Последовательность днк-аптамеров, связывающаяся с протеолитической субъединицей нейротоксина типа a clostridium botulinum

Изобретение относится к биотехнологии, а именно к последовательности ДНК-аптамера, которая связывается с протеолитической субъединицей нейротоксина типа A Clostridium botulinum. Данная последовательность ДНК-аптамера состоит из одноцепочечной ДНК длиной 81 нуклеотид, выбранной из группы: APT/LCBONTA N10, представляющая собой CATACGTTCGACTGCTACCCTCCACTTTTGACGGCTTCCTCGGGATTATACGGCTA ACCGAGGGTGAGATGTACAGACTAG, или APT/LCBONTA N16, представляющая собой CATACGTTCGACTGCTACTCTGCTGGGATGGCCTAGCAGCCGATTATTGG GCTAAGCGGGCGTGTGAGATGTACAGACTAG. Данная последовательность ДНК-аптамера обладает высокой специфичностью в отношении протеолитической субъединицы (легкой цепи) токсина типа A Clostridium botulinum с константами аффинности соответственно 1,2·109 М-1, 1,3·109 М-1. Изобретение позволяет ингибировать протеолитическую активность легкой цепи BoNT/A с высокой эффективностью. 10 ил., 4 пр.

 

Изобретение относится к области биотехнологии, биоинженерии, биохимии и диагностической медицинской микробиологии.

Основными областями применения ДНК-аптамеров являются медицинские и биологические исследования, клиническая диагностика заболеваний, в том числе создание высокочувствительных и высокоэффективных систем детекция мишеней белковой природы, а также терапия заболеваний различной природы.

Токсины Clostridium botulinum представляют собой нейротоксины белковой природы, которые ответственны за развитие смертельно опасной интоксикации с преимущественно алиментарным путем инфицирования. Семейство ботулотоксинов содержит восемь (A-Η) серологически и биохимически отличных типов токсина [Dover Ν., Barash J.R., Hill K.K., Xie G., & Amon S.S. // Journal of Infectious Diseases. - 2014. - V. 209. - №. 2. - P. 192-202], секретируемых различными штаммами С. botulinum. Летальная доза (LD50) ботулотоксинов составляет 1-5 нг/кг массы тела. Также отмечены штаммы с одновременной комбинированной продукцией двух серотипов нейротоксинов [Montecucco С, Molgó J. // Current Opinion in Pharmacology. - 2005. -V.5, N.3. - P. 274-279.; Kukreja R, Singh BR. // Microbial Toxins: Current Research and Future Trends. - Caister Academic Press. - 2009. - ISBN 978-1-904455-44-8]. Основные типы ботулинических нейротоксинов, вызывающие заболевание у человека, представлены типами А, В и Е, из них наиболее тяжелые случаи интоксикации связаны с BoNT/A [Simpson L.L. // Annu. Rev. Pharmacol. Toxicol. - 2004. - V. 44. - P. 167-193].

Ботулинический нейротоксин продуцируется в форме неактивного единого пептида с молекулярной массой 150 кДа, активируемого посредством протеолитического расщепления трипсином или бактериальными протеазами на легкую цепь (LC), которая представляет собой Zn-зависимую металлопротеазу (50 кДа), и тяжелую цепь (НС), состоящую из связывающего и транслокационного доменов (100 кДа). Под действием легкой цепи токсина происходит расщепление белков группы SNARE (в том числе, SNAP-25), которое приводит к нарушению связывания нейротрансмиттерных везикул и их интеграцию в плазматическую мембрану периферических нейронов [Chen S, Barbieri JT. // J. Biol. Chem. - 2011. - V. 286. - №17. - P. 15067-15072]. Легкая и тяжелая цепи токсина связаны посредством дисульфидной связи и множества нековалентных взаимодействий между двумя пептидными цепями [Capek Р, Dickerson T.J. // Toxins. - 2010. - V. 2. - Р. 24-53].

В этиологии ботулизма можно выделить две общие категории: первичная интоксикация, при которой токсины попадают в организм алиментарным путем при употреблении в пищу продуктов питания, контаминированных вегетативной формой клостридий ботулизма, и первичная инфекция, за которой следует вторичная интоксикация, когда в организм попадают споровые формы клостридий, которые после прорастают в анаэробных условиях (в кишечнике или раневой поверхности), выделяя токсин. Инкубационный период развития симптомов ботулизма составляет от нескольких часов до пяти суток и зависит от типа и дозы токсина. Выздоровление наступает медленно и может потребовать подключения к аппарату искусственной вентиляции легких, наибольшие сроки восстановительного периода наблюдаются при интоксикации BoNT/A [Simpson L.L. // Annu. Rev. Pharmacol. Toxicol. - 2004. - V. 44. - P. 167-193].

Диагностика ботулизма на ранних этапах заболевания, а также определение токсина в подозрительных продуктах питания и своевременно примененная терапия обеспечивают благоприятный прогноз исхода заболевания. Для клинической диагностики и терапии ботулинической интоксикации могут быть успешно использованы ДНК-аптамеры - одноцепочечные олигнуклеотиды, которые благодаря образованию сложных трехмерных структур и пространственному расположению зарядов в молекуле имеют высокую аффинность в отношении заданных молекул. Направленный отбор аптамеров против выбранных мишеней осуществляется по технологии SELEX ("Systematic Evolution of Ligands by Exponential Enrichment") [US Patent 5567588] с применением различных модификаций технологии, таких как микромагнитная селекция в микрожидкостных каналах (M-SELEX) [Lou X., Qian J., Xiao Y., Viel L., Gerdon A.E., Lagally E.T., … & Soh H.T. // Proceedings of the National Academy of Sciences. - 2009. - V. 106. - №. 9. - P. 2989-2994], использование капиллярного элекрофореза (ECEEM) [Drabovich Α., Berezovski M., Krylov S.N. // Journal of the American Chemical Society. - 2005. - V. 127. - №. 32. - P. 11224-11225] и др.

Известны ДНК-аптамеры, специфичные к различным доменам ботулинического токсина типа А: протеолитический домен [US 20090186342; Fan M., McBurnett S.R., Andrew С.J., Allman A.M., Bruno J.G., & Kie, J.L. // Journal of biomolecular techniques: JBT. - 2008. - V.19. - №.5. - P. 311], тяжелая цепь ботулотоксина [Tok J.В.H., Fischer Ν.О. // Chemical CoMMunications. - 2008. - №.16. - P. 1883-1885] и готолоксин [US 20090186342; Wei F., Но C.M. // Analytical and bioanalytical chemistry. - 2009. - V. 393. - №. 8. - P. 1943-1948]. Все описанные аптамеры были получены с применением нативного токсина, его отдельных доменов, полученных разделением нативного белка, или токсоида, инактивированного формальдегидом. Специфичные к мишени аптамеры отделяли от неспецифичных олигонуклеотидов с использованием хроматографии высокого давления (HPLC) [US 20090186342; Wei F., Но С.M. // Analytical and bioanalytical chemistry. - 2009. - V. 393. - №.8. - P. 1943-1948.] или магносепарации [Fan M., McBurnett S.R., Andrews С.J., Allman A.M., Bruno J.G., & Kiel J.L. // Journal of biomolecular techniques: JBT. - 2008. - V. 19. - №.5. - P. 311; Tok J.В.H., Fischer N.O. // Chemical CoMMunications. - 2008. - №.16. - P. 1883-1885].

Наиболее актуально получение высокоспецифичных аптамеров к легкой цепи токсина, поскольку именно блокирование активных центров протеолитического домена способно инактивировать ботулинический токсин.

Известны РНК-аптамеры, ингибирующие активность легкой цепи ботулотоксина A [Chang Т.W., Blank M., Janardhanan P., Singh В.R., Mello С., Blind M., & Cai S. // Biochemical and biophysical research coMMunications. - 2010. - V. 396. - №.4. - P. 854-860], полученные в отношении рекомбинантного белка легкой цепи ботулотоксина А. Однако молекулы РНК подвержены деградации под действием РНКаз и не обладают достаточной стабильностью для прямого применения в качестве диагностических или терапевтических агентов.

Задачей изобретения является селекция аптамеров к протеолитическому домену нейротоксина ботулизма типа А, обладающих аффинностью и специфичностью в отношении легкой цепи ботулинического нейротоксина типа А, стабильностью при длительном хранении и способностью к ингибированию протеолитической активности легкой цепи ботулотоксина А.

Поставленная задача решается с использованием оптимизированной системы селекции аптамеров, основанной на применении химерного рекомбинантного полипептида, несущего в своем составе пептидную последовательность для иммобилизации данного полипептида на твердой фазе, отделенную от пептидной последовательности легкой субъединицы нейротоксина ботулизма типа А уникальной пептидной последовательностью, расшепляемой протеазой летальным фактором В. anthracis, что позволяет провести отбор аптамеров с высокой специфичностью к мишени в результате малого числа раундов селекции.

Также поставленная задача решается применением системы магносепарации в виде магнитных микрочастиц, покрытых глутатионом, на поверхности которых через взаимодействие с глутатион-S-трансферазой иммобилизируют химерный рекомбинатный полипептид для улучшения эффективности циклов отмывки и отделения комплекса протеолитический домен/аптамеры в раствор.

Также поставленная задача решается применением протеазы летального фактора В. anthracis для расщепления специфического для нее субстрата в составе химерного полипептида, что позволяет отделить от него рекомбинантный фрагмент ботулотоксина А, несущий специфически связанные аптамеры.

Также поставленная задача решается применением раундов негативной селекции библиотеки ДНК-олигонуклеотидов против белков, являющихся традиционными компонентами блокирующих растворов в классических реакциях иммуноанализа.

Также поставленная задача решается путем клонирования селектированных последовательностей ДНК в плазмидный вектор, определения их первичной структуры и проверки на специфическую активность в отношении протеолитического домена ботулотоксина А.

Также поставленная задача решается определением показателей константы аффинности селектированных индивидуальных последовательностей к протеолитическому домену ботулотоксина типа А С. botulinum.

Также задача решается расщеплением комбинированного полипептида, содержащего субстрат SNAP-25, протеазой легкой цепью ботулотксина А в присутствии селектированных аптамеров для определения способности одноцепочечных последовательностей ДНК к ингибированию протеолитической активности протеолитического домена ботулинического токсина типа А.

Техническим результатом изобретения являются последовательности одноцепочечных ДНК-аптамеров длиной 81 нуклеотид с молекулярной массой 28 кДа, специфически связывающие легкую цепь BoNT/A с константой аффинности не менее 109 М-1 и ингибирующие протеолитическую активность легкой цепи ботулотоксина типа А.

Предлагаемое техническое решение предусматривает сочетание раундов негативной и позитивной селекции, что существенно повышает специфичность отобранных последовательностей.

Также техническое решение предполагает применение расщепляемого химерного белка для осуществления этапов позитивной селекции, что позволяет выделить при отборе исключительно те аптамеры, которые связаны с последовательностью легкой цепи нейротоксина ботулизма типа А.

Также техническое решение предполагает использование иммобилизации химерного белка на поверхности магнитных микросфер, что позволяет повысить эффективность выделения комплекса аффинных аптамеров и белка-мишени.

Важным преимуществом предлагаемой системы позитивной селекции является возможность получения пула высокоаффинных ДНК-аптамеров с минимальным содержанием низкоаффинных молекул при применении малого количества раундов селекции. Принципиальная схема проведения анализа для первичного скрининга чувствительности и специфичности индивидуальных последовательностей аптамеров представлена на фиг. 5.

Изобретение осуществляют следующим образом.

Синтезируют комбинаторную библиотеку ДНК-олигонуклеотидов вида 5′-const1-N45-const2, где N45 - вариабельная область, состоящая из 45 нуклеотидов, а const1 и const2 - константные фланкирующие области длиной по 18 нуклеотидов, которые служат для связывания со специфическими праймерами, позволяющими амплифицировать пул олигонуклеотидов после этапов селекции. (фиг. 1). Негативную селекцию из комбинаторной библиотеки осуществляют в отношении белков бычьего сывороточного альбумина и α-казеина молока. Выбор данных белков-мишеней основан, в первую очередь, на предполагаемом использовании выбранных ДНК-аптамеров в составе тест-систем на основе иммуноанализа, сопряженного с ПЦР, таких как иммуно-аптамерная ПЦР, поскольку именно указанные выше белки чаще всего используют в качестве компонентов блокирующих растворов при проведении иммуноанализа. Разделение комплексов ДНК/белок и несвязавшихся с белком олигонуклеотидов осуществляют с применением гель-фильтрационной хроматографии на колонке с Superdex 200™ (GE Healthcare, Великобритания). Пул несвязавшихся олигонуклеотидов амплифицируют в ПЦР с применением праймеров: прямого ForFAM, меченного FAM по 5′-концу цепи, и обратного RevP, несущего на 5′-конце остаток фосфорной кислоты (фиг. 1). Двуцепочечный продукт ПЦР обрабатывают 5′-экзонуклеазой фага лямбда для получения одноцепочечных олигонуклеотидов. Деградацию цепи, фосфорилированной по 5′-концу, визуально контролируют электрофорезом в ПААГ по наличию в электрофореграмме единичной меченой FAM полосы одноцепочечной ДНК (фиг. 2). Против каждого белка проводят три раунда селекции с чередованием белка-мишени.

Позитивную селекцию проводят с использованием химерного белка GST/APT/LCBONTA, экспрессируемого с последовательности gst-apt-lcbonta (фиг. 3) в составе плазмидной конструкции pGST/APT/LCBONTA, созданной на основе конструкта pGST/APT/X [Заявка на получение патента RU 2013147132]. Для этого оптимизированную последовательность, кодирующую протеолитический домен BoNT/A, полученную синтетически путем проведения элонгации цепи ДНК в серии ПЦР-амплификаций, обрабатывают эндонуклеазами рестрикции BamHI и XhoI (Thermo, США) и клонируют в плазмиду pGST/APT/X, обработанную теми же эндонуклеазами. Полученная плазмида pGST/APT/LCBONTA кодирует экспрессионную конструкцию для синтеза химерного слитного белка, содержащего последовательность фрагмента глютатион-S-трансферазы, пептид RRKKVYPYPME, являющийся субстратом летального фактора В. anthracis, in vivo биотинилируемый пептид, а также легкую цепь ботулинического токсина типа А.

Трансформируют плазмидой pGST/APT/LCBONTA клетки E. coli BL21(DE3), получая тем самым продуцент химерного пептида GST/APT/LCBONTA. Проводят продукцию полипептида в течение 3 ч после индукции жидкой культуры добавлением IPTG. После окончания продукции клеточную биомассу собирают центрифугированием, суспендируют в лизирующем буфере, суспензию бактерий обрабатывают лизоцимом и ДНКазой и центрифугируют для получения осветленного лизата, содержащего полипептид GST/APT/LCBONTA в растворимой форме.

Очистку белка GST/APT/LCBONTA из лизата проводят на колонке с иммобилизованным глутатионом, белок элюируют добавлением буфера, содержащего глутатион. Дополнительную очистку белка и перевод его в буфер для расщепления протеазой летальным фактором В. anthracis осуществляют при помощи эксклюзионной хроматографии на колонке с Superdex 200. Чистоту препарата белка GST/APT/LCBONTA анализируют денатурирующим электрофорезом в полиакрил амид ном геле.

Проверяют эффективность выщепления белка-мишени (~53 кДа) из состава химерного полипептида. Для этого химерный полипептид (~82 кДа) обрабатывают протеазой летальным фактором В. anthracis в соотношении 1 мкг/10 мг белка при 30°С в течение 1 ч. Анализ продуктов расщепления проводят гель-электрофорезом в денатурирующих условиях в полиакриламидном геле (фиг. 4).

Раунд позитивной селекции осуществляют следующим образом: химерный белок GST/APT/LCBONTA иммобилизуют на магнитных частицах, покрытых глутатионом, за счет взаимодействия глутатион-S-трансферазы в составе химерного белка с глутатионом на поверхности магнитных частиц; проводят инкубацию подготовленных магнитных частиц, несущих химерную конструкцию, с пулом одноцепочечных олигонуклеотидов, подвергшихся предварительно негативной селекции; промывают магнитные частицы от несвязавшихся олигонуклеотидов потоком отмывающего раствора в трубке, пропущенной сквозь магнит; отделяют аптамеры, специфически связанные с белком-мишенью LC BoNT/A, от конструкта GST/APT/LCBONTA и микросфер, удерживаемых магнитом, в раствор обработкой комплекса протеазой летальным фактором Bacillus anthracis; отобранный пул олигонуклеотидов очищают методом фенол-хлороформной экстракции и концентрируют осаждением в этаноле, после чего проводят обогащение пула аптамеров амплификацией с использованием праймеров ForFAM и RevP (отжиг при 54°С, элонгация 15 с). Получение одноцепочечного продукта и контроль его образования проводят аналогично описанному на этапе негативной селекции. Проводят пять раундов позитивной селекции (фиг. 5).

Получают индивидуальные последовательности аффинных к LC BoNT/A аптамеров. Для этого пул олигонуклеотидов, прошедший все раунды селекции, амплифицируют с применением прямого ForP и обратного RevP праймеров (фиг. 1), фосфорилированных по 5′-концу. Двуцепочечный ПЦР-продукт лигируют в вектор pBluescriptII SK(-) (Agilent Technologies, США), расщепленный эндонуклеазой рестрикции SmaI (Thermo, США) и обработанный щелочной фосфатазой (Invitrogen, США). Полученной плазмидой трансформируют электрокомпетентные клетки Е. coli DH12S. Клетки высевают на плотную питательную среду, содержащую ампициллин, X-Gal и IPTG. По принципу бело-голубой селекции выбирают и отсевают колонии, содержащие вставку в составе плазмиды. Проверяют наличие искомой вставки в ПЦР со стандартными праймерами M13/pUC (фиг. 6). Колонии, содержащие вставку, соответствующую по размеру единичному аптамеру, подвергают амплификации с собственных праймеров ForFAM и RevP и получают одноцепочечные фрагменты методом, описанным выше.

Проводят скрининг индивидуальных последовательностей аффинных к протеолитическому домену BoNT/A аптамеров в отношении чувствительности и специфичности связывания с белком-мишенью и контрольной панелью рекомбинантных белков токсинов. Для этого индивидуальные последовательности инкубируют в лунках ПЦР-планшета, на поверхности которых иммобилизованы следующие белки: протеолитический домен BoNT/A (LC BoNT/A), рецептор-связывающий домен тяжелой цепи BoNT/A (НС 50 BoNT/A), рецептор-связывающий домен тяжелой цепи BoNT/B (НС 50 BoNT/B), летальный фактор В. anthracis (LF), протективный антиген В. anthracis (РА), шига-токсины энтерогеморрагической Е. coli O157:Н7 (Stx1 и Stx2), дифтерийный токсин (DT), стафилококковые энтеротоксины А и В (SEA и SEB), термолабильный токсин Е. coli (LT). Лунки планшета отмывают от свободных молекул ДНК, затем проводят ПЦР в режиме реального времени с применением интеркалирующего флуоресцентного красителя (фиг. 7).

Для последовательностей с наиболее выраженными свойствами чувствительности и специфичности определяют константу аффинности на приборе ProteOn™ XPR36 Protein Interaction Array System (Bio-Rad, США).

Выбранные аптамеры тестируют в отношении ингибирования протеолитической активности легкой цепи ботулотоксина типа А. Для этого используют рекомбинантный флуоресцентный субстрат, содержащий последовательности белков CFP и YFP, разделенные последовательностью SNAP-25, представляющей собой субстрат для протеазы легкой цепи ботулотоксина типа А. Данный субстрат может быть использован для исследования протеолитической активности ботулинического токсина во FRET-анализе. Исследуют ингибирование расщепления SNAP-25 при добавлении в раствор аптамеров к LC BoNT/A. Результат визуализируют электрофорезом в денатурирующих условиях (фиг. 8).

Проводят определение первичных последовательностей аптамеров, связывающихся с легкой цепью BoNTA и ингибирующих опосредованный ею протеолиз.

Изобретение иллюстрируют следующие графические материалы:

Фиг. 1. Последовательности ДНК, используемые для отбора молекул ДНК, для обогащения селектированного пула и для проведения амплификации полученных аптамерных последовательностей.

1) Последовательность олигонуклеотидной библиотеки, используемой в процессе селекции, где N45 - вариабельная область, const1 и const2 - константные области для отжига специфических праймеров;

2) Последовательности праймеров, используемых в реакциях обогащения библиотеки, для клонирования и наращивания количества последовательностей ДНК-аптамеров.

Фиг. 2. Расщепление обратной цепи ДНК при обработке двуцепочечного фрагмента 5′-экзонуклеазой фага лямбда.

1. Маркер молекулярной массы (50 bp DNA Ladder, New England BioLabs, США);

2. Двуцепочечный фрагмент ДНК;

3. Отрицательный контроль (амплификация без внесения целевой ДНК);

4. Одноцепочечный фрагмент ДНК, полученный после обработки ПЦР-продукта 5′-экзонуклеазой фага лямбда.

Изображение получено с использованием лазерного сканера Typhoon FLA 9500.

Фиг. 3. Последовательность gst-apt-lcbonta в составе плазмидной конструкции и экспрессируемый пептид GST/APT/LCBONTA.

Фиг. 4. Результат расщепления пептида GST/APT/LCBONTA в присутствии протеазы летального фактора В. anthracis.

1. Маркер молекулярной массы (PageRuler™ Prestained Protein Ladder #SM0671, Fermentas, США);

2. Химерный белок GST/APT/LCBONTA без добавления летального фактора В. anthracis;

3. Белок протеаза летальный фактор В. anthracis;

4. Химерный белок GST/APT/LCBONTA после обработки летальным фактором В. anthracis.

Фиг. 5. Принципиальная схема селекции ДНК-аптамеров, обладающих специфической активностью в отношении LC BoNT/A.

A) Схема негативной селекции аптамеров из исходной комбинаторной библиотеки олигонуклеотидов.

B) Схема позитивной селекции преселектированных аптамеров против LC BoNT/A.

Фиг. 6. Типичные результаты ПЦР со стандартными праймерами М13 отдельных выделенных колоний после клонирования селектированного пула ДНК в вектор pBluescriptII SK(-).

1. Маркер молекулярной массы (O′RangeRuler 100+500 bp DNA Ladder, Thermo Scientific, США);

2. Контроль (апмлификация исходной плазмиды pBluescriptll SK(-) со стандартными праймерами М13;

3. Отрицательный контроль (амплификация без внесения ДНК мишени);

4, 6, 7, 9. Результаты амплификации клонов, содержащих две копии вставки;

5, 8, 10. Результаты амплификации клонов, содержащих одну копию вставки, соответствующей 81 нуклеотиду.

Изображение получено с использованием лазерного сканера Typhoon FLA 9500.

Фиг. 7А. Принципиальная схема проведения анализа для первичного скрининга чувствительности и специфичности индивидуальных последовательностей аптамеров.

Фиг. 7В. Типичные результаты скрининга чувствительности и специфичности индивидуальных последовательностей аптамеров на примере последовательностей APT/LCBONTA N10, APT/LCBONTA N16.

Фиг. 8. Результаты скрининга аптамеров APT/LCBONTA N10, APT/LCBONTA N16 на наличие блокирующей активности в отношении LC BoNT/A с использованием рекомбинантного субстрата CFP-SNAP-25-YFP.

1. Маркер молекулярной массы (PageRuler Plus Prestained Protein Ladder, Thermo, США);

2. Рекомбинантный белок-субстрат CFP-SNAP-25-YFP;

3. Белок-субстрат CFP-SNAP-25-YFP, обработанный протеазой LC BoNT/A;

4. Белок-субстрат CFP-SNAP-25-YFP, обработанный протеазой LC BoNT/A в присутствии аптамера APT/LCBONTA N10;

5. Белок-субстрат CFP-SNAP-25-YFP, обработанный протеазой LC BoNT/A в присутствии аптамера APT/LCBONTA N16.

Фиг. 9. Первичные последовательности аптамеров, специфичных к LC BoNT/A.

Для лучшего понимания сущности изобретения ниже следуют примеры его конкретного выполнения.

Пример 1. Проведение раунда негативной селекции последовательностей ДНК из пула комбинаторной библиотеки олигонуклеотидов против БСА и казеина.

Бычий сывороточный альбумин, имеющий массу 69 кДа, в количестве 500 мкг растворяют в 1 мл буферного раствора, содержащего 20 мМ Трис-HCl, 50 мМ NaCl и 5 мМ EDTA (pH 7,4). К полученному раствору добавляют 20 мкг (4×1014 молекул) исходной комбинаторной библиотеки олигонуклеотидов. Таким образом, в смеси представлен молярный избыток белка по отношению к ДНК. Смесь инкубируют в течение 1 ч при температуре 37°С со встряхиванием на орбитальном шейкере. По окончании инкубации смесь разделяют при помощи эксклюзионной хроматографии на колонке, содержащей сорбент низкого давления Superdex 200™ (GE Healthcare, Великобритания), в буферном растворе состава 20 мМ Трис-HCl, 300 мМ NaCl, 5 мМ EDTA (pH 7,4), при скорости потока 0,5 мл/мин и идентифицируют фракции, содержащие молекулы ДНК, несвязавшиеся с молекулами белка, и молекулы ДНК, ассоциировавшие с белком.

Выделенный пул олигонуклеотидов, не связывающихся с БСА, доочищают с использованием метода фенол-хлороформной экстракции нуклеиновых кислот, затем концентрируют преципитацией ДНК этанолом в присутствии копреципитанта Pellet Paint® Co-Precipitant (Novagen, Германия) и амплифицируют с использованием ПЦР. Амплификацию проводят с использованием праймеров: прямого ForFAM, несущего в положении 5′ флуоресцентную метку карбоксифлуоресцеин, и обратного RevP, фосфорилированного по 5′-концу последовательности (температура отжига праймеров 54°С, время элонгации 15 с) (фиг. 1). В результате проведенной ПЦР получают двуцепочечный фрагмент, одна из цепей которого мечена FAM.

Для получения обогащенного пула одноцепочечных фрагментов ПЦР-продукт обрабатывают 5′-экзонуклеазой фага лямбда, которая расщепляет обратную фосфорилированную цепь фрагмента [Higuchi R.G., Ochman H. // Nucleic Acids Research. - 1989. - V. 17. - N. 14. - P. 5865]. Эффективность расщепления цепи контролируют проведением электрофореза в 10%-ном полиакриламидном геле, содержащем мочевину с последующим окрашиванием бромистым этидием, при этом наличие в пробе только полосы, флуоресцирующей зеленым, свидетельствует об успешном расщеплении обратной цепи фрагмента, а присутствие в пробе второй полосы с красным цветом флуоресценции свидетельствует о неуспешном или неполном расщеплении фосфорилированной цепи ДНК (фиг. 2)

Полученный пул одноцепочечных ДНК, истощенных на связывание с БСА, экстрагируют смесью фенол-хлороформ, концентрируют, используя преципитацию этанолом. Пул олигонуклеотидов, в количестве 20 мкг примешивают к 1 мл буферного раствора (20 мМ Трис-HCl, 50 мМ NaCl и 5 мМ EDTA, pH 7,4), содержащему 250 мкг α-казеина (молекулярная масса 20 кДа), что также составляет молярный избыток белка по отношению к ДНК. Инкубируют смесь 1 ч при 37°С, после чего разделяют гель-фильтрационной хроматографией и обогащают амплификацией, как описано выше.

Проводят еще 2 аналогичных раунда селекции для каждого белка-мишени.

Пример 2. Проведение раунда позитивной селекции последовательностей олигонуклеотидов против легкой цепи токсина типа А С. botulinum.

Выделенный из лизата культуры Е. coli BL21(DE3) растворимый химерный пептид GST/APT/LCBONTA иммобилизуют на поверхности магнитных микрочастиц, покрытых глутатионом. Для этого 100 мкл суспензии частиц Pierce™ Glutathione Magnetic Beads (Thermo, США) в пробирке объемом 1,5 мл помещают на магнитный штатив DynaMag™-2 Magnet (Invitrogen, США), отбирают жидкость. Сняв пробирку со штатива, ресуспендируют микрочастицы в 300 мкл буфера состава 125 мМ Трис, 150 мМ NaCl, pH 8,0. Вновь помещают пробирку в магнитный штатив и отбирают жидкость. Повторяют трижды, отмывая тем самым микрочастицы от буфера хранения.

Белок химерного конструкта GST/APT/LCBONTA приводят к конечной концентрации 1 мг/мл и объему 300 мкл буфером 125 мМ Трис-HCl рН 8.0, 150 мМ NaCl. Добавляют суспензию белка к изолированным с помощью магнитного стенда магнитным микрочастицам. Инкубируют суспензию при комнатной температуре в течение 1 ч, встряхивая пробирку на вортексе каждые 15 мин. По окончании инкубации помещают пробирку в магнитный штатив и отбирают супернатант. Пятикратно отмывают частицы 500 мкл того же буферного раствора. Ресуспендируют частицы в 300 мкл буфера. При необходимости хранят при +4°С, добавив к суспензии натрия азид до конечной концентрации 0,02%.

Перед добавлением пула аптамеров к магнитным микрочастицам помещают пробирку в магнитный штатив и отбирают супернатант. Добавляют суспензию одноцепочечных аптамеров, подвергшихся предварительной негативной селекции, в объеме 300 мкл (буферный раствор состава 20 мМ Трис-HCl, 50 мМ NaCl, 5 мМ EDTA, pH 7,4) с содержанием ДНК в растворе 50 мкг. Инкубируют суспензию на протяжении 1 ч при комнатной температуре при периодическом перемешивании на вортексе. Отмывают магнитные частицы от несвязавшихся молекул ДНК потоком буферного раствора объемом 300 мл состава 20 мМ Трис-HCl, 250 мМ NaCl, 5 мМ EDTA, рН 7,4, используя систему проточной магнитной сепарации MiniMACS™ Separator (Miltenyi Biotec, Германия). Удалив магнитное воздействие на частицы, несущие на своей поверхности химерный полипептид GST/APT/LCBONTA, связанный с аптамерами, собирают микросферы в чистую пробирку объемом 1,5 мл. Фиксируя магнитные микросферы, отбирают супернатант. Добавляют 300 мкл раствора протеазы летального фактора В. anthracis [патент РФ №2355769] с содержанием 5 мкг протезы в буфере 30 мМ Трис-HCl, рН 7.4. Выдерживают в течение 1 ч при температуре 30°С.Фиксируют частицы при помощи магнитного штатива, отбирают супернатант, содержащий отщепленный белок легкой цепи ботулотоксина А, несущий специфически связанные аптамеры. Пул олигонуклеотидов очищают методом фенол-хлороформной экстракции и концентрируют преципитацией этанолом, как описано выше (фиг. 5).

Наращивают селектированный пул аптамеров с помощью ПЦР-амплификации с использованием прямого праймера ForFAM и обратного праймера RevP (фиг. 1). Получают одноцепочечный продукт обработкой способом, описанным выше, контроль удаления комплементарной цепи ДНК осуществляют при помощи электрофореза в ПААГ (фиг. 2).

Полученный обогащенный пул ДНК-аптамеров используют для осуществления дальнейших раундов селекции.

Всего проводят пять раундов позитивной селекции.

Пример 3. Получение индивидуальных последовательностей олигонуклеотидов, подвергшихся негативной селекции.

Фрагменты для клонирования в коммерческий вектор pBluescriptll SK(-) (Agilent Technologies, США) нарабатывают на основе пула селектированных олигонуклеотидов при помощи ПЦР с использованием прямого и обратного фосфорилированных праймеров ForP и RevP (отжиг праймеров при 54°С, элонгация 15 с) (фиг. 1). Плазмиду pBluescriptll SK(-) обрабатывают эндонуклеазой рестрикции SmaI в буфере Tango (Thermo, США), после чего обрабатывают щелочной фосфатазой (Invitrogen, США). Фосфорилированные двуцепочечные фрагменты ДНК лигируют в подготовленную плазмиду.

Электрокомпетентные клетки E. coli DH12S трансформируют подготовленной ранее плазмидой pBluescriptll SK(-), содержащей вставки селектированных последовательностей, применив электротрансформацию (прибор Eppendorf Electroporator 2510 (Eppendorf, Германия), режим 1,7 кB). Трансформированные клетки высевают на плотную среду с 2xYT-агаром, содержащим 50 мкг/мл ампициллина, 80 мкг/мл X-Gal и 20 мМ IPTG, и выращивают в течение ночи при 37°С.

Единичные колонии, потенциально содержащие вектор со вставкой (по принципу бело-голубой селекции [Ullmann A, Jacob F, Monod J. // J Mol Biol. - 1967. - V. 24. - N. 2. - P. 339-343.]) верифицируют на наличие единичного встроенного фрагмента ДНК искомой длины в плазмиде с помощью ПЦР со стандартными прямым и обратным праймерами M13/pUC (Fermentas, США) (фиг. 6). Наращивают количество копий индивидуальных последовательностей клонированных фрагментов ДНК амплификацией с использованием праймеров ForFAM и RevP (фиг. 1). Получают одноцепочечный продукт для каждого из клонов обработкой 5′-экзонуклеазой фага лямбда с визуальным контролем в электрофорезе (фиг. 2). Таким образом получают клонированные одноцепочечные индивидуальные последовательности из 500 бактериальных клонов.

Пример 4. Скрининг чувствительности и специфичности индивидуальных селектированных последовательностей в отношении протеолитического домена ботулотоксина типа А и панели контрольных рекомбинантных белков токсинов.

На поликарбонатном 96-луночном ПЦР-планшете с высокосвязывающей поверхностью (Corning, США) иммобилизуют белки: протеолитический домен BoNT/A (LC BoNT/A), рецептор-связывающий домен тяжелой цепи BoNT/A (НС 50 BoNT/A), рецептор-связывающий домен тяжелой цепи BoNT/B (НС 50 BoNT/B), летальный фактор В. anthracis (LF), протективный антиген В. anthracis (РА), шига-токсины Stx1 и Stx2 энтерогеморрагической Е. coli O157:Н7, дифтерийный токсин (DT), стафилококковые энтеротоксины А и В (SEA и SEB), термолабильный токсин Е. coli (LT). Первый вертикальный ряд планшета (8 лунок) не содержит белки и его лунки служат в качестве отрицательных контрольных проб. Начиная со второго вертикального ряда вносят рекомбинатные белки из исследуемой панели в количестве 0,5 мкг/лунку в фосфатно-солевом буфере, рН 7,4 (ФСБ) в объеме 50 мкл. Инкубируют планшет на протяжении часа при 37°С при встряхивании на орбитальном шейкере. По окончании инкубации трижды отмывают лунки планшета ФСБ, содержащим 0,05% Tween-20. Свободные валентности планшета блокируют буфером, состоящим из обезжиренного (содержание жира 0,5%) молока с добавлением 3% БСА, в объеме 200 мкл/лунку в течение 40 минут при 37°С на орбитальном шейкере. Отмывку производят трижды ФСБ с 0,05% Tween-20.

Затем в лунки горизонтальных рядов планшета вносят одноцепочечную ДНК индивидуальных аптамеров в объеме 50 мкл и количестве 0,2 мкг/лунку. В первый и второй горизонтальные ряды в качестве контроля сравнения вносят исходную комбинаторную библиотеку. В последующие горизонтальные ряды вносят ДНК аптамеров (в 2 ряда по 12 лунок). Таким образом, каждая проба исследуется в двух повторностях (фиг. 7А). Буфер для разведения ДНК содержит 20 мМ Трис-HCl, 50 мМ NaCl, 5 мМ EDTA, pH 7,4. Инкубируют планшет с ДНК в течение 1 ч при 37°С. Отмывку от несвязавщихся молекул ДНК производят раствором, содержащим 20 мМ Трис-HCl, 300 мМ NaCl, 5 мМ EDTA, pH 7,4 пятикратно.

Контролируют реакцию связывания ДНК с белками в ПЦР в режиме реального времени. Для этого в лунки планшета вносят амплификационную смесь, содержащую флуоресцентный интеркалирующий краситель SYBR-Green I (ЗАО "Синтол", Россия) с добавлением праймеров ForP и RevP (фиг. 1). Амплификацию проводят в режиме: температура отжига праймеров 54°С, время элонгации 10 с, детекцию сигнала проводят по каналу SYBR 1(FAM) (прибор IQ™5, Bio-Rad, США) (фиг. 7В).

По результатам предварительного скрининга выделяют 2 индивидуальных клона аптамеров (APT/LCBONTA N10, N16) (фиг. 9), проявившие наибольшую специфическую активность в отношении LC BoNT/A, и вместе с тем не выявляющие неспецифические взаимодействия с другими рекомбинантными белками токсинов, присутствующими в использованной скрининговой панели.

Для указанных последовательностей определяют константы аффинности с использованием системы ProteOn™ XPR36 Protein Interaction Array System (Bio-Rad, США): APT/LCBONTA N10 - 1,2·109 М-1, APT/LCBONTA N16 - 1,3·109 M-1.

Пример 5. Проверка наличия ингибирующей активности селектированных аптамеров в отношении протеолитического домена ботулинического токсина типа А.

Для проверки способности ингибирования протеолитической активности легкой цепи ботулотоксина аптамерами, получают рекомбинантный конструкт, который содержит флуоресцентные белки CFP и YFP, разделенные субстратом для легкой цепи ботулотоксина А - SNAP-25.

В микропробирки вносят 100 мкл смеси флуоресцентного белка CFP-SNAP-25-YFP и рекомбинантного белка LC BoNT/A (в соотношении 1 мкг субстрата к 100 мкг протеазы) в присутствии одноцепочечной ДНК индивидуальных клонов аптамеров (в количестве 50 мкг на 100 мкг протеазы). Инкубируют смесь в течение 1 ч при 30°С. В качестве контроля используют смесь субстрата с протеазой без добавления аптамера.

Контроль эффективности ингибирования протеазы проводят электрофоретически в денатурирующих условиях в 10%-ном полиакриламидном геле в присутствии мочевины и SDS. Окрашивание геля осуществляют кумасси R-250 по стандартной методике. На электрофореграмме полосы с молекулярной массой ~50 кДа соответствуют нерасщепленному субстрату CFP-SNAP-25-YFP, который при воздействии протеазы ботулотоксина А расщепляется на две части с молекулярной массой ~27 кДа и ~23 кДа.

Аптамеры APT/LCBONTA N10 и APT/LCBONTA N16 частично ингибируют расщепление естественного субстрата SNAP-25 протеазой ботулотоксина типа А (фиг. 8).

Перечень последовательностей к заявке на получение патента «Последовательность ДНК-аптамеров, связывающаяся с протеолитической субъединицей нейротоксина типа А Clostridium botulinum"

А) Последовательность gst-apt-lcbonta в составе плазмиды pGST/APT/LCBONTA

В) Аминокислотная последовательность химерного пептида GST/APT/LCBONTA

С) Последовательности ДНК-аптамеров, связывающиеся с протеолитической субъединицей нейротоксина типа A Clostridium botulinum

Перечень последовательностей к заявке на получение патента «Последовательность ДНК-аптамеров, связывающаяся с протеолитической субъединицей нейротоксина типа А Clostridium botulinum

А) Последовательность gst-apt-lcbonta в составе плазмиды pGST/APT/LCBONTA

TCT CGA TCC CGC GAA ATT AAT ACG ACT CAC TAT AGG GGA ATT GTG AGC GGA TAA CAA TTC CCC TCT AGA AAT AAT TTT GTT TAA CTT TAA GAA GGA GAT ATA CAT ATG TCC CCT ATA CTA GGT TAT TGG AAA ATT AAG GGC CTT GTG CAA CCC ACT CGA CTT CTT TTG GAA TAT CTT GAA GAA AAA TAT GAA GAG CAT TTG TAT GAG CGC GAT GAA GGT GAT AAA TGG CGA AAC AAA AAG TTT GAA TTG GGT TTG GAG TTT CCC AAT CTT CCT TAT TAT ATT GAT GGT GAT GTT AAA TTA ACA CAG TCT ATG GCC ATC ATA CGT TAT ATA GCT GAC AAG CAC AAC ATG TTG GGT GGT TGT CCA AAA GAG CGT GCA GAG ATT TCA ATG CTT GAA GGA GCG GTT TTG GAT ATT AGA TAC GGT GTT TCG AGA ATT GCA TAT AGT AAA GAC TTT GAA ACT CTC AAA GTT GAT TTT CTT AGC AAG CTA CCT GAA ATG CTG AAA ATG TTC GAA GAT CGT TTA TGT CAT AAA ACA TAT TTA AAT GGT GAT CAT GTA ACC CAT CCT GAC TTC ATG TTG TAT GAC GCT CTT GAT GTT GTT TTA TAC ATG GAC CCA ATG TGC CTG GAT GCG TTC CCA AAA TTA GTT TGT TTT AAA AAA CGT ATT GAA GCT ATC CCA CAA ATT GAT AAG TAC TTG AAA TCC AGC AAG TAT ATA GCA TGG CCT TTG CAG GGC TGG CAA GCC ACG TTT GGT GGT GGC GAC CAT CCT CCG AAA TCT GGC GAA GAT CTG GGT GGC GGT AGC GGT CGC CGT AAG AAA GTT TAC CCG TAT CCG ATG GAA GGT GGC GGT AGC GGT GGC CTG AAC GAC ATC TTC GAA GCT CAG AAG ATC GAA TGG CAC GAG GAT CCG GGT CTG CCG TTC GTG AAC AAG CAG TTC AAC TAC AAG GAC CCG GTG AAC GGT GTG GAC ATC GCT TAC ATC AAG ATC CCG AAC GCT GGT CAG ATG CAG CCG GTT AAG GCG TTC AAG ATC CAC AAC AAG ATC TGG GTG ATC CCG GAG CGT GAC ACC TTC ACC AAC CCG GAG GAA GGC GAC CTG AAC CCG CCA CCG GAA GCG AAG CAG GTT CCG GTG AGC TAC TAT GAC AGC ACC TAC CTG AGC ACC GAC AAC GAG AAG GAC AAC TAC CTG AAG GGT GTC ACC AAG CTG TTC GAG CGC ATC TAC AGC ACC GAC CTG GGT CGC ATG CTG CTC ACC AGC ATC GTG CGT GGC ATC CCG TTC TGG GGT GGC AGC ACC ATC GAC ACC GAG CTG AAG GTG ATC GAC ACC AAC TGC ATC AAC GTG ATC CAG CCG GAC GGC AGC TAC CGC AGC GAA GAG CTG AAC CTG GTG ATC ATT GGT CCG AGC GCT GAC ATC ATT CAG TTC GAG TGC AAG AGC TTC GGC CAC GAG GTT CTG AAC CTG ACG CGC AAC GGT TAC GGC AGC ACC CAG TAC ATC CGC TTC AGC CCA GAC TTC ACC TTC GGC TTC GAA GAG AGC CTG GAG GTC GAC ACC AAC CCG CTG CTC GGT GCT GGC AAG TTC GCG ACC GAC CCG GCT GTG ACC CTG GCT CAC GAG CTG ATC CAC GCT GGC CAC CGC CTG TAC GGC ATC GCG ATC AAC CCG AAC CGT GTG TTC AAG GTG AAC ACC AAC GCC TAC TAT GAG ATG AGC GGC CTG GAG GTG AGC TTC GAG GAA CTG CGC ACC TTC GGT GGC CAC GAC GCG AAG TTC ATC GAC AGC CTG CAG GAG AAC GAG TTC CGT CTG TAC TAT TAC AAC AAG TTC AAG GAC ATC GCG AGC ACC CTG AAC AAG GCT AAG AGC ATC GTT GGT ACC ACT GCG AGC CTG CAG TAC ATG AAG AAC GTG TTC AAG GAG AAG TAC CTC CTG AGC GAG GAT ACC AGC GGC AAG TTC AGC GTG GAC AAG CTG AAG TTC GAC AAG CTG TAC AAA ATG TTA ACA GAG ATT TAC ACA GAG GAT AAC TTC GTT AAG TTC TTT AAG GTG CTG AAC CGC AAG ACC TAC CTG AAC TTC GAC AAG GCC GTG TTC AAG ATC AAC ATC GTT CCG AAG GTG AAC TAC ACC ATC TAC GAC GGC TTC AAC CTG CGC AAC ACC AAC CTG GCT GCG AAC TTC AAC GGT CAG AAC ACC GAG ATC AAC AAT ATG AAC TTC ACC AAG CTG AAG AAC TAA GAG CTCC GTC GAC AAG CTT GCG GCC GCA CTC GAG CAC CAC CAC CAC CAC CAC TGA

B) Аминокислотная последовательность химерного пептида GST/APT/LCBONTA

Met S P I L G Y W K I K G L V Q P T R L L L E Y L E E K Y E E H L Y E R D E G D K W R N K K F E L G L E F P N L P Y Y I D G D V K L T Q S Met A I I R Y I A D K H N Met L G G C P K E R A E I S Met L E G A V L D I R Y G V S R I A Y S K D F E T L K V D F L S K L P E Met L K Met F E D R L C H K T Y L N G D H V T H P D F Met L Y D A L D V V L Y Met D P Met C L D A F P K L V C F K K R I E A I P Q I D K Y L K S S K Y I A W P L Q G W Q A T F G G G D H P P K S G E D L G G G S G R R K K V Y P Y P Met E G G G S G G L N D I F E A Q K I E W H E D P G L P F V N K Q F N Y K D P V N G V D I A Y I K I P N A G Q Met Q P V K A F K I H N K I W V I P E R D T F T N P E E G D L N P P P E A K Q V P V S Y Y D S T Y L S T D N E K D N Y L K G V T K L F E R I Y S T D L G R Met L L T S I V R G I P F W G G S T I D T E L K V I D T N C I N V I Q P D G S Y R S E E L N L V I I G P S A D I I Q F E C K S F G H E V L N L T R N G Y G S T Q Y I R F S P D F T F G F E E S L E V D T N P L L G A G K F A T D P A V T L A H E L I H A G H R L Y G I A I N P N R V F K V N T N A Y Y E Met S G L E V S F E E L R T F G G H D A K F I D S L Q E N E F R L Y Y Y N K F K D I A S T L N K A K S I V G T T A S L Q Y Met K N V F K E K Y L L S E D T S G K F S V D K L K F D K L Y K Met L T E I Y T E D N F V K F F K V L N R K T Y L N F D K A V F K I N I V P K V N Y T I Y D G F N L R N T N L A A N F N G Q N T E I N N Met N F T K L K N Stop

С) Последовательности ДНК-аптамеров, связывающиеся с протеолитической субъединицей нейротоксина типа А Clostridium botulinum

APT/LCBONTA N10 CA-TAC-GTT-CGA-CTG-CTA-C CCTCCACTTTTGACGGCTTCCTCGGGATTATACGGCTAACCGAGG
GT-GAG-ATG-TAC-AGA-CTA-G
APT/LCBONTA N16 CA-TAC-GTT-CGA-CTG-CTA-C TСTGCTGGGATGGCCTAGCAGCCGATTATTGGGCTAAGCGGGCGT
GT-GAG-ATG-TAC-AGA-CTA-G

Последовательность ДНК-аптамера, связывающаяся с протеолитической субъединицей нейротоксина типа A Clostridium botulinum, состоящая из одноцепочечной ДНК длиной 81 нуклеотид, выбранной из группы: APT/LCBONTA N10, представляющая собой CATACGTTCGACTGCTACCCTCCACTTTTGACGGCTTCCTCGGGATTATACGGCTA ACCGAGGGTGAGATGTACAGACTAG, или APT/LCBONTA N16, представляющая собой CATACGTTCGACTGCTACTCTGCTGGGATGGCCTAGCAGCCGATTATTGG GCTAAGCGGGCGTGTGAGATGTACAGACTAG, обладает высокой специфичностью в отношении протеолитической субъединицы (легкой цепи) токсина типа A Clostridium botulinum с константами аффинности соответственно: 1,2·109 М-1, 1,3·109 М-1, образует трехмерные структуры, способна ингибировать протеолитическую активность легкой цепи BoNT/A, отобрана с применением комбинации негативной селекции против белков бычьего сывороточного альбумина и α-казеина молока и позитивной селекции в отношении рекомбинантного белка легкой цепи ботулинического токсина типа А с использованием системы магносепарации в совокупности с выщеплением белка-мишени, аффинно связанного со специфичными аптамерами, из состава химерного рекомбинантного полипептида при помощи протеазы летального фактора Bacillus anthracis.



 

Похожие патенты:

Изобретение относится к области биотехнологии, а именно к набору для выявления ДНК вируса оспы свиней методом полимеразной цепной реакции в реальном времени. Набор включает олигонуклеотидные праймеры и флуоресцентно-меченый зонд следующего состава: SPVU - 5' - gta сса ttt tgg agg аса cg - 3', SPVD - 5' - ttc aat aaa tcg cca gtt gta с - 3', SPVZ - 5'- [FAM] ggt acc ata tct ata tat ccc tgt tg [BHQ1] - 3'.

Изобретение относится к биотехнологии, а именно к выделенному пептиду, который имеет индуцибельность цитотоксических Т-лимфоцитов (CTL), а также к его применению. Предложенный пептид может использоваться в противораковой иммунотерапии, более конкретно, в противораковых вакцинах.

Группа изобретений относится к области биотехнологии, в частности к антисмысловым олигомерам, используемым в качестве активного ингредиента в фармацевтических композициях для лечения мышечной дистрофии.

Изобретение относится к биотехнологии, а именно к способам детекции нуклеиновокислотной последовательности-мишени из ДНК или смеси нуклеиновых кислот в анализе с РТОСЕ (расщеплением и удлинением РТО).

Изобретение относится к биотехнологии, а именно к последовательности ДНК-аптамеров. Указанный ДНК-аптамер связывается с шига-токсином типа 2 и представляет собой одноцепочечную ДНК AptStx2B17 длиной 81 нуклеотид и молекулярной массой 27 кДа.

Изобретение относится к биотехнологии, а именно к последовательности ДНК-аптамера. Указанный ДНК-аптамер связывается с бактериями Escherichia coli O157:Н7 и представлен одноцепочечной ДНК O157Flank длиной 81 нуклеотид и молекулярной массой 27 кДа.

Изобретение относится к биотехнологии, а именно к последовательности ДНК, которую используют в качестве зонда для обеспечения максимального соотношения «сигнал/фон» в тест-системах на основе иммуно-ПЦР.

Изобретение относится к области биотехнологии и касается способа дифференциации биоваров и геновариантов штаммов Yersinia pestis основного подвида с помощью полимеразной цепной реакции.

Изобретение относится к биотехнологии, а именно к способу захвата и амплификации избранной последовательности и набору для его осуществления. Способ включает получение субстрата, представленного твердофазной подложкой, содержащего первую и вторую популяции связанных с поверхностью олигонуклеотидов, где данные олигонуклеотиды распределены случайным образом относительно друг друга на субстрате.

Изобретение относится к области биотехнологии, конкретно к получению вариантов плазминогена и плазмина, содержащих одну или несколько точковых мутаций в каталитическом домене, которые снижают или предотвращают аутокаталитическую потерю протеазной активности плазмина, и может быть использовано в медицине.

Настоящее изобретение относится к биохимии и раскрывает твердую подложку, к которой присоединено содержащее полиэтиленгликоль соединение (3'-ПЭГ-СКП), а также способ получения указанного соединения. Способ предусматривает реакцию СКП с 3-аминопропилтриэтоксисиланом с образованием длинноцепочеченого алкиламина и стекла с контролируемым размером пор (ДЦАА-СКП), затем реакцию полиэтиленгликоля с 4,4'-диметокситритилхлоридом с образованием 2[бис-(4-диметокситритил)полиэтиленгликоля)] и еще ряд стадий. Настоящее изобретение позволяет получать 3'-ПЭГ-СКП с высоким выходом. 2 н. и 1 з.п. ф-лы, 1 табл., 6 пр.

Изобретение относится к области биохимии. Заявлен лиганд гликопротеина VI (GPVI), представляющий собой нуклеиновую кислоту, который взаимодействует с гликопротеином тромбоцитов GPVI и модулирует его активность с регуляцией функции тромбоцитов. Лиганд имеет вторичную структуру, содержащую в направлении от 5′ к 3′ первый стебель, первую петлю, второй стебель, вторую петлю, третью петлю, третий стебель и четвертую петлю. Четвертая петля содержит UAA. Последовательность лиганда модифицирована для увеличения устойчивости к нуклеазам. Лиганд может применяться для ингибирования агрегации тромбоцитов. Также представлены модуляторы, ингибирующие активность лиганда, с восстановлением функции GPVI. Кроме того, изобретение относится к композициям, содержащим лиганд или модулятор, предназначенным для лечения опосредуемых тромбоцитами нарушений. 8 н. и 15 з.п. ф-лы, 39 ил., 7 табл., 8 пр.

Изобретение относится к области биохимии. Заявлен лиганд гликопротеина VI (GPVI), представляющий собой нуклеиновую кислоту, который взаимодействует с гликопротеином тромбоцитов GPVI и модулирует его активность с регуляцией функции тромбоцитов. Лиганд имеет вторичную структуру, содержащую в направлении от 5′ к 3′ первый стебель, первую петлю, второй стебель, вторую петлю, третью петлю, третий стебель и четвертую петлю. Четвертая петля содержит UAA. Последовательность лиганда модифицирована для увеличения устойчивости к нуклеазам. Лиганд может применяться для ингибирования агрегации тромбоцитов. Также представлены модуляторы, ингибирующие активность лиганда, с восстановлением функции GPVI. Кроме того, изобретение относится к композициям, содержащим лиганд или модулятор, предназначенным для лечения опосредуемых тромбоцитами нарушений. 8 н. и 15 з.п. ф-лы, 39 ил., 7 табл., 8 пр.

Группа изобретений относится к области молекулярной биологии. Сущность изобретения состоит в подавлении активности активированного онкогена AML-ETO методом РНК-интерференции в злокачественных кроветворных клетках, полученных от больных лейкозом, с использованием конструкции малой шпилечной РНК, встроенной в лентивирусный вектор pLSLP-AML-ETO-shRNA, кодируемой нуклеотидной последовательностью двухцепочечной ДНК, представляющей собой: 5′-р-gatccgCCTCGAAATCGTACTGAGActtcctgcaa TCTCAGTACGATTTCGAGGtttttg-3′ (смысловая цепь), 5′-р-aattcaaaaaCCTCGAAATCGTACT GAGAttgcaggaagTCTCAGTACGATTTCGAGGcg-3′ (антисмысловая цепь). Ингибирование активности конкретного онкогена посредством малой шпилечной РНК позволяет определить спектр изменения экспрессии генов, ответственных за рост и дифференцировку кроветворных клеток, и обнаружить те из них, изменение активности которых напрямую связано с активацией данного онкогена, и определить, в какой мере воздействие на такие гены - потенциальные мишени оказывает влияние на способность злокачественных клеток к неконтролируемому росту. 2 н.п. ф-лы, 7 ил., 2 табл. 2 пр.

Изобретение относится к биотехнологии. Предложена рекомбинантная ДНК, обеспечивающая в составе плазмидного вектора синтез в клетках E.coli химерного белка аполипопротеина Α-I человека, размером 852 п.н. Рекомбинантная ДНК последовательно включает с 5′-конца фрагмент ДНК, кодирующий 6 а.о. гистидина размером 18 п.н. (SEQ ID NO 1), фрагмент ДНК, кодирующий 6 а.о. пpο-формы белка апоА-I человека размером 18 п.н. (SEQ ID NO 2), фрагмент ДНК, кодирующий N-концевой фрагмент из 15 а.о. бычьей панкреатической РНКазы А размером 45 п.н. (SEQ ID NO 3), фрагмент ДНК, кодирующий 6 а.о. пpο-формы белка апоА-I человека размером 18 п.н. (SEQ ID NO 2), фрагмент ДНК, кодирующий сайт узнавания протеазы вируса табачной мозаики размером 21 п.н. (SEQ ID NO 4), мутантный ген зрелого белка апоА-I человека размером 729 п.н. (SEQ ID NO 5). Выход химерного белка аполипопротеина Α-I человека из 1 л культуры клеток E.coli составляет 182±32 мг, что составляет 39,7±6,2 мг из 1 г биомассы. 5 ил., 3 табл., 9 пр.

Изобретение относится к области биохимии, в частности к молекулам нуклеиновой кислоты для модуляции экспрессии генов-мишеней. Заявлена двухцепочечная молекула нуклеиновой кислоты для ингибирования экспрессии гена белка теплового шока 47 (hsp47). Также представлены композиция, включающая указанную молекулу нуклеиновой кислоты, и способ лечения пациента, страдающего от заболевания, связанного с hsp47. Изобретение может быть использовано для лечения ассоциированных с hsp47 состояний и нарушений, таких как фиброз печени, фиброз легких, фиброз брюшины и фиброз почек. 3 н. и 22 з.п. ф-лы, 27 ил., 31 табл., 10 пр.

Настоящее изобретение относится к фосфодиэстеразе 4D7 (PDE4D7) для применения в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера повышена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы с экспрессией в нормальной ткани или ткани доброкачественной опухоли предстательной железы, и к применению PDE4D7 в качестве диагностического маркера для агрессивного гормон-чувствительного рака предстательной железы. Также настоящее изобретение относится к композиции для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы, к соответствующему способу обнаружения, к способу, позволяющему различить доброкачественный и агрессивный гормон-чувствительный рак предстательной железы, и к способу сбора данных, а также к соответствующим иммуноанализам. Также настоящее изобретение относится к способу идентификации индивидуума, соответствующего требованиям для агрессивного гормон-чувствительного рака предстательной железы, а также к иммуноанализу для стратификации индивидуума с таким раком предстательной железы. Кроме того, настоящее изобретение относится к фармацевтическим композициям и к их применению для лечения агрессивного гормон-чувствительного рака предстательной железы. Изобретение позволяет эффективно диагносцировать гормон-чувствительный рак предстательной железы. 12 н. и 20 з.п. ф-лы, 19 ил., 2 табл., 3 пр.

Изобретение относится к области биотехнологии, а именно к способу выявления РНК вируса бешенства и набору, который используется в данном способе. Способ включает проведение ОТ-ПЦР с олигонуклеотидными праймерами. Праймеры имеют следующие нуклеотидные последовательности: fp_850_gp_rabv 5' TTAGACTTATGGATGGAACATGGGT 3', rp_850_gp_rabv 5' AGTGACTGACACCTCCCTCCCT 3', fp_350_gp_rabv 5'TCAGACGAAATTGAGCACCTTGT3', rp_350_gp_rabv 5'ACCTCCCCCCAACTCTTAAACA3'. ОТ-ПЦР проводят в два раунда, при этом в случае положительной реакции синтезируется фрагмент, соответствующий размеру в первом раунде - 755 п.н., во втором - размеру 259 п.н. Предложенное изобретение позволяет проводить выявление РНК штаммов и изолятов вируса бешенства различного происхождения на ранних этапах клинического проявления, а также снизить себестоимость диагностики. 2 н.п. ф-лы, 2 ил., 3 табл., 4 пр.

Изобретение относится к биохимии. Раскрыты способы повышения экспрессии полинуклеотида PAR4, включающие осуществление контакта с по меньшей мере одним олигонуклеотидом длиной от 15 до 30 нуклеотидов, который нацелен на природную антисмысловую последовательность для полинуклеотида PAR4, и при этом указанная природная антисмысловая последовательность имеет последовательность, представленную в SEQ ID NO: 2. Представлен синтетический модифицированный олигонуклеотид длиной от 15 до 30 нуклеотидов и фармацевтическая композиция, содержащая указанный олигонуклеотид. Раскрыт способ индукции апоптоза в биологической системе, экспрессирующей или с приобретенной способностью экспрессировать продукты генов PAR4, включающий введение олигонуклеотида длиной от 15 до 30 нуклеотидов в указанную систему, который нацелен на природную антисмысловую последовательность SEQ ID NO: 2 полинуклеотида PAR4 и повышает экспрессию указанного полинуклеотида PAR4. Изобретение позволяет повышать экспрессию полинуклеотида PAR4. 6 н. и 22 з.п. ф-лы, 6 ил., 1 табл., 3 пр.

Предложенное изобретение относится к области биотехнологии, а именно к вирусоподобной частице (VLP) для применения в вакцинах или антигенных композициях для лечения или профилактики инфекции вируса бешенства (RV), а также способам их получения и применения. Вирусоподобная частица содержит один или несколько гликопротеинов (G-белков) RV, где G-белки находятся в форме мицеллы и формируют триммер и где указанная мицелла содержит детергент нонилфенол этоксилат 9 (NP-9). Предложенное изобретение позволяет с высокой эффективностью лечить или профилактировать инфекции вируса бешенства. 5 н. и 16 з.п. ф-лы, 6 ил., 2 табл., 5 пр.

Изобретение относится к биотехнологии, а именно к последовательности ДНК-аптамера, которая связывается с протеолитической субъединицей нейротоксина типа A Clostridium botulinum. Данная последовательность ДНК-аптамера состоит из одноцепочечной ДНК длиной 81 нуклеотид, выбранной из группы: APTLCBONTA N10, представляющая собой CATACGTTCGACTGCTACCCTCCACTTTTGACGGCTTCCTCGGGATTATACGGCTA ACCGAGGGTGAGATGTACAGACTAG, или APTLCBONTA N16, представляющая собой CATACGTTCGACTGCTACTCTGCTGGGATGGCCTAGCAGCCGATTATTGG GCTAAGCGGGCGTGTGAGATGTACAGACTAG. Данная последовательность ДНК-аптамера обладает высокой специфичностью в отношении протеолитической субъединицы токсина типа A Clostridium botulinum с константами аффинности соответственно 1,2·109 М-1, 1,3·109 М-1. Изобретение позволяет ингибировать протеолитическую активность легкой цепи BoNTA с высокой эффективностью. 10 ил., 4 пр.

Наверх