Олигонуклеотидные праймеры burk0090s/burk0090as для оценки адаптационной изменчивости генома патогенных буркхольдерий

Изобретение относится к области биохимии. Заявлен набор олигонуклеотидных праймеров для амплификации участка генома патогенных буркхольдерий, последовательность которого гомологична фрагменту генома В. mallei ВМАА0090, для выявления с помощью секвенирования изменения количества тандемных повторов ДНК штаммов возбудителей сапа и мелиоидоза. Изобретение позволяет выявлять изменения генома штаммов возбудителей сапа и мелиоидоза, культивированных при различных условиях на питательных средах и пассированных на лабораторных животных. 2 ил., 2 пр.

 

Изобретение относится к биотехнологии, молекулярной биологии и может быть использовано для научных исследований при изучении адаптационной изменчивости генома штаммов возбудителей сапа и мелиоидоза, культивированных при различных условиях на питательных средах и пассированных на лабораторных животных.

Возбудитель сапа {Burkholderia mallei} и возбудитель мелиоидоза (Bzirkholderia pseudomallei) - аэробные грамотрицательные неферментирующие бактерии, принадлежащие к роду Burkholderia. Мелиоидоз - эндемичное для Австралии и ряда стран Юго-Восточной Азии инфекционное заболевание людей и животных. Caп - особо опасная зоонозная инфекция. При этом штаммы патогенных буркхольдерий, пассированные в организме млекопитающих, как правило, обладают более высокой вирулентностью по сравнению с культивированными на питательных средах.

Метод полимеразной цепной реакции (ПЦР) является прямым методом выявления определенных фрагментов ДНК и обладает высокой специфичностью и чувствительностью. В основе метода ПЦР лежит природный процесс репликации ДНК - комплементарное достраивание ДНК матрицы, осуществляемое с помощью фермента ДНК-полимеразы.

Процесс удвоения нуклеиновых кислот можно использовать для получения копий коротких участков ДНК, специфичных для конкретных фрагментов генома микроорганизмов, т.е. осуществлять целенаправленный поиск определенных локусов. В данном случае искомым фрагментом ДНК является гипервариабельный участок генома возбудителей сапа и мелиоидоза, нуклеотидная последовательность которого изменяется после пассажей в организме млекопитающих.

Для эффективного проведения ПЦР необходимы праймеры - синтетические олигонуклеотиды определенного размера с заданной последовательностью. Праймеры комплементарны последовательностям ДНК на левой и правой границах специфического фрагмента и ориентированы таким образом, что достраивание новой цепи ДНК протекает только между ними. В результате ПЦР происходит многократное увеличение числа копий (амплификация) специфического участка гена, катализируемое ферментом ДНК-полимеразой. Выбор специфического фрагмента и подбор праймеров играет важнейшую роль в специфичности проведения амплификации, что сказывается на качестве проведения анализа.

Наиболее близким аналогом являются специфичные праймеры, фланкирующие тандемные повторы В. pseudomallei, предложенные J.M. U'Ren с соавторами в 2007 г. [Tandem repeat regions within the Burkholderia pseudomallei genome and their application for high resolution genotyping. JM U'Ren, JM Schupp, Т Pearson, H Hornstra, CL Friedman, KL Smith, RR Daugherty, SD Rhoton, В Leadem, S Georgia, M Cardon, LY Huynh, D DeShazer, SP Harvey, R Robison, D Gal, MJ Mayo, D Wagner, BJ Currie, and P Keim. BMC Microbiol, Jan 2007; 7: 23] Однако данные праймеры и фланкируемые ими тандемные повторы обеспечивают только внутривидовую дифференциацию В. pseudomallei и не выявляют различий генома у штаммов, культивированных при различных условиях на питательных средах и пассированных на лабораторных животных.

Целью настоящего изобретения является получение высокоспецифичных праймеров для амплификации фрагмента генома В. mallei и В. pseudomallei, последовательность которого изменяется при различных условиях культивирования и после пассажей в организме млекопитающих.

Цель достигается конструированием специфичных олигонуклеотидов, фланкирующих гипервариабельный локус ДНК возбудителей сапа и мелиоидоза ВМАА0090 (В. mallei ATCC 23344), обладающих активностью прямого и обратного праймеров в реакции амплификации и имеющих следующую структуру:

5'- АТС GCA АТС GGC АТТ ТСС АСС С - 3'- Burk0090s;

5'- GTG GCG GAG ACG ACG GTG С - 3'- Burk0090as.

Характеристика олигонуклеотидных праймеров и участка амплифицируемой ДНК.

Основываясь на данных, представленных в базе GenBank NCBI (National Center for Biotechnology Information, США), были подобраны праймеры, обозначенные Burk0090s/Burk0090as, комплементарные гипервариабельному фрагменту ВМАА0090 В. mallei и В. pseudomallei и фланкирующие локус, содержащий различное количество тандемных повторов, кратных 9 парам оснований. Расчетная длина специфического фрагмента составляла 692 п.н.

Эксперименты проводили на музейных штаммах В. mallei и В. pseudomallei (из коллекционного центра музея живых культур ФКУЗ Волгоградский научно-исследовательский противочумный институт Роспотребнадзора) как исходных, так и выделенных из экспериментально зараженных животных (белые мыши) на 4-е и 20-е сутки заражения.

После проведения ПЦР полученные ампликоны были секвенированы и проанализированы с использованием специализированного программного обеспечения. В результате проведенного исследования установлено, что после пассажей на экспериментально зараженных животных, в локусе ВМАА0090 ДНК возбудителей сапа и мелиоидоза, с помощью праймеров Burk0090s/Burk0090as, выявляется делеция, соответствующая одному нуклеотидному повтору (рис.2).

Примеры конкретного выполнения.

Пример 1. Методика конструирования олигонуклеотидных праймеров для изучения адаптационной изменчивости генома возбудителей сапа и мелиоидоза.

На основе теоретического изучения секвенированных нуклеотидных последовательностей возбудителей сапа и мелиоидоза, присутствующих в базах данных сети Интернет (EMBL, Genbank, DDBJ), для конструирования праймеров была выбрана последовательность локуса ВМАА0090 В. mallei АТСС 23344, размер которого составляет 1755 п.н. Данный локус кодирует гипотетический липопротеин и содержит в своем составе тандемные повторы из 9 пар оснований. Аналогичная последовательность нуклеотидов обнаружена также в геноме В. pseudomallei. Расчетная длина фрагмента ДНК, фланкируемого предлагаемыми праймерами - 692 п.н.

При подборе праймеров руководствовались общими требованиями к олигонуклеотидным затравкам, используемым в ГЩР. При использовании компьютерных программ была проанализирована структура выбранных пар праймеров на предмет образования димеров, шпилек и других вторичных структур и показана их теоретическая пригодность для успешной инициации реакции амплификации.

Пример 2. Амплификация специфических фрагментов ДНК с помощью разработанных праймеров для изучения адаптационной изменчивости генома патогенных буркхольдерий.

В состав реакционных смесей, помимо анализируемой ДНК, входили праймеры Burk0090s/Burk0090as, дезоксирибонуклеозидтрифосфаты, буферный раствор и фермент Taq-полимераза. Для предупреждения испарения в процессе амплификации на мультициклере «Терцик» на поверхность смеси наслаивали 20 мкл минерального масла.

Амплификацию продолжительностью 40 циклов (денатурация ДНК при 94°С - 30 с, отжиг праймеров 67°С - 30 с, элонгация цепи при 72°С - 45 с) проводили в микроцентрифужных пробирках (0,5 мл) на мультициклере «Терцик» в объеме 25 мкл с использованием «горячего старта», который осуществлялся разделением нуклеотидов и праймеров от ДНК-пробы и Taq-полимеразы прослойкой воска.

После этого продукты реакции разделяли при помощи электрофореза в 3% агарозном геле, сравнивая его подвижность с подвижностью полос маркеров молекулярного веса. При использовании разработанного набора праймеров в реакции амплификации с ДНК возбудителей сапа и мелиоидоза синтезируемые ампликоны по электрофоретической подвижности соответствовали расчетным данным у штаммов, культивируемых на питательных средах, и имели небольшие различия у штаммов, пассированных на лабораторных животных. На рисунке 1 изображена электрофореграмма продуктов амплификации вариабельного фрагмента локуса ВМАА0090 патогенных буркхольдерий с помощью праймеров Burk0090s/Burk0090as, где дорожки 1 и 3 - исходные штаммы В. pseudomallei, a 2 и 4 - выделенные после пассажей на лабораторных животных. Пятая дорожка электрофореграммы представляет собой маркер молекулярных размеров (леддер 100-1000 п.н.). Это подтверждает дифференцирующую способность сконструированных олигонуклеотидов при изучении адаптационной изменчивости генома В. mallei и В. pseudomallei.

С целью установления генетических изменений, происходящих в вариабельном локусе ВМАА0090, провели секвенирование амплифицированных фрагментов ДНК штаммов возбудителей сапа и мелиоидоза. Для сравнения полученных нуклеотидных последовательностей использовали фрагменты генов штаммов В. mallei ATCC 23344 и В. pseudomallei K96243 из базы данных GeneBank.

Реакцию секвенирования осуществляли при помощи набора BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies, США) в объеме 10 мкл на амплификаторе GeneAmp PCR System 2700 (Life Technologies, США). Неинкорпорированные дНТФ удаляли переосаждением этанолом. Учет результатов проводили при помощи генетического анализатора ABI Prism 3130. Анализ полученных последовательностей осуществляли при помощи программного пакета UGENE v1.11.5 (Unipro, Россия).

В результате проведенного анализа секвенированных последовательностей локуса ВМАА0090 у штаммов возбудителей сапа и мелиоидоза, пассированных на лабораторных животных, обнаружена делеция, соответствующая одному тандемному повтору (рис.2).

Таким образом, использование разработанных праймеров позволяет выявлять изменения генома штаммов возбудителей сапа и мелиоидоза, культивированных при различных условиях на питательных средах и пассированных на лабораторных животных.

Набор олигонуклеотидных праймеров, позволяющих амплифицировать участок генома патогенных буркхольдерий, последовательность которого гомологична фрагменту генома В. mallei ВМАА0090, для выявления с помощью секвенирования изменения количества тандемных повторов ДНК штаммов возбудителей сапа и мелиоидоза, имеющих следующую структуру:

5' - АТС GCA АТС GGC АТТ ТСС АСС С - 3' Burk0090s
5' - GTG GCG GAG ACG ACG GTG С - 3' Burk0090as



 

Похожие патенты:

Заявленная группа изобретений относится к области биологии, в частности к оборудованию для автоматической очистки биологических образцов при выделении целевых веществ из множества биологических образцов, для автоматической очистки биологического образца, оснащенное элементом для приложения магнитного поля, в котором элемент для приложения магнитного поля для очистки биологических образцов и нагревательный элемент сформированы в виде единого компонента друг с другом так, чтобы быть подвижными вверх и вниз.

Группа изобретений относится к области биотехнологии. Способ выбора пищевого рациона предусматривает определение пищевого рациона или вещества, которые повышают количество микроРНК, присутствующее в молоке млекопитающего, используя корреляцию профилей микроРНК в молоке и пищевом рационе, полученном млекопитающим, или веществе, содержащемся в пищевом рационе, в качестве индекса.

Изобретение относится к генетике, медицине и молекулярной биологии. Предложен способ неинвазивной диагностики анеуплоидий плода на основе использования геномных библиотек.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации риновирусов человека видов А, В и С, методом ПЦР в реальном времени, содержащему два прямых и два обратных олигодезоксирибонуклеотидных праймера и два флуоресцентно-меченых ДНК-зонда.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации РНК метапневмовируса человека методом ПЦР в реальном времени, содержащему четыре прямых олигодезоксирибонуклеотидных праймера и два обратных олигодезоксирибонуклеотидных праймера, а также два флуоресцентно-меченых ДНК-зонда.

Изобретение относится к области биотехнологии и вирусологи. Предложен набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации РНК энтеровирусов, риновирусов, вирусов гепатита А и Е в образцах воды из окружающей среды методом мультиплексной ПЦР.

Группа изобретений касается дискриминирующего мишень зонда (TD-зонду), способа его конструирования и способов детекции нуклеиновокислотной последовательности-мишени с его использованием.

Изобретение относится к области биотехнологии и микробиологии. Предложен способ количественного определения видового состава пропионовых бактерий, обитающих на коже человека.

Группа изобретений относится к области биотехнологии, в частности к автоматическому устройству и способу очистки и выделения целевой нуклеиновой кислоты из биологического образца, причем устройство обеспечивает возможность предотвратить загрязнение выделенной целевой нуклеиновой кислоты от аэрозоля и которое может быть применено ко всем видам оборудования выделения и очистки нуклеиновых кислот из множества биологических образцов, использующего магнитный стержень или мультипипеточный блок, движущийся в двух или трех осевых направлениях.

Изобретение относится к области биохимии, в частности к набору реагентов и способу для выявления ДНК возбудителей чумы, сибирской язвы и туляремии. Набор содержит шесть видоспецифичных олигонуклеотидных праймеров и три зонда, комплементарных фрагментам ДНК генов Yersinia pestis, Bacillus anthracis и Francisella tularensis.

Изобретение относится к области биохимии. Заявлен набор олигонуклеотидных праймеров для амплификации участка генома патогенных буркхольдерий, последовательность которого гомологична фрагменту генома В. mallei ВМАА1526, для выявления с помощью секвенирования изменения количества тандемных повторов ДНК штаммов возбудителей сапа и мелиоидоза. Изобретение позволяет выявлять изменения генома штаммов возбудителей сапа и мелиоидоза, культивированных при различных условиях на питательных средах и пассированных на лабораторных животных. 2 ил., 2 пр.

Настоящее изобретение относится к биотехнологии и представляет собой мутантные варианты рекомбинантной L-аспарагиназы, характеризующиеся аминокислотной последовательностью, соответствующей аминокислотной последовательности L-аспарагиназы бактерий Wolinella succinogenes, в которой аминокислотный остаток лизина в положении 24 заменен на остаток серина либо аминокислотный остаток валина в положении 23 заменен на остаток глутамина, а аминокислотный остаток лизина в положении 24 заменен на остаток треонина. Изобретение позволяет получить варианты L-аспарагиназы с улучшенной устойчивостью к протеолизу под действием трипсина по сравнению с немодифицированным рекомбинантным белком и различным уровнем глутаминазной активности при полном сохранении аспарагиназной активности, что делает их привлекательными объектами для разработки на их основе новых противоопухолевых терапевтических препаратов. 2 н.п. ф-лы, 1 ил., 1 табл., 11 пр.

Предложенная группа изобретений относится к области медицины. Предложен способ прогнозирования у пациента с влажной возрастной дегенерацией желтого пятна (AMD) повышенной вероятности эффекта от лечения высокоаффинным антителом против VEGF, в частности ранибизумабом. Предложен набор, содержащий первый олигонуклеотид и дополнительные олигонуклеотиды, специфичные для аллелей полиморфизма гена матриксной металлопротеазы 25 (ММР25), соответствующего rs1064875. Если соответствующий генотип содержит АА или AG, у пациента прогнозируют повышенную вероятность эффекта от указанного лечения. Предложенная группа изобретений обеспечивает эффективные средства и методы для прогнозирования у пациента с влажной AMD повышенной вероятности получения эффекта от лечения высокоаффинным антителом против VEGF. 2 н. и 7 з.п. ф-лы, 1 ил., 5 табл., 1 пр.

Группа изобретений относится к биотехнологии. Предложен способ получения персонифицированного аутопробиотического продукта в виде молочнокислой закваски на основе аутоштаммов лактобактерий и способ лечения синдрома раздраженной кишки, сопровождающегося дисбиозом кишечника, с его использованием. Указанный продукт получают забором пробы нативного материала, посевом и выращивание бактерий из фекалий пациента на селективной питательной среде, идентификацией и отбором типичных для лактобактерий колоний, получением чистой культуры, уточнением видовой принадлежности с использованием ПЦР, ее депонированием в криохранилище при температуре не выше -75оС со сроком хранения не более 1 года и приготовлением из полученной культуры молочнокислой закваски. В качестве лактобактерий используют аутоштаммы Lactobacillus spp. Для ПЦР используют специфичные для определенных видов лактобацилл праймеры. Молочнокислую закваску готовят из чистой культуры полученных штаммов с титром не менее 1×108 KOE/мл. Полученный продукт назначают субъекту в дозе не менее 50 мл с кратностью приема не менее 2 раз в сутки через 30-40 мин после еды в течение не менее 10 дней. Группа изобретений позволяет повысить длительность стойкого лечения и его эффективность. 2 н.п. ф-лы, 5 табл.

Изобретение относится к области биотехнологии, вирусологии и иммунологии. В частности, настоящее изобретение относится к новому птичьему астровирусу; к антителам и их фрагментам, направленным против указанного нового вируса; к антигенным препаратам, белкам и ДНК-молекулам нового птичьего астровируса; к вакцинам на основе указанного нового вируса или к его антигенным препаратам, белку или ДНК; к способам получения таких вакцин и к диагностическим наборам. Настоящее изобретение может быть использовано в ветеринарии. 8 н. и 3 з.п. ф-лы, 5 ил., 4 табл., 12 пр.

Группа изобретений относится к многоканальным устройствам, модифицированным нанослоями анилинсодержащих полимеров. Предложен многоканальный наконечник для выделения нуклеиновых кислот, белков, пептидов и способ изготовления многоканального элемента, входящего в состав многоканального наконечника. Наконечник состоит из стеклянного гексагонального многоканального массива, включающего многоканальные элементы из множества параллельных капилляров. На внутренней поверхности капилляров нанесен сорбционный слой, который состоит из от одного до трех полимерных нанослоев. Многоканальный элемент выполнен с защитным обрамлением из нескольких рядов стеклянных стержней. Стеклянный гексагональный многоканальный массив состоит из уложенных многократно вытянутых единичных многоканальных элементов с диаметром капилляров от 1 мкм и более, рабочей поверхностью до 500 см2, объемом до 500 мкл. Способ изготовления многоканального элемента включает сборку стеклянных трубок в многоканальный пакет, закрепление одного его конца в захвате узла подачи, нагревание в печи другого конца с образованием луковицы и вытяжку до требуемого размера. В процессе формования для получения структур с диаметром канала порядка и меньше 1 мкм осуществляют многократную вытяжку многоканальных элементов, предварительно сформированных укладкой элементов шестигранной формы. Изобретения обеспечивают проведение экспресс-выделения и очистки как нуклеиновых кислот, так и белков, пептидов, а также обеспечивают высокую воспроизводимость результатов. 2 н. и 3 з.п. ф-лы, 6 ил., 3 табл., 9 пр.

Изобретение относится к области медицины, фтизиатрии и медицинской микробиологии и касается способа генотипирования штаммов Mycobacterium tuberculosis. Охарактеризованный способ основан на однонуклеотидном полиморфизме генов систем токсин-антитоксин II типа суперсемейств VapBC, HigAB и MazEF и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора олигонуклеотидных праймеров для 10 генов систем токсин-анатоксин. ПЦР продукты анализируют в агарозном геле, размер полученного фрагмента определяют с помощью ДНК-маркера, выделяют целевые фрагменты из ПЦР-смеси или агарозного геля и секвенируют их с целью обнаружения соответствующих полиморфизмов. Предложенное изобретение позволяет точно и быстро проводить генотипирование микобактерий в режиме ПЦР и может быть использовано для идентификации клинически значимых штаммов M. tuberculosis, в том числе с множественной и широкой лекарственной устойчивостью, а также с измененной вирулентностью при работе с пациентами. 1 ил., 3 табл., 5 пр.
Группа изобретений относится к области биотехнологии. Способ выявления генома вируса инфекционной анемии лошадей предусматривает постановку полимеразной цепной реакции, амплификацию ДНК вируса, оценку проведения реакции. При этом при выявлении вирусной РНК предварительно проводят реакцию денатурации и обратной транскрипции, а идентификацию проводят с помощью ОТ-ПЦР в реальном времени при выявлении РНК вируса ИНАН и ПЦР в реальном времени при выявлении пДНК вируса ИНАН. Для осуществления способа используют специфические праймеры и ДНК-зонд. При этом температурные режимы включают следующие этапы: 5 мин предварительной денатурации при 94°C, 5 циклов амплификации без детекции (94°C - 10 сек, 56°C - 15 сек, 72°C - 15 сек) и 35 циклов амплификации с детекцией (94°C - 10 сек, 56°C - 15 сек, 72°C - 15 сек). Интерпретацию результатов проводят на основании наличия/отсутствия пересечения кривой флуоресценции с пороговой линией (Threshold). Использование изобретений позволяет обнаружить РНК и пДНК вируса ИНАН с помощью ОТ-ПЦР в режиме реального времени, а также повысить специфичность и чувствительность способа. 2 н.п. ф-лы, 3 табл., 1 пр.

Настоящее изобретение относится к области биотехнологии, конкретно к предварительной оценке эффективности трансплантации аутологичного клеточного материала для стимуляции роста кровеносных сосудов, и может быть использовано в медицине. Предлагается способ комплексной оценки ангиогенного потенциала прогениторных клеток у больных сердечно-сосудистыми заболеваниями, апробированный на мезенхимальных стромальных клетках жировой ткани (МСК-ЖТ) пациентов с ишемической болезнью сердца и включающий в себя измерение содержания мРНК и белков основных ангиогенных факторов, продуцируемых прогениторными клетками, таких как фактор роста эндотелия сосудов (VEGF), плацентарный фактора роста (PlGF), фактор роста гепатоцитов (HGF), ангиопоэтин-1 и ангиогенин, ангиогенной активности суммарных продуктов секреции клеток, а также оценку способности прогениторных клеток стимулировать васкуляризацию подкожных имплантатов Матригеля, введенных иммунодефицитным мышам. В качестве скринингового метода используют более простой и доступный, но менее информативный метод экспресс-оценки ангиогенных свойств прогениторных клеток, основанный на измерении ангиогенной активности суммарных продуктов секреции. Изобретение позволяет проводить тестирование аутологичного клеточного материала, полученного от пациентов, в том числе с ишемической болезнью сердца, перед трансплантацией для выбора оптимальной тактики клеточной терапии с целью стимуляции роста кровеносных сосудов. 2 н.п. ф-лы, 2 ил., 4 табл., 4 пр.

Изобретение относится к области биотехнологии и может быть использовано для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ММР9-1562 C>Т (rs3918242). Способ основан на снятии кривых плавления с флуоресцентно-мечеными аллель-специфичными олигонуклеотидными пробами. В способе используют общую для всех аллелей пару праймеров, отличающиеся для каждого аллеля флуоресцентно-меченые аллель-специфичные олигонуклеотидные пробы и универсальный олигонуклеотид, меченый гасителем флуоресценции следующего нуклеотидного состава: MMP9-1562s CGAAACCAGCCTGGTCAACG; ММР9-1562а TCTGCCTCCCGGGTTCAAGC; ММР9-1562р1 GGCGCACGCCTATAA-FAM; ММР9-1562р2 GGCGCATGCCTATAA-HEX; ММР9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), где FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный краситель HEX, BHQ1 - означает присоединенный к 5'-концевому нуклеотиду темновой гаситель флуоресценции. Отнесение образца к гомозиготе или гетерозиготе по данному аллелю оценивается по форме кривых плавления ДНК - по максимуму первой производной графиков флуоресценции. Изобретение позволяет повысить надежность и доступность генотипирования. 1 ил.

Изобретение относится к области биохимии. Заявлен набор олигонуклеотидных праймеров для амплификации участка генома патогенных буркхольдерий, последовательность которого гомологична фрагменту генома В. mallei ВМАА0090, для выявления с помощью секвенирования изменения количества тандемных повторов ДНК штаммов возбудителей сапа и мелиоидоза. Изобретение позволяет выявлять изменения генома штаммов возбудителей сапа и мелиоидоза, культивированных при различных условиях на питательных средах и пассированных на лабораторных животных. 2 ил., 2 пр.

Наверх