Кормовая добавка с пробиотической активностью на минеральной основе



Кормовая добавка с пробиотической активностью на минеральной основе
Кормовая добавка с пробиотической активностью на минеральной основе
Кормовая добавка с пробиотической активностью на минеральной основе
Кормовая добавка с пробиотической активностью на минеральной основе
Кормовая добавка с пробиотической активностью на минеральной основе
Кормовая добавка с пробиотической активностью на минеральной основе
Кормовая добавка с пробиотической активностью на минеральной основе
Кормовая добавка с пробиотической активностью на минеральной основе
Кормовая добавка с пробиотической активностью на минеральной основе
Кормовая добавка с пробиотической активностью на минеральной основе
Кормовая добавка с пробиотической активностью на минеральной основе
Кормовая добавка с пробиотической активностью на минеральной основе

 


Владельцы патента RU 2569002:

Общество с ограниченной ответственностью "БИОТРОФ" (RU)

Изобретение относится к сельскому хозяйству и биотехнологии, а именно к составу кормовой добавки с пробиотической активностью и может быть использовано при приготовлении кормов для сельскохозяйственных животных и птицы. Кормовая добавка состоит из жизнеспособных спор спорообразующих бактерий штамма Bacillus subtilis и наполнителя. В качестве штамма спорообразующих бактерий взят штамм бактерий Bacillus subtilis 111, депонированный во Всероссийской коллекции микроорганизмов института биохимии и физиологии микроорганизмов им. Г.К. Скрябина РАН (ИБФМ РАН) под регистрационным номером ВКМ В-2334 Д, хранящийся в коллекции микроорганизмов ООО «БИОТРОФ» и состоящий из жизнеспособных спор спорообразующих бактерий Bacillus subtilis 111 с титром 2·106-6·109 КОЕ/г. В качестве наполнителя используют диатомит в виде обожженной крошки. Жизнеспособные споры спорообразующих бактерий Bacillus subtilis 111 и диатомит в виде обожженной крошки берут в массовом соотношении как 1:10 соответственно. При этом кормовая добавка в составе корма взята при соотношении как 0,001:1. Скармливание кормовой добавки обеспечивает повышение усвояемости корма, подавляет развитие патогенных микроорганизмов и способствует формированию полезной микрофлоры в пищеварительном тракте, обеспечивает повышение продуктивности сельскохозяйственных животных и птицы. 11 табл., 4 пр.

 

Изобретение относится к сельскохозяйственной биотехнологии, а именно к составу кормовой добавки с пробиотической активностью на минеральной основе и может быть использовано при приготовлении кормов для сельскохозяйственных животных и птицы.

Известен способ получения комплексной биологически активной кормовой добавки для осетровых рыб, заключающийся в том, что осуществляют раздельное глубинное культивирование штаммов Cellulomonas uda АТСС 491, Bacillus subtilis ВКПМ В-8130 и Bacillus subtilis ВКПМ В-2984 на питательных средах заданного состава, полученные культуры смешивают, проводят твердофазную ферментацию в условиях ограниченного доступа кислорода и высушивают до влажности 8-10%, RU №2506810 C1, А23К 1/165, 20.02.2014.

Известно использование штамма бактерий Bacillus subtilis для приготовления животных кормов и кормовых добавок, RU №2433738 C1, А23К 1/00, 20.11.2011; RU №2422506 C1, C12N 1/00, А23К 1/00, А23К 1/16, А23К 1/175, 27.06.2011.

Известны штаммы Bacillus subtilis с высоким уровнем продуцирования фитазы, зарегистрированные в DSMZ (Deutshe Sammlung von Mikroorganismen und Zellkulturen GmbH) под инвентарными номерами DSM 19466, 19467, 19489, на основе которых получают композицию для кормления животных в сочетании с другими добавками, RU №2506307 С2, C12N 1/20, А23К 1/16, 10.02.2014.

Известен штамм бактерий Bacillus subtilis IC-1435-1-1, обеспечивающий восстановление микробиоценоза желудочно-кишечного тракта животных, обладающий бактерицидной, фунгицидной и вирулицидной активностью и депонированный во Всероссийской Коллекции Промышленных Микроорганизмов ФГУП ГосНИИГенетика под регистрационным номером ВКПМ В-10641, на основе которого получают препарат, в качестве наполнителя в котором используют порошкообразный сорбент из отрубей, или цеолита, RU №2482174 С2, C12N 1/20, А61К 35/74, 20.05.2013.

Известен пробиотический штамм Bacillus subtilis 8130, на основе которого создана кормовая добавка пробиотического действия «Пробиоцел», оказывающую влияние на кишечную микрофлору, секреторную и ферментативную активность желудочно-кишечного тракта животных и в целом активизирующую функциональную активность, улучшая обмен веществ, dissercat.com/content/izuchenie…, RU №2346463 С2, А23К 1/165, 20.02.2009.

Известен пробиотический препарат, предназначенный для лечения и профилактики гастроэнтерита поросят-отъемышей, на основе штамма Bacillus subtilis ТПИ и штамма Bacillus lichemformis, представляющий собой смесь культуральных жидкостей, содержащих продукты микробного синтеза данных штаммов, с концентрацией микробных клеток 5 млрд.м.к/см3 в объемном соотношении указанных штаммов 1:1, в которую внесено равное по массе количество смеси отрубей и дикальцийфосфата, RU №2399662 C1, C12N 1/20, А23К 1/16, 20.09.2010; RU №2399661 C1, C12N 1/20, А23К 1/16, 20.09.2010.

Известна пробиотическая композиция для животных и птицы, содержащая бактерии Rhuminococcus albus, Bacillus subtilis, взятые в равных количествах, и способ получения пробиотической композиции, RU №2266747 C1, А61К 35/66, А23К 1/165, 27.12.2005; RU №2266126 C1, А61К 35/66, А23К 1/165, 20.12.2005.

Известна пробиотическая добавка, содержащая биомассу спорообразующих бактерий Bacillus subtilis и носитель гидрофильный марки А и гидрофобный марки AM, RU №2252956 С2, C12N 1/20, А23К 1/165, А23К 35/66, 27.05.2005.

Известна пробиотическая кормовая добавка, включающая смесь биомассы бактерий штаммов Bacillus subtilis ВКПМ 10172 и Bacillus licheniformis ВКПМ 10135 в равных соотношениях в споровой форме при их суммарном количестве не менее 2·108 спор/г и углеводный протектор, RU №2437563 C1, А23К 1/00, 27.12.2011.

Известна кормовая добавка для цыплят-бройлеров, содержащая природный минерал - глауконит и выполненная в виде сухого порошка, размолотого до величины частиц не более 0,1 мм, при дополнительном введении пробиотика «Биоспорин», RU №2352135 С2, А23К 1/00, А23К 1/16, А23К 1/175, 20.04.2009.

Известные штаммы и кормовые добавки на их основе имеют индивидуальные биотехнологии получения.

Известна органоминеральная кормовая добавка, содержащая наполнитель и кремнесодержащий материал, в качестве которого добавка содержит диатомит Инзенского месторождения Ульяновской области с содержанием кремнезема 81,30-85,60% или опоку Дубинского месторождения Ульяновской области с содержанием кремнезема 84,10-89,62%, имеющие высокую пористость и гигроскопичность с возможностями накапливания физиологически активных веществ из наполнителя, RU №2199883 C1, А23К 1/16, А23К 1/175, 10.03.2003.

Известна кормовая добавка для крупного рогатого скота, включающая растительные и зерновые компоненты и минеральную добавку в виде голубой глины, являющейся природным сорбентом и дешевым источником жизненно необходимых макро- и микроэлементов и обладающей высокими адсорбционными и ионообменными свойствами, RU №2238659 С2, А23К 1/16, А23К 1/175, 27.10.2004.

Известна кормовая добавка для животных и птицы, включающая природный цеолит, RU №2484640 C1, А23К 1/00, 20.06.2013; RU №2467591 C1, А23К 1/16, А23К 1/00, 27.11.2012; RU №2448472 C2, A23K 1/175, 27.04.2012; RU №2390254 C1, A23K 1/00, A23K 1/16, A23K 1/175, 27.05.2010; RU №2385623 C2, A23K 1/16, A23K 1/175, 10.04.2010; RU №2374896 C1, A23K 1/00, A23K 1/175, 10.12.2009; RU №2262863 C2, A23K 1/16, A23K 1/175, 27.10.2005.

Известна кормовая добавка для стимулирования роста свиней, содержащая наполнитель и антибиотики, при этом в качестве наполнителя она содержит адсорбент «Бажедин», RU №2386343 С2, А23К 1/00, А23К 1/17, А23К 1/175, 20.04.2010.

Известна лечебно-кормовая добавка из торфа Бастьяновского торфопредприятия Свердловской области с добавлением щелочного компонента, RU №2475038 С2, А23К 1/00, 20.02.2013.

Известна кормовая добавка для свиней, представляющая собой природный минерал Водинского месторождения Красноярского района Самарской области, содержащий в своем составе 47,37% серы и 21,4% кальция, RU №2480025 С2, А23К 1/175, 27.04.2013.

Известна кормовая добавка для молодняка крупного рогатого скота, включающая бентонит Донгузского месторождения, подсолнечный фуз и неорганический селенит натрия, а в качестве наполнителя - отруби пшеничные, RU №2497382 С2, А23К 1/16, А23К 1/175, 10.11.2013.

Известна активная угольная кормовая добавка для повышения продуктивности кур-несушек, включающая сорбент, в качестве которого используют активированный уголь, полученный из мягколиственных пород древесины, имеющий размер частиц от 0,1 до 2 мм, в количестве 400 г на 1 т корма, U №2505069 C1, А23К 1/00, 27.01.2014.

Известные кормовые добавки содержат в своем составе природные материалы на основе глины или торфа, или сорбирующие наполнители в виде активированного угля или природного цеолита (наиболее распространенного), которые в каждом конкретном случае имеют индивидуальные технологии обработки.

Известна пробиотическая кормовая добавка, используемая в составе корма для сельскохозяйственных животных и птицы, состоящая из жизнеспособных спор спорообразующих бактерий штамма Bacillus subtilis и наполнителя, RU №2458526 C1, А23К 1/16, C12N 1/20, 20.08.2012.

Данное техническое решение принято в качестве ближайшего аналога настоящего изобретения.

Спорообразующие бактерии рода Bacilus, общим биологическим свойством которых является антагонистическая активность по отношению к условно-патогенной микрофлоре кишечника животных и продуцирование ферментов, улучшают усвоение корма. Пробиотическая кормовая добавка ближайшего аналога оптимизирует микробный баланс в кишечнике за счет восстановления нормофлоры, способствует повышению неспецифической резистентности организма животных.

Однако кормовая добавка ближайшего аналога выполнена на основе ассоциации трех видов спорообразующих бактерий Bacillus subtilis ВКПМ В-2574, Bacillus licheniformis Б-020, Bacillus cereus ВКПМ В-2492, наполнителя и диспергатора. В качестве наполнителя используют лактозу, сахарозу, обезжиренное сухое молоко, в качестве диспергатора - Твин-80.

Использование другого состава в ближайшем аналоге не предусмотрено.

В основу настоящего изобретения положено решение задачи, расширить ассортимент кормовых добавок с высокой пробиотической активностью на минеральной основе и повышенной функциональностью, предназначенных для увеличения продуктивности сельскохозяйственных животных и птиц.

Технический результат настоящего изобретения заключается в объединении двух функций кормовых добавок как кормового фермента и пробиотика, при этом ферментная функция повышает усвояемость корма и эффективно воздействует на диатамит в виде обожженной крошки, а пробиотическая функция подавляет развитие патогенных микроорганизмов и способствует формированию полезной микрофлоры в пищеварительном тракте за счет использования жизнеспособных спор спорообразующих бактерий Bacillus subtilis 111.

Согласно изобретению эта задача решается за счет того, что кормовая добавка с пробиотической активностью на минеральной основе, используемая в составе корма для сельскохозяйственных животных и птицы, состоит из жизнеспособных спор спорообразующих бактерий штамма Bacillus subtilis и наполнителя.

В качестве штамма взят штамм бактерий Bacillus subtilis 111.

Штамм бактерий Bacillus subtilis 111 депонирован во Всероссийской коллекции микроорганизмов института биохимии и физиологии микроорганизмов им. Г.К. Скрябина РАН (ИБФМ РАН) под регистрационным номером ВКМ В-2334 Д и хранится в коллекции микроорганизмов ООО «БИОТРОФ».

Штамм бактерий Bacillus subtilis 111 состоит из жизнеспособных спор спорообразующих бактерий Bacillus subtilis 111 с титром 2·106 - 6·109 КОЕ/г.

В качестве наполнителя использован диатомит в виде обожженной крошки при массовом соотношении: жизнеспособные споры спорообразующих бактерий Bacillus subtilis 111 и диатомит в виде обожженной крошки как 1:10, соответственно.

Кормовая добавка в составе корма взята при соотношении как 0,001:1.

Заявителем не выявлены источники, содержащие информацию о технических решениях, идентичных настоящему изобретению, что позволяет сделать вывод о его соответствии критерию «новизна».

За счет реализации отличительных признаков изобретения (в совокупности с признаками, указанными в ограничительной части формулы) достигаются важные новые свойства объекта.

Использование жизнеспособных спор спорообразующих бактерий Bacillus subtilis 111 при взаимодействии с диатомитом в виде обожженной крошки позволяет получить новую кормовую добавку с высокой пробиотической активностью при выполнении функций двух кормовых добавок: кормового фермента и пробиотика.

Заявителю не известны какие-либо публикации, которые содержали бы сведения о влиянии отличительных признаков изобретения на достигаемый технический результат. В связи с этим, по мнению заявителя, можно сделать вывод о соответствии заявляемого технического решения критерию «изобретательский уровень».

Настоящее изобретение осуществляют следующим образом.

Кормовую добавку с пробиотической активностью используют в составе корма для сельскохозяйственных животных и птицы.

Видовая идентификация штаммов микроорганизмов

Наработка чистой культуры штамма бактерий, являющихся основой разрабатываемой кормовой добавки с пробиотической активностью, и испытание их проведено в период с 17.10.2011 г. по 21.10.2011 г. на производственной базе ООО «БИОТРОФ», г. Санкт-Петербург.

Чистую культуру штамма бактерий анализировали молекулярно-генетическим методом секвенирования.

ДНК из штамма бактерий выделяли согласно стандартному протоколу «Набора для выделения геномной ДНК из различных источников».

Были выбраны консервативные праймеры для наработки 16S рДНК.

27F AGAGTTTGATCMTGGCTCAG

1525r AAGGAGGTGWTCCARCC

Был определен следующий режим ПНР-реакции:

1) 95°С - 3 мин

2) 35 циклов

95°С - 30 с

55°С - 30 с

72°С - 1 мин

3) 72°С - 20 мин

Электрофорез исследуемых образцов проводили в 1,0% агарозном геле при напряженности электрического поля 5 В/см.

Выделение ДНК из геля_проводили с использованием ДНК-сорбента «Silica».

Клонирование ПЦР-фрагментов осуществляли в векторе pTZ-57R в компетентные клетки E.coli штамма DH5A.

Скрининг трансформантов проводили с помощью метода «ПЦР-колоний» с помощью праймеров М13

fM13: 5′-GCCAGGGTTTTCCCAGTCACGA-3′,

rМ13: 5′-GAGCGGATAACААТТТСAC ACAGG-3

Был установлен следующий режим ПЦР-реакции:

1). 95°С - 3 мин

2). 35 циклов

95°С - 40 с

50°С - 40 с

72°С - 1 мин

3). 72°С - 20 мин

Определение нуклеотидной последовательности ПЦР-фрагментов проводили с использованием набора реагентов фирмы «Beckman» (США) в соответствии с рекомендациями изготовителя. Разделение фрагментов и их регистрацию осуществляли с помощью прибора для автоматического секвенирования CEQ8000, Beckman Coulter, США.

Определение филогенетической принадлежности проводили в базе данных NCBI BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi)

По базе данных отобраны виды, имеющие максимальное соответствие (не менее 99%) штамм бактерий - основа кормовой добавки с пробиотической активностью (Bacillus subtilis strain ТССС11441 16S ribosomal RNA gene, partial sequence (100%)).

Штамм бактерий Bacillus subtilis 111 является основой кормовой добавки с пробиотической активностью.

Отбор штамма бактерий для использования в качестве основы кормовой добавки с пробиотической активностью

Критерием отбора штамма бактерий Bacillus subtilis 111 как основы кормовой добавки с пробиотической активностью - высокая антагонистическая активность к тест-культурам гнилостных бактерий и плесневых грибов.

Результаты отбора штамма бактерий Bacillus subtilis 111 по антагонистической активности представлены в Таблице 1.

Из Таблицы 1 видно, что штамм бактерий Bacillus subtilis 111 обладает высокой антагонистической активностью по отношению к гнилостным бактериям, плесневым грибам и дрожжам.

Штамм бактерий Bacillus subtilis 111 был проверен на патогенные свойства.

В соответствии с ГОСТ 12.1.007-76 проведены исследования штамма бактерий Bacillus subtilis 111 на патогенные свойства: вирулентность, токсичность, токсигенность, способность вызывать дессиминации во внутренних органах теплокровных животных.

Испытания проведены на беспородных белых крысах и беспородных белых мышах.

Вирулентность и диссеминацию штамма бактерий Bacillus subtilis 111 изучали при однократном введении суточной агаровой культуры в физиологическом растворе в желудок белым мышам и белым крысам в дозах но 106, 10′, 10х и 109 и внутрибрюшинно по 106, 107, 108 и 109 микробных клеток (мк.кл) на животное. В опыте использовали по 12 животных на дозу (6 самцов и 6 самок). В период наблюдения клинических симптомов заболевания у животных не наблюдалось, гибель отсутствовала. Через 30 суток после введения культуры микроорганизмов, животных умерщвляли ингаляцией СО2 и методом отпечатков делали посев из крови и внутренних органов (легких, печени, почек и селезенки) на чашки Петри с агаризованной средой. Рост культуры в высевах из органов животных при обоих способах введения не обнаружен.

Токсичность штамма бактерий Bacillus subtilis 111 оценивали путем внутрибрюшинного введения мышам взвеси агаровой культуры микроорганизмов, приготовленной на стерильном физиологическом растворе и инактивированной нагреванием при 60°С в течение 30 мин в концентрациях, 108 и 109 (мк. кл) на животное (по 6 особей на дозу). В течение срока наблюдения - первые двое суток - гибели мышей не было.

Токсигенность штамма бактерий Bacillus subtilis 111 изучали на мышах путем внутрибрюшинного и внутрижелудочного введения стерильною фильтрата культуральной жидкости (фильтрация через фильтр Millipor с размером пор 0,45 мкм) 3-х и 7-ми суточных культур в дозах 0,3 мл, 0,6 мл и 1,0 мл (по 6 особей на дозу). Животным контрольных групп вводили стерильную жидкую питательную среду в таких же объемах. Гибели мышей не было. ЛД50 не установлена, при обоих способах введения она превышала 1,0 мл на животное для 3-х и 7-ми суточных культуральных жидкостей.

Результаты представлены в Таблице 2.

Из таблицы 2 видно, что штамм бактерий Bacillus subtilis 111 по показателям вирулентности, диссеминации, токсичности и токсигенности не патогенен для теплокровных животных и относятся к 4 классу опасности (малоопасны), что удовлетворяет требованиям, предъявляемым к промышленным микроорганизмам.

Штамм бактерий Bacillus subtilis 111 - основа кормовой добавки с пробиотической активностью.

Определение оптимальных условий роста штамма бактерии Bacillus subtilis 111 для кормовой добавки с пробиотической активностью

Результаты отбора приведены в Таблице 3, где

- Среда 1 - меласса- 1,5%; кукурузный экстракт- 0,9%; кормовые дрожжи 2%.

- Среда 2 - кукурузный экстракт - 5%; лактоза- 1%.

- Среда 3 - соевая мука- 3%, нитрат натрия- 0,3%,калий фосфорнокислый двузамещенный- 0,1%, калий фосфорнокислый однозамещенный- 0,1%, сульфат магния - 0,02%, калий хлористый- 0,02%.

Из Таблицы 3 видно, что наилучшим условиям роста штамма бактерии Bacillus subtilis 111 соответствует среда 3.

Приготовление кормовой добавки с пробиотической активностью на основе штамма бактерии Bacillus subtilis 111

Состав производственной среды приведен в Таблице 4.

Питательную среду готовят в ферментере, тщательно перемешивая и стерилизуя горячим паром при давлении 1,6 атм и температуре 128°С в течение 1 ч.

Экспериментальные образцы культуры штамма бактерий нараба-таны в ферментерах.

Была наработана культура микроорганизмов на основе штамма бактерий Bacillus subtilis 111 для получения кормовой добавки с пробиотической активностью.

Установлены характеристики культуры микроорганизмов Bacillus subtilis 111:

- внешний вид и цвет: жидкость светло-коричневого цвета с небольшим осадком питательной среды;

- культура микроорганизмов состоит из штамма бактерий Bacillus subtilis 111,

не подвергавшихся генно-инженерным модификациям;

- титр бактерий составляет 2,0·106 - 6,0·109 КОЕ /г;

- посторонняя микрофлора отсутствует.

Выбранный интервал концентраций (титра) бактерий является оптимальным.

В кормовой добавке в качестве наполнителя использован диатомит Инзенского месторождения Ульяновской области.

Диатомит - осадочная горная порода рыхлая или слабосцементированная, состоящая из останков диатомовых водорослей и имеющая серый или желтый цвет слабых тонов.

Химически диатомит более чем на 80% состоит из водного кремнезема.

Диатомит в виде обожженной крошки поставляет "Диатомовый Комбинат" г. Инза Ульяновской области.

В кормовой добавке использован диатомит в виде обожженной крошки фракций 0,3-0,7 мм с влажностью не больше 9%.

Приготовление кормовой добавки в виде сухого порошка.

Жизнеспособные споры бактерий Bacillus subtilis 111 наносят на диатомит в виде обожженной крошки, помещенный в смеситель СМ- 150, при соотношении 1:10. Влажный препарат раскладывают на лотки.

Высушивание препарата проводят в шкафах сушильных РТ-ШС. В шкафы завозят лотки с разложенным на них препаратом.

Высушивание препарата проводят воздушно-тепловым способом при температуре от 55°С до 60°С в течение 9 ч до конечной влажности 7,0-7,2%.

После сушки препарат направляют на размол на дробилку кормов ДКР-3. Препарат размалывают до состояния порошка.

Кормовую добавку в составе корма берут при соотношении как 0,001:1.

Соотношение подтверждено экспериментальными исследованиями.

Исследования по использованию предложенной кормовой добавки представлены в примерах 1-3.

Пример 1

Использование кормовой добавки с пробиотической активностью в составе корма для телят

Опыт проводили в ЗАО «ПЛЕМЗАВОД БОЛЬШЕВИК» Ленинградской области. Продолжительность опыта составила 89 дней.

Для опыта отбирали телят черно-пестрой породы от 30-45 суточного возраста до 4 месяцев. Животные содержались в клетках по 5 голов.

Первая контрольная группа получала основной рацион (ОР) комбикормов.

Вторая группа опытная получала основной рацион (ОР) с кормовой добавкой с пробиотической активностью.

Основной рацион до трехмесячного возраста в среднем содержал: молоко - 10 л, в том числе ЗЦМ, комбикорм - 0,2 кг, сено - 0,2 кг, МВД - 0,08 кг. С трехмесячного возраста рацион изменился: ЗЦМ - 3-5 л, комбикорм - 0,8-1,5 кг, сено - 0,5 кг, силос - 2-4 кг, мел - 0,05 кг, соль - 0,01 кг, МВД-0,6 кг.

Кормовую добавку с пробиотической активностью смешивали с комбикормом на Гатчинском комбикормовом заводе из расчета 1 кг на 1 тонну комбикорма и добавляли в молоко в первый месяц опыта, а в последующие два месяца с комбикормом включали в рацион.

Результаты проведенных исследований приведены в таблице 5 (Влияние кормовой добавки с пробиотической активностью на прирост живой массы телят).

Из таблицы 5 видно, что за счет ввода в рацион кормовой добавки с пробиотической активностью у телят во 2 опытной группе быстрее произошла нормализация микрофлоры желудочно-кишечного тракта, что позволило повысить усвояемость питательных веществ рациона и положительно отразилось на привесах. Телята раньше стали поедать грубый корм (сено). Среднесуточные привесы во 2 опытной группе были выше на 128 г (29,2%), что позволило сократить расход кормов на 1 кг привеса на 1,32 к.ед. по сравнению с 1 контрольной группой.

В рационах сельскохозяйственных животных кормовая добавка с пробиотической активностью выполняет функции двух кормовых добавок: кормового фермента и пробиотика. У телят кормовая добавка с пробиотической активностью повышает иммунитет, способствует созреванию рубцовой микрофлоры и нормализует работу пищеварительной системы, повышает жизнеспособность растущего молодняка и раннее его приучение к поеданию грубого корма (сена).

Пример 2

Использование кормовой добавки с пробиотической активностью в составе корма для коров

Опыт проводили в ЗАО «ПЛЕМЗАВОД БОЛЬШЕВИК» Ленинградской области. Продолжительность опыта составила 60 дней.

Были сформированы две группы дойных коров черно-пестрой породы второй и третьей лактации. Животные находились на привязном содержании.

Первая контрольная группа получала основной рацион (ОР) комбикормов.

Вторая группа опытная получала основной рацион (ОР) с кормовой добавкой с пробиотической активностью.

Основной рацион содержал: комбикорм - 7 кг, силос - 30 кг, сено - 1,5 кг, пивная дробина - 5 кг, жмых подсолнечный - 1,2 кг, патока - 0,2-1,0 кг, минерально-витаминная добавка - 0,2 кг.

Кормовую добавку с пробиотической активностью смешивали с комбикормом из расчета 1 кг на 1 тонну комбикорма.

Результаты проведенных исследований приведены в таблице 6 (Продуктивность коров и качество молока дойных коров черно-пестрой породы при использовании кормовой добавки с пробиотической активностью).

Из таблицы 6 видно, что за период опыта количество соматических клеток в молоке коров во 2 опытной группе снизилось на 29,6% по сравнению с животными в 1 контрольной группе. Среднесуточный удой молока натуральной жирности во 2 опытной группе был выше на 1,4 кг, содержание жира в молоке было выше на 0,3%, что позволило дополнительно получить 3,2 кг молока 4%-ой жирности на 1 голову в сутки.

Полученная разница по сумме молочного жира и белка у коров во 2 опытной группе (57,7 кг и 46,8 кг соответственно) по сравнению с животными в 1 контрольной группе (50,2 кг и 43,2 кг соответственно), может быть обусловлена изменением направленности межуточного обмена. Сопоставимый анализ между группами показывает, что более высокий показатель жирномолочности у животных во 2 опытной группе получен как за счет увеличения надоя, так и увеличения процентного содержания жира и белка в молоке.

Как пробиотик кормовая добавка с пробиотической активностью подавляет развитие патогенных микроорганизмов и способствует формированию полезной микрофлоры в пищеварительном тракте, что обеспечивает увеличение продуктивности, повышает содержание жира и белка в молоке, снижает количество соматических клеток.

Влияние кормовой добавки с пробиотической активностью на микрофлору рубца коров дойного стада представлено в таблице 7.

Из Таблицы 7 видно, что добавление в рацион кормовой добавки с пробиотической активностью способствовало достоверному увеличению количества полезных бактерий семейства Ruminococcaceae в 1,8 раз.

Содержание актинобактерий, среди которых часто встречаются возбудители актиномикозов, было высоким в рубце коров дойного стада в 1 контрольной группе- 9,53%, при этом при добавлении в рацион кормовой добавки снижалось до 7,14%.

Следует отметить, что в рубце коров дойного стада в 1 контрольной группе наблюдалось значительное количество патогенных микроорганизмов родов Staphylococcus (возбудитель мастита), Helicobacter (Campylobacter) (возбудитель кампилобактериозного мастита) и Fusobacterium (возбудитель некробактериоза). Ввод в рацион кормовой добавки с пробиотической активностью способствовал снижению количества данных патогенов в 1,5, 1,25 и 2,5 раз, соответственно.

Кормовая добавка с пробиотической активностью оказывает положительное влияние на микрофлору рубца коров дойного стада. Состояние микрофлоры рубца во многом определяет показатели продуктивности.

Пример 3

Использование кормовой добавки с пробиотической активностью в составе корма для поросят-отъемышей

Опыт проводили на свиноферме ОАО ПЗ «Пламя» Ленинградской области. Продолжительность опыта составляла 60 дней.

Было сформировано 2 группы поросят-отъемышей по 50 голов в каждой.

Первая контрольная группа получала основной рацион (ОР) комбикормов.

Вторая группа опытная получала основной рацион (ОР) комбикормов с кормовой добавки с пробиотической активностью.

Комбикорм был приготовлен на Гатчинском комбикормовом заводе, из расчета 1 кг кормовой добавки с пробиотической активностью на 1 тонну комбикорма.

Результаты проведенных исследований приведены в таблице 8 (Влияние кормовой добавки с пробиотической активностью на выращивание поросят-отъемышей).

Из таблицы 8 видно, что применение кормовой добавки с пробиотической активностью способствовало более полному усвоению корма. Во 2 опытной группе среднесуточные привесы у поросят-отъемышей были выше на 6,3%, а затраты корма на 1 кг привеса были ниже на 0,48 к. ед. чем в 1 контрольной группе.

Влияние кормовой добавки с пробиотической активностью на микробное сообщество тонкого отдела кишечника свиней-отъемышей представлено в таблице 9.

Из таблицы 9 видно, что содержание бактерий филы Bacteroidetes, среди которых встречаются патогенные для свиней виды, было высоким в тонком отделе ЖКТ животных в 1 контрольной группе. Установлено, что доля бактероидов в ЖКТ свиней-отъемышей во 2 опытной группе была ниже по сравнению с 1 контрольной группой в 20,2 раза.

Содержание актинобактерий филы Actinobacteria, среди которых часто встречаются возбудители актиномикозов животных, было в пределах нормы в ЖКТ животных во 2 опытной группе. Доля данных микроорганизмов в ЖКТ свиней-отъемышей должна составлять не более 6%. При этом содержание данных микроорганизмов в ЖКТ свиней-отъемышей в 1 контрольной группе превышало норму и было выше, чем в ЖКТ животных во 2 опытной группе в 4,16 раза.

Результаты исследований показали, что кормовая добавка с пробиотической активностью достоверно повышает численность полезных молочнокислых бактерий (сем. Lactobacillaceae).

Кормовая добавка с пробиотической активностью улучшает микрофлору в кишечнике свиней-отъемышей.

Пример 4

Использование кормовой добавки с пробиотической активностью в птицеводстве

Опыт проводили на базе ФГУП Загорское ЭПХ ВНИТИП Россельхозакадемии на цыплятах-бройлерах кросса «Кобб авиан-48».

Выращивание цыплят-бройлеров проведено в клеточной батарее типа Р-15.

Было сформировано 2 группы цыплят-бройлеров по 35 голов в каждой.

Первая и вторая группы цыплят-бройлеров получали рассыпные комбикорма вволю.

Первая группа контрольная получала основной рацион (ОР) комбикормов.

Вторая группа опытная получала основной рацион (ОР) комбикормов с кормовой добавкой с пробиотической активностью (1000 г/т).

Питательность комбикормов соответствовала рекомендуемым нормам для кросса, в структуру комбикормов был включен подсолнечный жмых (12,5% по массе комбикорма) и отруби пшеничные (5% по массе комбикорма) в ростовой и финишный периоды выращивания.

Основные зоотехнические показатели опыта на цыплятах-бройлерах при использовании кормовой добавки с пробиотической активностью представлены в таблице 10.

Из таблицы 10 видно, что эффективность введения кормовой добавки с пробиотической активностью в ОР во 2 опытной группе очевидна: среднесуточный прирост живой массы выше в сравнении с 1 контрольной группой при снижении затрат корма на 1 кг живой массы до 1,67 кг.

Влияние кормовой добавки с пробиотической активностью на микрофлору кишечника цыплят-бройлеров представлено в таблице 11.

Из таблицы 11 видно, что кормовая добавка с пробиотической активностью в 2,7 раза увеличивает численность полезных молочнокислых бактерий (лактобактерий), существенно снижает численность вредных для организма птицы актиномицетов и стафилококков, препятствует развитию условно-патогенных энтеробактерий.

Полученные результаты на основании Примеров 1-4 подтверждают целесообразность использования новой кормовой добавки с пробиотической активностью.

Пробиотическую активность кормовой добавки определяли с использованием молекулярно-генетического метода на основе T-RFLP-анализа.

ДНК из содержимого кишечника экстрагировали с использованием коммерческого набора DNA Purification Kit (Fermentas, Литва).

ПЦР-амплификацию генов 16S рРНК бактерий проводили с использованием праймеров: 63F (CAGGCCTAACACATGCAAGTC) - с меткой на 5′-конце (флуорофор D4 - WellRed); 1492R (TACGGHTACCTTGTTACGACTT).

Амплифицированный фрагмент выделяли из агарозного геля помощью 3М раствора гуанидина тиоционата.

Рестрикцию ампликонов проводили с использованием рестриктаз НаеIII, Hhal и MspI (Fermentas), в течение 2 ч при 37°С. После окончания рестрикции ДНК из реакционной смеси осаждали этанолом, растворяли в SLS (Beckman Coulter) с последующим добавлением маркера молекулярного веса - 600 п.н. (Beckman Coulter). Следующим этапом анализа являлась флуоресцентная детекция целевой ДНК на автоматическом секвенаторе CEQ8000 (Beckman Coulter).

Вычисление размеров пиков и их площади проводили с использованием программного блока Fragment Analysis (Beckman Coulter). Для идентификации пиков T-RFLP-граммы для трех эндонуклеаз (НаеIII, HhaI и MspI) обрабатывали с помощью программы Fragment Sorter (http://www.oardc.ohio-state.edu/trflpfragsort/index.php).

Из коллекции производственных штаммов выявлен штамм бактерий Bacillus subtilis 111, жизнеспособные споры спорообразующих бактерий которого входят в состав кормовой добавки с пробиотической активностью на минеральной основе в виде обожженной крошки диатомита.

Предложенная кормовая добавка с пробиотической активностью получена по известным биотехнологиям, имеющим широкое применение в сельском хозяйстве, и проведенные опытные работы на базе ФГУП Загорское ЭПХ ВНИТИП Россельхозакадемии, свинофермы ОАО ПЗ «Пламя» Ленинградской области и в ЗАО «ПЛЕМЗАВОД БОЛЬШЕВИК» Ленинградской области обусловливают, по мнению заявителя, его соответствие критерию «промышленная применимость».

Предложенная кормовая добавка с высокой пробиотической активностью и повышенной функциональностью позволяет:

- увеличить продуктивность сельскохозяйственных животных и птицы;

- нормализовать и улучшить микрофлору желудочно-кишечного тракта, подавляя развитие патогенных микроорганизмов и способствуя формированию полезной микрофлоры в пищеварительном тракте;

- повысить усвояемость питательных веществ корма.

Кормовая добавка с пробиотической активностью на минеральной основе, используемая в составе корма для сельскохозяйственных животных и птицы, состоящая из жизнеспособных спор спорообразующих бактерий штамма Bacillus subtilis и наполнителя, отличающаяся тем, что в качестве штамма взят штамм бактерий Bacillus subtilis 111, депонированный во Всероссийской коллекции микроорганизмов института биохимии и физиологии микроорганизмов им. Г.К. Скрябина РАН (ИБФМ РАН) под регистрационным номером ВКМ В-2334 Д, хранящийся в коллекции микроорганизмов ООО «БИОТРОФ» и состоящий из жизнеспособных спор спорообразующих бактерий Bacillus subtilis 111 с титром 2·106-6·109 КОЕ/г, а в качестве наполнителя использован диатомит в виде обожженной крошки при массовом соотношении: жизнеспособные споры спорообразующих бактерий Bacillus subtilis 111 и диатомит в виде обожженной крошки как 1:10 соответственно, при этом кормовая добавка в составе корма взята при соотношении как 0,001:1.



 

Похожие патенты:
Изобретение относится к ветеринарии, в частности к способам лечения щенков, склонных к запорам или страдающих от него. Способ включает регулирование баланса метаболизируемых катионов по отношению к метаболизируемым анионам в композиции корма, потребляемой щенком, с помощью количества, достаточного для улучшения качества стула, посредством уменьшения баланса метаболизируемых катионов по отношению к метаболизируемым анионам, потребляемым щенком, для получения более жидкого стула.

Изобретение относится к области сельского хозяйства, в частности к птицеводству. Способ предусматривает с момента посадки племенных цыплят до момента перевозки их в корпуса для взрослого поголовья, а в дальнейшем в начале яйцекладки и на пике яйценоскости выпаивать птице с водой антистрессовый водорастворимый препарат «Magic Аntistress Мix» в дозе 100 г на 100 л воды, причем препарат выпаивают птице в периоды стрессов и пиков в 10 курсов по 5-10 дней: с 1 по 5 сутки жизни (при посадке), далее 9-13 (дебикирование), 21-25 (вакцинация), 27-31 (вакцинация), 45-49 (сортировка), 63-67 (вакцинация), 75-79 (перевозка), 105-110 (вакцинация, начало яйцекладки), 148-157 (выход на пик) и 238-246 суток жизни (поддержка в пик).

Изобретение относится к кормопроизводству, в частности к способу приготовления корма на основе соевого белкового компонента. Способ включает использование предварительно подготовленного соевого белкового и минерального компонентов с последующим их смешиванием в определенном соотношении, получением гранул и их сушкой.
Изобретение относится к ветеринарной медицине. Для выращивания телят вводят в рацион стимулирующую минеральную кормовую добавку, в качестве которой используют препарат мицеллат углекислого кальция «Алексанат Зоо».

Изобретение относится к органическим хелатированным минеральным композициям и способам их получения. Способ получения минерального продукта включает контактирование карбоновой кислоты и неорганического минерального соединения, достаточное для образования раствора, реагирование раствора в течение периода времени, достаточного для получения минерального хелатированного соединения и одного или нескольких газов и/или паров, пассивное удаление одного или нескольких газов и/или паров с образованием быстрорастворимого минерального хелатированного продукта.

Способ приготовления белково-минерального продукта для птицы относится к кормопроизводству и, в частности, к способам приготовления кормов для сельскохозяйственной птицы.

Изобретение относится к области ветеринарии. Способ предусматривает введение в основной рацион средства активизации воспроизводительной функции свиней, в 100 г которого содержатся: витамин А (ретинола ацетат) - 100 тыс.
Изобретение относится к кормлению сельскохозяйственных жвачных животных, в частности молочных коров. Способ повышения биосинтеза молочного жира у высокопродуктивных коров предусматривает введение в состав рациона буферной смеси в количестве 100 г/гол./сутки.
Изобретение относится к ветеринарии. Лечебно-профилактическое средство для сельскохозяйственных животных содержит соли натрия, соли калия, калия хлорид и вспомогательное вещество.
Изобретение относится к области сельского хозяйства, в частности к кормлению сельскохозяйственных животных. Способ предусматривает введение в основной рацион средства повышения репродуктивных качеств в дозе 0,3% от массы суточной нормы корма в первые 84 суток супоросности и дозе 0,4% с 85-х суток до 115-х суток супоросности, в 100 г которого содержатся: Витамин А (ретинола ацетат) - 100 тыс.

Группа изобретений относится к стабильной сухой композиции, способу ее изготовления. Композиция содержит биоактивный микроорганизм или материал, два стабилизирующих агента - альгинат натрия и инулин, и два защитных агента - дисахарид и белковый гидролизат.

Изобретение относится к биотехнологии и представляет собой новую фитазу с повышенной термостабильностью. Изобретение касается также применения фитазы в корме для животных для снижения содержания фосфата в навозе, а также в кормовых добавках и кормах для животных.
Изобретение относится к кормлению сельскохозяйственной птицы. Кормовая добавка для цыплят-бройлеров включает минеральные вещества в виде природного бишофита Волгоградского месторождения, при этом кормовая добавка дополнительно содержит препарат незаменимой аминокислоты в виде «L-треонин» при следующем соотношении компонентов, мас.%: природный бишофит Волгоградского месторождения - 90,0-91,0, препарат незаменимой аминокислоты «L-треонин» - 9,0-10,0.
Изобретение относится к производству продуктов кормового назначения, используемых в кормлении сельскохозяйственных животных. Кормовая добавка для сельскохозяйственных животных содержит маточную культуру бактерий, питательную среду и воду.

Изобретение относится к области сельского хозяйства, в частности к птицеводству. Способ предусматривает с момента посадки племенных цыплят до момента перевозки их в корпуса для взрослого поголовья, а в дальнейшем в начале яйцекладки и на пике яйценоскости выпаивать птице с водой антистрессовый водорастворимый препарат «Magic Аntistress Мix» в дозе 100 г на 100 л воды, причем препарат выпаивают птице в периоды стрессов и пиков в 10 курсов по 5-10 дней: с 1 по 5 сутки жизни (при посадке), далее 9-13 (дебикирование), 21-25 (вакцинация), 27-31 (вакцинация), 45-49 (сортировка), 63-67 (вакцинация), 75-79 (перевозка), 105-110 (вакцинация, начало яйцекладки), 148-157 (выход на пик) и 238-246 суток жизни (поддержка в пик).

Изобретение относится к кормопроизводству, в частности к способу приготовления комбикормов. Способ включает смешивание соевого и витаминного компонентов в соответствующих соотношениях.
Изобретение относится к сельскому хозяйству, а именно к кормлению растущего молодняка цыплят. Кормовая добавка для цыплят включает углеводно-протеиновую добавку, состоящую из кормового сахара и дрожжевой суспензии, витамины А, Е и С, фолиевую кислоту и холин.

Изобретение относится к сельскому хозяйству и может быть использовано при производстве кормов. Способ деконтаминации кормов, загрязненных микотоксинами, заключается в их предварительной обработке активированным средством.

Изобретение относится к кормопроизводству, а именно к кормам для домашних животных. Композиция корма для домашних животных содержит от 0,0001 г/кг массы тела животного до 1 г/кг массы тела животного антиметаболита глюкозы и от 2 мг/кг до 140 мг/кг бутилированного гидроксианизола (ВНА) или бутилированного гидрокситолуола (ВНТ) или от 2 мг/кг до 140 мг/кг бутилированного гидроксианизола (ВНА) и бутилированного гидрокситолуола (ВНТ) в суммарном количестве.

Группа изобретений относится к способу скрининга и выделения клеток Bacillus subtilis, к композиции кормовой добавки к кормовому продукту для животного, содержащей указанные клетки, и способу кормления животного.

Изобретение относится к кормопроизводству, а именно к кормовой добавке с фитобиотической активностью на минеральной основе, которая может использоваться в составе кормов для сельскохозяйственных животных и птицы. Кормовая добавка содержит смесь эфирных масел эвкалипта, чабреца, чеснока и лимона при соотношении 1:2:1:2, соответственно, нанесенную на диатомит в виде обожженной крошки при соотношении 1:10 и высушенную с получением сухого концентрата смеси эфирных масел в виде порошка, а также наполнитель, в качестве которого использован диатомит в виде обожженной крошки. Все компоненты кормовой добавки взяты в определённых количествах. Кормовая добавка вводится в состав корма при соотношении 0,001:1. Кормовая добавка обеспечивает иммуномодулирующее и антиоксидантное действие, обладает антимикробной активностью и противовоспалительным эффектом. Скармливание кормовой добавки обеспечивает нормализацию процессов пищеварения. 4 табл., 3 пр.
Наверх