.И. и др. Способ получения пробиотического продукта, содержащего аутоштаммы Enterococcus faecium, представителя индигенной микрофлоры кишечника хозяина, патент на изобретение RU 2460778 С1, опубликовано 10.09.2012 (Прототип к п.1 формулы)

15. Коллинз Д.К., О′ Салливан Д.К., О′ Махони Л. Пробиотический штамм Lactobacillus salivarius (варианты), пробиотический препарат на их основе и способ лечения и предупреждения с использованием штаммов Lactobacillus salivarius. Патент на изобретение RU 2302458 С2, опубликовано 10.05.2005 (Прототип к п.2 формулы).

1. Способ получения персонифицированного аутопробиотического продукта в виде молочнокислой закваски на основе аутоштаммов лактобактерий, характеризующийся забором пробы нативного материала, посевом бактерий из фекалий пациента на селективную питательную среду и выращиванием культуры в селективной питательной среде, идентификацией и отбором типичных для лактобактерий колоний, получением чистой культуры, уточнением видовой принадлежности с использованием полимеразной цепной реакции, ее депонированием в криохранилище при температуре не выше -75°С со сроком хранения не более 1 года и приготовлением из полученной культуры молочнокислой закваски, отличающийся тем, что в качестве лактобактерий используют аутоштаммы Lactobacillus spp, полимеразную цепную реакцию используют после отбора типичных для лактобактерий колоний для выделения штаммов, пригодных в качестве пробиотиков, с использованием праймеров gaaactttgtttagttttgag, tgacttgtacacaccgcccgt, ctagcgtccaacaaatcaccc, gattcaagtttgaaaggcggc, gtaaatctgttagttccgctcgct, aagcagatcgcatgatcagct, agttgagtttctctctcttctcg, tcccaagtagcggcgagcga, ccatgttgaatctcggtgc, ctaataccgcatagatccaagaacc, caaaattaaatcaagatgcaagca, gcattcggtgtaagaaagtttcg, tcatgatgcaagcaccaatcaatac, tagttttgagagatttaact, aacaatgacttgagcatccctt, tccaaaactgctttgagtagga, ccaagttacctaaaccaccagc, taagcttcatgtcaccttgtgg, tatcactgtggtcttggcaaac, gttagtcatggcgaggatcttt, tcgtcatcgtcaataatccgta, gtatcacgatttgctgctttca, ttaaсgcgtggtaaggtgattc, cctgtccatcggctaattcata, tcaaaaccaatgtcaaatgcat, cagcacttggaatacgaacaag, atttcttggatcgccttcaaat, tgaacgcatttcaagacgagta, сконструированных на основании специфицеских последовательностей, соответствующих генам, кодирующим белки, специфичных для определенных видов лактобацилл, а молочнокислую закваску готовят из чистой культуры полученных штаммов с содержанием в ней не менее 1×108 KOE/мл.

2. Способ лечения синдрома раздраженной кишки, сопровождающегося дисбиозом кишечника, включающий прием полученного по п. 1 персонифицированного аутопробиотического продукта, который назначают в дозе не менее 50 мл с кратностью приема не менее 2 раз в сутки через 30-40 минут после еды в течение не менее 10 дней.



 

Похожие патенты:

Предложенная группа изобретений относится к области медицины. Предложен способ прогнозирования у пациента с влажной возрастной дегенерацией желтого пятна (AMD) повышенной вероятности эффекта от лечения высокоаффинным антителом против VEGF, в частности ранибизумабом.

Настоящее изобретение относится к биотехнологии и представляет собой мутантные варианты рекомбинантной L-аспарагиназы, характеризующиеся аминокислотной последовательностью, соответствующей аминокислотной последовательности L-аспарагиназы бактерий Wolinella succinogenes, в которой аминокислотный остаток лизина в положении 24 заменен на остаток серина либо аминокислотный остаток валина в положении 23 заменен на остаток глутамина, а аминокислотный остаток лизина в положении 24 заменен на остаток треонина.

Изобретение относится к области биохимии. Заявлен набор олигонуклеотидных праймеров для амплификации участка генома патогенных буркхольдерий, последовательность которого гомологична фрагменту генома В.

Изобретение относится к области биохимии. Заявлен набор олигонуклеотидных праймеров для амплификации участка генома патогенных буркхольдерий, последовательность которого гомологична фрагменту генома В.

Заявленная группа изобретений относится к области биологии, в частности к оборудованию для автоматической очистки биологических образцов при выделении целевых веществ из множества биологических образцов, для автоматической очистки биологического образца, оснащенное элементом для приложения магнитного поля, в котором элемент для приложения магнитного поля для очистки биологических образцов и нагревательный элемент сформированы в виде единого компонента друг с другом так, чтобы быть подвижными вверх и вниз.

Группа изобретений относится к области биотехнологии. Способ выбора пищевого рациона предусматривает определение пищевого рациона или вещества, которые повышают количество микроРНК, присутствующее в молоке млекопитающего, используя корреляцию профилей микроРНК в молоке и пищевом рационе, полученном млекопитающим, или веществе, содержащемся в пищевом рационе, в качестве индекса.

Изобретение относится к генетике, медицине и молекулярной биологии. Предложен способ неинвазивной диагностики анеуплоидий плода на основе использования геномных библиотек.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации риновирусов человека видов А, В и С, методом ПЦР в реальном времени, содержащему два прямых и два обратных олигодезоксирибонуклеотидных праймера и два флуоресцентно-меченых ДНК-зонда.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации РНК метапневмовируса человека методом ПЦР в реальном времени, содержащему четыре прямых олигодезоксирибонуклеотидных праймера и два обратных олигодезоксирибонуклеотидных праймера, а также два флуоресцентно-меченых ДНК-зонда.

Изобретение относится к области биотехнологии и вирусологи. Предложен набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации РНК энтеровирусов, риновирусов, вирусов гепатита А и Е в образцах воды из окружающей среды методом мультиплексной ПЦР.

Группа изобретений относится к биотехнологии. Предложен штамм Bifidobacterium longum NCIMB 41676, обладающий иммуномодулирующим действием.

Группа изобретений относится к биотехнологии и сельскому хозяйству. Предложены соединения A-87774, представленные соединениями A-87774-1, A-87774-2, A-87774-3 или их солью, способ получения соединений A-87774, штамм Streptomyces sp.

Изобретение относится к области сельскохозяйственной микробиологии и может быть использовано для получения биопрепаратов. Штамм Serratia ficaria TP депонирован во Всероссийской Коллекции Промышленных Микроорганизмов (ВКПМ) под регистрационным номером ВКПМ В-11403 и обладает выраженными антагонистическими, фитостимулирующими и фунгицидными свойствами по отношению к фитопатогенным грибам.

Способ получения питательной основы микробиологических сред относится к биотехнологии. Способ предназначен для получения основы для приготовления микробиологических питательных сред из сырья морского генеза и может быть использован в медицинской и технической микробиологии, в научно-исследовательской и практической работе для выделения и культивирования микроорганизмов. В способе получают щелочной гидролизат из моллюсков и соединяют с кислотным гидролизатом из рыбного сырья в соотношении 1:3-3:1, чтобы количество аминного азота была в пределах 600-900 мг %.
Изобретение относится к области биохимии, в частности к бескапсульному природно-ослабленному штамму Bacillus anthracis. Штамм В.

Изобретение относится к биотехнологии и может быть использовано в качестве закваски прямого внесения для приготовления пробиотической сметаны. Способ включает приготовление питательной среды, в которую дополнительно вносят селенит натрия в количестве 30-50 мкг/мл, стерилизацию и охлаждение до 35°С.

Группа изобретений касается применения живых бактерий, которые относятся к группе нокардиоформных актиномицетов для получения фармацевтической композиции и способа использования такой композиции.

Изобретение относится к применению препарата, содержащего штамм Bifidobacterium breve и смесь двух растворимых углеводных компонентов А и В для изготовления композиции для профилактики или лечения раздражения кожи от пеленок у детей.

Изобретение относится к биотехнологии и к сельскохозяйственной микробиологии. Способ предусматривает предпосевную обработку семян, пролив почвы и обработку вегетативных частей растений культуральной жидкостью штамма Lactobacillus plantarum 60-ДЕП, депонированного во Всероссийской государственной коллекции штаммов микроорганизмов, используемых в ветеринарии и животноводстве, с титром 106 KOE/мл при расходе 5-30 мл на 100 мл воды.

Изобретение относится к биотехнологии и может быть использовано для очистки промышленных сточных вод машиностроительных, приборостроительных, электротехнических предприятий от повышенных концентраций ионов меди и других тяжелых металлов.

Группа изобретений относится к биотехнологии. Предложен штамм Bifidobacterium longum NCIMB 41676, обладающий иммуномодулирующим действием.

Группа изобретений относится к биотехнологии. Предложен способ получения персонифицированного аутопробиотического продукта в виде молочнокислой закваски на основе аутоштаммов лактобактерий и способ лечения синдрома раздраженной кишки, сопровождающегося дисбиозом кишечника, с его использованием. Указанный продукт получают забором пробы нативного материала, посевом и выращивание бактерий из фекалий пациента на селективной питательной среде, идентификацией и отбором типичных для лактобактерий колоний, получением чистой культуры, уточнением видовой принадлежности с использованием ПЦР, ее депонированием в криохранилище при температуре не выше -75оС со сроком хранения не более 1 года и приготовлением из полученной культуры молочнокислой закваски. В качестве лактобактерий используют аутоштаммы Lactobacillus spp. Для ПЦР используют специфичные для определенных видов лактобацилл праймеры. Молочнокислую закваску готовят из чистой культуры полученных штаммов с титром не менее 1×108 KOEмл. Полученный продукт назначают субъекту в дозе не менее 50 мл с кратностью приема не менее 2 раз в сутки через 30-40 мин после еды в течение не менее 10 дней. Группа изобретений позволяет повысить длительность стойкого лечения и его эффективность. 2 н.п. ф-лы, 5 табл.

Наверх