Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы



Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы
Фосфодиэстераза 4d7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы

 


Владельцы патента RU 2575076:

КОНИНКЛЕЙКЕ ФИЛИПС ЭЛЕКТРОНИКС Н.В. (NL)
ДЗЕ ЮНИВЕРСИТИ КОРТ ОФ ДЗЕ ЮНИВЕРСИТИ ОФ ГЛАЗГО (GB)

Настоящее изобретение относится к фосфодиэстеразе 4D7 (PDE4D7) для применения в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера повышена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы с экспрессией в нормальной ткани или ткани доброкачественной опухоли предстательной железы, и к применению PDE4D7 в качестве диагностического маркера для агрессивного гормон-чувствительного рака предстательной железы. Также настоящее изобретение относится к композиции для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы, к соответствующему способу обнаружения, к способу, позволяющему различить доброкачественный и агрессивный гормон-чувствительный рак предстательной железы, и к способу сбора данных, а также к соответствующим иммуноанализам. Также настоящее изобретение относится к способу идентификации индивидуума, соответствующего требованиям для агрессивного гормон-чувствительного рака предстательной железы, а также к иммуноанализу для стратификации индивидуума с таким раком предстательной железы. Кроме того, настоящее изобретение относится к фармацевтическим композициям и к их применению для лечения агрессивного гормон-чувствительного рака предстательной железы. Изобретение позволяет эффективно диагносцировать гормон-чувствительный рак предстательной железы. 12 н. и 20 з.п. ф-лы, 19 ил., 2 табл., 3 пр.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к фосфодиэстеразе 4D7 (PDE4D7) для применения в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера повышена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы с экспрессией в нормальной ткани или ткани доброкачественной опухоли предстательной железы, и к применению PDE4D7 в качестве диагностического маркера для агрессивного гормон-чувствительного рака предстательной железы. Также настоящее изобретение относится к композиции для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы, к соответствующему способу обнаружения, к способу, позволяющему различить доброкачественную опухоль от агрессивного гормон-чувствительного рака предстательной железы, и к способу сбора данных, а также к соответствующим иммуноанализам. Также настоящее изобретение относится к способу идентификации индивидуума, соответствующего требованиям для агрессивного гормон-чувствительного рака предстательной железы, а также к иммуноанализу для стратификации индивидуума с таким раком предстательной железы. Кроме того, настоящее изобретение относится к фармацевтическим композициям и к их применению для лечения агрессивного гормон-чувствительного рака предстательной железы. Также настоящее изобретение относится к использованию антитела, специфичного для белка PDE4D7, для обнаружения, диагностики, мониторинга или прогнозирования злокачественной опухоли или для лечения злокачественной опухоли.

УРОВЕНЬ ТЕХНИКИ

Злокачественная опухоль представляет собой класс заболеваний, при которых группа клеток отличается неконтролируемым ростом, инвазией и метастазированием. Эти три злокачественных свойства злокачественных опухолей отличают их от доброкачественных опухолей, которые являются самоограничивающимися, не инвазивными или не метастазирующими. В развитых странах среди мужчин тремя из наиболее часто диагностируемых злокачественных опухолей являются рак предстательной железы, рак легкого и рак ободочной и прямой кишки. В частности, рак предстательной железы является наиболее распространенной злокачественной опухолью у мужчин в Европе. Согласно оценкам, в 2002 году в Европе у 225000 мужчин был вновь диагностирован рак предстательной железы и приблизительно 83000 умерли от этого заболевания.

Была показана связь определенных фосфодиэстераз с развитием злокачественной опухоли. Например, было показано, что фосфодиэстераза PDE7 связана с хроническим лимфоцитарным лейкозом. В то же время для многих типов злокачественной опухоли или форм прогрессирования злокачественной опухоли отсутствует доступная надежная маркерная молекула.

Рак предстательной железы, например, традиционно диагностируют с помощью уровня простатспецифического антигена (PSA) в сыворотке. Однако PSA не является специфическим для рака предстательной железы и его уровень может увеличиваться при других обстоятельствах, что приводит к большому количеству ложноположительных результатов (злокачественную опухоль не находят приблизительно у 70% мужчин с повышенными уровнями PSA после проведения биопсии). Более того, возможно непредсказуемое количество ложноотрицательных результатов, когда в присутствии "нормального" теста PSA впоследствии развивается рак предстательной железы.

Таким образом, существует потребность в предоставлении новой и эффективной альтернативной диагностической возможности для обнаружения, мониторинга и прогнозирования рака предстательной железы, в частности, агрессивного гормон-чувствительного рака предстательной железы.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение направлено на эту необходимость и представляет средства и способы, которые позволяют провести диагностику и обнаружение рака предстательной железы, в частности, агрессивного гормон-чувствительного рака предстательной железы. Указанная выше задача решается с помощью фосфодиэстеразы 4D7 (PDE4D7), используемой в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера является повышенной при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы с экспрессией в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

Авторами настоящего изобретения показано, что фосфодиэстераза 4D7 активируется в клетках или клеточных линиях рака предстательной железы. Таким образом, PDE4D7 рассматривается как биомаркер для прогнозирования рака предстательной железы и решающего инструмента для выбора стратегии контроля рака предстательной железы, а также для прогноза и мониторинга прогрессирования рака предстательной железы. В частности, авторами настоящего изобретения было продемонстрировано, что PDE4D7 активируется, в частности, в клетках и клеточных линиях агрессивного гормон-чувствительного рака предстательной железы, полученных у человека, а также в соответствующих образцах тканей человека. Таким образом, диагностические способы и варианты применения, основанные на PDE4D7 в качестве маркера рака предстательной железы, можно преимущественно использовать для (i) обнаружения и диагностики агрессивного гормон-чувствительного рака предстательной железы, (ii) прогнозирования агрессивного гормон-чувствительного рака предстательной железы, (iii) мониторинга прогрессирования злокачественной опухоли в направлении форм агрессивного гормон-чувствительного рака предстательной железы, и (iv) различения доброкачественной формы и злокачественной формы гормон-чувствительного рака предстательной железы.

В другом аспекте настоящее изобретение относится к композиции для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, содержащей аффинный лиганд в виде нуклеиновой кислоты и/или пептидный аффинный лиганд для продукта экспрессии или белка PDE4D7.

В предпочтительном варианте осуществления настоящего изобретения указанная композиция содержит аффинный лиганд в виде нуклеиновой кислоты или пептидный аффинный лиганд, которые модифицированы таким образом, что могут использоваться как контрастное средство.

В следующем предпочтительном варианте осуществления настоящего изобретения указанная композиция содержит набор олигонуклеотидов, специфичных к продукту экспрессии PDE4D7, зонд, специфичный к продукту экспрессии PDE4D7, аптамер, специфичный к продукту экспрессии или белку PDE4D7, антитело, специфичное к белку PDE4D7, и/или вариант антитела, специфичный к белку PDE4D7.

В следующем аспекте настоящее изобретение относится к использованию PDE4D7 в качестве маркера для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы.

В другом аспекте настоящее изобретение относится к способу обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, предусматривающему по меньшей мере стадию определения уровня PDE4D7 в образце.

В другом аспекте настоящее изобретение относится к способу диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, где указанный способ позволяет отличить доброкачественную опухоль предстательной железы от агрессивного гормон-чувствительного рака предстательной железы, предусматривает стадии:

(a) определение уровня PDE4D7 в образце;

(b) определение уровня экспрессии эталонного гена в образце;

(c) нормализация измеренного уровня экспрессии PDE4D7 относительно экспрессии эталонного гена; и

(d) сравнение нормализованного уровня экспрессии с заданной пороговой величиной, выбранной так, чтобы исключить доброкачественную опухоль предстательной железы, где нормализованный уровень экспрессии выше пороговой величины указывает на агрессивный гормон-чувствительный рак предстательной железы, где указанная пороговая величина составляет от -2 до +2, предпочтительно, приблизительно равна 0.

В другом аспекте настоящее изобретение относится к способу сбора данных, предусматривающему по меньшей мере стадии:

(a) тестирование у индивидуума экспрессии PDE4D7; и

(b) сравнение экспрессии, определенной на стадии (a), с контрольным уровнем.

В следующем предпочтительном варианте осуществления настоящего изобретения диагностирование, обнаружение, мониторинг, прогнозирование или сбор данных проводят с помощью образца, полученного от индивидуума.

В другом аспекте настоящее изобретение относится к иммуноанализу для обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, предусматривающему по меньшей мере стадии:

(a) тестирование в образце, полученном от индивидуума, экспрессии PDE4D7,

(b) тестирование в контрольном образце экспрессии PDE4D7,

(c) определение отличий в экспрессии PDE4D7 на стадиях (a) и (b); и

(d) принятие решения о наличии или стадии злокачественной опухоли или прогрессировании злокачественной опухоли, исходя из результатов, полученных на стадии (c), где указанные стадии тестирования основаны на применении антитела, специфично связывающегося с PDE4D7.

В другом аспекте настоящее изобретение относится к иммуноанализу для различения между доброкачественной опухолью предстательной железы и агрессивным гормон-чувствительным раком предстательной железы, предусматривающему стадии:

(a) определение уровня PDE4D7 в образце;

(b) определение уровня экспрессии эталонного гена в образце;

(c) нормализация измеренного уровня экспрессии PDE4D7 к экспрессии эталонного гена; и

(d) сравнение нормализованного уровня экспрессии с заданной пороговой величиной, выбранной так, чтобы исключить доброкачественную опухоль предстательной железы, где нормализованный уровень экспрессии выше пороговой величины указывает на агрессивный гормон-чувствительный рак предстательной железы, где указанная пороговая величина составляет приблизительно от -2 до +2, предпочтительно, приблизительно равна 0.

В другом аспекте настоящее изобретение относится к способу идентификации индивидуума как подходящего для терапии агрессивного гормон-чувствительного рака, предусматривающему:

(a) тестирование в образце, полученном от индивидуума, экспрессии PDE4D7;

(b) тестирование в указанном образце экспрессии эталонного гена и/или тестирование в контрольном образце экспрессии PDE4D7;

(c) классификация уровней экспрессии стадии (a) относительно уровней в контрольных образцах PDE4D7 стадии (b); и

(d) идентификация индивидуума как подходящего для получения терапии против агрессивного гормон-чувствительного рака предстательной железы, где образец индивидуума классифицирован как имеющий увеличенный уровень экспрессии PDE4D7.

В другом аспекте настоящее изобретение относится к иммуноанализу стратификации индивидуума или группы индивидуумов с агрессивным гормон-чувствительным раком предстательной железы, предусматривающему:

(a) тестирование в образце, полученном от индивидуума, экспрессии PDE4D7;

(b) тестирование в указанном образце экспрессии эталонного гена и/или тестирование в контрольном образце экспрессии PDE4D7;

(c) определение отличия в экспрессии PDE4D7 на стадии (a) и экспрессии PDE4D7 и/или эталонного гена на стадии (b); и

(d) стратификация индивидуума или группы индивидуумов для терапии агрессивного гормон-чувствительного рака предстательной железы, исходя из результатов, полученных на стадии (c), где образец индивидуума имеет повышенный уровень экспрессии PDE4D7.

В следующем предпочтительном варианте осуществления настоящего изобретения указанное тестирование или определение экспрессии проводят, или дополнительно проводят, измерением уровней нуклеиновой кислоты или белка или определением биологической активности PDE4D7 или эталонного гена.

В следующем предпочтительном варианте осуществления настоящего изобретения указанный способ или иммуноанализ включает дополнительную стадию сравнения измеренных уровней нуклеиновой кислоты или белка или измеренной биологической активности с контрольным уровнем.

В следующем предпочтительном варианте осуществления настоящего изобретения указанный эталонный ген представляет собой ген домашнего хозяйства, особенно предпочтительно, GAPDH или PBGD, или ген другой фосфодиэстеразы, особенно предпочтительно, PDE4D5.

В предпочтительном варианте осуществления настоящего изобретения указанную стадию определения проводит путем измерения уровней нуклеиновой кислоты или белка или путем определения биологической активности PDE4D7.

В следующем предпочтительном варианте осуществления настоящего изобретения указанный способ включает дополнительную стадию сравнения измеренных уровней нуклеиновой кислоты или белка или измеренной биологической активности с контрольным уровнем.

В следующем предпочтительном варианте осуществления настоящего изобретения указанный способ или иммуноанализ включает дополнительную стадию определения уровня простатспецифического антигена (PSA).

В следующем особенно предпочтительном варианте осуществления настоящего изобретения уровень PSA от 2,5 до 4 нг/мл, определенный на дополнительной стадии способа или иммуноанализа, как определено выше, указывает на агрессивный гормон-чувствительный рак предстательной железы.

В следующем предпочтительном варианте осуществления настоящего изобретения образец, упоминаемый выше, представляет собой образец ткани, образец мочи, биоптат, образец осадка мочи, образец крови, образец слюны, образец семенной жидкости, образец, содержащий циркулирующие опухолевые клетки или образец, содержащий секретируемые предстательной железой экзосомы.

В другом аспекте настоящее изобретение относится к ингибиторной фармацевтической композиции, содержащей по меньшей мере один элемент, выбранный из группы:

(a) соединение, непосредственно ингибирующее активность PDE4D7, предпочтительно, антагонист ферментативной активности PDE4D7;

(b) соединение, косвенно ингибирующее активность PDE4D7;

(c) доминантно-негативная форма белка PDE4D7 или ее биологически активный эквивалент;

(d) нуклеиновая кислота, кодирующая и экспрессирующая доминантно-негативную форму PDE4D7;

(e) miРНК, специфичная к PDE4D7;

(f) антисмысловая молекула для PDE4D7;

(g) siРНК, специфичная к PDE4D7;

(h) аптамер, специфичный к продукту экспрессии PDE4D7 или к белку PDE4D7;

(i) низкомолекулярное соединение или пептидомиметик, способные специфично связываться с белком PDE4D7; и

(j) антитело, специфичное к белку PDE4D7, и/или вариант антитела, специфичный к белку PDE4D7.

В другом аспекте настоящее изобретение относится к ингибиторной фармацевтической композиции для лечения или профилактики агрессивного гормон-чувствительного рака предстательной железы, содержащей по меньшей мере один элемент, выбранный из группы:

(a) соединение, непосредственно ингибирующее активность PDE4D7, предпочтительно, антагонист ферментативной активности PDE4D7;

(b) соединение, косвенно ингибирующее активность PDE4D7;

(c) доминантно-негативная форма белка PDE4D7 или ее биологически активный эквивалент;

(d) нуклеиновая кислота, кодирующая и экспрессирующая доминантно-негативную форму PDE4D7;

(e) miРНК, специфичная к PDE4D7;

(f) антисмысловая молекула для PDE4D7;

(g) siРНК, специфичная к PDE4D7;

(h) аптамер, специфичный к продукту экспрессии PDE4D7 или к белку PDE4D7;

(i) низкомолекулярное соединение или пептидомиметик, способные специфично связываться с белком PDE4D7; и

(j) антитело, специфичное к белку PDE4D7, и/или вариант антитела, специфичный к белку PDE4D7.

Поскольку фосфодиэстераза 4D7 активируется в условиях агрессивного гормон-чувствительного рака предстательной железы, в качестве лекарственных средств можно преимущественно использовать ингибиторы PDE4D7 и средства, модифицирующие, например, ингибирующие PDE4D7, модифицирующие экспрессию PDE4D7, например, ингибирующие экспрессию PDE4D7, или модифицирующие взаимодействия PDE4D7, например, ингибирующие взаимодействия PDE4D7. Таким образом, для противодействия наблюдаемому процессу активации ингибиторы и/или средства для модификации PDE4D7 можно применять в качестве лекарственного средства, например в качестве лекарственного средства, препятствующего всем или некоторым из эффектов, связанных с высокой экспрессией PDE4D7 или его активацией.

В другом аспекте настоящее изобретение относится к стимулирующей фармацевтической композиции, содержащей по меньшей мере один элемент, выбранный из группы:

(a) соединение, непосредственно стимулирующее или модулирующее активность PDE4D7, предпочтительно, аллостерический агонист ферментативной активности PDE4D7;

(b) соединение, косвенно стимулирующее или модулирующее активность PDE4D7;

(c) белок PDE4D7 или его биологически активный эквивалент;

(d) нуклеиновая кислота, кодирующая и экспрессирующая PDE4D7;

(e) ингибитор miРНК, специфичный к miРНК PDE4D7;

(f) деметилирующий агент; и

(g) вытесняющий фосфодиэстеразу фактор.

В предпочтительном варианте осуществления настоящего изобретения для лечения рака предстательной железы можно использовать либо указанную ингибиторную, либо указанную стимулирующую фармацевтическую композицию, в зависимости от уровня экспрессии PDE4D7, где определение и/или мониторинг уровня экспрессии проводят согласно стадиям:

(a) определение уровня PDE4D7 в образце;

(b) определение уровня экспрессии эталонного гена в образце; и

(c) нормализация измеренного уровня экспрессии PDE4D7 к экспрессии эталонного гена.

В следующем особенно предпочтительном варианте осуществления настоящего изобретения в случае увеличенных и/или увеличивающихся уровней PDE4D7 вводят указанную ингибиторную фармацевтическую композицию, а в случае сниженных и/или снижающихся уровней PDE4D7 вводят указанную стимулирующую фармацевтическую композицию.

В другом аспекте настоящее изобретение относится к использованию антитела, специфичного к белку PDE4D7, и/или варианта антитела, специфичного к белку PDE4D7, для обнаружения, диагностики, мониторинга или прогнозирования злокачественной опухоли или для лечения злокачественной опухоли, предпочтительно, рака предстательной железы, более предпочтительно, агрессивного гормон-чувствительного рака предстательной железы.

В другом предпочтительном варианте осуществления настоящего изобретения указанная злокачественная опухоль, упоминаемая выше, представляет собой рак предстательной железы.

В другом предпочтительном варианте осуществления настоящего изобретения указанный рак предстательной железы представляет собой агрессивный гормон-чувствительный рак предстательной

железы.

В особенно предпочтительном варианте осуществления настоящего изобретения агрессивный гормон-чувствительный рак предстательной железы представляет собой гормон-чувствительный рак предстательной железы стадии I-IV, гормон-чувствительный рецидивирующий рак предстательной железы или гормон-чувствительный метастазирующий рак предстательной железы.

Некоторые другие объекты изобретения перечислены ниже по пунктам:

1. Фосфодиэстераза 4D7 (PDE4D7) для применения в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы с экспрессией в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

2. Композиция для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, содержащая аффинный лиганд в виде нуклеиновой кислоты и/или пептидный аффинный лиганд для продукта экспрессии или белка PDE4D7.

3. Композиция по п.2, где указанный аффинный лиганд в виде нуклеиновой кислоты или пептидный аффинный лиганд модифицированы, чтобы они функционировали в качестве контрастного средства.

4. Композиция по п.2, где указанный аффинный лиганд представляет собой набор олигонуклеотидов, специфичных к продукту экспрессии PDE4D7, зонд, специфичный к продукту экспрессии PDE4D7, аптамер, специфичный к продукту экспрессии PDE4D7 или к белку PDE4D7, антитело, специфичное к белку PDE4D7, и/или вариант антитела, специфичный к белку PDE4D7.

5. Применение PDE4D7 в качестве маркера для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы.

6. Способ обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, включающий по меньшей мере стадию определения уровня PDE4D7 в образце.

7. Способ диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, где указанный способ различает между доброкачественной опухолью предстательной железы и агрессивным гормон-чувствительным раком предстательной железы, включающий стадии

(a) определение уровня PDE4D7 в образце;

(b) определение уровня экспрессии эталонного гена в образце;

(c) нормализация измеренного уровня экспрессии PDE4D7 к экспрессии эталонного гена; и

(d) сравнение нормализованного уровня экспрессии с заданной пороговой величиной, выбранной так, чтобы исключить доброкачественную опухоль предстательной железы, где нормализованный уровень экспрессии выше пороговой величины указывает на агрессивный гормон-чувствительный рак предстательной железы, где указанная пороговая величина составляет приблизительно от -2 до +2, предпочтительно, приблизительно равна 0.

8. Способ сбора данных, включающий по меньшей мере стадии:

(a) тестирование у индивидуума экспрессии PDE4D7; и

(b) сравнение экспрессии, определенной на стадии (а) с контрольным уровнем.

9. Иммуноанализ для обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, включающий по меньшей мере стадии

(a) тестирование в образце, полученном от индивидуума, экспрессии PDE4D7,

(b) тестирование в контрольном образце экспрессии PDE4D7,

(c) определение отличий в экспрессии PDE4D7 на стадиях (а) и (b);

(d) принятие решения о наличии или стадии злокачественной опухоли или прогрессировании злокачественной опухоли, исходя из результатов, полученных на стадии (с),

где указанные стадии тестирования основаны на применении антитела, специфично связывающегося с PDE4D7.

10. Иммуноанализ для различения между доброкачественной опухолью предстательной железы и агрессивным гормон-чувствительным раком предстательной железы, включающий стадии

(a) определение уровня PDE4D7 в образце;

(b) определение уровня экспрессии эталонного гена в образце;

(c) нормализация измеренного уровня экспрессии PDE4D7 к экспрессии эталонного гена; и

(d) сравнение нормализованного уровня экспрессии с заданной пороговой величиной, выбранной так, чтобы исключить доброкачественную опухоль предстательной железы, где нормализованный уровень экспрессии выше пороговой величины указывает на агрессивный гормон-чувствительный рак предстательной железы, где указанная пороговая величина составляет приблизительно от -2 до +2, предпочтительно, приблизительно равна 0.

11. Способ идентификации индивидуума, подходящего для терапии агрессивного гормон-чувствительного рака предстательной железы, включающий:

(a) тестирование в образце, полученном от индивидуума, экспрессии PDE4D7;

(b) тестирование в указанном образце экспрессии эталонного гена и/или в контрольном образце экспрессии PDE4D7;

(c) классификация уровней экспрессии стадии (а) относительно уровней на стадии (b); и

(d) идентификация индивидуума как подходящего для получения терапии агрессивного гормон-чувствительного рака предстательной железы, где образец индивидуума классифицирован как имеющий увеличенный уровень экспрессии PDE4D7.

12. Иммуноанализ для стратификации индивидуума или группы индивидуумов с агрессивным гормон-чувствительным раковым заболеванием предстательной железы, включающий:

(a) тестирование в образце, полученном от индивидуума, экспрессии PDE4D7;

(b) тестирование в указанном образце экспрессии эталонного гена и/или в контрольном образце экспрессии PDE4D7;

(c) определение отличий в экспрессии PDE4D7 на стадиях (а) и экспрессии PDE4D7 и/или эталонного гена на стадии (b); и

(d) стратификация индивидуума или группы индивидуумов для терапии агрессивного гормон-чувствительного рака предстательной железы исходя из результатов, полученных на стадии (с), где образец индивидуума имеет повышенный уровень экспрессии PDE4D7.

13. Способ по любому из пп.6, 7 или 11, или иммуноанализ по п.10 или 12, где указанное тестирование или определение экспрессии проводят или дополнительно проводят измерением уровней нуклеиновой кислоты или белка или путем определения биологической активности PDE4D7 или эталонного гена.

14. Способ или иммуноанализ по п.13, где указанный способ или иммуноанализ включает дополнительную стадию сравнения измеренных уровней нуклеиновой кислоты или белка или измеренной биологической активности с контрольным уровнем.

15. Способ по любому из пп.7, 11, 13 или 14 или иммуноанализ по любому из пп.10, 12, 13 или 14, где указанный эталонный ген представляет собой другую фосфодиэстеразу, предпочтительно, PDE4D5, или ген домашнего хозяйства, предпочтительно, GAPDH или PBGD.

16. Способ по любому из пп.7, 11, 13, 14 или 15, или иммуноанализ по любому из пп.12, 13, 14 или 15, где указанный способ или иммуноанализ включает дополнительную стадию определения уровня простатспецифического антигена (PSA).

17. Способ или иммуноанализ по п.16, где уровень PSA от 2,5 до 4 нг/мл указывает на агрессивный гормон-чувствительный рак предстательной железы.

18. Способ по любому из пп.6, 7, 11 или 13-17, или иммуноанализ по любому из пп.9, 10, или 12-17, где указанный образец представляет собой образец ткани, биоптат, образец мочи, образец осадка мочи, образец крови, образец слюны, образец семенной жидкости, образец, содержащий циркулирующие опухолевые клетки, или образец, содержащий секретируемые предстательной железой экзосомы.

19. Ингибиторная фармацевтическая композиция, содержащая по меньшей мере один элемент, выбранный из группы:

(a) соединение, непосредственно ингибирующее активность PDE4D7, предпочтительно, антагонист ферментативной активности PDE4D7;

(b) соединение, косвенно ингибирующее активность PDE4D7;

(c) доминантно-негативная форма белка PDE4D7 или ее биологически активный эквивалент;

(d) нуклеиновая кислота, кодирующая и экспрессирующая доминантно-негативную форму PDE4D7;

(e) miPHK, специфичная к PDE4D7;

(f) антисмысловая молекула для PDE4D7;

(g) siPHK, специфичная к PDE4D7;

(h) аптамер, специфичный к продукту экспрессии PDE4D7 или к белку PDE4D7;

(i) низкомолекулярное соединение или пептидомиметик, способные специфично связываться с белком PDE4D7; и

(j) антитело, специфичное к белку PDE4D7, и/или вариант антитела, специфичный к белку PDE4D7.

20. Ингибиторная фармацевтическая композиция для лечения или профилактики агрессивного гормон-чувствительного рака предстательной железы, содержащая по меньшей мере один элемент, выбранный из группы:

(a) соединение, непосредственно ингибирующее активность PDE4D7, предпочтительно, антагонист ферментативной активности PDE4D7;

(b) соединение, косвенно ингибирующее активность PDE4D7;

(c) доминантно-негативная форма белка PDE4D7 или ее биологически активный эквивалент;

(d) нуклеиновая кислота, кодирующая и экспрессирующая доминантно-негативную форму PDE4D7;

(e) miPHK, специфичная к PDE4D7;

(f) антисмысловая молекула для PDE4D7;

(g) siPHK, специфичная к PDE4D7;

(h) аптамер, специфичный к продукту экспрессии PDE4D7 или к белку PDE4D7;

(i) низкомолекулярное соединение или пептидомиметик, способные специфично связываться с белком PDE4D7; и

(j) антитело, специфичное к белку PDE4D7, и/или вариант антитела, специфичный к белку PDE4D7.

21. Стимулирующая фармацевтическая композиция, содержащая по меньшей мере один элемент, выбранный из группы:

(a) соединение, непосредственно стимулирующее или модулирующее активность PDE4D7, предпочтительно, аллостерический агонист ферментативной активности PDE4D7;

(b) соединение, косвенно стимулирующее или модулирующее активность PDE4D7;

(c) белок PDE4D7 или его биологически активный эквивалент;

(d) нуклеиновая кислота, кодирующая и экспрессирующая PDE4D7;

(e) ингибитор miPHK, специфичный к miPHK PDE4D7;

(f) деметилирующий агент; и

(g) вытесняющий фосфодиэстеразу фактор.

22. Ингибиторная фармацевтическая композиция по п.19 или стимулирующая фармацевтическая композиция по п.21, где либо указанную ингибиторную, либо указанную стимулирующую фармацевтическую композицию, применяют для лечения рака предстательной железы в зависимости от уровня экспрессии PDE4D7, где указанный уровень экспрессии определяют и/или подвергают мониторингу согласно стадиям (а)-(с) п.7.

23. Фармацевтическая композиция по п.22, где в случае увеличенных и/или увеличивающихся уровней PDE4D7 вводят указанную ингибиторную фармацевтическую композицию, и в случае сниженных и/или снижающихся уровней PDE4D7 вводят указанную стимулирующую фармацевтическую композицию.

24. Способ по любому из пп.11 или 13-18, или иммуноанализ по любому из пп.12-18, где терапия рака предстательной железы включает введение фармацевтической композиции по п.19, или введение фармацевтической композиции по п.19 в комбинации с дополнительной терапией злокачественной опухоли, предпочтительно, лучевой терапией или химиотерапией.

25. Применение антитела, специфичного к белку PDE4D7, и/или варианта антитела, специфичного к белку PDE4D7, для обнаружения, диагностики, мониторинга или прогнозирования злокачественной опухоли или для лечения злокачественной опухоли, предпочтительно, рака предстательной железы, более предпочтительно, агрессивного гормон-чувствительного рака предстательной железы.

26. Фосфодиэстераза по п.1, композиция по любому из пп.2-4, применение по п.5, способ по любому из пп.6, 7, 11, 13-18 или 24, иммуноанализ по любому из пп.9, 10, 12-18 или 24, ингибиторная фармацевтическая композиция по п.20, или применение по п.25, где указанный агрессивный гормон-чувствительный рак предстательной железы представляет собой гормон-чувствительный рак предстательной железы стадии I-IV, гормон-чувствительный рецидивирующий рак предстательной железы, или гормон-чувствительный метастазирующий рак предстательной железы.

Эти и другие характеристики, признаки и задачи настоящего изобретения станут понятными из представленного ниже подробного описания, учитывая прилагаемые фигуры и примеры, которые демонстрируют путем иллюстрации принципы изобретения.

Описание приведено только для примера, не ограничивающего объем изобретения.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На фиг.1, фигуры 1А и 1В (продолжение фиг.1А), представлен обзор исследований образцов тканей человека способом RT-PCR в отношении относительной экспрессии PDE4D7 относительно GAPDH. Указаны возраст и пол пациента, предоставившего образец, тип ткани, внешний вид образца, диагноз, степень опухоли (показатель Gleason), стадия согласно системе определения стадии TNM (как определено UICC), стадия опухоли и соответствующее гистологическое подтверждение, независимое от применения маркера.

На фиг. 2 представлена коробчатая диаграмма относительных уровней экспрессии PDE4D7 относительно GAPDH в нормальных, доброкачественных и злокачественных образцах ткани предстательной железы. В колонке 1 показаны относительные уровни экспрессии PDE4D7 относительно GAPDH в нормальных/контрольных образцах ткани, в колонке 2 показаны относительные уровни экспрессии PDE4D7 относительно GAPDH в доброкачественных образцах ткани и в колонке 3 указаны относительные уровни экспрессии PDE4D7 относительно GAPDH в злокачественных образцах ткани.

На фиг. 3 представлена диаграмма разброса относительных уровней экспрессии PDE4D7 относительно GAPDH в нормальных, доброкачественных и злокачественных образцах ткани. Указаны индивидуальные величины относительной экспрессии PDE4D7 в нормальной, доброкачественной и злокачественной тканях предстательной железы. Величины экспрессии представлены относительно экспрессии GAPDH.

На фиг. 4 представлен анализ на основе ROC-кривой экспрессии PDE4D7 в доброкачественных против злокачественных образцов предстательной железы.

На фиг. 5 представлена коробчатая диаграмма величин PSA человека в крови у 90 мужчин с доброкачественным и различными стадиями злокачественного заболевания предстательной железы. В колонке 1 указаны мужчины с доброкачественным заболеванием предстательной железы, в колонке 2 указаны мужчины со злокачественным заболеванием предстательной железы, имеющие небольшие злокачественные опухоли, и в колонке 3 указаны мужчины со злокачественным заболеванием предстательной железы, имеющие выраженные злокачественные опухоли.

На фиг. 6 представлен анализ на основе ROC-кривой уровней PSA в крови у мужчин с доброкачественным против различных стадий злокачественного заболевания предстательной железы.

На фиг. 7 представлена относительная экспрессия гена PDE4D5 человека в 96 различных образцах, происходящих из панелей I и II Origene HPRT. Указаны индивидуальные величины относительной экспрессии PDE4D5 человека на тканях предстательной железы человека и данные измерений относительно срединного значения для данных для каждой группы пациентов.

На фиг. 8 представлена относительная экспрессия гена PDE4D5 человека в 96 различных образцах, происходящих из панелей I и II Origene HPRT. На фигуре представлена коробчатая диаграмма индивидуальных данных относительно результатов измерений экспрессии PDE4D5 человека, причем блок включает 75% всех результатов измерений. Срединная величина относительной экспрессии указана в качестве границы между двумя окрашенными блоками.

На фиг. 9 представлена относительная экспрессия гена PDE4D7 в 96 различных образцах, происходящих из панелей I и II Origene HPRT. Указаны индивидуальные величины относительной экспрессии PDE4D7 человека на тканях предстательной железы и данные измерений относительно срединного значения для данных для каждой группы пациентов.

На фиг. 10 представлена относительная экспрессия гена PDE4D7 в 96 различных образцах, происходящих из панелей I и II Origene HPRT. На фигуре представлена коробчатая диаграмма индивидуальных данных относительно результатов измерений экспрессии PDE4D7 человека, причем блок включает 75% всех результатов измерений. Срединная величина относительной экспрессии указана в качестве границы между двумя окрашенными серым цветом блоками.

На фиг. 11 представлены изображения ROC-кривых для экспрессии гена PDE4D7 на образцах ткани предстательной железы человека, показывающие AUC для различных попарных сравнений. На фиг. 11A показаны нормальная (N) против опухолевой ткани. На фиг. 11B представлена доброкачественная (очаг повреждения + гиперплазия (B)) против опухолевой ткани. На фиг. 11C представлены очаг повреждения (L) против опухолевой ткани. На фиг. 11D представлена гиперплазия (H) против опухолевой ткани. На фиг. 11E представлена нормальная + доброкачественная (NB) против опухолевой ткани.

На фиг. 12 представлено соотношение относительной экспрессии генов PDE4D7 и PDE4D5 (дельта(Ct[PDE4D5 человека] - Ct[PDE4D7 человека])). Величины Ct для PDE4D7 человека вычитали из величин Ct для PDE4D5 человека для каждого индивидуального протестированного образца ткани. Информация была получена всего для 96 различных образцов, проанализированных на панелях I и II Origene HPRT (см. примеры). На фиг. представлены индивидуальные величины относительной экспрессии для дельта(PDE4D5-PDE4D7 человека) на тканях предстательной железы человека. Для каждой группы пациентов указаны данные измерений относительно срединного значения для данных.

На фиг. 13 представлено соотношение относительной экспрессии генов PDE4D7 и PDE4D5 (дельта(Ct[PDE4D5 человека] - Ct[PDE4D7 человека])). Величины Ct для PDE4D7 человека вычитали из величин Ct для PDE4D5 человека для каждого индивидуального протестированного образца ткани. Информация была получена всего для 96 различных образцов, проанализированных на панелях I и II Origene HPRT (см. примеры). На фиг. указана коробчатая диаграмма индивидуальных результатов измерений данных относительной экспрессии для дельта(PDE4D5-PDE4D7 человека), причем блок включает 75% всех измерений. Срединная величина относительной экспрессии указана в качестве границы между двумя окрашенными в серый цвет блоками.

На фиг. 14 представлены рабочие характеристические кривые для величин экспрессии генов дельта(Ct[PDE4D5 человека] - Ct[PDE4D7 человека]) для оценки диагностической мощности. На фигуре указаны представления ROC-кривых для индекса PDE предстательной железы для образцов тканей предстательной железы человека, показывающие AUC для различных попарных сравнений. На фиг. 14A представлены нормальные (N) против опухолевых образцов. На фиг. 14B представлены доброкачественные (очаг повреждения + гиперплазия (B)) против опухолевых образцов. На фиг. 14C представлен очаг повреждения (L) против опухоли. На фиг. 14D представлена гиперплазия (H) против опухоли. На фиг. 14E представлены нормальные + доброкачественные (NB) против опухолевых образцов.

На фиг. 15 представлены результаты мультиплексного анализа относительной экспрессии гена дельта(Ct[PDE4D5 человека] - Ct[PDE4D7 человека]), проведенного в одном эксперименте. Ct для PDE-4D7 вычитали из Ct для PDE-4D5. Информация получена всего для 96 различных образцов, проанализированных на панелях I и II Origene HPRT (см. примеры). На фиг. представлены индивидуальные величины относительной экспрессии для дельта(Ct[PDE4D5 человека] - Ct[PDE4D7 человека]) на тканях предстательной железы человека. Для каждой группы пациентов указаны данные измерений относительно срединного значения для данных.

На фиг. 16 представлены результаты мультиплексного анализа относительной экспрессии гена дельта(Ct[PDE4D5 человека] - Ct[PDE4D7 человека]), проведенного в одном эксперименте. Ct для PDE-4D7 вычитали из Ct для PDE-4D5. Информация получена всего для 96 различных образцов, проанализированных на панелях I и II Origene HPRT (см. примеры). На фиг. указана коробчатая диаграмма индивидуальных результатов измерений данных относительной экспрессии для дельта(Ct[PDE4D5 человека] - Ct[PDE4D7 человека]), причем блок включает 75% всех измерений. Срединная величина относительной экспрессии указана в качестве границы между двумя окрашенными в серый цвет блоками.

На фиг. 17 представлены рабочие характеристические кривые для мультиплексного анализа индекса PDE (PIMA), определенного как дельта(Ct[PDE4D5 человека] - Ct[PDE4D7 человека]). На фиг. представлены изображения ROC-кривых для индекса PDE предстательной железы для образцов тканей предстательной железы человека, указывающие на AUC для различных попарных сравнений. На фиг. 17A представлены нормальные (N) против опухолевых образцов. На фиг. 17B представлены доброкачественные (очаг повреждения + гиперплазия (B)) против опухолевых образцов. На фиг. 17C представлен очаг повреждения (L) против опухоли. На фиг. 17D представлена гиперплазия (H) против опухоли. На фиг. 17E представлены нормальные + доброкачественные (NB) против опухолевых образцов.

На фиг. 18 представлен анализ Xcelligence с клетками LNCaP и ингибитором PDE4 ролипрамом. Данные о росте выражены в качестве процента величины наклона "без обработки", полученной в ходе измерений электрического импеданса в реальном времени. Измерения проводили через 12 часов после первоначальной фазы высевания анализа, т.е. в течение 12 часов-60 часов - так, чтобы исследовать пролиферативный потенциал, а не морфологическое изменение. Клетки анализировали в отсутствие андрогенов.

На фиг. 19 представлен анализ роста с помощью MTT на клетках LNCaP и с ингибитором PDE ролипрамом. Данные о росте выражены в качестве процента от данных считывания поглощения при A590 "без обработки" через 48 часов. Клетки анализировали в отсутствие андрогенов.

ПОДРОБНОЕ ОПИСАНИЕ ВАРИАНТОВ ОСУЩЕСТВЛЕНИЯ

Авторы изобретения обнаружили, что PDE4D7 высоко активирована в определенных клетках или клеточных линиях рака предстательной железы и, таким образом, ее можно использовать в качестве биомаркера для агрессивного гормон-чувствительного рака предстательной железы. Ингибиторы PDE4D7, а также средства, модифицирующие PDE4D7 или модифицирующие экспрессию PDE4D7 можно, кроме того, использовать в качестве лекарственных средств, в частности, для лечения агрессивного гормон-чувствительного рака предстательной железы.

Хотя настоящее изобретение описано в отношении конкретных вариантов осуществления, это описание не следует рассматривать как ограничивающее.

Перед подробным описанием иллюстративных вариантов осуществления настоящего изобретения представлены определения, важные для понимания настоящего изобретения.

Как используют в настоящем описании и прилагаемой формуле изобретения, формы единственного числа также включают соответствующие формы множественного числа, если контекст явно не указывает на другое.

В контексте настоящего изобретения термины "приблизительно" и "примерно" обозначают интервал точности, который, как понятно специалисту в данной области, обеспечивает технический эффект рассматриваемого признака. Как правило, эти термины указывают на отклонение от указанной числовой величины на ±20%, предпочтительно, на ±15%, более предпочтительно, на ±10% и, еще более предпочтительно, на ±5%.

Следует понимать, что термин "содержащий" не является ограничивающим. Для целей настоящего изобретения термин "состоящий из" считается предпочтительным вариантом осуществления термина "содержащий". Если в дальнейшем группа определена, как содержащая по меньшей мере определенное количество вариантов осуществления, это означает, что также она охватывает группу, которая предпочтительно, состоит только из этих вариантов осуществления.

Более того, термины "первый", "второй", "третий" или "(a)", "(b)", "(c)", "(d)" и т.д. и сходные с ними в описании и в формуле изобретения используют для различения сходных элементов и не обязательно для описания последовательного или хронологического порядка. Следует понимать, что термины, используемые таким образом, являются взаимозаменяемыми в соответствующих обстоятельствах, и что варианты осуществления изобретения, описанные в настоящем документе, допускают функционирование в других последовательностях, чем описано или проиллюстрировано в настоящем документе.

В случае если термины "первый", "второй", "третий" или "(a)", "(b)", "(c)", "(d)" и т.д. относятся к стадиям способа или к применению, то отсутствует связность во времени или интервале стадиями, т.е. стадии можно проводить одновременно или между такими стадиями могут существовать временные промежутки, составляющие секунды, минуты, часы, сутки, недели, месяцы или даже годы, если нет иных указаний в заявке, как указано в настоящем документе выше или ниже.

Следует понимать, что изобретение не ограничивается конкретной методикой, протоколами, белками, бактериями, векторами, реагентами и т.д., описанными в настоящем документе, поскольку они могут варьировать. Также следует понимать, что терминология, использованная в настоящем документе, представлена только для целей описания конкретных вариантов осуществления и не предназначена для ограничения объема настоящего изобретения, который ограничивается только прилагаемой формулой изобретения. Если не определено иначе, все технические и научные термины, используемые в настоящем документе, имеют те же значения, как обычно понимает специалист в данной области.

Как указано выше, в одном из аспектов настоящее изобретение относится к фосфодиэстеразе 4D7 (PDE4D7), которая может использоваться в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера повышена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы с экспрессией в нормальной ткани или ткани доброкачественной опухоли предстательной железы. Термин "фосфодиэстераза 4D7" или "PDE4D7" относится к варианту по сплайсингу 7 фосфодиэстеразы PDE4D человека, т.е. к гену фосфодиэстеразы PDE4D7 человека, предпочтительно, к последовательности, как определено в Genbank под регистрационным номером No: AF536976 (версия AF536976.1, GI:22901883, от 3 марта 2009 года), более предпочтительно, к нуклеотидной последовательности SEQ ID NO:1, которая соответствует последовательности под указанным выше регистрационным номером Genbank для транскрипта PDE4D7, и также относится к соответствующей аминокислотной последовательности SEQ ID NO:2, которая соответствует последовательности под указанным выше регистрационным номером Genbank полипептида PDE4D7, кодируемого транскриптом PDE4D7. Также термин включает нуклеотидные последовательности, демонстрирующие высокую степень гомологии с PDE4D7, например, последовательности нуклеиновых кислот, которые по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны последовательностям SEQ ID NO:1, или аминокислотные последовательности, которые по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны последовательностям SEQ ID NO:2, или последовательности нуклеиновых кислот, кодирующие аминокислотные последовательности, которые по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны последовательностям SEQ ID NO:2, или аминокислотные последовательности, кодируемые последовательностями нуклеиновых кислот, которые по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны последовательностям SEQ ID NO:1.

Термины "ген фосфодиэстеразы PDE4D7 человека", "ген PDE4D7" или "маркерный ген PDE4D7", как используют в настоящем документе, относятся к гену, кодирующему фосфодиэстеразу 4D. Предпочтительно, термины относятся к гену, экспрессирующему фосфодиэстеразу 4D в качестве варианта по сплайсингу 7, например, конкретной комбинации экзонов, как определено в Genbank под регистрационным номером No: AF536976 (версия AF536976.1, GI:22901883, от 3 марта 2009 года) или как указано в SEQ ID NO:1. Также термин относится к молекулам ДНК, производным мРНК-транскриптов, кодирующих фосфодиэстеразу 4D, сплайсированную в качестве варианта 7, предпочтительно, к молекулам кДНК.

Термин "маркер" или "маркер PDE4D7", как используют в настоящем документе, относится к гену, генетическому элементу или последовательности (нуклеотидной последовательности или аминокислотной или белковой последовательности), как определено в настоящем документе выше, уровень экспрессии которого повышен в клетке или ткани агрессивного гормон-чувствительного рака предстательной железы или в любом типе образца, содержащем такие клетки или ткани, или их части и фрагменты, по сравнению с контрольным уровнем, предпочтительно, по сравнению с экспрессией в нормальной ткани или ткани доброкачественной опухоли предстательной железы. Также термин относится к любому продукту экспрессии указанного генетического элемента или последовательности, в частности, к мРНК-транскрипту PDE4D7, полипептиду или белку, кодируемому транскриптом PDE4D7, или их вариантам или фрагментам, а также к их гомологичным производным, как описано в настоящем документе выше.

Термин "уровень экспрессии", как используют в настоящем документе, относится к количеству транкскрипта PDE4D7 и/или белка PDE4D7, извлекаемому из определенного количества клеток или определенной части ткани, предпочтительно, к количеству транскрипта PDE4D7 и/или белка PDE4D7, получаемым стандартным способом экстракции нуклеиновых кислот (например, РНК) или белка. Подходящие способы экстракции известны специалисту в данной области.

Термин "контрольный уровень" (или "контрольное состояние"), как используют в настоящем документе, относится к уровню экспрессии, который может быть определен в то же время и/или в сходных или сравнимых условиях с тестируемым образцом с использованием (a) образца(ов), ранее взятого и сохраненного от индивидуума/индивидуумов, для которого известно его состояние или заболевание, например, незлокачественное состояние, нормальное состояние или доброкачественная опухоль предстательной железы, развернутый рак предстательной железы и т.д. Термин "болезненное состояние" или "злокачественное болезненное состояние" относится к любому состоянию или типу клеточного или молекулярного состояния между незлокачественным состоянием клетки и (включая) терминальным состоянием злокачественной клетки. Предпочтительно, термин включает различные стадии злокачественной пролиферации/развития или уровни развития опухоли в организме между (и исключая) незлокачественным состоянием клетки и (включая) терминальным состояние злокачественной клетки. Такие стадии развития могут включать все стадии системы классификации злокачественной опухолей TNM (опухоль, узлы, метастазы), как определено UICC, например, стадии 0 и от I до IV. Также термин включает стадии до стадии 0 TNM, например, стадии развития, при которых биомаркеры злокачественной опухоли, известные специалисту в данной области, демонстрируют модифицированную экспрессию или характер экспрессии.

Уровень экспрессии, как упоминалось выше, предпочтительно, может представлять собой уровень экспрессии PDE4D7, как определено в настоящем документе выше. Альтернативно, или дополнительно, уровень экспрессии также может представлять собой уровень экспрессии любого другого подходящего гена или генетического элемента, экспрессируемого в клетке, предпочтительно, в контексте PDE4D7, например, уровень экспрессии другой фосфодиэстеразы, уровень экспрессии гена домашнего хозяйства, например, GAPDH или PBGD.

Термин "злокачественный" в контексте настоящего изобретения относится к злокачественному болезненному состоянию, как определено в настоящем документе выше.

Термин "незлокачественный" в контексте настоящего изобретения относится к состоянию, при котором нельзя выявить ни доброкачественную, ни злокачественную пролиферацию. Подходящие способы для указанного обнаружения известны в данной области.

Предпочтительный контрольный уровень в контексте настоящего изобретения представляет собой экспрессию PDE4D7 в нормальной, т.е. здоровой или незлокачественной ткани, или экспрессию PDE4D7 в ткани доброкачественной опухоли предстательной железы. Термин "доброкачественная опухоль предстательной железы", как используют в настоящем документе, относится к опухоли предстательной железы, у которой отсутствуют все три свойства злокачественной опухоли, т.е. она не растет неограниченным агрессивным образом, не инвазирует окружающие ткани и не метастазирует. Как правило, доброкачественная опухоль предстательной железы предполагает мягкое и непрогрессирующее неопластическое или разрастающееся заболевание, у которого отсутствуют инвазивные свойства злокачественной опухоли. Более того, доброкачественные опухоли предстательной железы, как правило, являются инкапсулированными, и, таким образом, их способность проявлять себя злокачественным образом ингибируется. Доброкачественную опухоль или здоровое состояние можно определять любым подходящим, независимым молекулярным, гистологическим или физиологическим способом, известным специалисту в данной области.

Альтернативно, контрольный уровень можно определять статистическим способом на основе результатов, полученных путем анализа ранее определенного уровня(ей) экспрессии маркерного гена PDE4D7 по настоящему изобретению в образцах от индивидуумов с известным болезненным состоянием. Более того, контрольный уровень может быть установлен из базы данных характера экспрессии или уровней экспрессии ранее протестированных индивидуумов, тканей или клеток. Более того, уровень экспрессии маркерных генов по настоящему изобретению в тестируемом биологическом образце, можно сравнивать с множеством контрольных уровней, которые определяют из множества эталонных образцов. Предпочтительно, использовать контрольный уровень, определенный для эталонного образца, происходящего из ткани, сходной с типом ткани в биологическом образце, полученном от пациента. Особенно предпочтительно использовать образец (образцы), полученный от индивидуума/индивидуумов, болезненное состояние которых является незлокачественным, как определено в настоящем документе выше, т.е. которые соответствует здоровому состоянию, при котором нельзя выявить ни доброкачественной, ни злокачественной пролиферации. Также особенно предпочтительно, использовать образец(образцы), полученный от индивидуума/индивидуумов, имеющих доброкачественную опухоль предстательной железы, как определено в настоящем документе выше, т.е. который соответствует здоровому состоянию, при котором может быть выявлена доброкачественная пролиферация. В другом варианте осуществления настоящего изобретения контрольный уровень можно определить в эталонном образце, полученном от индивидуума, у которого был диагностирован рак предстательной железы, например, гормон-независимый или гормон-резистентный рак предстательной железы.

Альтернативно, эталонные образцы могут содержать материал, происходящий из клеточных линий, например иммортализованных клеточных линий, или он может происходить из ксенотрансплантатов тканей. Предпочтительно, в эталонном образце по настоящему изобретению может содержаться материал, происходящий из клеточных линий рака предстательной железы, или материал, происходящий из ксенотрансплантатов ткани предстательной железы человека, в частности доброкачественной и происходящей из опухоли ткани предстательной железы человека. Примеры предпочтительных злокачественных клеточных линий включают клеточные линии PC346P, PC346B, LNCaP, VCaP, DuCaP, PC346C, PC3, DU145, PC346CDD, PC346Flu1, PC346Flu2. Примеры предпочтительных ксенотрансплантатов включают PC295, PC310, PC-EW, PC82, PC133, PC135, PC324 и PC374. Предпочтительно, можно использовать целую панель клеточных линий и ксенотрансплантатов, например, панель PC346 человека.

В следующей предпочтительной альтернативе эталонные образцы могут происходить из тканей пациента, или панелей тканей или коллекций тканей, полученных в клинических условиях. Образцы, например, могут быть получены от пациентов-мужчин, подвергаемых хирургической операции. Образцы могут происходить из любого подходящего типа ткани, например, из ткани предстательной железы или лимфатических узлов. Предпочтительные примеры коллекций тканей пациента получают во время хирургических процедур (например, простатэктомии).

Более того, предпочтительно, использовать стандартную величину уровней экспрессии маркера PDE4D7 по настоящему изобретению в популяции с известным болезненным состоянием, например, в популяции, имеющей доброкачественную опухоль предстательной железы или в здоровой популяции. Стандартную величину можно получать любым способом известным в данной области. Например, в качестве стандартной величины можно использовать диапазон среднее значение ±2 SD (стандартное отклонение) или среднее значение ±3 SD.

Более того, контрольный уровень можно также определять в то же время и/или в сходных или сравнимых условиях с тестируемым образцом с использованием образца (образцов), ранее взятого и сохраненного от индивидуума/индивидуумов, о которых известно, что их болезненное состояние является злокачественным, т.е. у которых независимо диагностирован рак предстательной железы, в частности, агрессивный гормон-чувствительный рак предстательной железы.

В контексте настоящего изобретения контрольный уровень, определенный для биологического образца, который, как известно, не является злокачественным, например, представляет собой образец здоровой ткани или образец доброкачественной опухоли предстательной железы, называют "нормальным контрольным уровнем".

Если контрольный уровень определяют из злокачественного биологического образца, в частности образца от индивидуума, для которого был независимо диагностирован гормон-резистентный рак, он может быть назван "злокачественным контрольным уровнем".

Термин "рак предстательной железы" относится к раку предстательной железы в мужской репродуктивной системе, который возникает, когда клетки предстательной железы мутируют и начинают бесконтрольно размножаться. Как правило, рак предстательной железы связан с повышенным уровнем простатспецифического антигена (PSA). В одном из вариантов осуществления настоящего изобретения термин "рак предстательной железы" относится к злокачественной опухоли, демонстрирующей уровни PSA выше 4,0. В другом варианте осуществления термин относится к злокачественной опухоли, демонстрирующей уровни PSA выше 2,0. Термин "уровень PSA" относится к концентрации PSA в крови в нг/мл.

Термин "агрессивный гормон-чувствительный рак предстательной железы" означает, что рост и пролиферация клеточных линий рака предстательной железы или рака предстательной железы являются чувствительными при стимуляции мужскими половыми гормонами. Термин "чувствительный" относится к ситуациям, в которых рак предстательной железы или клеточная линия рака предстательной железы демонстрирует биохимический или клеточный характер реакции в присутствии мужских половых гормонов, но не требует мужского полового гормона для роста и/или пролиферации. Таким образом, гормон-чувствительный рак предстательной железы понимают как злокачественную опухоль предстательной железы, которая развилась из предзлокачественных форм, таких как PIN (внутриэпителиальная неоплазия предстательной железы) и характеризуется тем фактом, что ее рост все еще зависит от присутствия мужских половых гормонов - андрогенов. Напротив, после лечения таких опухолей истощающей гормоны терапией эти злокачественные опухоли, как правило, развиваются в гормон-резистентную форму, которая растет независимо от присутствия андрогенов.

Термин "гормон-резистентный рак предстательной железы", таким образом, означает, что рост и пролиферация клеточных линий рака предстательной железы или рака предстательной железы являются устойчивыми к стимуляции мужскими половыми гормонами. Также этот термин относится к поздней стадии развития рака предстательной железы, который более не отвечает на введение антигормонов, предпочтительно, антиандрогенов, как определено в настоящем документе выше.

Термин "мужской половой гормон", как используют в настоящем документе, относится к андрогену, предпочтительно, к тестостерону, андростендиону, дигидротестостерону, дегидроэпиандростерону, адностендиолу или андростерону.

В следующем аспекте настоящее изобретение относится к использованию PDE4D7 в качестве маркера для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы.

Термин "диагностика агрессивного гормон-чувствительного рака предстательной железы", как используют в настоящем документе, означает, что индивидуума или лицо можно считать страдающим агрессивным гормон-чувствительным раком предстательной железы, когда уровень экспрессии маркера PDE4D7 по настоящему изобретению увеличивается или повышается по сравнению с контрольным уровнем, как определено в настоящем документе выше, предпочтительно, по сравнению с нормальным контрольным уровнем, как определено в настоящем документе выше. Термин "диагностика" также относится к заключению, достигаемому посредством этого процесса сравнения.

Термин "увеличенный", или "увеличенный уровень экспрессии", или "повышенный уровень экспрессии", или "увеличение уровня экспрессии" (которые могут быть использованы в качестве синонимов) в контексте настоящего изобретения, таким образом, означает повышение уровня экспрессии между ситуацией, подлежащей анализу, например, ситуацией, устанавливаемой из образца пациента, и эталонной точкой, которая может представлять собой либо нормальный контрольный уровень, либо злокачественный контрольный уровень, устанавливаемый на любой подходящей стадии опухоли или рака предстательной железы, известной специалисту в данной области. Уровни экспрессии считают "повышенными", когда экспрессия гена PDE4D7, например, в образце, подлежащему анализу, отличается, т.е. повышена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, или более чем 50% по сравнению с контрольным уровнем, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере 1 раз, по меньшей мере 2 раза, по меньшей мере 5 раз, или по меньшей мере 10 раз или более по сравнению с контрольным уровнем. Контрольный уровень может представлять собой либо нормальный контрольный уровень, либо злокачественный контрольный уровень, как определено в настоящем документе выше. Если проводят сравнение со злокачественным контрольным уровнем, предпочтительным является дополнительное сравнение с нормальным контрольным уровнем. Такое дополнительное сравнение позволяет определение тенденции к модификации, например, можно наблюдать повышение величины уровня экспрессии и/или можно сделать соответствующие выводы. Предпочтительным является сравнение с доброкачественной опухолью предстательной железы, или со здоровой тканью или образцом, происходящим от здорового индивидуума.

В следующем варианте осуществления дополнительное сходство общего характера экспрессии генов между образцом, полученным от индивидуума и эталоном, как определено в настоящем документе выше, который является злокачественным, указывает на то, что индивидуум страдает раком предстательной железы. В другом варианте осуществления настоящего изобретения диагностику можно комбинировать с установлением уровней экспрессии дополнительных биомаркеров злокачественной опухоли, в частности биомаркеров рака предстательной железы. Подходящие биомаркеры, в частности, биомаркер рака предстательной железы, могут быть известны специалистам в данной области. Например, можно тестировать экспрессию таких биомаркеров, как PSA.

Агрессивный гормон-чувствительный рак предстательной железы можно считать диагностированным, когда уровень экспрессии маркера PDE 4D7 по настоящему изобретению увеличен по сравнению с нормальным контрольным уровнем, как определено в настоящем документе выше.

В следующем предпочтительном варианте осуществления агрессивный гормон-чувствительный рак предстательной железы можно считать диагностированным, если уровень экспрессии PDE4D7, как определено в настоящем документе, увеличен на величину от 20% до 80%, предпочтительно, на величину 30%, 40%, 50%, 60% или 70% в тестируемом образце по сравнению с контрольным уровнем. Контрольный уровень может представлять собой либо нормальный контрольный уровень, либо злокачественный контрольный уровень, как определено в настоящем документе выше. В особенно предпочтительном варианте осуществления агрессивный гормон-чувствительный рак предстательной железы можно считать диагностированным, если уровень экспрессии PDE4D7, как определено в настоящем документе выше, повышен на коэффициент от 1,5 до 10, предпочтительно, на коэффициент от 2 до 5 в тестируемом образце по сравнению с нормальным контрольным уровнем, в частности, со здоровой тканью или доброкачественной опухолью предстательной железы.

Термин "обнаружение агрессивного гормон-чувствительного рака предстательной железы", как используют в настоящем документе, означает, что может быть определено наличие агрессивного гормон-чувствительного ракового заболевания или нарушения предстательной железы в организме или что такое заболевание или нарушение может быть идентифицировано в организме. Определение или идентификацию агрессивного гормон-чувствительного ракового заболевания или нарушения предстательной железы можно проводить путем сравнения уровня экспрессии маркера PDE4D7 по настоящему изобретению и нормального контрольного уровня, как определено в настоящем документе выше. Обнаружение агрессивного гормон-чувствительного рака предстательной железы можно проводить, когда уровень экспрессии маркера PDE4D7 увеличен по сравнению с нормальным контрольным уровнем, как определено в настоящем документе выше. В предпочтительном варианте осуществления настоящего изобретения обнаружение агрессивного гормон-чувствительного рака предстательной железы можно проводить, если уровень экспрессии маркера PDE4D7 сходен с уровнем экспрессии в установленной, например, независимо установленной, клетке или клеточной линии рака предстательной железы, например, клеточной линии агрессивного гормон-чувствительного рака предстательной железы, или клеточной линии, упоминаемой в настоящем документе выше.

Термин "мониторинг агрессивного гормон-чувствительного рака предстательной железы", как используют в настоящем документе, относится к слежению за диагностированным или детектированным агрессивным гормон-чувствительным раковым заболеванием или нарушением предстательной железы, например, в ходе процедуры лечения или в течение определенного периода времени, как правило, в течение 2 месяцев, 3 месяцев, 4 месяцев, 6 месяцев, 1 года, 2 лет, 3 лет, 5 лет, 10 лет или любого другого периода времени. Термин "слежение" означает, что можно проводить обнаружение состояния заболевания, как определено в настоящем документе выше, и, в частности, изменений этих состояний заболевания, путем сравнения уровня экспрессии маркера PDE4D7 по настоящему изобретению в образце с нормальным контрольным уровнем, как определено в настоящем документе выше, предпочтительно, контрольным уровнем экспрессии, установленным для контроля в виде доброкачественной опухоли или здорового контроля, или с уровнем экспрессии установленной, например, независимо установленной, клетки или клеточной линии рака предстательной железы, например, клеточной линии агрессивного гормон-чувствительного рака предстательной железы, в периодический отрезок времени любого типа, например, каждую неделю, каждые 2 недели, каждый месяц, каждые 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 или 12 месяцев, каждые 1,5 года, каждые 2, 3, 4, 5, 6, 7, 8, 9 или 10 лет, в течение любого периода времени, например, в течение 2 недель, 3 недель, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 месяцев, 1,5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 или 20 лет, соответственно. Установленная, например, независимо установленная, клетка или клеточная линия рака предстательной железы, обеспечивающая дополнительный контрольный уровень, может происходить из образцов, соответствующих различным стадиями развития злокачественной опухоли, например, стадиям 0 и с I под IV системы классификации TNM. В предпочтительном варианте осуществления настоящего изобретения этот термин относится к слежению за диагностированным раком предстательной железы, более предпочтительно, за агрессивным гормон-чувствительным раком предстательной железы. Также мониторинг может включать обнаружение экспрессии дополнительных генов или генетических элементов, например, генов домашнего хозяйства, таких как GAPDH или PBGD, или других фосфодиэстераз, предпочтительно, PDE4D5.

Термин "прогнозирование агрессивного гормон-чувствительного рака предстательной железы", как используют в настоящем документе, относится к прогнозу течения или исхода диагностированного или детектированного агрессивного гормон-чувствительного рака предстательной железы, например, в течение определенного периода времени в ходе лечения или после лечения. Также термин относится к определению вероятности выживания или выздоровления от заболевания, а также к прогнозу ожидаемого времени выживания индивидуума. В частности, прогноз может включать установление вероятности выживания индивидуума в течение периода времени в будущем, такого как 6 месяцев, 1 год, 2 года, 3 лет, 5 лет, 10 лет, или любого другого периода времени.

Термин "прогрессирование в агрессивный гормон-чувствительный рак предстательной железы", как используют в настоящем документе, относится к переключению между различными стадиями развития злокачественной опухоли, например, стадиями 0 и с I по IV классификации TNM, или любой другой стадией или подстадией, начиная со здорового состояния вплоть до агрессивного гормон-чувствительного рака предстательной железы. Как правило, такое переключение сопровождается модификацией уровня экспрессии PDE4D7, как правило, увеличением, в тестируемом образце по сравнению с предыдущим тестируемым образцом от того же индивидуума, например, по сравнению с образцом, происходящим из контроля в виде доброкачественной опухоли предстательной железы или контроля в виде здоровой ткани. Прогрессирование в агрессивный гормон-чувствительный рак предстательной железы можно считать детектированным или диагностированным, если уровень экспрессии PDE4D7, как определено в настоящем документе выше, возрастает на величину от 3% до 50%, предпочтительно, на величину 10%, 15%, 20% или 25% в тестируемом образце по сравнению с предыдущим тестируемым образцом того же индивидуума. Обнаружение модификации можно проводить в течение любого периода времени, предпочтительно, в течение 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 месяцев, 1,5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 или 20 лет, т.е. указанную выше величину можно вычислять путем сравнения уровня экспрессии PDE4D7 в первый момент времени и во второй момент времени после указанного периода времени.

В особенно предпочтительном варианте осуществления настоящего изобретения термин "прогрессирование в агрессивный гормон-чувствительный рак предстательной железы" относится к переключению со здорового состояния или состояния доброкачественной опухоли предстательной железы на состояние агрессивного гормон-чувствительного рака предстательной железы. Прогрессирование со здорового состояния в состояние гормон-чувствительного рака предстательной железы можно считать обнаруженным или диагностированным, если уровень экспрессии PDE4D7, как определено в настоящем документе выше, увеличен на величину от 20% до 50%, предпочтительно, на величину 20%, 25%, 30% или 35%, в тестируемом образце по сравнению с предыдущим тестируемым образцом от того же индивидуума, который был диагностирован как являющийся здоровым. Альтернативно, можно использовать сравнение тестируемых образцов от других индивидуумов, например, тестируемых образцов от здоровых индивидуумов. Также предусматривается применение доступной информации баз данных в отношении экспрессии или использования образцов коллекций злокачественных клеток и т.д.

Прогрессирование от состояния доброкачественной опухоли предстательной железы в состояние агрессивного гормон-чувствительного рака предстательной железы можно считать детектированным или диагностированным, если уровень экспрессии PDE4D7, как определено в настоящем документе, повышен на величину от 3% до 30%, предпочтительно, на величину 5%, 10%, 15% или 20%, в тестируемом образце по сравнению с предыдущим тестируемым образцом от того же индивидуума, который был диагностирован как страдающий доброкачественной опухолью предстательной железы. Альтернативно, для сравнения можно использовать тестируемые образцы от других индивидуумов, например, тестируемые образцы от индивидуумов, у которых диагностированы доброкачественные опухоли предстательной железы. Также предусматривается применение доступной информации базы данных в отношении экспрессии или использования образцов коллекций злокачественных клеток и т.д.

Обнаружение модификации можно проводить в течение любого периода времени, предпочтительно, в течение 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 месяцев, 1,5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 или 20 лет, т.е. величину, указанную выше, можно вычислять путем сравнения уровня экспрессии PDE4D7 в первый момент времени и во второй момент времени после указанного выше периода времени.

В следующем варианте осуществления настоящее изобретение относится к диагностике и обнаружению предрасположенности к развитию агрессивного гормон-чувствительного рака предстательной железы. "Предрасположенность к развитию агрессивного гормон-чувствительного рака предстательной железы" в контексте настоящего изобретения представляет собой состояние риска развития агрессивного гормон-чувствительного рака предстательной железы. Предпочтительно, предрасположенность к развитию агрессивного гормон-чувствительного рака предстательной железы может существовать в случаях, когда уровень экспрессии PDE4D7, как определено в настоящем документе выше, превышает нормальный или злокачественный контрольный уровень, как определено в настоящем документе выше, т.е. эталонный уровень экспрессии, установленный для тканей или образцов от индивидуума, которые являются несомненно здоровыми. Термин "выше" в этом контексте относится к уровню экспрессии PDE4D7, который увеличен приблизительно на 2%-20% по сравнению со здоровым контрольным уровнем, предпочтительно, увеличен приблизительно на 15%. В конкретном варианте осуществления уровень экспрессии PDE4D7 может превышать нормальный контрольный уровень и, в то же время, быть ниже злокачественного контрольного уровня. Термин "ниже", как используют в настоящем документе, означает, что уровень экспрессии PDE4D7 снижен приблизительно на 5%-10% по сравнению со злокачественным контрольным уровнем, предпочтительно, снижен приблизительно на 7%. Альтернативно, предрасположенность к развитию агрессивного гормон-чувствительного рака предстательной железы в контексте настоящего изобретения может быть установлена в ситуациях, когда уровень экспрессии PDE4D7, как определено в настоящем документе, превышает нормальный контрольный уровень и/или превышает или является более низким, чем злокачественный контрольный уровень, как определено в настоящем документе выше, и когда дополнительные альтернативные маркеры злокачественной опухоли, например, PSA, не демонстрируют модификации уровня экспрессии или характера экспрессии. Подходящие дополнительные маркеры злокачественной опухоли известны специалисту в данной области.

Таким образом, предрасположенность к злокачественному гормон-чувствительному раку предстательной железы можно считать диагностированной или детектированной, если наблюдают одну из описанных выше ситуаций.

Отличие между уровнями экспрессии в тестируемом биологическом образце и контрольным уровнем можно нормализовать к уровню экспрессии дополнительных контрольных нуклеиновых кислот, например, генов домашнего хозяйства, уровни экспрессии которых известны тем, что они не отличаются, в зависимости от злокачественного или незлокачественного состояния клетки. Характерные контрольные гены включают, помимо прочего, гены β-актина, глицеринальдегид-3-фосфатдегидрогеназы (GAPDH), порфобилиногендезаминазы (PBGD) и рибосомального белка P1. Нормализацию также можно проводить с помощью других фосфодиэстераз, предпочтительно, с помощью фосфодиэстеразы человека, демонстрирующей неизмененный характер экспрессии на различных стадиях опухоли. Предпочтительная фосфодиэстераза представляет собой любую изоформу PDE4D, за исключением PDE4D7, более предпочтительно, она представляет собой PDE4D5.

В контексте настоящего изобретения термины "диагностирование" и "прогнозирование" также включают прогноз и анализы вероятности. Таким образом, PDE4D7 в качестве маркера можно использовать клинически при принятии решений, касающихся режимов лечения, включая терапевтическое вмешательство или диагностические критерии, такие как наблюдение за заболеванием. По настоящему изобретению, может быть предусмотрен промежуточный результат для исследуемого состояния индивидуума. Такой промежуточный результат можно комбинировать с дополнительной информацией для облегчения диагностирования врачом, медсестрой или другим практикующим специалистом того, что индивидуум страдает заболеванием. Альтернативно, настоящее изобретение можно использовать для обнаружения злокачественных клеток в происходящей от индивидуума ткани, и для предоставления врачу полезной информации для диагностирования того, что индивидуум страдает заболеванием.

Индивидуум или лицо, подлежащие диагностированию, мониторингу или у которых намереваются диагностировать или прогнозировать агрессивный гормон-чувствительный рак предстательной железы, прогрессирование в агрессивный гормон-чувствительный рак предстательной железы или предрасположенность к злокачественному гормон-чувствительному раку предстательной железы по настоящему изобретению, представляют собой животное, предпочтительно, млекопитающее, более предпочтительно, человека.

Особенно предпочтительным является применение инструментов молекулярной визуализации, как известно специалисту в данной области, например, технологии магнитно-резонансной томографии (MRI) и/или магнитно-резонансной фотонной визуализации (MPI) в контексте использования PDE4D7 в качестве маркера для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы. Например, PDE4D7 можно использовать в качестве маркера для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы в подходах, таких как MRI или MPI, которые позволяют проводить интерактивное обнаружение диагностического маркера у человека.

В следующем аспекте настоящее изобретение относится к композиции для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы или предрасположенности к злокачественному гормон-чувствительному раку предстательной железы у индивидуума. Композиция по настоящему изобретению может содержать нуклеиновую кислоту и/или пептидный аффинный лиганд для продукта экспрессии или белка PDE4D7.

Термин "аффинный лиганд в виде нуклеиновой кислоты для продукта экспрессии PDE4D7", как используют в настоящем документе, относится к молекуле нуклеиновой кислоты, способной специфично связываться с транскриптом PDE4D7 или молекулой ДНК, происходящей из варианта по сплайсингу 7 PDE4D, еще более предпочтительно, с последовательностью ДНК SEQ ID NO:1, или с последовательностью, комплементарной последовательности ДНК с последовательностью SEQ ID NO:1, или соответствующей молекулой РНК. Аффинный лиганд в виде нуклеиновой кислоты также может быть способен специфично связываться с последовательностью ДНК, по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичной последовательности SEQ ID NO:1, или с последовательностью ДНК, кодирующей аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности SEQ ID NO:2, или с любыми фрагментами указанных последовательностей.

Термин "пептидный аффинный лиганд для белка PDE4D7", как используют в настоящем документе, относится к пептидной молекуле, способной специфично связываться с белком PDE4D7. Пептидная молекула, предпочтительно, может быть способна специфично связываться с белком или полипептидом, содержащим аминокислотную последовательность SEQ ID NO:2. Пептидный аффинный лиганд также может быть способен специфично связываться с белком или полипептидом, содержащим аминокислотную последовательность, кодируемую последовательностью ДНК, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности SEQ ID NO:1, или с белком или полипептидом, содержащим аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности SEQ ID NO:2, или с любыми фрагментами указанных последовательностей. Термин "пептид" относится к любому типу аминокислотной последовательности, содержащей более 2 аминокислот, например к полипептидным структурам, белковым структурам или их функциональным производным. Более того, пептид можно комбинировать с другими химическими структурами или функциональными группами.

Термин "продукт экспрессии", как используют в настоящем документе, относится к транскрипту или молекуле мРНК PDE4D7, образовавшимся в результате экспрессии гена PDE4D. Более предпочтительно, термин относится к процессированному транскрипту PDE4D, как определено в настоящем документе выше, например, на основе последовательности SEQ ID NO:1.

В предпочтительном варианте осуществления настоящего изобретения композиция по настоящему изобретению содержит аффинные лиганды в виде нуклеиновых кислот и/или пептидные аффинные лиганды, выбранные из группы, состоящей из набора олигонуклеотидов, специфичных к продукту экспрессии PDE4D7, зонда, специфичного к продукту экспрессии PDE4D7, аптамера, специфичного к продукту экспрессии PDE4D7 или к белку PDE4D7, антитела, специфичного к белку PDE4D7, и варианта антитела, специфичного к белку PDE4D7.

Композиция по настоящему изобретению, например, может содержать набор олигонуклеотидов, специфичных к продукту экспрессии PDE4D7, и/или зонд, специфичный к продукту экспрессии PDE4D7. Термин "олигонуклеотид, специфичный к продукту экспрессии PDE4D7", как используют в настоящем документе, относится к нуклеотидной последовательности, которая комплементарна смысловой или антисмысловой цепи варианта по сплайсингу 7 PDE4D. Предпочтительно, олигонуклеотид комплементарен последовательности ДНК SEQ ID NO:1, или последовательности, комплементарной последовательности ДНК SEQ ID NO:1. Олигонуклеотидная последовательность также может быть комплементарна последовательности ДНК, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности SEQ ID NO:1, или последовательности ДНК, кодирующей аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности SEQ ID NO:2.

Олигонуклеотид может иметь любую подходящую длину и последовательность, известную специалисту в данной области тем, что она происходит из последовательности SEQ ID NO:1 или комплементарной ей последовательности. Как правило, олигонуклеотид может иметь длину от 8 до 60 нуклеотидов, предпочтительно, от 10 до 35 нуклеотидов, более предпочтительно, длину 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 или 33 нуклеотидов. Олигонуклеотидные последовательности, специфичные к продукту экспрессии PDE4D7, можно определять с помощью программных средств, известных специалисту в данной области.

В следующем варианте осуществления настоящего изобретения олигонуклеотидные последовательности могут быть комплементарны последовательностям, локализованным в экзоне 1 или экзоне 2 гена PDE4D7, последовательностям, локализованным на границе между экзоном 1 и экзоном 2 гена PDE4D7, или последовательностям, локализованным только в экзоне 2 гена PDE4D7, предпочтительно, участку из 271 уникальных нуклеотидов PDE4D7, т.е. 42 нуклеотидов на 3'-конце экзона 1 и 229 5'-концевых нуклеотидов экзона 2 PDE4D. Например, олигонуклеотид, подходящий в качестве прямого праймера, может быть локализован на границе между экзоном 1 и экзоном 2 гена PDE4D7, и олигонуклеотид, подходящий в качестве обратного праймера, может быть локализован в экзоне 2 гена PDE4D7.

В предпочтительном варианте осуществления настоящего изобретения набор олигонуклеотидов имеет последовательности SEQ ID NO:3 и SEQ ID NO:4. Кроме того, предпочтительными являются олигонуклеотиды, имеющие или содержащие последовательность SEQ ID NO:10 и/или SEQ ID NO:11.

Термин "зонд, специфичный к продукту экспрессии PDE4D7", как используют в настоящем документе, означает нуклеотидную последовательность, которая комплементарна смысловой или антисмысловой цепи варианта по сплайсингу 7 PDE4D. Предпочтительно, зонд комплементарен последовательности ДНК SEQ ID NO:1 или последовательности, комплементарной последовательности ДНК SEQ ID NO:1. Последовательность зонда также может быть комплементарна последовательности ДНК, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности SEQ ID NO:1, или последовательности ДНК, кодирующей аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности SEQ ID NO:2.

Зонд может иметь любую подходящую длину и последовательность, известную специалисту в данной области в качестве последовательности, производной последовательности SEQ ID NO:1 или комплементарной ей последовательности. Как правило, зонд может иметь длину от 6 до 300 нуклеотидов, предпочтительно, от 15 до 60 нуклеотидов, более предпочтительно, длину 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 или 50 нуклеотидов. Последовательности зондов, специфичные к продукту экспрессии PDE4D7, можно определить с помощью программных средств, известных специалисту в данной области.

В следующем варианте осуществления настоящего изобретения последовательность зонда может быть комплементарна последовательности, локализованной в экзоне 1 или экзоне 2 гена PDE4D7, предпочтительно, участку из 271 уникальных нуклеотидов PDE4D7, т.е. 42 нуклеотидов на 3'-конце экзона 1 и 229 5'-концевых нуклеотидов экзона 2 PDE4D. Если зонд следует использовать для количественных реакций ПЦР, например, ПЦР в реальном времени, зонд может быть сконструирован так, чтобы он был расположен в положении между положениями связывания прямого и обратного праймера. Предпочтительно, зонд может быть сконструирован так, чтобы он был локализован вблизи одного из олигонуклеотидов праймеров. Более предпочтительно, он может быть локализован вблизи прямого праймера.

В предпочтительном варианте осуществления настоящего изобретения зонд имеет последовательность SEQ ID NO:5 или SEQ ID NO:12.

Альтернативно, или дополнительно, композиция по настоящему изобретению может содержать аптамер, специфичный к продукту экспрессии или белку PDE4D7. Термин "аптамер, специфичный к продукту экспрессии PDE4D7", как используют в настоящем документе, относится к короткой молекуле нуклеиновой кислоты, например, РНК, ДНК, PNA, CNA, HNA, LNA или ANA, или любому другому подходящему формату нуклеиновой кислоты, известному специалисту в данной области, способной специфично связываться с вариантом по сплайсингу 7 PDE4D, предпочтительно, молекулой ДНК, происходящей из варианта по сплайсингу 7 PDE4D. Более предпочтительно, молекула нуклеиновой кислоты аптамера может специфично связываться с последовательностью ДНК SEQ ID NO:1, или с ее двухцепочечным производным. Нуклеиновая кислота-аптамер по настоящему изобретению также может связываться с молекулой РНК, соответствующей транскрипту PDE4D7, предпочтительно, с молекулой РНК, соответствующей последовательности ДНК SEQ ID NO:1.

Нуклеиновая кислота-аптамер, кроме того, может быть способна специфично связываться с последовательностью ДНК, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности SEQ ID NO:1, или последовательностью ДНК, кодирующей аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности SEQ ID NO:2, или с молекулами РНК, соответствующими этим последовательностям.

Специфичность нуклеиновой кислоты-аптамера в отношении варианта по сплайсингу 7 PDE4D может быть обеспечена специфическим связыванием с последовательностями, присутствующими только в указанном варианте по сплайсингу, например, в экзоне 2 или на границе экзонов между экзоном 1 и экзоном 2 PDE4D. В конкретном варианте осуществления настоящего изобретения специфичность нуклеиновой кислоты-аптамера в отношении варианта по сплайсингу 7 PDE4D может быть обеспечена специфическим связыванием с последовательностью, расположенной в участке из 271 уникальных нуклеотидов PDE4D7, т.е. 42 нуклеотидов на 3'-конце экзона 1 и 229 5'-концевых нуклеотидов экзона 2 PDE4D. Нуклеиновые кислоты-аптамеры можно получать любым подходящим способом, известным специалисту в данной области, например, способами селекции in vitro или SELEX. Предпочтительно, нуклеиновые кислоты-аптамеры можно получать и/или конструировать согласно руководству, представленному в Ellington and Szostak, 1990, Nature, 346:818-822. Нуклеиновую кислоту-аптамер по настоящему изобретению, кроме того, можно комбинировать с дополнительными структурами, например, с взаимодействующими частями, такими как биотин, или ферментными функциональными структурами, такими как элементы рибозимов.

Термин "аптамер, специфичный к белку PDE4D7", как используют в настоящем документе, относится к короткому пептиду, способному взаимодействовать и специфично связывать белок PDE4D7. Пептидный аптамер предпочтительно, может быть способен специфично связываться с белком или полипептидом, содержащим аминокислотную последовательность SEQ ID NO:2. Пептидный аптамер также может быть способен специфично связываться с белком или полипептидом, содержащим аминокислотную последовательность, кодируемую последовательностью ДНК, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности SEQ ID NO:1, или с белком или полипептидом, содержащим аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности SEQ ID NO:2. Как правило, пептидный аптамер представляет собой вариабельную пептидную петлю, содержащую, например, от 10 до 20 аминокислот. В контексте настоящего изобретения пептидный аптамер, предпочтительно, может быть связан на одном или обоих его концах с каркасной структурой. Каркасная структура может представлять собой любую молекулу, предпочтительно, белок, которая обладает хорошими свойствами растворимости. Подходящие каркасные молекулы известны специалисту в данной области. Предпочтительной каркасной молекулой для применения в контексте настоящего изобретения является бактериальный белок тиоредоксин-A. Пептидная петля аптамера, предпочтительно, может быть встроена в восстанавливающий активный центр каркасной молекулы. Альтернативно, в качестве каркасных структур в контексте настоящего изобретения можно использовать стафилококковый белок A и его домены и производные этих доменов, такие как белок Z или липокалины.

Пептидные аптамеры могут быть получены любым подходящим способом, известным специалисту в данной области, например, с помощью двухгибридных подходов на дрожжах.

В другом варианте осуществления настоящее изобретение относится к антителу, специфичному к белку PDE4D7. Такое антитело предназначено для любого применения, использования, способа, композиции, иммуноанализа, способа скрининга и диагностической или фармацевтической композиции или набора, как определено в настоящей заявке. Термин "антитело", как используют в настоящем документе, относится к молекулам иммуноглобулинов и иммунологически активным частям молекул иммуноглобулинов, т.е. к молекулам, которые содержат антигенсвязывающий центр, который иммуноспецифически связывает антиген. Молекулы иммуноглобулинов по изобретению могут представлять собой молекулы иммуноглобулинов любого типа (например, IgG, IgE, IgM, IgD, IgA и IgY), класса (например, IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2) или подкласса.

Антитела по настоящему изобретению могут быть описаны или охарактеризованы с помощью эпитопа(ов) или части(ей) полипептида PDE4D7 по настоящему изобретению, которые они распознают или специфично связывают. Предпочтительные эпитопы по настоящему изобретению представляют собой аминокислоты 1-10, 2-11, 3-12, 4-13, 5-14, 6-15, 7-16, 8-17, 9-18, 10-19, 11-20, 12-21, 13-22, 14-23, 15-24, 16-25, 17-26, 18-27, 19-28, 20-29, 21-30, 22-31, 23-32, 24-33, 25-34, 26-35, 27-36, 28-37, 29-38, 30-39, 31-40, 32-41, 33-42, 34-43, 35-44, 36-45, 37-46, 38-47, 39-48, 30-49, 41-50, 42-51, 43-52, 44-53, 45-54, 46-55, 47-56, 48-57, 49-58, 50-59, 51-60, 52-61, 53-62, 54-63, 55-64, 56-65, 57-66, 58-67, 59-68, 60-69, 61-70, 62-71, 63-72, 64-73, 65-74, 66-75, 67-76, 68-77, 69-78, 70-79, 71-80, 72-81, 73-82, 74-83, 75-84, 76-85, 77-86, 78-87, 79-88, 80-89, 81-90, 82-91, 83-92, 84-93, 85-94, 86-95, 87-96, 88-97, 89-98, 90-99, 91-100, 1-20, 2-21, 3-22, 4-23, 5-24, 6-25, 7-26, 8-27, 9-28, 10-29, 11-30, 12-31, 13-32, 14-33, 15-34, 16-35, 17-36, 18-37, 19-38, 20-39, 21-40, 22-41, 23-42, 24-43, 25-44, 26-45, 27-46, 28-47, 29-48, 30-49, 31-50, 32-51, 33-52, 34-53, 35-54, 36-55, 37-56, 38-57, 39-58, 30-59, 41-60, 42-61, 43-62, 44-63, 45-64, 46-65, 47-66, 48-67, 49-68, 50-69, 51-70, 52-71, 53-72, 54-73, 55-74, 56-75, 57-76, 58-77, 59-78, 60-79, 61-80, 62-81, 63-82, 64-83, 65-84, 66-85, 67-86, 68-87, 69-88, 70-89, 71-90, 72-91, 73-92, 74-93, 75-94, 76-95, 77-96, 78-97, 79-98, 80-99, 81-100, 1-30, 2-31, 3-32, 4-33, 5-34, 6-35, 7-36, 8-37, 9-38, 10-39, 11-40, 12-41, 13-42, 14-43, 15-44, 16-45, 17-46, 18-47, 19-48, 20-49, 21-50, 22-51, 23-52, 24-53, 25-54, 26-55, 27-56, 28-57, 29-58, 30-59, 31-60, 32-61, 33-62, 34-63, 35-64, 36-65, 37-66, 38-67, 39-68, 30-69, 41-70, 42-71, 43-72, 44-73, 45-74, 46-75, 47-76, 48-77, 49-78, 50-79, 51-80, 52-81, 53-82, 54-83, 55-84, 56-85, 57-86, 58-87, 59-88, 60-89, 61-90, 62-91, 63-92, 64-93, 65-94, 66-95, 67-96, 68-97, 69-98, 70-99 или 71-100 белка PDE4D7, предпочтительно, N-концевой части белка PDE4D7, более предпочтительно, последовательности SEQ ID NO:2.

Кроме того, включаются все другие подходящие эпитопы, которые могут быть распознаны, определены, описаны, а затем использованы согласно способам, известным специалисту в данной области.

Термин "специфичный к белку PDE4D7", как используют в настоящем документе, относится к иммуноспецифическому обнаружению и связыванию антитела с антигенным эпитопом, как определено в настоящем документе выше. Термин "специфично связывающийся" исключает неспецифическое связывание, но не обязательно исключает перекрестную реактивность в отношении других антигенов, в частности антигенов, содержащих тот же антигенный эпитоп, который поддается обнаружению с помощью настоящего антитела.

В предпочтительном варианте осуществления антитела по изобретению включают поликлональные, моноклональные, полиспецифические, человеческие, гуманизированные или химерные антитела, одноцепочечные антитела, Fab-фрагменты, Fab'-фрагменты, фрагменты, продуцируемые экспрессирующей Fab библиотекой, F(ab')2, Fv, связанные дисульфидными связями Fv, миниантитела, диатела, scFv, sc(Fv)2, целые молекулы иммуноглобулинов, иммунопрепараты на основе модульного белка с малым размером молекул (SMIP), слитые белки связывающего домена иммуноглобулина, камелизованные антитела, содержащие VHH антитела, антиидиотипические (анти-Id) антитела (включая, например, анти-Id антитела к антителам по изобретению) и связывающие эпитоп фрагменты любого из указанных выше.

Наиболее предпочтительно, антитела представляют собой антигенсвязывающие фрагменты антител человека по настоящему изобретению, и они включают Fab, Fab' и F(ab')2, Fv, одноцепочечные Fv (scFv), sc(Fv)2, одноцепочечные антитела, связанные дисульфидной связью Fv (sdFv) и фрагменты, содержащие либо VL-, либо VH-домен.

Термин "Fab-фрагмент", как используют в настоящем документе, относится к фрагментам антител, состоящим из первого константного домена тяжелой цепи (CH1), константного домена легкой цепи (CL), вариабельного домена тяжелой цепи (VH) и вариабельного домена легкой цепи (VL) интактного иммуноглобулинового белка. Термин "F(ab')2" или "F(ab')2-фрагмент", как используют в настоящем документе, относится к фрагментам антител, состоящим из двух первых константных доменов тяжелой цепи (CH1), двух константных доменов легкой цепи (CL), двух вариабельных доменов тяжелой цепи (VH) и двух вариабельных доменов легкой цепи (VL) интактного иммуноглобулинового белка, т.е. он содержит два Fab-фрагмента. Термин "Fab'-фрагмент", как используют в настоящем документе, относится к фрагментам, происходящим из молекул "F(ab')2", предпочтительно, к фрагментам, содержащим S-S-связь в шарнирной области антитела. Термин "Fv-фрагменты", как используют в настоящем документе, относится к фрагментам антител, состоящим из двух вариабельных доменов антитела: VH и VL. Термин "одноцепочечный Fv-фрагмент (scFv)", как используют в настоящем документе, относится к фрагментам антител, состоящим из двух доменов VH и VL, связанных подвижным пептидным линкером.

Антитела по изобретению могут происходить из любого животного, включая птиц и млекопитающих. Предпочтительно, антитела представляют собой антитела человека, грызуна (например, мыши и крысы), осла, обезьяны, кролика, козы, морской свинки, верблюда, лошади или курицы.

Антитела по настоящему изобретению могут быть моноспецифическими, биспецифическими, триспецифическими или более полиспецифическими. Полиспецифические антитела могут быть специфичными к различным эпитопам полипептида по настоящему изобретению или они могут быть специфичными как к полипептиду по настоящему изобретению, так и к гетерологичному эпитопу, такому как гетерологичный полипептид или материал твердой подложки.

Антитела по настоящему изобретению также могут быть описаны или охарактеризованы с помощью их перекрестной реактивности. В особенно предпочтительном варианте осуществления настоящее изобретение относится к антителам, которые не связывают какой-либо другой аналог, ортолог или гомолог полипептида по настоящему изобретению. Однако также в настоящее изобретение включены антитела, которые связывают полипептиды по меньшей мере с 95%, по меньшей мере 90%, по меньшей мере 85%, по меньшей мере 80%, по меньшей мере 75%, по меньшей мере 70%, по меньшей мере 65%, по меньшей мере 60%, по меньшей мере 55%, и по меньшей мере 50% идентичностью (как вычисляют с использованием способов, известных в данной области и описанных в настоящем документе) полипептиду по настоящему изобретению.

Также изобретение относится к антителам, которые могут конкурентно ингибировать связывание антитела с эпитопом по изобретению при определении любым известным в данной области способом определения конкурентного связывания, например, посредством иммуноанализов. В предпочтительных вариантах осуществления антитело конкурентно ингибирует связывание с эпитопом по меньшей мере на 95%, по меньшей мере на 90%, по меньшей мере на 85%, по меньшей мере на 80%, по меньшей мере на 75%, по меньшей мере на 70%, по меньшей мере на 60%, или по меньшей мере на 50%.

В следующем варианте осуществления антитела по изобретению включают производные, которые являются модифицированными, например, посредством ковалентного присоединения любого типа молекулы антитела, так чтобы указанное ковалентное присоединение не препятствовало специфичному связыванию эпитопа или формированию антиидиотипического ответа. Характерными примерами таких модификаций являются гликозилирование, ацетилирование, пегилирование, фосфорилирование, амидация, преобразование в производные с помощью известных защищающих/блокирующих групп, протеолитическое расщепление, связывание с клеточным лигандом или другим белком и т.д. Химические модификации можно проводить известными способами, включая специфическое химическое расщепление, ацетилирование, формилирование и т.д. Кроме того, производное может содержать одну или несколько неклассических аминокислот.

Антитела можно получать любым подходящим способом, известным специалисту в данной области. Поликлональные антитела можно получать иммунизацией животных выбранным антигеном. Например, полипептид по изобретению можно вводить различным животным-хозяевам, включая любой эукариотический, прокариотический или фаговый клон. Моноклональные антитела с определенной специфичностью можно получать, например, с использованием технологии гибридом, разработанной Kohler и Milstein (Kohler and Milstein, 1976, Eur. J. Immunol, 6: 511-519).

Фрагменты антител, которые распознают конкретные эпитопы, можно получать известными способами. Например, Fab- и F(ab')2-фрагменты по изобретению можно получать протеолитическим расщеплением молекул иммуноглобулинов с использованием ферментов, таких как папаин (для получения Fab-фрагментов) или пепсин (для получения F(ab')2-фрагментов).

Термин "химерное антитело", как используют в настоящем документе выше, относится к молекуле, в которой различные части антитела происходят из различных видов животных, такой как антитела, имеющие вариабельную область, происходящую из моноклонального антитела мыши и константную область иммуноглобулина человека. Термин "гуманизированное антитело", как используют в настоящем документе выше, относится к молекулам антител, которые связывают желаемый антиген, имеющий одну или несколько определяющих комплементарность областей (CDR) из не являющегося человеком вида и каркасные области из молекулы иммуноглобулина человека. Способы получения гуманизированных антител известны специалисту в данной области. Термин "антитело человека", как используют в настоящем документе, относится к антителам, имеющим аминокислотную последовательность иммуноглобулина человека, и включают антитела, выделенные из библиотек иммуноглобулинов человека или из животных, трансгенных по одному или нескольким иммуноглобулинам человека.

В следующем варианте осуществления настоящего изобретения антитело или его фрагмент, как определено в настоящем документе выше, могут быть биотинилированными или мечеными. Термин "биотинилированный", как используют в настоящем документе, означает, что указанное антитело ковалентно связано с молекулой биотина. Как правило, биотин может быть связан с первичными аминами, например, присутствующими в качестве боковых цепей лизина в эпсилон-аминах или N-концевых альфа-аминах. Альтернативно, связывание можно проводить через сульфгидрильные группы, карбоксильные группы, группы сахаров или остатки, присутствующие на молекуле антитела. Более того, биотинилирование можно проводить в качестве неспецифического биотинилирования.

Термин "меченое антитело", как используют в настоящем документе, означает, что указанное антитело может содержать одну или несколько меток на C- или N-конце цепей антитела. Альтернативно, указанное антитело также может содержать одну или несколько меток в любом положении на протяжении молекулы. Предпочтительно, указанное антитело содержит от 1 до 10 меток, которые либо могут быть идентичными, либо могут отличаться, или могут представлять собой любую их комбинацию. Более предпочтительно, антитело может содержать от 1 до 5 меток, еще более предпочтительно, одну метку. Указанные метки могут представлять собой любую подходящую метку, известную специалисту в данной области, например, радиоактивную, флуоресцентную или хемилюминесцентную метки. В особенно предпочтительном варианте осуществления указанная метка представляет собой радиоактивную метку, ферментную метку, флуоресцентную метку, хемилюминесцентную или биолюминесцентную метку.

Термин "ферментная метка" относится к меткам, которые обладают ферментативной активностью. Характерным предпочтительным примером является фермент пероксидаза хрена (HRP), который может быть связан с антителом или присоединен к нему. Этот ферментный комплекс впоследствии может катализировать превращение подходящего субстрата, например, хемилюминесцентного субстрата, в сенсибилизированный реагент вблизи антитела, что в конечном итоге приводит к испусканию света или образованию цветной реакции. В частности, усиленная хемилюминесценция, которую можно использовать в этом контексте, позволяет обнаружение ничтожно малых количеств меченых молекул.

Термин "радиоактивная метка" относится к меткам, испускающим радиоактивное излучение, предпочтительно, состоящим из радиоактивных изотопов. Термин "радиоактивный изотоп" в контексте метки относится к любому такому фактору, известному специалисту в данной области. Более предпочтительно, термин относится к 3H, 14C, 32P, 33P, 35S или 125I.

Термин "хемилюминесцентная метка" относится к метке, которая способна испускать свет (люминесценцию) с ограниченным испусканием тепла в результате химической реакции. Предпочтительно, термин относится к люминолу, циалюму, оксалилхлориду, TMAE (тетракис(диметиламино)этилену), пирагаллолу, люцигенину, сложному эфиру акридиния или диоксетану.

Термин "биолюминесцентная метка" относится к метке, которая способна испускать свет вследствие биохимической реакции. Как правило, термин относится к продукции света вследствие реакции люциферина и люциферазы. В такой схеме реакции люцифераза катализирует окисление люциферина, что приводит к испусканию света и неактивному оксилюциферину. Например, антитело по настоящему изобретению может быть связано с люциферазой. Альтернативно, антитело также можно метить люциферином. Люциферин и люцифераза, а также кофактор, такой как кислород, могут быть связаны с образованием одного фотобелка. Эта молекула может быть связана с антителом по настоящему изобретению. Испускание света может быть запущено, когда присутствует конкретное соединение, например конкретный тип иона, предпочтительно, кальций. Примеры люциферина, используемого в контексте настоящего изобретения, включают бактериальный люциферин, люциферин динофлагеллат, варгулин, коэлентеразин и люциферин светляка.

Термин "флуоресцентная метка" относится к химически реакционно-способным производным флуорофоров. Как правило, обычные реакционно-способные группы включают реакционно-способные в отношении аминов производные изотиоцианата, такие как FITC и TRITC (производные флуоресцеина и родамина), реакционно-способные в отношении аминов сукцинимидильные сложные эфиры, такие как NHS-флуоресцеин, и реакционно-способные в отношении сульфгидрила активированные малеинимидом флуоресцирующие агенты, такие как флуоресцеин-5-малеинимид. По настоящему изобретению можно использовать любую подходящую флуоресцентную метку, известную специалисту в данной области. Предпочтительно, можно использовать флуоресцентные метки FITC, флуоресцеин, флуоресцеин-5-EX, 5-SFX, родамин Green-X, BodipyFL-X, Cy2, Cy2-OSu, Fluor X, Bodipy TMR-X, родамин, родамин Red-X, Texas Red, Texas Red-X, Bodipy TR-X, Cy3,5-OSu, флуоресцирующие агенты Alexa, флуоресцирующие агенты Dylight и/или Cy5.5-OSu. В более предпочтительном варианте осуществления настоящего изобретения можно использовать флуоресцентные метки 6-FAM, HEX, TET, ROX, Cy3, Cy3-OSu, Cy5, Cy5-Osu, Texas Red или родамин.

Альтернативно, антитела также можно метить или комбинировать с флуоресцентными полипептидами, например, с зеленым флуоресцентным белком (GFP), а также с их производными, известными специалисту в данной области.

Эти метки можно использовать либо по отдельности, либо группами в любой комбинации. В другом аспекте настоящее изобретение относится к молекуле нуклеиновой кислоты, кодирующей антитело или его фрагмент, как определено в настоящем документе выше. Также изобретение относится к молекулам нуклеиновых кислот, которые гибридизуются в жестких или менее жестких условиях гибридизации, например, как определено в настоящем документе выше, с молекулами нуклеиновых кислот, которые кодируют антитело. Предпочтительно, антитело, кодируемое такими гибридизующимися молекулами, специфично связывается с белком PDE4D, более предпочтительно, с полипептидом SEQ ID NO:2 или эпитопами, содержащимися в нем, например, как описано в настоящем документе выше.

Альтернативно, полинуклеотид, кодирующий антитело, можно получать из нуклеиновой кислоты из подходящего источника.

В следующем варианте осуществления настоящего изобретения молекулу нуклеиновой кислоты, кодирующую антитело или его фрагмент, как определено в настоящем документе выше, можно использовать для экспрессии рекомбинантного антитела. Предпочтительно, такие векторы экспрессии содержат кодирующие антитело последовательности и подходящие сигналы контроля транскрипции и трансляции. Векторы могут содержать кодирующие последовательности либо для вариабельной области тяжелой цепи или вариабельной области легкой цепи, либо для обеих из них. Такие векторы также могут включать нуклеотидную последовательность, кодирующую константные области молекулы антитела.

В предпочтительном варианте осуществления в качестве эффективной экспрессирующей системы для антител можно использовать клетки млекопитающих, более предпочтительно, клетки яичника китайского хомячка (CHO), совместно с вектором, таким как основной средне-ранний промоторный элемент гена из цитомегаловируса человека. В бактериальных системах может быть преимущественно выбрано множество векторов экспрессии, в зависимости от применения, предполагаемого для экспрессируемой молекулы антитела.

В другом варианте осуществления настоящее изобретение относится к клетке, которая продуцирует антитело или его фрагмент, как определено в настоящем документе выше. Такая клетка может представлять собой гибридомную клетку, как определено в настоящем документе выше, или клетку, которая экспрессирует молекулу нуклеиновой кислоты, кодирующую антитело по настоящему изобретению. В частности, предпочтительными являются клетки или клеточные линии, которые стабильно экспрессируют молекулу антитела.

После продуцирования синтеза или рекомбинантной экспрессии молекулы антитела по изобретению, ее можно очищать любым известным в данной области способом очистки молекулы иммуноглобулина, например, хроматографией (например, ионообменной, аффинной, предпочтительно, по аффинности в отношении конкретного антигена после колоночной хроматографии с белком A, и колоночной хроматографии по размеру), центрифугированием, дифференциальной растворимостью или любым другим стандартным способом очистки белков, известных специалисту в данной области.

Кроме того, антитела по настоящему изобретению или их фрагменты можно подвергать слиянию с любой гетерологичной полипептидной последовательностью, например, для облегчения очистки антитела или для обеспечения механизмов для нацеливания антитела. Также предусматривается слияние с цитотоксическими гетерологичными белками или молекулами, например, токсинами и т.д. Соответствующие примеры и способы известны специалисту в данной области.

В другом предпочтительном варианте осуществления настоящего изобретения композиция, например, диагностическая композиция может содержать или может дополнительно содержать антитело, специфичное к белку PDE4D7, предпочтительно, варианты или фрагменты моноклонального или поликлонального антитела, такие как одноцепочечное антитело, диатело, миниантитело, одноцепочечный Fv-фрагмент (sc(Fv)), антитело Sc(Fv)2, Fab-фрагмент или F(ab')2-фрагмент на основе моноклонального специфичного к PDE4D7 антитела, иммунопрепарат на основе модульного белка с малым размером молекул (SMIP), слитый белок связывающего домена иммуноглобулина, камелизованное антитело или содержащее VHH антитело и т.д. как определено в настоящем документе выше. В конкретном варианте осуществления настоящего изобретения в композиции могут содержаться коммерчески доступные антитела против PDE4D7, такие как NB300-652 (Novus Biologicals, Inc.) или GTX14629 (GeneTex, Inc.) или их можно использовать, например, в диагностических целях.

Аффинный лиганд, как описано в настоящем документе выше, можно метить различными маркерами или можно выявлять с помощью вторичного аффинного лиганда, меченного различными маркерами, для обеспечения обнаружения, визуализации и/или количественного определения. Это можно проводить с использованием любых подходящих меток, которые можно конъюгировать с аффинным лигандом, способным взаимодействовать с продуктом экспрессии PDE4D7 или белком PDE4D7 или с вторичным аффинным лигандом, с использованием любой подходящей технологии или способов, известных специалисту в данной области. Термин "вторичный аффинный лиганд" относится к молекуле, которая способна связываться с аффинным лигандом, как определено в настоящем документе выше (т.е. "первичный аффинный лиганд", если его применяют в контексте системы с двумя взаимодействующими аффинными лигандами). Связывающее взаимодействие, предпочтительно, представляет собой специфическое связывание.

Примеры меток, которые можно конъюгировать с первичными и/или вторичными аффинными лигандами, включают флуоресцентные красители или металлы (например, флуоресцеин, родамин, фикоэритрин, флуорескамин), хромофорные красители (например, родопсин), хемилюминесцентные соединения (например, люминал, имидазол) и биолюменесцентные белки (например, люциферин, люцифераза), гаптены (например, биотин).

В особенно предпочтительном варианте осуществления аффинный лиганд, используемый в качестве зонда, в частности зонда, специфичного к продукту экспрессии PDE4D7, как определено в настоящем документе выше, можно метить флуоресцентной меткой, такой как 6-FAM, HEX, TET, ROX, Cy3, Cy5, Texas Red или родамин, и/или в то же время тушащей меткой, такой как TAMRA, Dabcyl, Black Hole Quencher, BHQ-1 или BHQ-2. Множество других подходящих флуоресцирующих агентов и хромофоров описано в Stryer, 1968, Science, 162:526-533. Аффинные лиганды также можно метить ферментами (например, пероксидазой хрена, щелочной фосфатазой, бета-лактамазой), радиоактивными изотопами (например, 3H, 14C, 32P, 33P, 35S, 125I, 11C, 13N, 15O, 18F, 64Cu, 62Cu, 124I, 76Br, 82Rb, 68Ga или 18F) или частицами (например, золото).

Различные типы меток можно конъюгировать с аффинным лигандом с использованием различных химических реакций, например, реакцией аминов или реакцией тиолов. Однако также можно использовать другие реакционно-способные группы, отличные от аминов и тиолов, например, альдегиды, карбоновые кислоты и глутамин.

В предпочтительном варианте осуществления настоящего изобретения аффинный лиганд в виде нуклеиновой кислоты или пептидный аффинный лиганд по настоящему изобретению можно модифицировать так, чтобы они функционировали в качестве контрастного средства. Термин "контрастное средство", как используют в настоящем документе, относится к молекулярному соединению, которое способно специфично взаимодействовать с маркером PDE4D7 и обнаружение которого можно проводить с помощью устройства, расположенного вне организма человека или животного. Предпочтительно, такие контрастные средства подходят для применения в способах визуализации, например, в магнитно-резонансной томографии (MRI) или магнитно-фотонной визуализации (MPI). Термин "специфично взаимодействующий" относится к свойству молекулярного соединения предпочтительно, взаимодействовать с маркером PDE4D7 на поверхности клеток, присутствующих в организме человека или животного, относительно других белков, которые экспрессируются такими клетками. Предпочтительные контрастные средства, которые также могут называться композициями контрастных средств, способны осуществлять специфическое обнаружение молекул, имеющих нуклеотидную последовательность SEQ ID NO:1 или аминокислотную последовательность SEQ ID NO:2, или их производных или гомологичных вариантов, как определено в настоящем документе выше. Предпочтительные контрастные средства представляют собой аптамеры, специфичные к продукту экспрессии PDE4D7 или к белку PDE4D7, как определено в настоящем документе выше, а также антитела, специфичные к белку PDE4D7, как определено в настоящем документе выше, или они связаны или ассоциированы с указанными аптамерами.

Контрастные средства, помимо их свойства быть способными специфично распознавать маркер PDE4D7, кроме того, как правило, могут содержать дополнительную молекулу, которая поддается обнаружению с помощью конкретной используемой технологии обнаружения. Термин "модифицированный для функционирования", как используют в настоящем документе, таким образом, относится к любым подходящим модификациям, известным специалисту в данной области, которые могут быть необходимыми для обеспечения применения контрастного средства в способах молекулярной визуализации, в частности в MRI или MPI. Например, если в качестве способа обнаружения используют флуоресцентную спектроскопию, такие молекулы могут содержать флуорофоры в качестве поддающихся обнаружению маркерных молекул, которые могут возбуждаться при конкретной длине волны. Альтернативно, можно использовать радиоактивную метку, например, радиоактивный изотоп, как описано в настоящем документе выше. Что касается предпочтительных контрастных средств в соответствии с изобретением, которые подходят для MRI, контрастные средства, такие как описанные выше антитела, могут содержать маркерную молекулу, которая поддается обнаружению посредством MRI. Такие поддающиеся обнаружению метки включают, например, USPIOS и 19Fluor.

В конкретном варианте осуществления настоящего изобретения композиция, кроме того, может содержать вспомогательные ингредиенты, такие как буферы для ПЦР, dNTP, полимераза, ионы, такие как двухвалентные катионы или одновалентные катионы, растворы для гибридизации, вторичные аффинные лиганды, например, такие как вторичные антитела, красители для обнаружения или любое другое подходящее соединение или жидкость, необходимые для выполнения обнаружения на основе любого из аффинных лигандов или контрастных средств, как определено в настоящем документе выше, которые известны специалисту в данной области.

В другом аспекте настоящее изобретение относится к использованию аффинного лиганда в виде нуклеиновой кислоты или пептидного аффинного лиганда для продукта экспрессии или белка PDE4D7, как определено в настоящем документе выше, для получения композиции для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы или предрасположенности к злокачественному гормон-чувствительному раку предстательной железы у индивидуума, как описано в настоящем документе выше.

В предпочтительном варианте осуществления настоящее изобретение относится к использованию набора олигонуклеотидов, специфичных к продукту экспрессии PDE4D7, и/или зонда, специфичного к продукту экспрессии PDE4D7, как определено в настоящем документе выше, для получения композиции для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы или предрасположенности к злокачественному гормон-чувствительному раку предстательной железы у индивидуума, как описано в настоящем документе выше. В другом предпочтительном варианте осуществления настоящее изобретение относится к использованию аптамера, специфичного к продукту экспрессии или белку PDE4D7, как определено в настоящем документе выше, для получения композиции для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы или предрасположенности к злокачественному гормон-чувствительному раку предстательной железы у индивидуума, как описано в настоящем документе выше.

В следующем варианте осуществления настоящее изобретение относится к использованию антитела, специфичного к белку PDE4D7, и/или варианта антитела, специфичного к белку PDE4D7, как определено в настоящем документе выше, для получения композиции для диагностики, обнаружения, мониторинга или прогнозирования злокачественной опухоли или прогрессирования злокачественной опухоли или предрасположенности к злокачественно опухоли у индивидуума, как описано в настоящем документе выше.

В предпочтительном варианте осуществления настоящего изобретения композиция, как определено в настоящем документе выше, представляет собой диагностическую композицию.

В другом варианте осуществления настоящее изобретение относится к использованию антитела, специфичного к белку PDE4D7, и/или варианта антитела, специфичного к белку PDE4D7, как определено в настоящем документе выше, для получения композиции для лечения злокачественной опухоли.

В другом аспекте настоящее изобретение относится к использованию антитела, специфичного к белку PDE4D7, и/или варианта антитела, специфичного к белку PDE4D7, для обнаружения, диагностики, мониторинга или прогнозирования злокачественной опухоли или для лечения злокачественной опухоли. В предпочтительном варианте осуществления настоящего изобретения антитело, как описано в настоящем документе выше, используют для обнаружения, диагностики, мониторинга или прогнозирования рака предстательной железы или для лечения рака предстательной железы. В еще более предпочтительном варианте осуществления антитело, как описано в настоящем документе, используют для обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или для лечения агрессивного гормон-чувствительного рака предстательной железы.

В другом аспекте настоящее изобретение относится к диагностическому для обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы или предрасположенности к злокачественному гормон-чувствительному раку предстательной железы, содержащему набор олигонуклеотидов, специфичных к продукту экспрессии PDE4D7, зонд, специфичный к продукту экспрессии PDE4D7 и/или аптамер, специфичный к продукту экспрессии или белку PDE4D7, и/или антитело, специфичное к белку PDE4D7, и вариант антитела, специфичный к белку PDE4D7.

Как правило, диагностический набор по настоящему изобретению содержит одно или несколько средств, позволяющих специфичное обнаружение PDE4D7, как определено в настоящем документе выше. Средства или ингредиенты диагностического набора могут, по настоящему изобретению, содержаться в одном или нескольких контейнерах или в отдельных элементах. Природа средств определяется способом обнаружения, для которого предназначен набор. Когда обнаружение намереваются проводить на уровне экспрессии мРНК PDE4D7, т.е. через продукт экспрессии PDE4D7, средства, содержащиеся в наборе, могут представлять собой набор олигонуклеотидов, специфичных к продукту экспрессии PDE4D7, и/или зонд, специфичный к продукту экспрессии PDE4D7, как определено в настоящем документе выше, который может быть необязательно меченным способами, известными в данной области, например, с помощью меток, описанных в настоящем документе выше. Дополнительно или альтернативно, набор может содержать аптамер, специфичный к продукту экспрессии PDE4D7. Когда предполагается обнаружение на уровне белка PDE4D7, средства, содержащиеся в наборе, могут представлять собой одно или несколько антител или соединений, содержащих антигенсвязывающий фрагмент антитела, или варианты антитела, специфичные к белку PDE4D7, как описано в настоящем документе выше. Дополнительно или альтернативно, набор может содержать аптамер, специфичный к белку PDE4D7. Альтернативно, диагностический набор может содержать контрастное средство, как определено в настоящем документе выше.

Обнаружение присутствия конкретных белков также можно проводить с использованием других соединений, которые специфично взаимодействуют с PDE4D7, например, специфичных субстратов или лигандов.

Предпочтительно, диагностический набор по настоящему изобретению содержит реагенты для обнаружения продукта экспрессии PDE4D7 или белка PDE4D7. Такие реагенты для обнаружения содержат, например, буферные растворы, метки или промывочные жидкости и т.д. Более того, набор может содержать количество известной молекулы нуклеиновой кислоты или белка, которое можно использовать для калибровки набора или в качестве внутреннего контроля. Как правило, диагностический набор для обнаружения продуктов экспрессии PDE4D7 может содержать дополнительные ингредиенты, такие как буферы для ПЦР, dNTP, полимераза, ионы, такие как двухвалентные катионы или одновалентные катионы, растворы для гибридизации и т.д. Диагностический набор для обнаружения белков PDE4D7 также может содержать вспомогательные ингредиенты, такие как вторичные аффинные лиганды, например, вторичные антитела, красители для обнаружения и любое другое подходящее соединение или жидкость, необходимые для проведения обнаружения белка, как известно специалисту в данной области. Такие ингредиенты известны специалисту в данной области и могут изменяться, в зависимости от проводимого способа обнаружения. Кроме того, набор может содержать листок-вкладыш с инструкцией и/или может предоставлять информацию в отношении значения полученных результатов.

В другом аспекте настоящее изобретение относится к способу обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, например, у индивидуума, включающему по меньшей мере стадию определения уровня PDE4D7 в образце. Термин "определение уровня PDE4D7" относится к определению присутствия или количества продуктов экспрессии PDE4D7, например, транскрипта(ов) PDE4D7, и/или к определению присутствия и/или количества белка(ов) PDE4D7. Термин "уровень PDE4D7", таким образом, означает присутствие или количество продуктов экспрессии PDE4D7, например, транскрипта(ов) PDE4D7, и/или определение присутствия или количества белка(ов) PDE4D7. Определение присутствия или количества продуктов экспрессии PDE4D7, например, транскрипта(ов) PDE4D7 или белка(ов) PDE4D7 можно проводить любыми способами, известными в данной области.

В предпочтительном варианте осуществления настоящего изобретения определение присутствия или количества продуктов экспрессии PDE4D7, например, транскрипта(ов) PDE4D7 и/или белка(ов) PDE4D7, проводят путем измерения уровней нуклеиновой кислоты или белка или путем определения биологической активности PDE4D7. Таким образом, уровень(уровни) экспрессии PDE4D7 можно определять способом, вовлекающим обнаружение мРНК, кодируемую геном PDE4D7, обнаружение белка PDE4D7, кодируемого транскриптом PDE4D7, и/или обнаружение биологической активности белка PDE4D7.

Например, измерение уровня экспрессии нуклеиновой кислоты PDE4D7 можно оценивать путем разделения молекул нуклеиновых кислот (например, РНК или кДНК), полученных из образца, в агарозном или полиакриламидном гелях, с последующей гибридизацией со специфичными к PDE4D7 олигонуклеотидными зондами, как определено в настоящем документе выше. Альтернативно, уровень экспрессии можно определять путем мечения нуклеиновой кислоты, полученной из образца, с последующим разделением на геле для секвенирования. Образцы нуклеиновых кислот можно наносить на гель так, чтобы нуклеиновая кислота пациента и контрольная или стандартная нуклеиновая кислота находились в соседних дорожках. Сравнение уровней экспрессии можно проводить визуально или с помощью денситометра. Способы обнаружения мРНК или продуктов экспрессии известны специалисту в данной области. Как правило, для такой цели можно использовать нозерн-блот-анализ.

Альтернативно, обнаружение уровня нуклеиновой кислоты PDE4D7 можно проводить в подходах ДНК-чипов или ДНК-микрочипов. Как правило, нуклеиновые кислоты образцов, происходящие от индивидуумов, подлежащих тестированию, подвергают обработке и метят, предпочтительно, флуоресцентной меткой. Затем такие молекулы нуклеиновых кислот можно использовать в подходе гибридизации с иммобилизованными улавливающими зондами, соответствующими маркерному гену PDE4D7 по настоящему изобретению или генам известного биомаркера или маркера злокачественной опухоли. Подходящие средства для проведения анализа на микрочипах известны специалистам в данной области.

В стандартных условиях ДНК-чип или микрочип содержит иммобилизованные зонды с высокой плотностью для обнаружения ряда генов. Зонды на чипе комплементарны одной или нескольким частям последовательности маркерного гена или всей кодирующей области маркерного гена. В настоящем изобретении в качестве зонда для ДНК-чипа можно использовать любой тип связанного с PDE4D7 полинуклеотида, при условии, что этот полинуклеотид позволяет специфическое различение между экспрессией гена PDE4D7 и экспрессией других генов. Как правило, в качестве зондов подходят кДНК, продукты ПЦР и олигонуклеотиды. Предпочтительно, в качестве зонда можно использовать зонд, вовлекающий специфические части варианта по сплайсингу 7 PDE4D. В дополнение к определению экспрессии PDE4D7, также можно проводить определение экспрессии других генов, например, генов дополнительных биомаркеров или маркеров злокачественных опухолей.

Способ обнаружения на основе ДНК-чипа или ДНК-микрочипа, как правило, включает следующие стадии: (1) выделение мРНК из образца и необязательно превращение мРНК в кДНК, а затем мечение этой РНК или кДНК. Способы выделения РНК, превращения ее в кДНК и мечения нуклеиновых кислот, описаны в руководствах для технологии микрочипов. (2) Гибридизация нуклеиновых кислот стадии 1 с зондами для маркерных генов. Нуклеиновые кислоты из образца можно метить красителем, таким как флуоресцентные красители Cy3 (красный) или Cy5 (синий). Как правило, контрольный образец метят отличающимся красителем. (3) Обнаружение гибридизации нуклеиновых кислот из образца с зондами и определение, по меньшей мере качественно, и более конкретно количественно, количеств мРНК в образце для PDE4D7 и/или дополнительных исследованных маркерных генов. Отличие в уровне экспрессии между образцом и контролем можно оценивать, на основе отличия в интенсивности сигнала. Ее можно измерять и анализировать с помощью соответствующего программного обеспечения, такого как, но не ограничиваясь ими, программное обеспечение, предоставляемое, например, Affymetrix.

Отсутствует ограничение количества зондов, соответствующих используемым маркерным генам, которые наносят на ДНК-чип. Также маркерный ген может быть представлен двумя или тремя зондами, где зонды гибридизуются с различными частями гена. Зонды конструируют для каждого выбранного маркерного гена. Такой зонд, как правило, представляет собой олигонуклеотид, содержащий 5-50 нуклеотидных остатков. Более длинные ДНК можно синтезировать способом ПЦР или химически. Способы синтеза таких олигонуклеотидов и нанесения их на подложку хорошо известны в области микрочипов. Также на ДНК-чип можно наносить гены, отличные от маркерных генов. Например, на ДНК-чип можно наносить зонд, уровень экспрессии гена которого не изменен существенно, для нормализации результатов анализа иди для сравнения результатов анализа множества чипов или различных анализов.

Альтернативно, обнаружение уровня экспрессии нуклеиновых кислот PDE4D7 можно проводить в количественном подходе RT-PCR, предпочтительно, в подходе ПЦР в реальном времени с последующей обратной транскрипцией мРНК-транскрипта PDE4D7. Как правило, в качестве первой стадии транскрипт подвергают обратной транскрипции в молекулу кДНК согласно любому подходящему способу, известному специалисту в данной области. Затем на основе первой цепи ДНК, полученной как описано выше, можно проводить количественный подход или подход на основе ПЦР в реальном времени.

Предпочтительно, для количественного обнаружения способом ПЦР можно использовать зонды Taqman или Molecular Beacon в качестве основных зондов на основе FRET этого типа. В обоих случаях, зонды, предпочтительно, PDE4D7 зонды, как определено в настоящем документе выше, служат в качестве внутренних зондов, которые используют совместно с парой противостоящих праймеров, которые фланкируют представляющую интерес заданную область, предпочтительно, набор олигонуклеотидов PDE4D7, как определено в настоящем документе выше. При амплификации заданного сегмента зонд может селективно связываться с продуктами при идентификации последовательности между участками праймеров, тем самым вызывая увеличение передачи сигнала FRET относительно увеличения заданной частоты.

Предпочтительно, зонд Taqman, используемый для количественного подхода на основе ПЦР по настоящему изобретению, может включать олигонуклеотид PDE4D7, как определено выше, приблизительно из от 22 до 30 оснований, который является меченым на обоих концах парой FRET. Как правило, 5'-конец имеет флуорофор с более короткой длиной волны, такой как флуоресцеин (например, FAM) и 3'-конце обычно метят тушителем флуоресценции с большей длиной волны (например, TAMRA) или соединением нефлуоресцентного тушителя (например, Black Hole Quencher). Предпочтительно, чтобы зонды, используемые для количественной ПЦР, в частности, зонды PDE4D7, как определено в настоящем документе выше, не имели гуанина (G) на 5'-конце, соседнего с репортерным красителем, для предотвращения тушения флуоресценции репортера после деградации зонда.

Зонд Molecular Beacon, используемый для количественного подхода на основе ПЦР по настоящему изобретению, предпочтительно, использует взаимодействия FRET для обнаружения и количественного определения продукта ПЦР, причем каждый зонд имеет 5'-флуоресцентно меченный конец и 3'-меченный тушителем конец. Эта конфигурация шпильки или конфигурация стебель-петля структуры зонда содержит, предпочтительно, стебель с двумя короткими самосвязывающимися концами и петлю с длинной внутренней специфичной к мишени областью из от 20 до 30 оснований.

Альтернативно, механизмы обнаружения, которые также можно использовать в контексте настоящего изобретения направлены на зонд, изготовленный только со структурой петли и без короткой комплементарной области стебля. Альтернативный подход на основе FRET для количественной ПЦР, который также можно использовать в контексте настоящего изобретения, основан на применении двух зондов для гибридизации, которые связываются с двумя соседними участками на мишени, где первый зонд имеет флуоресцентную донорную метку на 3'-конце и второй зонд имеет флуоресцентную акцепторную метку на его 5'-конце.

Измерение уровней белка PDE4D7 или его любых фрагментов, гомологов или производных, можно проводить с помощью любого подходящего способа обнаружения, известного в данной области. Предпочтительно, уровень белка PDE4D7 и его производных можно определять иммунологически, например, с использованием антитела, специфичного к белку PDE4D7, предпочтительно, антитела, как определено в настоящем документе выше. Альтернативно, можно использовать варианты или фрагменты антител, как определено в настоящем документе. Также настоящее изобретение предусматривает использование пептидных аффинных лигандов, таких как аптамеры, специфичных к белку PDE4D7, как определено в настоящем документе выше.

Определение уровней белка PDE4D7 можно проводить, например, путем разделения белков из образца на полиакриламидном геле с последующей идентификацией белка PDE4D7 с использованием специфично связывающихся антител в вестерн-блот анализе. Альтернативно, белки можно разделять с помощью систем для двумерного гель-электрофореза. Двумерный гель-электрофорез хорошо известен в данной области и, как правило, вовлекает изоэлектрическое фокусирование вдоль первого измерения с последующим SDS-PAGE-электрофорезом вдоль второго измерения. Анализ 2D-гелей SDS-PAGE можно проводить путем определения интенсивности пятен белка на геле, или его можно проводить с использованием иммунного обнаружения. В других вариантах осуществления образцы белка анализируют с помощью масс-спектроскопии.

В контексте настоящего изобретения специфичные к PDE4D7 антитела можно помещать на подложку и иммобилизовывать. Затем белки, происходящие из образцов или тканей, подлежащих анализу, можно смешивать с антителами. Затем можно проводить реакцию обнаружения, например, с помощью второго аффинного лиганда, как определено в настоящем документе выше, предпочтительно, с помощью специфического антитела.

Иммунологические тесты, которые можно использовать в контексте настоящего изобретения, в частности, для диагностических целей по настоящему изобретению, включают, например, системы конкурентного и неконкурентного анализа с использованием таких способов, как вестерн-блоты, радиоиммунный анализ, такой как RIA (радиоактивный иммуноанализ), ELISA (твердофазный иммуноферментный анализ), "сэндвич"-иммуноанализы, анализы иммунопреципитации, реакции с преципитином, реакции с преципитином с диффузией в геле, анализы иммунодиффузии, анализы агглютинации, например, латексной агглютинации, анализы фиксации комплемента, иммунорадиометрические анализы, флуоресцентные иммуноанализы, например, FIA (ассоциированный с флуоресценцией иммуноанализ), хемилюминесцентные иммуноанализы, электрохемилюминесцентный иммуноанализ (ECLIA) и иммуноанализы с белком A. Такие анализы являются общепринятыми и хорошо известны специалисту в данной области.

Более того, аффинность связывания антитела с антигеном и константу скорости диссоциации для взаимодействия антитело-антиген можно определять с помощью конкурентных анализов связывания. Одним примером конкурентного анализа связывания является радиоиммунный анализ, включающий инкубацию меченого антигена (например, 3H или 125I) с подходящим антителом в присутствии возрастающих количеств немеченого антигена, и обнаружение антитела, связанного с меченым антигеном. Аффинность представляющего интерес антитела в отношении конкретного антигена и константу скорости диссоциации для связывания можно определять из этих данных с помощью любого подходящего подхода для анализа, например, с помощью анализа графика Скэтчарда. Также можно определять конкуренцию со вторым антителом с использованием радиоиммунных анализов. В этом случае антиген можно инкубировать с подходящим антителом, конъюгированным с меченым соединением (например, 3H или 125I) в присутствии возрастающих количеств немеченого второго антитела.

Кроме того, в способе обнаружения белков PDE4D7 можно использовать аптамеры, специфичные к белку PDE4D7, предпочтительно, как определено в настоящем документе выше. Такие аптамеры, предпочтительно, можно метить для обеспечения обнаружения взаимодействия белок-лиганд.

Определение биологической активности PDE4D7 можно проводить с использованием молекулярных или ферментных анализов, специфичных к соответствующей функции или функциям PDE4D7. Предпочтительно, можно использовать систему получения данных на основе преобразования cAMP фосфодиэстеразой. Подходящие способы известны специалисту в данной области. В следующем предпочтительном варианте осуществления анализ для определения биологической активности PDE4D7 можно проводить в сочетании с ингибированием активности других вариантов по сплайсингу PDE4D, других изоформ PDE4 и/или других PDE, предпочтительно, других PDE, способных осуществлять превращение cAMP. Такое ингибирование активности можно проводить с помощью любых подходящих средств, известных специалисту в данной области, предпочтительно, путем применения подходящих антисмысловых нуклеотидов, молекул siРНК или молекул miРНК, более предпочтительно, путем специфической гибридизации антисмысловых нуклеотидов, специфичных молекул siРНК или miРНК.

В следующем предпочтительном варианте осуществления биологическую активность PDE4D7 можно тестировать с помощью специфических ингибиторов PDE4D7. Применение таких ингибиторов можно, например, комбинировать с системой получения данных на основе превращения субстрата cAMP. Характерные используемые ингибиторы PDE4D7 включают антисмысловые молекулы, молекулы siРНК или молекулы miРНК.

Обнаружение уровня PDE4D7 также можно проводить в способах, предусматривающих гистологические или клеточно-биологические процедуры. Как правило, можно использовать визуальные способы, такие как световая микроскопия или иммунофлуоресценция или УФ-микроскопия, а также проточную цитометрию или люминометрию. Обнаружение или определение присутствия белка PDE4D7 в клетке можно, например, проводить путем извлечения клеток, подлежащих тестированию, из образцов, как определено в настоящем документе выше. Также для этих способов можно использовать срезы тканей или биоптаты. Затем можно использовать аффинные лиганды для PDE4D7, предпочтительно, антитела или аптамеры. Как правило, такие аффинные лиганды метят, предпочтительно, флуоресцентными метками, как определено в настоящем документе выше. Такой способ позволяет проводить обнаружение PDE4D7, его количественное определение и, кроме того, позволяет определить его распределение и относительный уровень экспрессии.

Такие способы предусматривают применение способов визуализации. Подходящие способы визуализации известны специалисту в данной области. Характерные способы, подлежащие применению, включают флуориметрические, люминометрические и/или ферментативные способы. Обнаружение и/или количественное определение флуоресценции, как правило, проводят путем воздействия на флуоресцентные метки света с конкретной длиной волны, а затем обнаружения и/или количественного определения испускаемого света конкретной длины волны. Обнаружение присутствия и/или количественное определение люминесцентно меченого аффинного лиганда можно проводить с помощью люминесценции, появляющейся в ходе химической реакции. Обнаружение ферментативной реакции проводят по изменению цвета образца вследствие химической реакции.

В следующем предпочтительном варианте осуществления уровень PDE4D7 можно определять с помощью подходящих способов молекулярной визуализации, например, магнитно-резонансной томографии (MRI) или магнитно-фотонной визуализации (MPI), и/или с использованием подходящих контрастных средств, например, контрастных средств, как определено в настоящем документе выше.

В следующем предпочтительном варианте осуществления способ обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы по настоящему изобретению включает дополнительную стадию сравнения измеренных уровней нуклеиновой кислоты или белка или измеренной биологической активности с контрольным уровнем. Термин "контрольный уровень", как используют в настоящем документе, относится к экспрессии маркера PDE4D7 или других подходящих маркеров в нормальном контроле или злокачественном контроле, как определено в настоящем документе выше. Статус, характер, количество и состояние контрольного уровня можно корректировать в зависимости от потребности. Предпочтительно, можно использовать здоровый или доброкачественный контрольный уровень. Термин "сравнение", как используют в настоящем документе, относится к любому подходящему способу оценки, вычисления, охарактеризации или переработки данных.

В другом варианте осуществления в качестве следующей дополнительной стадии, заключение в отношении присутствия или стадии злокачественной опухоли или прогрессирования злокачественной опухоли может быть основано на результатах стадии сравнения. Агрессивный гормон-чувствительный рак предстательной железы можно диагностировать или прогнозировать или прогрессирование в агрессивный гормон-чувствительный рак предстательной железы можно диагностировать или прогнозировать в указанном способе по соответствующим определениям, представленным в настоящем документе выше в контексте PDE4D7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы.

В другом варианте осуществления настоящее изобретение относится к способу обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, предусматривающему по меньшей мере стадии:

(a) тестирование по меньшей мере в одном образце, полученном от по меньшей мере одного индивидуума, предположительно страдающего агрессивным гормон-чувствительным раком предстательной железы, экспрессии продукта экспрессии PDE4D7 или белка PDE4D7;

(b) тестирование по меньшей мере в одном контрольном образце, полученном от по меньшей мере одного индивидуума, не страдающего агрессивным гормон-чувствительным раком предстательной железы, экспрессии продукта экспрессии PDE4D7 или белка PDE4D7;

(c) определение отличий в экспрессии стадий (a) и (b); и

(d) заключение о присутствии или стадии агрессивного гормон-чувствительного рака предстательной железы или прогрессировании в агрессивный гормон-чувствительный рак предстательной железы, исходя из результатов, полученных на стадии (c).

В одном из вариантов осуществления, стадии a), b), c) и/или d) этого способа диагностики можно проводить вне организма человека или животного, например, в образцах, полученных от пациента или индивидуума.

В другом аспекте настоящее изобретение относится к способу диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, где указанный способ различает между доброкачественным и агрессивным гормон-чувствительным раком предстательной железы, включающему стадии:

(a) определение уровня PDE4D7,

(b) определение уровня экспрессии эталонного гена в образце;

(c) нормализация измеренного уровня экспрессии PDE4D7 к экспрессии эталонного гена; и

(d) сравнение нормализованного уровня экспрессии с заданной пороговой величиной, выбранной для исключения доброкачественной опухоли предстательной железы, где нормализованный уровень экспрессии выше пороговой величины указывает на агрессивный гормон-чувствительный рак предстательной железы, где указанная пороговая величина составляет от -2 до +2, предпочтительно, приблизительно равна 0.

Уровень PDE4D7 можно определять по уровню нуклеиновой кислоты, белка или активности, как описано в настоящем документе выше. Предпочтительным является определение количества транскрипта(ов) и/или белка PDE4D7. В дополнение к этому, можно определять уровень гена домашнего хозяйства в образце.

Термин "эталонный ген", как используют в настоящем документе, относится к любому подходящему гену, например, к любому стабильно экспрессируемому и непрерывно поддающемуся обнаружению гену, продукту гена, продукту экспрессии, белку или варианту белка в выбранном организме. Также термин включает продукты генов, такие как экспрессируемые белки, пептиды, полипептиды, а также их модифицированные варианты. Таким образом, изобретение также включает эталонные белки, происходящие из эталонного гена. Также предусматриваются все типы транскриптов, происходящие из эталонного гена, а также их модификации или вторичные параметры, связанные с ними. Альтернативно, или дополнительно, также для целей эталона можно использовать другие эталонные параметры, например, метаболические концентрации, размеры клеток и т.д.

Экспрессия, предпочтительно, может происходить в одном образце, т.е. уровень PDE4D7 и эталонного гена определяют в одном образце. Если тестирование проводят в одном образце, можно осуществлять подход единичного обнаружения или мультиплексного обнаружения, как описано в настоящем документе. Предпочтительно, для мультиплексного обнаружения можно использовать олигонуклеотиды и зонды, имеющие последовательность SEQ ID NO:10, 11 и 12. Для проведения мультиплексного обнаружения можно модифицировать концентрацию праймеров и/или олигонуклеотидов-зондов. Более того, можно модифицировать концентрацию и присутствие других ингредиентов, таких как буферы, ионы и т.д., например, их увеличение или снижение по сравнению с указаниями изготовителей.

В конкретном варианте осуществления настоящего изобретения, можно определять экспрессию более чем одного эталонного гена или стабильно экспрессируемого гена. Например, можно определять экспрессию 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 30 или более эталонных генов. Результаты таких измерений можно либо вычислять по отдельности, либо их можно комбинировать для получения среднего индекса экспрессии. Более того, характер экспрессии эталонного гена можно определять и/или использовать в качестве основы для последующих стадий. Такой характер может быть основан на известном экспрессионном поведении генов при определенных злокачественных опухолях, в частности, на определенных стадиях или состояниях рака предстательной железы.

Более того, результаты экспрессии можно сравнивать с уже известными результатами из стандартных ситуаций или баз данных. Кроме того, сравнение может включать процесс нормализации для улучшения статистической значимости результатов.

В альтернативном варианте осуществления настоящего изобретения вместо определения уровня экспрессии эталонного гена в образце можно определять экспрессию дополнительного маркера злокачественной опухоли или нестабильно экспрессируемого гена. Например, можно определять экспрессию гена, которая, как известно, является сниженной при гормон-резистентном раке предстательной железы, или которая, как известно, является повышенной при гормон-чувствительном раке предстательной железы.

В следующем варианте осуществления также можно проводить оба определения экспрессии, т.е. определение экспрессии эталонного гена и дополнительного гена злокачественной опухоли или биомаркерного гена.

Результаты экспрессии можно нормализовать по любому подходящему способу, известному специалисту в данной области, например, с помощью статистического способа нормализации, таким как стандартная оценка, T-критерий Стьюдента, стьюдентизированный остаточный критерий, стандартизованный моментальный критерий, или критерий изменения коэффициентов. Как правило, такие критерии или соответствующие формулы, которые могут быть известны специалисту в данной области, можно использовать для стандартизации данных экспрессии для обеспечения различения между реальным варьированием уровней экспрессии генов и изменения вследствие процессов измерения.

На основе результатов для экспрессии, полученных на стадиях (a) и (b), и/или нормализованных результатов, полученных на стадии (c), можно проводить сравнение с пороговой величиной для экспрессии PDE4D7. Пороговая величина, выше которой уровень экспрессии PDE4D7 указывает на агрессивный гормон-чувствительный рак предстательной железы, тем самым, исключая доброкачественные формы опухоли предстательной железы или ситуации здоровья или формы здоровых тканей, составляет приблизительно от -3 до + 3, от -3 до +2,75, от -3 до +2,5, от -3 до +2,25, от -3 до +2, от -3 до +1,75, от -3 до +1,5, от -3 до +1,25, от -3 до +1, от -3 до +0,75, от -3 до +0,5, от -3 до +0,25, от -3 до 0, от -2,75 до +3, от -2,5 до +3, от -2,25 до +3, от -2 до +3, от -1,75 до +3, от -1,5 до +3, от -1,25 до +3, от -1 до +3, от -0,75 до +3, от -0,5 до +3, от -0,25 до +3, или от 0 до +3. Более предпочтительная пороговая величина представляет собой пороговую величину приблизительно 0, например, 0,9, 0,8, 0,7, 0,6, 0,5, 0,4, 0,3, 0,2, 0,1 или -0,9, -0,8, -0,7, -0,6, -0,5, -0,4, -0,3, -0,2 или -0,1. В особенно предпочтительном варианте осуществления указанную пороговую величину используют для гена другой фосфодиэстеразы в качестве эталонного гена. Еще более предпочтительно, указанную пороговую величину используют для гена PDE4D5 в качестве эталонного гена.

В предпочтительном варианте осуществления настоящего изобретения пороговая величина представляет собой пороговую величину для PDE4D7 в образцах крови, например, в образцах сыворотки или плазмы, образцах мочи или образцах осадка мочи. В особенно предпочтительном варианте осуществления настоящего изобретения пороговая величина представляет собой пороговую величину для белка или полипептида PDE4D7 или любого их производного, как определено в настоящем документе выше, в образце мочи. В другом особенно предпочтительном варианте осуществления настоящего изобретения пороговая величина представляет собой пороговую величину для белка или полипептида PDE4D7 или любого их производного, как определено в настоящем документе выше, в клетках, содержащихся в моче или экзосомах, секретируемых из клеток, содержащихся в моче. В еще более предпочтительном варианте осуществления настоящего изобретения пороговая величина представляет собой пороговую величину для белка или полипептида PDE4D7 или их любого производного, как определено в настоящем документе выше, в образце осадка мочи и клетках, содержащихся в образце осадка мочи, или в экзосомах, секретируемых из клеток, содержащихся в образце осадка мочи.

Если измеренная и/или нормализованная экспрессия PDE4D7 находится ниже указанной пороговой величины, это можно видеть в качестве указания на то, что индивидуум либо является здоровым с точки зрения опухолей предстательной железы, либо страдает только доброкачественной опухолью предстательной железы, но не агрессивным гормон-чувствительным раком предстательной железы.

В другом аспекте настоящее изобретение относится к способу сбора данных, включающему по меньшей мере стадии:

(a) тестирование у индивидуума экспрессии PDE4D7; и

(b) сравнение экспрессии, определенной на стадии (a), с контрольным уровнем.

Тестирование в отношении экспрессии PDE4D7 можно проводить согласно стадиям, как определено в настоящем документе выше. Предпочтительно, тестирование можно проводить в качестве измерения уровней нуклеиновой кислоты или белка PDE4D7 или путем определения биологической активности PDE4D7, более предпочтительно, согласно возможностям для таких измерений, описанным в настоящем документе выше. Тестирование можно проводить у индивидуума, т.е. in vivo, или вне индивидуума, т.е. ex vivo или in vitro. Термин "контрольный уровень", как используют в контексте способа сбора данных, относится к экспрессии маркера PDE4D7 или других подходящих маркеров в нормальном контроле или злокачественном контроле, как определено в настоящем документе выше. Статус, характер, количество и состояние контрольного уровня можно корректировать в соответствии с потребностью. Предпочтительно, можно использовать нормальный здоровый контрольный уровень. Сравнение экспрессии с контрольным уровнем можно проводить согласно любому подходящему способу оценки, вычисления, характеризации или обработки данных и, в частности, оно нацелено на обнаружение различий между двумя наборами данных. Кроме того, можно проводить статистическую оценку значимости отличий. Подходящие статистические способы известны специалисту в данной области. Полученные данные и информацию можно хранить, накапливать или обрабатывать с помощью любых информатических или компьютерных способов или инструментов, известных специалисту в данной области и/или они могут быть предоставлены соответствующим образом для обеспечения применения практикующим специалистом данных для одной или нескольких последующих стадий обобщения или заключения.

В другом аспекте настоящее изобретение относится к иммуноанализу для обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, включающему по меньшей мере стадии:

(a) тестирование в образце, полученном от индивидуума, экспрессии PDE4D7,

(b) тестирование в контрольном образце экспрессии PDE4D7,

(c) определение отличий в экспрессии PDE4D7 на стадиях(a) и (b); и

(d) заключение о присутствии или стадии агрессивного гормон-чувствительного рака предстательной железы или прогрессировании в агрессивный гормон-чувствительный рак предстательной железы исходя из результатов, полученных на стадии (c).

Иммуноанализ, предпочтительно, основан на применении антитела, специфично связывающегося с PDE4D7, например, одного или нескольких антител против PDE4D7, упомянутых в настоящем документе. Альтернативно, иммуноанализ можно проводить или комбинировать с любым другим подходящим способом. Например, анализ можно комбинировать с обнаружением нуклеиновых кислот, или способами ферментативного тестирования, как описано в настоящем документе.

В следующем аспекте настоящее изобретение относится к иммуноанализу для различения между доброкачественной опухолью предстательной железы и агрессивным гормон-чувствительным раком предстательной железы, предусматривающему стадии:

(a) определение уровня PDE4D7 в образце;

(b) определение уровня экспрессии эталонного гена в образце;

(c) нормализация измеренного уровня экспрессии PDE4D7 к экспрессии эталонного гена; и

(d) сравнение нормализованного уровня экспрессии с заданной пороговой величиной, выбранной так, чтобы исключить доброкачественную опухоль предстательной железы, где нормализованный уровень экспрессии выше пороговой величины указывает на агрессивный гормон-чувствительный рак предстательной железы, где указанная пороговая величина составляет приблизительно от -2 до +2. Предпочтительно, пороговая величина приблизительно равна 0.

Уровень PDE4D7, предпочтительно, можно определять по уровню белка или активности, как описано в настоящем документе выше. Предпочтительным является определение количества белка PDE4D7 с помощью специфических антител против PDE4D7, например, одного или нескольких антител против PDE4D7, упомянутых в настоящем документе. Альтернативно, иммуноанализ можно проводить с помощью любого другого подходящего средства или его можно комбинировать с определением других структур. Например, анализ можно комбинировать с определением присутствия или количества нуклеиновых кислот, или со способами ферментативного тестирования, как описано в настоящем документе.

Кроме того, можно определять уровень эталонного гена, как определено в настоящем документе выше. Для обнаружения эталонного гена можно определять количество продукта экспрессии гена (т.е. белка), предпочтительно, с помощью одного или нескольких подходящих антител, известных специалисту в данной области. Альтернативно, определение эталонного гена можно проводить с помощью любого другого подходящего средства или его можно сочетать с обнаружением присутствия или количества нуклеиновых кислот, или способов ферментного тестирования, как описано в настоящем документе.

Исходя из результатов экспрессии, полученных на стадиях (a) и (b) и/или нормализованных результатов, полученных на стадии (c), можно проводить сравнение с пороговой величиной экспрессии PDE4D7. Пороговая величина, выше которой уровень экспрессии PDE4D7 указывает на агрессивный гормон-чувствительный рак предстательной железы, тем самым, исключая доброкачественные формы опухоли предстательной железы или ситуации здоровья или формы здоровых тканей, составляет приблизительно от -3 до + 3, от -3 до +2,75, от -3 до +2,5, от -3 до +2,25, от -3 до +2, от -3 до +1,75, от -3 до +1,5, от -3 до +1,25, от -3 до +1, от -3 до +0,75, от -3 до +0,5, от -3 до +0,25, от -3 до 0, от -2,75 до +3, от -2,5 до +3, от -2,25 до +3, от -2 до +3, от -1,75 до +3, от -1,5 до +3, от -1,25 до +3, от -1 до +3, от -0,75 до +3, от -0,5 до +3, от -0,25 до +3, или от 0 до +3. Более предпочтительная пороговая величина представляет собой пороговую величину приблизительно 0, например, 0,9, 0,8, 0,7, 0,6, 0,5, 0,4, 0,3, 0,2, 0,1 или -0,9, -0,8, -0,7, -0,6, -0,5, -0,4, -0,3, -0,2 или -0,1. В особенно предпочтительном варианте осуществления указанную пороговую величину используют для гена другой фосфодиэстеразы в качестве эталонного гена. Еще более предпочтительно, указанную пороговую величину используют для гена PDE4D5 в качестве эталонного гена.

Пороговая величина может представлять собой пороговую величину для PDE4D7 в образцах крови, например, в образцах сыворотки или плазмы, образцах мочи или образцах осадка мочи и т.д., как описано в настоящем документе ниже.

Если измеренная и/или нормализованная экспрессия PDE4D7 ниже указанной пороговой величины, это можно считать показателем того, что индивидуум либо является здоровым в отношении опухолей предстательной железы, либо страдает только от доброкачественных опухолей предстательной железы, но не агрессивным гормон-чувствительным раком предстательной железы. Кроме того, эта величина может указывать на то, что индивидуум страдает гормон-резистентным раком предстательной железы. Для исследования или исключения присутствия гормон-резистентных злокачественных заболеваний можно тестировать уровень другого подходящего биомаркера, например, уровень PSA. В случае гормон-резистентного рака предстательной железы ожидаемым является уровень PSA >20 нг/мл.

В следующем аспекте настоящее изобретение относится к способу идентификации индивидуума, подходящего для терапии агрессивного гормон-чувствительного рака предстательной железы, включающему:

(a) тестирование в образце, полученном от индивидуума, экспрессии PDE4D7;

(b) тестирование в указанном образце экспрессии эталонного гена и/или тестирование в контрольном образце экспрессии PDE4D7;

(c) классификация уровней экспрессии стадии (a) относительно уровней стадии (b); и

(d) идентификация индивидуума как подходящего для получения терапии агрессивного гормон-чувствительного рака предстательной железы, где образец индивидуума классифицирован как имеющий увеличенный уровень экспрессии PDE4D7.

Уровень PDE4D7 можно определять по уровню нуклеиновой кислоты, белка или активности, как описано в настоящем документе выше. Предпочтительным является определение количества транскрипта(ов) и/или белка PDE4D7. Кроме того, можно определять уровень эталонного гена, как описано в настоящем документе выше, в образце. Тестирование экспрессии эталонного гена можно проводить в образце, используемом для определения PDE4D7. Если тестирование проводят в одном образце, можно осуществлять подход единичного обнаружения или множественного обнаружения, как описано в настоящем документе. Предпочтительно, для множественного обнаружения можно использовать олигонуклеотиды и зонды, имеющие последовательность SEQ ID NO:10, 11 и 12. Для проведения множественного обнаружения можно модифицировать концентрацию праймеров и/или олигонуклеотидов-зондов. Более того, можно модифицировать концентрацию и присутствие других ингредиентов, таких как буферы, ионы и т.д., например, их увеличение или снижение по сравнению с указаниями изготовителей. Альтернативно, тестирование экспрессии эталонного гена можно проводить в отличающемся образце, предпочтительно, в контрольном образце, как определено в настоящем документе выше. Предпочтительно, такой контрольный образец может представлять собой контрольный образец от того же индивидуума, что и тестируемый образец или контрольный образец, происходящий из другого источника или индивидуума. Контрольный образец, кроме того, может быть либо образцом, происходящим из той же ткани, предпочтительно, ткани предстательной железы, либо он может происходить из отличающегося типа ткани. Примерами предпочтительных альтернативных типов тканей являются стромальная ткань предстательной железы, эпителиальная ткань мочевого пузыря и эпителиальная ткань мочеточника. Более того, тестирование тестируемого образца в отношении экспрессии эталонного гена и тестирование контрольного образца в отношении экспрессии PDE4D7, можно комбинировать.

В следующем варианте осуществления контрольный образец также можно тестировать в отношении экспрессии эталонного гена. В случае тестирования более одного образца в отношении экспрессии эталонного гена, полученные результаты экспрессии можно сравнивать и/или усреднять или нормализовать в соответствии с любым подходящим статистическим способом, известным специалисту в данной области.

Термин "классификация уровней экспрессии стадии (a) относительно уровней стадии (b)", как используют в настоящем документе, означает, что экспрессию PDE4D7 в тестируемом образце и экспрессию PDE4D7 в контрольном образце сравнивают, например, после нормализации относительно подходящих эталонов для нормализации. Согласно исходу сравнения, тестируемый образец указывают как обеспечивающий сходную экспрессию с контрольным образцом, увеличенную экспрессию по сравнению с контрольным образцом или сниженную экспрессию по сравнению с контрольным образцом. Кроме того, термин означает, что сравнивают экспрессию PDE4D7 в тестируемом образце и экспрессию эталонного гена в том же тестируемом образце, например, после нормализации относительно другого гена в качестве эталона для нормализации. Согласно исходу сравнения, тестируемый образец указывают как обеспечивающий сходную экспрессию с эталонным геном, увеличенную экспрессию по сравнению с эталонным геном, или сниженную экспрессию по сравнению с эталонным геном.

Согласно классификации результатов экспрессии, индивидуума можно считать подходящим для терапии агрессивного гормон-чувствительного рака предстательной железы, когда уровни экспрессии PDE4D7 возрастают. Уровень экспрессии считают "увеличенными", когда экспрессия гена PDE4D7 в тестируемом образце повышена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем на 50% по сравнению с экспрессией PDE4D7 в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз, или по меньшей мере в 10 раз или более по сравнению с экспрессией PDE4D7 в контрольном образце; или когда экспрессия гена PDE4D7 повышена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем на 50% по сравнению с экспрессией эталонного гена в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз, или по меньшей мере в 10 раз или более повышена по сравнению с экспрессией эталонного гена. В конкретном варианте осуществления экспрессию эталонного гена также можно нормализовать или корректировать относительно экспрессии дополнительных генов или маркеров, например, генов домашнего хозяйства.

В следующем аспекте настоящее изобретение относится к иммуноанализу для стратификации индивидуума или группы индивидуумов с агрессивным гормон-чувствительным раковым заболеванием предстательной железы, предусматривающему:

(a) тестирование в образце, полученном от индивидуума, экспрессии PDE4D7;

(b) тестирование в указанном образце экспрессии эталонного гена и/или тестирование в контрольном образце экспрессии PDE4D7;

(c) определение отличия в экспрессии PDE4D7 на стадии (a) и экспрессии PDE4D7 и/или эталонного гена на стадии (b); и

(d) стратификация индивидуума или группы индивидуумов для терапии агрессивного гормон-чувствительного рака предстательной железы, исходя из результатов, полученных на стадии (c), где образец индивидуума имеет повышенный уровень экспрессии PDE4D7.

Тестирование экспрессии PDE4D7 можно, предпочтительно, проводить путем определения количества белка PDE4D7 или определения уровня активности PDE4D7, как описано в настоящем документе выше. Предпочтительным является определение количества белка PDE4D7 с помощью специфичных к PDE4D7 антител, например, одного или нескольких антител против PDE4D7, упомянутых в настоящем документе. Альтернативно, можно проводить иммуноанализы с любым другим подходящим средством или их можно комбинировать с определением других структур. Например, анализ можно комбинировать с обнаружением присутствия или количества нуклеиновых кислот, или способов ферментного тестирования, как описано в настоящем документе. Кроме того, можно определять уровень эталонного гена, как описано в настоящем документе выше, в образце. Тестирование экспрессии эталонного гена можно проводить в том же образце, который использовали для определения PDE4D7. Если тестирование проводят в том же образце, можно осуществлять подход единичного обнаружения или параллельного обнаружения или мультиплексного обнаружения. Предпочтительно, для параллельного или мультиплексного обнаружения можно использовать по-разному меченые первичные или вторичные антитела.

Альтернативно, тестирование экспрессии эталонного гена можно проводить в отличающемся образце, предпочтительно, в контрольном образце, как определено в настоящем документе выше. Предпочтительно, такой контрольный образец может представлять собой контрольный образец от того же индивидуума, что и тестируемый образец или контрольный образец, происходящий из другого источника или индивидуума. Контрольный образец, кроме того, может быть либо образцом, происходящим из той же ткани, предпочтительно, ткани предстательной железы, либо он может происходить из отличающегося типа ткани. Примерами предпочтительных альтернативных типов тканей являются стромальная ткань предстательной железы, эпителиальная ткань мочевого пузыря и эпителиальная ткань мочеточника. Более того, тестирование тестируемого образца в отношении экспрессии эталонного гена и тестирование контрольного образца в отношении экспрессии PDE4D7, можно комбинировать.

В следующем варианте осуществления контрольный образец также можно тестировать в отношении экспрессии эталонного гена. В случае тестирования более одного образца в отношении экспрессии эталонного гена, полученные результаты экспрессии можно сравнивать и/или усреднять или нормализовать согласно любому подходящему статистическому способу, известному специалисту в данной области.

Термин "определение отличия в экспрессии PDE4D7 на стадии (a) и экспрессии PDE4D7 и/или эталонного гена на стадии (b)", как используют в настоящем документе, означает, что экспрессию PDE4D7 в тестируемом образце и экспрессию PDE4D7 в контрольном образце сравнивают, например, после нормализации относительно подходящих эталонов для нормализации. Согласно исходу сравнения, тестируемый образец указывают как обеспечивающий сходную экспрессию с контрольным образцом, увеличенную экспрессию по сравнению с контрольным образцом или сниженную экспрессию по сравнению с контрольным образцом. Кроме того, термин означает, что, альтернативно, или дополнительно, сравнивают экспрессию PDE4D7 в тестируемом образце и экспрессию эталонного гена в том же тестируемом образце, например, после нормализации относительно другого гена в качестве эталона для нормализации. Согласно исходу сравнения, тестируемый образец указывают как обеспечивающий сходную экспрессию с эталонным геном или отличающуюся экспрессию. Отличие может представлять собой либо увеличенную экспрессию по сравнению с эталонным геном, либо сниженную экспрессию по сравнению с эталонным геном.

Термин "стратификация индивидуума или группы индивидуумов для терапии рака предстательной железы", как используют в настоящем документе, означает, что индивидуум идентифицирован как относящийся к группе сходных индивидуумов, для которых оптимальной формой терапии является терапия рака предстательной железы, предпочтительно, терапия против гормон-резистентного рака предстательной железы в соответствии с исходом теста экспрессии, как описано в настоящем документе выше, в частности, в соответствии с выявленным различием уровня экспрессии PDE4D7 и уровня экспрессии эталонного гена или уровня экспрессии PDE4D7 в других образцах. Согласно определению экспрессии, отличие в экспрессии у индивидуума может быть идентифицировано как принадлежность к группе сходных индивидуумов, оптимальной терапией для которых является терапия агрессивного гормон-чувствительного рака предстательной железы, когда уровни экспрессии PDE4D7 являются повышенными. Уровень экспрессии считают "повышенным", когда экспрессия гена PDE4D7 в тестируемом образце повышена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем 50% по сравнению с экспрессией PDE4D7 в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз, или по меньшей мере в 10 раз или более по сравнению с экспрессией PDE4D7 в контрольном образце; или когда уровень экспрессии генов PDE4D7 повышен, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем на 50% по сравнению с экспрессией эталонного гена в контрольном образце, или повышен по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз, или по меньшей мере в 10 раз или более по сравнению с экспрессией эталонного гена. В конкретном варианте осуществления экспрессию эталонного гена также можно нормализовывать или корректировать относительно экспрессии дополнительных генов или маркеров, например, генов домашнего хозяйства.

Индивидуум, для которого показана терапия агрессивного гормон-чувствительного рака предстательной железы или стратифицированный для терапии агрессивного гормон-чувствительного рака предстательной железы, как описано в настоящем документе выше, может получать любое подходящее терапевтическое лечение от этой формы рака предстательной железы, известное специалисту в данной области. В частности, термин "терапия агрессивного гормон-чувствительного рака предстательной железы", как используют в настоящем документе, относится к любой подходящей терапии рака предстательной железы, известной специалисту в данной области, и предпочтительно, он включает хирургическую кастрацию путем удаления яичек в качестве главного органа продукции мужских половых гормонов, химическую кастрацию, например, путем подавления образования андрогенов или путем ингибирования активности рецепторов андрогенов, цитотоксическую терапию, химиотерапию, лучевую терапию (лучевая терапия наружным пучком, брахитерапия), криотерапию, фокальную терапию, такую как удаление HIFU (высокочастотное ультразвуковое удаление) или термическое удаление.

Как правило, индивидуума, считаемого подходящим для терапии агрессивного гормон-чувствительного рака предстательной железы вследствие увеличенной экспрессии PDE4D7, можно считать страдающим гормон-чувствительным раком предстательной железы или являющегося предрасположенным к развитию гормон-чувствительного рака предстательной железы в будущем, например, в пределах последующих 1-24 месяцев. Соответственно идентифицированного или стратифицированного индивидуума можно лечить ингибиторной фармацевтической композицией по настоящему изобретению, например, как определено в настоящем документе ниже. В следующем варианте осуществления соответственно идентифицированного индивидуума можно лечить ингибиторной фармацевтической композицией по настоящему изобретению в комбинации с дополнительной терапией злокачественной опухоли. Термин "дополнительная терапия злокачественной опухоли" относится к любому типу терапии злокачественной опухоли, известному специалисту в данной области. Предпочтительными являются формы терапии злокачественной опухоли, известные для гормон-резистентного рака предстательной железы. Термин включает, например, все подходящие формы химиотерапии, лучевой терапии, хирургической операции, терапии антителами и т.д.

Альтернативно, соответственно идентифицированного или стратифицированного индивидуума также можно лечить только одной или несколькими способами терапии злокачественной опухоли, такими как химиотерапия, лучевая терапия, хирургическая операция, терапия антителами и т.д. Предпочтительными являются способы терапии злокачественной опухоли, обычно используемые для рака предстательной железы, более предпочтительно, способы терапии злокачественной опухоли, используемые для агрессивного гормон-чувствительного рака предстательной железы.

В следующем варианте осуществления настоящего изобретения способ классификации по пригодности или иммуноанализ для стратификации, как описано в настоящем документе выше, также можно использовать для мониторинга лечения индивидуума, например, индивидуума, классифицируемого как страдающего агрессивным гормон-чувствительным раком предстательной железы. Процесс мониторинга можно проводить в качестве определения экспрессии в течение длительного периода времени, например, в течение или после курсов лечения, в течение 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 недель, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 месяцев или 1, 2, 3 или более лет. Стадии определения можно проводить с подходящими интервалами, например, каждую неделю, 2 недели, 3 недели, каждый месяц, 2 месяца, 3 месяца, 6 месяцев, 12 месяцев и т.д. В следующем варианте осуществления настоящего изобретения любую схему лечения, упоминаемую в настоящем документе, можно корректировать, например, усиливать или ослаблять, или изменять любым подходящим образом в соответствии с результатами процесса мониторинга.

Тестирование экспрессии PDE4D7 можно проводить согласно стадиям, как определено в настоящем документе выше. Предпочтительно, тестирование можно проводить в качестве измерения уровней белка PDE4D7, более предпочтительно, в соответствии с возможностями для такого измерения, описанными в настоящем документе выше. В качестве контролей или контрольных образцов можно использовать контроли, как определено в настоящем документе выше. В особенно предпочтительном варианте осуществления стадии тестирования могут быть основаны на применении антитела, специфично связывающегося с PDE4D7, например, коммерчески доступного антитела против PDE4D7, такого как NB300-652 или GTX14629. Злокачественную опухоль можно диагностировать или прогнозировать или прогрессирование злокачественной опухоли можно диагностировать или прогнозировать в указанном иммуноанализе или индивидуума можно идентифицировать как подходящего для лечения рака предстательной железы, или индивидуума или группу индивидуумов можно стратифицировать в иммуноанализе, согласно соответствующим определениям, представленным в настоящем документе выше в контексте PDE4D7 в качестве маркера злокачественной опухоли. Таким образом, указанное тестирование или определение экспрессии PDE4D7 можно проводить, или можно дополнительно проводить, путем измерения уровней нуклеиновой кислоты или белка или путем определения биологической активности PDE4D7. Сходные измерения можно проводить в отношении эталонного гена.

В особенно предпочтительном варианте осуществления настоящего изобретения эталонный ген представляет собой ген домашнего хозяйства или другую фосфодиэстеразу. В организмах людей, примеры "генов домашнего хозяйства" включают, среди прочих, ген β-актина, глицеринальдегид-3-фосфатдегидрогеназы (GAPDH), порфобилиногендезаминазы (PBGD) и рибосомального белка P1. Помимо этих генов в качестве гена домашнего хозяйства можно использовать любой другой подходящий ген, при условии, что ген демонстрирует экспрессию или транскрипцию на стабильном немодифицированном уровне, в частности, в ходе различных стадий развития злокачественной опухоли, более предпочтительно, в ходе различных стадий развития рака предстательной железы, более предпочтительно, в ходе перехода гормон-чувствительного рака предстательной железы в состояние гормон-резистентного рака предстательной железы. Особенно предпочтительным является ген или транскрипт или продукт экспрессии или белок GAPDH. Кроме того, особенно предпочтительным является ген или транскрипт или продукт экспрессии или белок PBGD. Данные по экспрессии гена домашнего хозяйства можно получать для одного или нескольких образцов от одного индивидуума или от большего количества индивидуумов, например от 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 1000, 5000, 10000 или более. Данные об экспрессии также можно получать из баз данных или из коллекций данных, доступных специалисту в данной области.

Термин "отличающаяся фосфодиэстераза", как используют в настоящем документе, относится к другим фосфодиэстеразам, которые не являются PDE4D7. Такие фосфодиэстеразы, являющиеся подходящими в качестве эталонных генов, должны стабильно экспрессироваться и обеспечивать постоянно поддающийся обнаружению продукт гена, продукт экспрессии, белок или вариант белка в выбранном организме. Особенно предпочтительными являются фосфодиэстеразы семейства PDE4D, например, PDE4D1, PDE4D2, PDE4D3, PDE4D4, PDE4D5, PDE4D6, PDE4D8 и PDE4D9. Более предпочтительной является фосфодиэстераза PDE4D5. Таким образом, нормализацию и/или сравнение с GAPDH, PBGD и, в частности, PDE4D5 можно предпочтительно, использовать для описанных выше основанных на пороговой величине способов диагностики и иммуноанализов, способов идентификации или иммуноанализов для различения или стратификации индивидуумов. Соответствующие стадии определения можно проводить либо в отдельных реакциях, или, особенно предпочтительно, в мультиплексных реакциях. Для проведения мультиплексного обнаружения можно модифицировать концентрацию праймеров и/или олигонуклеотидов-зондов. Более того, можно модифицировать концентрацию и присутствие других ингредиентов, таких как буферы, ионы и т.д., например их можно увеличивать или снижать по сравнению с указаниями изготовителя.

В следующем варианте осуществления настоящего изобретения способ идентификации индивидуума, подходящего для терапии агрессивного гормон-чувствительного рака предстательной железы на основе экспрессии PDE4D7, как описано в настоящем документе выше, можно далее комбинировать с одним или несколькими сходными способами идентификации на основе экспрессии одного или нескольких различных биомаркеров. Предпочтительным является определение уровня простатспецифического антигена (PSA) в крови. Таким образом, если выявлен уровень PSA в крови в диапазоне приблизительно от 2 до 5 или более нг/мл, предпочтительно, приблизительно от 2,2 до 4,8 нг/мл или более, от 2,4 до 4,4 нг/мл или более, от 2,6 до 4,2 нг/мл или более или от 2,8 до 4,0 нг/мл или более, более предпочтительно, приблизительно от 2,5 до 4 нг/мл или более, индивидуума можно считать страдающим агрессивным гормон-чувствительным раком предстательной железы, или индивидуумом, у которого вероятно разовьется агрессивный гормон-чувствительный рак предстательной железы в ближайшем будущем, т.е. в течение последующих 1, 2, 3, 4, 5, 6, 12, 14, 48 месяцев. Тестирование экспрессии PDE4D7 можно проводить по стадиям, как определено в настоящем документе выше. Предпочтительно, тестирование можно проводить в качестве измерения уровней белка PDE4D7, более предпочтительно, согласно описанным в настоящем документе возможностям для такого измерения. В качестве контролей или контрольных образцов, можно использовать контроли, как определено в настоящем документе выше. В особенно предпочтительном варианте осуществления стадии тестирования могут быть основаны на применении антитела, специфично связывающегося с PDE4D7, например, антитела, как определено в настоящем документе выше, или коммерчески доступного антитела против PDE4D7, такого как NB300-652 или GTX14629. Агрессивный гормон-чувствительный рак предстательной железы можно диагностировать или прогнозировать или прогрессирование в агрессивный гормон-чувствительный рак предстательной железы можно диагностировать или прогнозировать в указанном иммуноанализе согласно соответствующим определениям, представленным в настоящем документе выше в контексте PDE4D7 в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы.

В предпочтительном варианте осуществления настоящего изобретения диагностику, обнаружение, мониторинг или прогнозирование, как упоминалось выше, проводят на образце, полученном от индивидуума. Термин "образец, полученный от индивидуума", как используют в настоящем документе, относится к любому биологическому материалу, полученному подходящими способами, известными специалисту в данной области, от индивидуума. Образец, используемый в контексте настоящего изобретения, предпочтительно, следует собирать клинически приемлемым образом, более предпочтительно, так, чтобы нуклеиновые кислоты (в частности, РНК) или белки сохранялись.

Биологические образцы могут включать ткани и жидкости организма, такие как кровь, пот, мокрота или слюна, семенная жидкость и моча, а также экскременты или образцы стула. Более того, биологический образец может содержать клеточный экстракт, происходящий из ткани, предположительно являющейся злокачественной, или популяцию клеток, включая эпителиальную клетку, предпочтительно, злокачественную эпителиальную клетку или эпителиальную клетку, происходящую из ткани, предположительно являющейся злокачественной. Еще более предпочтительно, биологический образец может содержать популяцию клеток, происходящую из железистой ткани, например, образец может происходить из предстательной железы мужчины. Кроме того, из полученных тканей и жидкостей организма, при необходимости, можно очищать клетки, а затем использовать их в качестве биологического образца.

Образцы, в частности после первоначальной переработки, можно объединять. Однако также можно использовать необъединенные образцы.

В конкретном варианте осуществления настоящего изобретения содержимое биологического образца также можно подвергать стадии обогащения. Например, образец можно контактировать с лигандами, специфичными к клеточной мембране или органеллам определенных типов клеток, например клеток предстательной железы, функционализированными, например, с помощью магнитных частиц. Материал, концентрированный с помощью магнитных частиц, затем можно использовать для стадий обнаружения и анализа, как описано в настоящем документе выше или ниже.

В конкретном варианте осуществления изобретения можно получать и/или использовать биоптаты или получаемые резекцией образцы. Такие образцы могут содержать клетки или клеточные лизаты.

Более того, клетки, например опухолевые клетки, можно обогащать способами фильтрации текучих или жидких образцов, например крови, мочи, пота и т.д. Такие процессы фильтрации также можно комбинировать со стадиями обогащения на основе специфических взаимодействий с лигандом, как описано в настоящем документе выше.

В особенно предпочтительном варианте осуществления настоящего изобретения образец может представлять собой образец ткани, биоптат, образец мочи, образец осадка мочи, образец крови, образец слюны, образец семенной жидкости, образец, содержащий циркулирующие опухолевые клетки, или образец, содержащий секретируемые предстательной железой экзосомы. Образец крови, может, например, представлять собой образец сыворотки или образец плазмы.

В другом аспекте настоящее изобретение относится к ингибиторной фармацевтической композиции, содержащей по меньшей мере один элемент, выбранный из группы, состоящей из: (a) соединение, непосредственно ингибирующее активность PDE4D7, предпочтительно, антагонист ферментативной активности PDE4D7; (b) соединение, косвенно ингибирующее активность PDE4D7; (c) доминантно-негативная форма белка PDE4D7 или ее биологически активный эквивалент; (d) нуклеиновая кислота, кодирующая и экспрессирующая доминантно-негативную форму PDE4D7; (e) miРНК, специфичная к PDE4D7; (f) антисмысловая молекула для PDE4D7; (g) siРНК, специфичная к PDE4D7; (h) аптамер, специфичный к продукту экспрессии PDE4D7 или к белку PDE4D7; (i) низкомолекулярное соединение или пептидомиметик, способные специфично связываться с белком PDE4D7; и (j) антитело, специфичное к белку PDE4D7, и/или вариант антитела, специфичный к белку PDE4D7.

Термин "соединение, непосредственно ингибирующее активность PDE4D7", как используют в настоящем документе, относится к соединению, которое способно снижать активность PDE4D7. Такое соединение может представлять собой любое непосредственно взаимодействующее с PDE4D7 соединение, которое оказывает отрицательное влияние на каталитическую активность PDE4D7. Такое соединение предпочтительно, может являться антагонистом каталитической активности PDE4D7.

Термин "соединение, косвенно ингибирующее активность PDE4D7", как используют в настоящем документе, относится к соединению, которое способно уменьшать активность PDE4D7 путем взаимодействия с непосредственно взаимодействующим с PDE4D7 соединением ("косвенно взаимодействующее соединение") или через косвенно действующий каскад, не вовлекающий взаимодействие с PDE4D7. Такое соединение может представлять собой любое соединение, непосредственно взаимодействующее с соединением, взаимодействующим с PDE4D7. Эффект, обеспечиваемый соединением, непосредственно взаимодействующим с соединением, взаимодействующим с PDE4D7, может быть отрицательным, если взаимодействующее соединение само по себе обладает отрицательным эффектом на активность PDE4D7, или отрицательным, если взаимодействующее с PDE4D7 соединение обладает положительным эффектом на активность PDE4D7.

Особенно предпочтительными являются ингибиторы фосфодиэстеразы, в частности, PDE4, более конкретно PDE4D, еще более конкретно PDE4D7. Примеры подходящих ингибиторов фосфодиэстеразы, которые можно отдельно или в комбинации включать в ингибиторную фармацевтическую композицию по настоящему изобретению, представляют собой: рофлумиласт, пикламиласт, Awd12-281, Ariflo, Sch351591, циломиласт, ролипрам, Ro 20-1724, этазолят, гидрохлорид, CP80633, ICI63197, ирсогладина малеат, мезопрам, YM976, Sch35159, V11294a, арофиллин, денбуфиллин и ингибитор фосфодиэстеразы 4. Другие примеры подходящих ингибиторов известны специалисту в данной области и также предусматриваются настоящим изобретением. Детали в отношении структуры, эффективности, подходящих составов и т.д. ингибиторов также известны специалисту в данной области и/или могут быть установлены из подходящих справочников или публикаций, например, Joseph A. Beavo, Sharron H. Francis, Miles D Houslay, Cyclic Nucleotide Phosphodiesterase in Health and Disease, CRC Press 2006.

Особенно предпочтительными в контексте ингибиторных фармацевтических композиций являются следующие ингибиторные соединения: ролипрам, Ro 20-1724, CP80633, ICI63197, YM976, Sch35159 и ингибитор фосфодиэстеразы 4.

Ролипрам представляет собой селективный полный ингибитор фосфодиэстеразы cAMP (PDE4) с IC50 2,0 мкМ. Ролипрам проводит различие между двумя конформационными состояниями изоферментов PDE4.

Ro 20-1724 представляет собой широко используемый ингибитор фосфодиэстеразы циклических нуклеотидов, селективный в отношении PDE4 с IC50 2,0 мкМ.

CP80633 представляет собой селективный ингибитор фосфодиэстеразы типа 4 с величинами IC50 1,9, > 100, > 100, > 100 и > 100 мкМ в отношении PDE4 легкого, PDE1 легкого, PDE2 легкого, PDE3 сердца и PDE-V тромбоцитов человека, соответственно. CP80633 не проявляет существенной селективности в отношении изофермента PDE4. CP80633 ингибирует гидролиз cAMP в выделенных моноцитах периферической крови человека, эозинофилах и T-клетках и проявляет противовоспалительные и бронхорасширяющие эффекты in vivo.

ICI63197 представляет собой сильнодействующий ингибитор фосфодиэстеразы (PDE) 4 с IC50 35 нМ (для ингибирования связывания [3H]-ролипрама с головным мозгом крысы).

YM976 представляет собой перорально активный ингибитор PDE4 с IC50 2,2 нМ. Он демонстрирует низкую рвотную активность, предположительно вследствие слабого проникновения в головной мозг.

Ингибитор фосфодиэстеразы 4 представляет собой соединение пиразола, которое действует в качестве высокоаффинного связывающего активный центр ингибитора фосфодиэстераз IVB и IVD с IC50 33 нМ и 21 нМ, соответственно. Показано, что он является значительно более сильнодействующим, чем ролипрам, в отношении PDEIVB и PDEIVD (с IC50 = 570 нМ и 1,1 мкМ, соответственно), и проявляет более высокую селективность в отношении PDEIB, PDEIIA, PDEIIIB, PDEVA, PDEVIIB, PDEVIIIA, PDEIXA и PDEXIA (IC50 > 30 мкМ) и в минимальной степени ингибирует PDEXA с IC50 6,9 мкМ.

Ингибиторные соединения, как определено выше, можно получать, дозировать, использовать или вводить согласно представленному в настоящем документе подробному описанию. В частности, для определения необходимых концентраций, составов и вспомогательных веществ и т.д. можно использовать следующую таблицу ингибиторов:

Таблица ингибиторов:

Соединение IC50 Изготовитель
Ролипрам 1 мкМ Calbiochem
Ro 20-1724 2 мкМ Calbiochem
CP80633 1,9 мкМ Tocris
ICI63197 35 нМ Tocris
YM976 2,2 нМ Tocris
Ингибитор фосфодиэстеразы 4 33 нМ Calbiochem

Альтернативно, такие косвенно взаимодействующие соединения отрицательного действия могут вызвать модификацию связывающего поведения непосредственно связывающих белков, что приводит к сниженной активности PDE4D7. Как правило, косвенно взаимодействующие соединения отрицательного действия могут обладать ингибиторным эффектом в отношении активаторов PDE4D7. Примерами таких взаимодействующих соединений являются ферментативно активные соединения, деградирующие активаторы PDE4D7, или белки, способные связывать и подавлять активаторы PDE4D7. Альтернативно, такие взаимодействующие вещества могут положительно модулировать активность, ведущую к деградации PDE4D7, например, протеазы. Другие примеры и их осуществления известны специалистам в данной области.

Альтернативно, косвенное ингибирование активности PDE4D7 может обеспечиваться соединениями, дезактивирующими, препятствующими или нарушающими экспрессию эндогенного гена(ов) PDE4D7. Примерами таких соединений являются специфические взаимодействующие соединения факторов транскрипции PDE4D7, которые ингибируют и/или препятствуют связыванию факторов транскрипции и основного транскрипционного аппарата с промоторами гена PDE4D7, активные соединения, специфически дестабилизирующие мРНК PDE4D7 или факторы, ингибирующие факторы сплайсинга, специфичные для PDE4D7. Другие примеры и их осуществления известны специалистам в данной области.

"Нуклеиновая кислота, кодирующая и экспрессирующая доминантно-негативную форму белка или маркера опухоли", как используют в настоящем документе, относится к любой нуклеиновой кислоте, способной экспрессировать мутантную форму природного белка или полипептида. Таким образом, термин относится к нуклеиновой кислоте, кодирующей вариант(ы) PDE4D7, которая содержит антиморфную модификацию, в частности, которая неблагоприятно влияет на PDE4D7. Как правило, такое поведение может происходить, если антиморфный вариант может взаимодействовать с PDE4D7, но блокирует некоторые аспекты его функции. Предпочтительно, такие варианты могут содержать определенные домены PDE4D7, например один или несколько доменов белок-белкового взаимодействия или доменов димеризации, доменов сборки комплекса, одного или нескольких ассоциированных с мембраной доменов и т.д. или они могут быть лишены их.

Термин "miРНК, специфичная к PDE4D7", относится к короткой одноцепочечной молекуле РНК, как правило, длиной 18-27 нуклеотидов, которая регулирует экспрессию гена PDE4D7. miРНК кодируются генами, с ДНК которых они транскрибируются, но не транслируются в белок. В природных условиях miРНК транскрибируются сначала в качестве первичных транскриптов или pri-miРНК с кэпом и поли-A-хвостом и процессируются в короткие структуры стебель-петля из 70-нуклеотидов, известные как пре-miРНК в клеточном ядре. Этот процессинг осуществляется у животных комплексом белков, известным как микропроцессорный комплекс, состоящий из нуклеазы Drosha и связывающего двухцепочечную РНК белка Pasha. Затем эти пре-miРНК процессируются в зрелые miРНК в цитоплазме путем взаимодействия с эндонуклеазой Dicer, которая также инициирует образование индуцируемого РНК комплекса сайленсинга (RISC). После встраивания в активный комплекс RISC, miРНК могут образовывать пары с их комплементарными молекулами мРНК и ингибировать трансляцию или могут индуцировать деградацию мРНК каталитически активными членами комплекса RISC, например, белками аргонавтами. Зрелые молекулы miРНК, как правило, по меньшей мере частично комплементарны молекулам мРНК, соответствующим продуктам экспрессии по настоящему изобретению, и полностью или частично подавляют экспрессию гена. Предпочтительно, miРНК по настоящему изобретению могут быть на 100% комплементарными их последовательностям-мишеням. Альтернативно, они могут иметь 1, 2 или 3 неправильно спаренных оснований, например, на концевых остатках или в центральной части молекулы. Молекулы miРНК по настоящему изобретению могут иметь длину приблизительно от 18 до 27 нуклеотидов, например, 18, 19, 20, 21, 22, 23, 24, 25, 26 или 27 нуклеотидов. Предпочтительными являются 21-23-меры.

miРНК, имеющие 100% комплементарность, предпочтительно, можно использовать для деградации нуклеиновых кислот по настоящему изобретению, в то время как miРНК, демонстрирующие менее чем 100% комплементарность, предпочтительно, можно использовать для блокирования процессов трансляции.

Термин "антисмысловая молекула для PDE4D7" относится к нуклеиновым кислотам, соответствующим последовательностям, содержащимся в SEQ ID NO:1 или 6 или их комплементарных цепях. Предпочтительно, антисмысловая молекула по изобретению содержит последовательность, комплементарную по меньшей мере части продукта экспрессии PDE4D7 по настоящему изобретению. Хотя можно использовать антисмысловые молекулы, комплементарные последовательности кодирующей области PDE4D7, предпочтительными являются антисмысловые последовательности, комплементарные транскрибируемой и нетранслируемой области.

Как правило, антисмысловую технологию можно использовать для контроля, т.е. снижения или завершения экспрессии гена через антисмысловую ДНК или РНК, или через образование тройной спирали. В одном из вариантов осуществления, антисмысловая молекула может образовываться внутри организма, например, внутриклеточно, путем транскрипции экзогенной последовательности. Вектор или его часть могут транскрибироваться, продуцируя антисмысловую нуклеиновую кислоту по изобретению. Такой вектор может содержать последовательность, кодирующую антисмысловую нуклеиновую кислоту по изобретению. Такой вектор может оставаться эписомальным или встраиваться в хромосому, при условии, что он может транскрибироваться с образованием желаемой антисмысловой молекулы. Соответствующие векторы можно конструировать способами технологии рекомбинантных ДНК, известными специалисту в данной области. Векторы могут представлять собой плазмиду, вирус или другие векторы, известные в данной области, используемые для репликации и экспрессии в клетках позвоночных, например векторы, как определено в настоящем документе выше.

В другом варианте осуществления, антисмысловую молекулу можно вводить отдельно. В качестве примера для конструирования антисмыслового РНК- или ДНК-олигонуклеотида длиной приблизительно от до 50 нуклеотидов можно использовать 5'-кодирующую часть нуклеиновой кислоты PDE4D7 по настоящему изобретению. Предпочтительно, длина олигонуклеотида составляет по меньшей мере 10 нуклеотидов, по меньшей мере 17 нуклеотидов, по меньшей мере 25 нуклеотидов или по меньшей мере 50 нуклеотидов.

Антисмысловые нуклеиновые кислоты по изобретению, как правило, содержат последовательность, комплементарную по меньшей мере части РНК-транскрипта представляющего интерес гена. Однако абсолютная комплементарность, хотя и является предпочтительной, не требуется. Последовательность "комплементарная по меньшей мере части РНК-транскрипта", упоминаемая в настоящем документе, означает последовательность, имеющую достаточную комплементарность, чтобы быть способной гибридизоваться с РНК, образующей стабильную дуплексную или триплексную структуру в случае двухцепочечных нуклеиновых кислот. Способность к гибридизации зависит как от степени комплементарности, так и от длины антисмысловой нуклеиновой кислоты. Как правило, чем большей является гибридизующаяся нуклеиновая кислота, тем больше она может содержать неправильно спаренных оснований с последовательностью РНК по изобретению и, все еще образовывать стабильный дуплекс или триплекс. Специалист в данной области может установить допустимую степень неправильного спаривания оснований с использованием стандартных способов определения температуры плавления гибридизованного комплекса.

Предпочтительно, можно использовать антисмысловые молекулы, комплементарные 5'-концу транскрипта, например 5'-нетранслируемой последовательности вплоть до и включая кодон инициации AUG, для ингибирования трансляции. В следующем предпочтительном варианте осуществления последовательности также можно использовать последовательности, комплементарные 3'-нетранслируемым последовательностям мРНК.

Антисмысловая молекула по настоящему изобретению может представлять собой ДНК или РНК или химерные смеси или производные или их модифицированные версии, одноцепочечные или двухцепочечные. Антисмысловую молекулу, предпочтительно, антисмысловой олигонуклеотид или любую другую антисмысловую молекулу нуклеиновой кислоты по настоящему изобретению или молекулу siРНК по настоящему изобретению можно модифицировать в части основания, части сахара или в фосфатном остове, например, для повышения стабильности молекулы, улучшения гибридизации, и т.д. молекула может включать другие присоединяемые группы, такие как пептиды (например, для нацеливания на рецепторы клеток-хозяев in vivo), или агенты, способствующие транспорту через клеточную мембрану или гематоэнцефалический барьер, запускаемые гибридизацией расщепляющие агенты и интеркалирующие агенты. Таким образом, молекулу можно конъюгировать с другой молекулой, например, пептидом, запускаемым гибридизацией сшивающим агентом, агентом для транспорта, запускаемым гибридизацией расщепляющим агентом и т.д.

Антисмысловая молекула или антисмысловой олигонуклеотид, молекула miРНК или молекула siРНК, может содержать по меньшей мере одну модифицированную часть основания, которая выбрана из группы включающей 5-фторурацил, 5-бромурацил, 5-хлорурацил, 5-йодурацил, гипоксантин, ксантин, 4-ацетилцитозин, 5-(карбоксигидроксилметил)урацил, 5-карбоксиметиламинометил-2-тиоуридин, 5-карбоксиметиламинометилурацил, дигидроурацил, бета-D-галактозилквеозин, инозин, N6-изопентениладенин, 1-метилгуанин, 1-метилинозин, 2,2-диметилгуанин, 2-метиладенин, 2-метилгуанин, 3-метилцитозин, 5-метилцитозин, N6-аденин, 7-метилгуанин, 5-метиламинометилурацил, 5-метоксиаминометил-2-тиоурацил, бета-D-маннозилквеозин, 5'-метоксикарбоксиметилурацил, 5-метоксиурацил, 2-метилтио-N6-изопентениладенин, урацил-5-оксиуксусную кислоту, псевдоурацил, квеозин, 2-тиоцитозин, 5-метил-2-тиоурацил, 2-тиоурацил, 4-тиоурацил, 5-метилурацил, метиловый сложный эфир урацил-5-оксиуксусной кислоты, урацил-5-оксиуксусную кислоту, 5-метил-2-тиоурацил, 3-(3-амино-3-N-2-карбоксипропил)урацил и 2,6-диаминопурин. Также молекула может содержать по меньшей мере одну модифицированную часть сахара, выбранную из группы, включающей, но ими не ограничивающейся, арабинозу, 2-фторарабинозу, ксилулозу и гексозу. В другом варианте осуществления молекула содержит, альтернативно, или дополнительно, по меньшей мере один модифицированный фосфатный остов, например, фосфоротиоат, фосфородитиоат, фосфорамидотиоат, фосфорамидат, фосфордиамидат, метилфосфонат, сложный алкилфосфотриэфир и формацеталь или их аналог.

В другом варианте осуществления антисмысловая молекула, например, антисмысловой олигонуклеотид, может представлять собой альфа-аномерный олигонуклеотид, т.е. олигонуклеотид, который образует специфические двухцепочечные гибриды с комплементарной РНК, в которой цепи идут параллельно друг другу.

Термин "siРНК, специфичная к PDE4D7", относится к конкретному типу антисмысловых молекул, а именно, к малым ингибиторным РНК-дуплексам, которые индуцируют каскад РНК-интерференции (РНКi) для отрицательной регуляции экспрессии гена маркера опухоли согласно таблице 1. Эти молекулы siРНК могут варьировать по длине и могут иметь длину приблизительно 18-28 нуклеотидов, например, иметь длину 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 или 28 нуклеотидов. Предпочтительно, молекула имеет длину 21, 22 или 23 нуклеотидов. Молекула siРНК по настоящему изобретению может обладать различными степенями комплементарности с их мРНК-мишенью, предпочтительно, в антисмысловой цепи. siРНК могут иметь неспаренные выступающие основания на 5'- или 3'-конце смысловой цепи и/или антисмысловой цепи. Термин "siРНК" включает дуплексы двух отдельных цепей, а также отдельные цепи, которые могут образовывать шпилечные структуры, содержащие дуплексную область. Предпочтительно, siРНК может быть двухцепочечной, где двухцепочечная молекула siРНК содержит первую и вторую цепь, причем длина каждой цепи молекулы siРНК составляет от приблизительно 18 до приблизительно 23 нуклеотидов, первая цепь молекулы siРНК содержит нуклеотидную последовательность, имеющую достаточную комплементарность с РНК-мишенью через РНК-интерференцию, и вторая цепь указанной молекулы siРНК содержит нуклеотидную последовательность, которая комплементарна первой цепи.

Способы конструирования подходящих siРНК, направленных на данную нуклеиновую кислоту-мишень, известны специалисту в данной области.

Термин "аптамер, специфичный к продукту экспрессии или специфичный к белку PDE4D7", как используют в настоящем документе, относится к (a) короткому пептиду(ам), способному взаимодействовать и специфично связываться с белком(ами) PDE4D7. Пептидный аптамер(ы), предпочтительно, может быть способен специфично связываться с (a) белком(ами) или полипептидом(ами), содержащими аминокислотную последовательность SEQ ID NO:2. Пептидный аптамер(ы) также может быть способен специфично связываться с (a) белком(ами) или полипептидом(ами), содержащими аминокислотную последовательность(и), кодируемую (a) последовательностью(ями) ДНК, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности SEQ ID NO:2 или белку или полипептиду, содержащему аминокислотную последовательность, которая по меньшей мере на 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична последовательности SEQ ID NO:2. Как правило, (a) пептидный аптамер(ы) представляет собой вариабельную пептидную петлю, содержащую например, от 10 до 20 аминокислот. В контексте настоящего изобретения пептидный аптамер(ы) может быть, предпочтительно, связан на одном или обоих концах с каркасной структурой. Каркасная структура может представлять собой любую молекулу, предпочтительно, белок, которая обладает свойствами хорошей растворимости. Подходящие каркасные молекулы известны специалисту в данной области. Предпочтительной каркасной молекулой для использования в контексте настоящего изобретения является бактериальный белок тиоредоксин-A. Пептидная петля аптамера, предпочтительно, может быть встроена в восстанавливающий активный центр молекулы каркаса. Альтернативно, в качестве каркасных структур в контексте настоящего изобретения можно использовать стафилококковый белок A и его домены и производные этих доменов, такой как белок Z или липокалины. Пептидные аптамеры можно получать любым подходящим способом, известным специалисту в данной области, например с помощью дрожжевых двухгибридных подходов.

В предпочтительном варианте осуществления упомянутый выше пептидный аптамер способен связываться с белком или полипептидом PDE4D7, предпочтительно, белком или полипептидом, соответствующим SEQ ID NO:2, и снижать биологическую активность и/или ферментативную активность этого белка(ов) по меньшей мере на 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или по меньшей мере на 98% или 99% по сравнению с контрольным уровнем, полученным для необработанного образца.

"Низкомолекулярное соединение, способное специфично связываться с белком PDE4DE7", как используют в настоящем документе, относится к небольшому органическому соединению, которое предпочтительно, является биологически активным, т.е. к биомолекуле, но, предпочтительно, не является полимером. Такое органическое соединение может обладать любой подходящей формой или химическим свойством. Соединение может представлять собой природное соединение, например вторичные метаболиты, или искусственное соединение, которое разработано и получено de novo. В одном из вариантов осуществления настоящего изобретения низкомолекулярное соединение способно блокировать взаимодействие между PDE, в частности PDE4D7, и взаимодействующим с ней соединением. Способы и технологии идентификации и получения низкомолекулярных соединений, а также анализы для тестирования низкомолекулярных соединений, известны специалисту в данной области.

Термин "пептидомиметик, способный специфично связываться с белком PDE4D7" в контексте настоящего изобретения относится к небольшой подобной белку цепи, разработанной для имитации пептида и способной связываться с белком PDE4D7. Такой пептидомиметик может быть получен путем модификации существующего пептида, например, пептида или пептидного аптамера, как определено в настоящем документе выше, для изменения свойств молекулы. Пептидомиметик может быть получен путем модификации, которая изменяет стабильность или связывающую способность молекулы. Эти модификации, как правило, вовлекают преобразование в пептид, который не встречается в природе. Например, пептидомиметик по настоящему изобретению может иметь измененные пептидные остовы или может содержать неприродные аминокислоты. Предпочтительно, пептидомиметик по настоящему изобретению может представлять собой молекулу фосфодиэстеразы, в частности PDE4D7, или взаимодействующий или секвестрирующий белок. В одном из вариантов осуществления настоящего изобретения пептидомиметик может блокировать взаимодействие между PDE, в частности PDE4D7, и взаимодействующей с ней молекулой. Способы и технологии для получения пептидомиметика, а также анализы для тестирования пептидомиметиков известны специалисту в данной области.

Ингибиторная фармацевтическая композиция по настоящему изобретению также может содержать антитело, специфичное к белку PDE4D7, и/или вариант антитела, специфичный к белку PDE4D7, например, антитело или вариант антитела, как определено в настоящем документе выше.

В предпочтительном варианте осуществления такое антитело или фрагмент антитела могут быть способны ингибировать биологическую активность и/или ферментативную активность PDE4D7.

Специалисту в данной области также известна возможность нацеливания на клетки и ткань агрессивного гормон-чувствительного рака предстательной железы и разрушения их с помощью конъюгированных антител, специфичных к PDE4D7. Таким образом, в конкретном варианте осуществления настоящего изобретения антитело или его фрагмент, как определено в настоящем документе выше, можно конъюгировать с терапевтическим или цитотоксическим средством. Термин "лекарственное средство" относится к любому соединению, лекарственному средству, низкомолекулярному соединению или медикаменту, которые способны обеспечивать терапевтический эффект на клетку, ткань или весь организм. Примеры таких средств известны специалисту в данной области. Термин "цитотоксическое средство" относится к любому соединению, лекарственному средству, низкомолекулярному соединению, которые способны обеспечивать токсический эффект на клетку или ткань. Такие средства, например, могут содержать соединения, которые активируют эндогенные цитотоксические эффекторные системы, а также радиоизотопы, голотоксины, модифицированные токсины, каталитические субъединицы токсинов, или любые молекулы или ферменты, в норме не присутствующие в клетке или на поверхности клетки, которые в определенных условиях вызывают гибель клетки. Также термин может включать радиоизотопы, известные в данной области, дополнительные антитела (или их фиксирующие комплемент части), которые связывают присущие или индуцированные элементы эндогенной цитотоксической эффекторной системы, тимидинкиназу, эндонуклеазу, РНК-азу, альфа-токсин, рицин, абрин, экзотоксин A Pseudomonas, дифтерийный токсин, сапорин, момордин, гелонин, противовирусный белок лаконоса, альфа-сарцин и холерный токсин. Также термин относится к цитотоксическим пролекарствам. Под "цитотоксическим пролекарством" понимают нетоксичное соединение, которое превращается ферментом, обычно присутствующим в клетке, в цитотоксическое соединение. Цитотоксические пролекарства, которые можно использовать в соответствии с изобретением, включают глутамильные производные алкилирующих средств на основе иприта бензойной кислоты, фосфатные производные этопозида или митомицина C, цитозин арабинозид, даунорубицин и производные доксорубицина с феноксиацетамидом.

В одном из вариантов осуществления изобретения фармацевтическая композиция может, кроме того, содержать дополнительные соединения, являющиеся активными против злокачественных клеток. Более того, в другом варианте осуществления изобретения фармацевтическая композиция может дополнительно содержать ингибиторы гормонов, предпочтительно, антиандрогены или антагонисты андрогенов, такие как спиронолактон, ципротерон ацетат, флутамид, нилутамид, бикалутамид, кетоконазол, финастерид или дутастерид.

В следующем варианте осуществления настоящее изобретение также предусматривает скрининговые процедуры и способы идентификации аптамера, специфичного к продукту экспрессии или белку PDE4D7, соединения, непосредственно ингибирующего активность PDE4D7, антагониста ферментативной активности PDE4D7, соединения, косвенно ингибирующего активность PDE4D7; доминантно-негативной формы белка PDE4D7 или ее биологически активного эквивалента; miРНК, специфичной к PDE4D7; антисмысловой молекулы для PDE4D7; siРНК, специфичной к PDE4D7 и низкомолекулярного соединения или пептидомиметика, способных специфично связываться с белком PDE4D7, как описано в настоящем документе выше. Такие скрининговые процедуры могут включать стадии (a) продуцирования клеток, которые экспрессируют полипептид PDE4D7 в качестве секретируемого белка или на клеточной мембране, или в качестве внутриклеточного компонента, (b) контактирования полипептида, продуцированного на стадии (a), с тестируемым образцом, потенциально содержащим взаимодействующую молекулу, например, аптамер, специфичный к продукту экспрессии или белку PDE4D7, соединение, непосредственно ингибирующее активность PDE4D7, антагонист ферментативной активности PDE4D7, соединение, косвенно ингибирующее активность PDE4D7; доминантно-негативную форму белка PDE4D7 или ее биологически активный эквивалент; miРНК, специфичную к PDE4D7; антисмысловую молекулу для PDE4D7; siРНК, специфичную к PDE4D7 или низкомолекулярное соединение или пептидомиметик, способные специфично связываться с PDE4D7 и (c) идентификации взаимодействующей молекулы путем выявления связывания и/или ингибирования или модулирования активности PDE4D7.

Альтернативно, такие скрининговые процедуры могут включать стадии (a) контактирования тестируемого образца, потенциально содержащего непосредственно или косвенно взаимодействующую молекулу, например аптамер, специфичный к продукту экспрессии или белку PDE4D7, соединение, непосредственно ингибирующее активность PDE4D7, антагонист ферментативной активности PDE4D7, соединение, косвенно ингибирующее активность PDE4D7; доминантно-негативную форму белка PDE4D7 или ее биологически активный эквивалент; miРНК, специфичную к PDE4D7; антисмысловую молекулу для PDE4D7; siРНК, специфичную к PDE4D7 и низкомолекулярное соединение или пептидомиметик, способные специфично связываться с PDE4D7, с одной или несколькими клетками, которые экспрессируют PDE4D7 в качестве транскрипта, (b) обнаружения уровня экспрессии указанной последовательности; и (c) идентификации взаимодействующей молекулы путем выявления связывания или модулирования или снижения уровня экспрессии PDE4D7.

Также настоящее изобретение охватывает аптамер, специфичный к продукту экспрессии или белку PDE4D7, соединение, непосредственно ингибирующее активность PDE4D7, антагонист ферментативной активности PDE4D7, соединение, косвенно ингибирующее активность PDE4D7; доминантно-негативную форму белка PDE4D7 или ее биологически активный эквивалент; miРНК, специфичную к PDE4D7; антисмысловую молекулу для PDE4D7; siРНК, специфичную к PDE4D7 и низкомолекулярное соединение или пептидомиметик, способные специфично связываться с PDE4D7, получаемым или полученным с помощью скрининговой процедуры или способа, как описано в настоящем документе выше.

В следующем аспекте настоящее изобретение относится к ингибиторной фармацевтической композиции, как определено в настоящем документе выше, для лечения или профилактики агрессивного гормон-чувствительного рака предстательной железы.

Кроме того, в другом аспекте настоящее изобретение относится к использованию (a) соединения, непосредственно ингибирующего активность PDE4D7, предпочтительно, антагониста ферментативной активности PDE4D7; (b) соединения, косвенно ингибирующего активность PDE4D7; (c) доминантно-негативной формы белка PDE4D7 или ее биологически активного эквивалента; (d) нуклеиновой кислоты, кодирующей и экспрессирующей доминантно-негативную форму PDE4D7; (e) miРНК, специфичной к PDE4D7; (f) антисмысловой молекулы для PDE4D7; (g) siРНК, специфичной к PDE4D7; (h) аптамера, специфичного к продукту экспрессии PDE4D7 или к белку PDE4D7; (i) низкомолекулярного соединения или пептидомиметика, способных специфично связываться с белком PDE4D7; и/или (j) антитела, специфичного к белку PDE4D7, и/или варианта антитела, специфичного к белку PDE4D7, для получения ингибиторной фармацевтической композиции для лечения или профилактики агрессивного гормон-чувствительного рака предстательной железы.

В другом аспекте настоящее изобретение относится к способу лечения или профилактики агрессивного гормон-чувствительного рака предстательной железы, включающему введение (a) соединения, непосредственно ингибирующего активность PDE4D7, предпочтительно, антагониста ферментативной активности PDE4D7; (b) соединения, косвенно ингибирующего активность PDE4D7; (c) доминантно-негативной формы белка PDE4D7 или ее биологически активного эквивалента; (d) нуклеиновой кислоты, кодирующей и экспрессирующей доминантно-негативную форму PDE4D7; (e) miРНК, специфичной к PDE4D7; (f) антисмысловой молекулы для PDE4D7; (g) siРНК, специфичной к PDE4D7; (h) аптамера, специфичного к продукту экспрессии PDE4D7 или к белку PDE4D7; (i) низкомолекулярного соединения или пептидомиметика, способных специфично связываться с белком PDE4D7; и/или (j) антитела, специфичного к белку PDE4D7, и/или варианта антитела, специфичного к белку PDE4D7, индивидууму, в частности индивидууму, страдающему агрессивным гормон-чувствительным раком предстательной железы или у которого прогнозировано развитие агрессивного гормон-чувствительного рака предстательной железы.

В другом аспекте настоящее изобретение относится к стимулирующей фармацевтической композиции, содержащей по меньшей мере один элемент, выбранный из группы, состоящей из: (a) соединения, непосредственно стимулирующего или модулирующего активность PDE4D7, предпочтительно, аллостерического агониста ферментативной активности PDE4D7; (b) соединения, косвенно стимулирующего или модулирующего активность PDE4D7; (c) белка PDE4D7 или его биологически активного эквивалента; (d) нуклеиновой кислоты, кодирующей и экспрессирующей PDE4D7; (e) ингибитора miРНК, специфичного к miРНК PDE4D7; (f) деметилирующего агента; и (g) вытесняющего фосфодиэстеразу фактора.

Термин "соединение, непосредственно стимулирующее или модулирующее активность PDE4D7", как используют в настоящем документе, относится к соединению, которое способно увеличивать активность PDE4D7 в отношении деградации cAMP путем прямого взаимодействия с PDE4D7. Такое соединение может быть непосредственно взаимодействующим с PDE4D7 соединением, которое обладает положительным влиянием на каталитическую активность PDE4D7. Такое соединение предпочтительно, может представлять собой аллостерический агонист каталитической активности PDE4D7, например, гомотропный аллостерический модулятор. Предпочтительными аллостерическими агонистами PDE4D7 являются cAMP или аналоги cAMP. Другими непосредственно стимулирующими соединениями, предусматриваемыми настоящим изобретением, являются ионы, предпочтительно, биологически активные одновалентные и двухвалентные катионы, такие как Ca2+, Mg2+.

Термин "соединение, косвенно стимулирующее или модулирующее активность PDE4D7", как используют в настоящем документе, относится к соединению, которое способно увеличивать активность PDE4D7 в отношении деградации cAMP путем взаимодействия с непосредственно взаимодействующим с PDE4D7 соединением ("косвенно взаимодействующее соединение") или через непрямой рабочий каскад, не вовлекающий взаимодействие с PDE4D7. Такое соединение может представлять собой любое соединение, непосредственно взаимодействующее с соединением, взаимодействующим с PDE4D7. Эффект, обеспечиваемый соединением, непосредственно взаимодействующим с соединением, взаимодействующим с PDE4D7, может быть либо положительным, если само взаимодействующее с PDE4D7 соединение обладает положительным эффектом на активность PDE4D7, или отрицательным, если взаимодействующее с PDE4D7 вещество обладает отрицательным эффектом на активность PDE4D7. Как правило, положительно действующие косвенно взаимодействующие соединения могут стимулировать агонистический эффект непосредственно взаимодействующих соединений, например, обеспечивая увеличение концентрации аллостерически действующих соединений, таких как cAMP или его аналоги, путем ингибирования процессов деградации cAMP, не обеспечиваемых PDE4D7, путем увеличения продукции cAMP и т.д.

Альтернативно, такие положительно действующие косвенно взаимодействующие соединения могут обеспечить модификацию связывающего поведения непосредственно связывающих белков, что приводит к увеличенной активности PDE4D7. Как правило, отрицательно действующие косвенно взаимодействующие соединения могут обладать ингибиторным эффектом на ингибиторы PDE4D7. Примерами таких взаимодействующих соединений являются ферментативно активные соединения, деградирующие ингибиторы PDE4D7, или белки, способные связывать и подавлять ингибиторы PDE4D7. Альтернативно, такие взаимодействующие соединения могут ингибировать активные вещества, вызывающие деградацию PDE4D7, например, ингибиторы протеаз. Другие примеры и их осуществления известны специалистам в данной области.

Альтернативно, косвенную стимуляцию активности PDE4D7 могут обеспечивать соединения, активирующие, защищающие или поддерживающие экспрессию эндогенного гена PDE4D7. Примерами таких соединений являются специфичные для PDE4D7 факторы транскрипции, специфичные для мРНК PDE4D7 стабилизирующие активные вещества или факторы сплайсинга PDE4D7. Другие примеры и их осуществления известны специалистам в данной области.

"Белок PDE4D7", содержащийся в стимулирующей фармацевтической композиции, может представлять собой белок PDE4D7, как определено в настоящем документе выше. В частности, он может представлять собой белок, кодируемый вариантом по сплайсингу 7 фосфодиэстеразы PDE4D человека, более предпочтительно, он может иметь аминокислотную последовательность, как определено в Genbank под регистрационным No: AF536976 (версия AF536976.1, GI:22901883 от 3 марта 2009 года), и, еще более предпочтительно, он может иметь аминокислотную последовательность SEQ ID NO:2. "Белок PDE4D7", как используют в этом контексте, также содержит аминокислотные последовательности, которые по меньшей мере на 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны последовательности SEQ ID NO:2, и аминокислотные последовательности, кодируемые нуклеотидными последовательностями, которые по меньшей мере на 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны последовательности SEQ ID NO:1. Гомологичные варианты PDE4D7, в частности варианты, упомянутые выше, предпочтительно, обладают функциональностью PDE4D7, т.е. способны деградировать cAMP. В следующем варианте осуществления изобретения гомологичные варианты PDE4D могут, дополнительно или альтернативно, иметь сходный или идентичный характер локализации с PDE4D7 в клетке или в типе ткани.

В следующем предпочтительном варианте осуществления область или гомология между гомологичными вариантами PDE4D7 и PDE4D7 может ограничиваться C-концевой частью белка. Например, гомологичный вариант может содержать N-концевой домен, присутствующий в PDE4D7 и остальную часть белка, имеющую степень гомологии с PDE4D7, как указано в настоящем документе выше. N-концевая часть гомологичного варианта может содержать аминокислоты с 1 по 120, с 1 по 110, с 1 по 100, с 1 по 90, с 1 по 80, с 1 по 70, с 1 по 60, с 1 по 50, с 1 по 40, с 1 по 30, с 1 по 20 или с 1 по 10, происходящие из PDE4D7.

Термин "биологически активный эквивалент PDE4D7", как используют в настоящем документе, относится к белку PDE4D7, который способен выполнять все или большинство функций PDE4D7. Предпочтительно, он относится к белкам, способным осуществлять деградацию cAMP. В следующем варианте осуществления изобретения биологически активные эквиваленты PDE4D7, дополнительно или альтернативно, могут иметь сходный или идентичный характер локализации с PDE4D7 в клетке или в типе ткани. Биологически активные эквиваленты PDE4D7 также могут содержать варианты PDE4D7, как определено в настоящем документе выше.

PDE4D7 или биологически активные эквиваленты PDE4D7 по настоящему изобретению можно продуцировать рекомбинантно любым подходящим способом, известным специалисту в данной области. Настоящее изобретение, таким образом, также охватывает способы получения PDE4D7 или биологически активных эквивалентов PDE4D7.

Таким образом, настоящее изобретение предусматривает векторы, содержащие полинуклеотиды, кодирующие PDE4D7 или биологически активные эквиваленты PDE4D7, как определено в настоящем документе выше, клетки-хозяева, и получение PDE4D7 или биологически активных эквивалентов PDE4D7 рекомбинантными способами.

Подходящий вектор может представлять собой, например, фаговый, плазмидный, вирусный или ретровирусный вектор. Ретровирусные векторы могут быть компетентными по репликации или дефектными по репликации. В последнем случае, размножение вируса, главным образом, происходят только в комплементирующих клетках-хозяевах. Полинуклеотиды, кодирующие PDE4D7 или биологически активные эквиваленты PDE4D7, можно связывать с вектором или носителем, содержащим селективный маркер для размножения в хозяине. Соответствующая полинуклеотидная вставка может быть функционально связана с подходящим промотором, таким как промотор PL фага лямбда, промоторы lac, trp, phoA и tac E. coli, ранний и поздний промоторы SV40 и промоторы ретровирусных LTR, или промотор PSA. Другие подходящие промоторы известны специалисту в данной области. Экспрессирующие конструкции, кроме того, могут содержать участки для инициации и терминации транскрипции, и, в транскрибируемой области, участок связывания рибосом для трансляции. Кодирующая часть транскриптов, экспрессируемых конструкциями, предпочтительно, включает кодон инициации трансляции в начале и кодон терминации (UAA, UGA или UAG), надлежащим образом расположенный в конце полипептида, подлежащего трансляции.

Полипептиды или белки могут быть гликозилированными или они могут быть негликозилированными или они могут быть иным образом модифицированными. Кроме того, полипептиды или белки также могут включать начальный модифицированный остаток метионина, в некоторых случаях в результате опосредуемых хозяином процессов. Более того, полипептид, белок или пептид могут быть модифицированы ацетилированием, пегилированием, гесилированием, формилированием, фосфорилированием, амидацией, преобразованием в производное известными защищающими/блокирующими группами, специфическим химическим расщеплением, протеолитическим расщеплением, связыванием с клеточным лигандом или другим белком или гапилированием, т.е. слиянием с глицин-богатым аминокислотным гомополимером (HAP), и т.д. Такие модификации можно вносить подходящими способами, известными специалисту в данной области. Кроме того, полипептид, пептид или вариант могут содержать одну или несколько неклассических аминокислот.

Кроме того, PDE4D7 или биологически активные эквиваленты PDE4D7 по изобретению можно химически синтезировать с использованием способов, известных в данной области, например, с использованием устройства для синтеза пептидов.

"Нуклеиновая кислота, кодирующая и экспрессирующая PDE4D7", содержащаяся в стимулирующей фармацевтической композиции, как определено в настоящем документе выше, относится к любому подходящему элементу-носителю, например, как описано в настоящем документе выше, содержащему экспрессируемый ген PDE4D7. Предпочтительно, такой элемент-носитель может содержать последовательность, как определено в Genbank под регистрационным номером No: AF536976 (версия AF536976.1, GI:22901883 от 3 марта 2009 года), более предпочтительно, нуклеотидную последовательность SEQ ID NO:1. Такой элемент-носитель также может содержать нуклеотидные последовательности, демонстрирующие высокую степень гомологии с PDE4D7, например, последовательности нуклеиновых кислот, которые по меньшей мере на 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны последовательности SEQ ID NO:1, или последовательности нуклеиновых кислот, кодирующие аминокислотные последовательности, которые по меньшей мере на 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны последовательности SEQ ID NO:2. Альтернативно, носитель может содержать геномную последовательность PDE4D, предпочтительно, последовательность, как определено в базе данных ENSEMBL в записи ENSG00000113448 (Version ENSG00000113448.8, выпуск Ensembl 53 - март 2009 года), которая соответствует SEQ ID NO:6, или получаемую из Genbank под регистрационным номером No. AC008934 (версия AC008934.5, GI:17386235 от 24 марта 2009 года) в комбинации с Genbank под регистрационным номером No. AC034234 (версия AC034234.4, GI:18390182 от 24 марта 2009 года) или получаемую из Wang et al, 2003, Cell Signal., 15(9): 883-91. Более предпочтительно, носитель может содержать геномную последовательность PDE4D, как определено в SEQ ID NO:6.

Более того, носитель по настоящему изобретению может содержать биологически активные эквиваленты PDE4D7, как определено в настоящем документе.

Полинуклеотид, кодирующий PDE4D7, предпочтительно, может быть связан с вектором, содержащим селективный маркер для размножения в клетке человека. В предпочтительном варианте осуществления полинуклеотидная вставка может быть функционально связана с промотором PSA.

В одном из вариантов осуществления настоящего изобретения нуклеиновые кислоты, кодирующие и экспрессирующие PDE4D7, как определено в настоящем документе, могут быть предоставлены через живые лекарственные средства. Термин "живое лекарственное средство" означает, что PDE4D7 или биологически активные эквиваленты PDE4D7, как определено в настоящем документе выше, экспрессируются в любом подходящем живом носителе. Таким образом, настоящее изобретение относится к соответствующим полинуклеотидам, которые подходят для экспрессии в живой клетке. Настоящее изобретение также относится к векторам, содержащим такие полинуклеотиды, к подходящим клеткам-хозяевам и к продукции полипептидов рекомбинантными способами в указанных клетках-хозяевах.

Термин "живой носитель" относится к любой подходящей живой клетке-хозяину или вирусу, известным специалисту в данной области. Характерные примеры подходящих хозяев включают, но ими не ограничиваются, бактериальные клетки, такие как Escherichia coli или Lactobacillus, клетки грибов, такие как клетки дрожжей, клетки простейших, клетки насекомых или клетки животных. Предпочтительно, термин относится к аттенуированным бактериям, аттенуированным клеткам грибов или аттенуированным клеткам простейших. Характерные примеры подходящих вирусов включают вирусы группы аденовирусов, ретровирусов или лентивирусов, предпочтительно, аттенуированные вирусы группы аденовирусов, ретровирусов или лентивирусов. В предпочтительном варианте осуществления, можно использовать пробиотические бактериальные клетки, в частности пробиотические клетки Escherichia coli или Lactobacillus. Более предпочтительно, можно использовать клетки Escherichia coli Nissle 1973 и, еще более предпочтительно, клетки Lactobacillus casei или Lactobacillus zeae 393.

"Ингибитор miРНК, специфичный к miРНК PDE4D7", содержащийся в стимулирующей фармацевтической композиции, как определено в настоящем документе выше, относится к молекуле нуклеиновой кислоты, кодирующей последовательность нуклеиновой кислоты, комплементарную молекуле miРНК или микроРНК для PDE4D7. Термин "комплементарный", как используют в настоящем документе, относится к абсолютной комплементарности между нуклеиновой кислотой ингибитора miРНК (смысловая молекула) и miРНК (антисмысловая молекула) без какого-либо несоответствия спаривания оснований, а также к ситуациям, в которых нуклеиновая кислота содержит какие-либо несоответствия спаривания оснований и/или дополнительные или отсутствующие нуклеотиды по сравнению с молекулой miРНК. В других вариантах осуществления две молекулы содержат одно или несколько несоответствий спаривания оснований или отличаются их общим количеством нуклеотидов (вследствие вставок или делеций). В следующих вариантах осуществления "комплементарная" молекула нуклеиновой кислоты ингибитора miРНК содержит по меньшей мере десять последовательно расположенных нуклеотидов, демонстрирующих абсолютную комплементарность с последовательностью, содержащейся в молекуле miРНК.

Как правило, молекулы нуклеиновых кислот ингибиторов miРНК представляют собой встречающиеся в природе молекулы ДНК или РНК или синтетические молекулы нуклеиновых кислот, содержащие в их последовательности один или несколько модифицированных нуклеотидов, которые могут быть одного типа или одного или нескольких различных типов.

Например, настоящее изобретение предусматривает, что такая молекула нуклеиновой кислоты ингибитора miРНК содержит по меньшей мере один рибонуклеотидный элемент остова и по меньшей мере один дезоксирибонуклеотидный элемент остова. Более того, молекула нуклеиновой кислоты ингибитора miРНК может содержать одну или несколько модификаций остова РНК с образованием 2'-O-метильной группы или 2'-O-метоксиэтильной группы (также обозначаемых как "2'-O-метилирование"), которые препятствует деградации нуклеазами в культуральной среде и, что важно, также препятствуют эндонуклеазному расщеплению посредством нуклеазы РНК-индуцируемого комплекса сайленсинга, приводящему к необратимому ингибированию miРНК. Другая возможная модификация, которая функционально эквивалентна 2'-O-метилированию, вовлекает замкнутые нуклеиновые кислоты (LNA), представляющие собой аналоги нуклеиновых кислот, содержащие один или несколько нуклеотидных мономеров LNA, как определено в настоящем документе выше.

Другой класс сайленсеров экспрессии miРНК, используемых в контексте настоящего изобретения, включает химически сконструированные олигонуклеотиды, называемые "антагомирами", которые представляют собой одноцепочечные молекулы РНК, конъюгированные с холестерином. Молекулы могут содержать от 19 до 25 нуклеотидов. Предпочтительно, молекула содержит 20, 21, 22, 23 или 24 нуклеотидов. Более предпочтительно, молекула содержит 23 нуклеотида (дальнейшие детали могут быть установлены из Krutzfeldt et al., 2005, Nature, 438: 685-689).

В другом варианте осуществления настоящего изобретения ингибиторы miРНК, как определено в настоящем документе выше, могут быть предоставлены в форме векторов экспрессии для введения в ткани или клетки. Альтернативно, такие векторы также можно вводить в живых лекарственных средствах, как определено в настоящем документе выше.

Как правило, РНК можно получать из трансгенов, предоставляемых путем трансфекции или временной экспрессии векторов или носителей. Например, конкурентные ингибиторы miРНК могут быть предоставлены в качестве транскриптов, экспрессируемых с сильных промоторов, содержащих более одного, предпочтительно, множество, тандемных участков связывания с представляющей интерес микроРНК. "МикроРНК-губка" как описано в Ebert et al., 2007, Nat. Methods, 4: 721-726 представляет собой иллюстративный неограничивающий пример этого способа.

"Деметилирующий агент", содержащийся в стимулирующей фармацевтической композиции, как определено в настоящем документе выше, относится к агенту, способному осуществлять деметилирование хроматиновых структур, предпочтительно, промоторных областей, более предпочтительно, промотора PDE4D7. Примерами деметилирующих агентов для использования в контексте настоящего изобретения являются 5-аза-2'-дезоксицитидин и 5-азацитидин, которые реактивируют гены, ненадлежащим образом подавленные структурными изменениями хроматина, которые вовлекают метилирование ДНК и которые могут обращать вспять эти изменения и, таким образом, восстанавливать основные клеточные каскады. Это, как правило, приводит к реэкспрессии гена и возвращению некоторых аспектов трансформированного состояния. 5-азацитидин и 5-аза-2'-дезоксицитидин, как правило, инактивируют цитозин-C5-метилтрансферазы ДНК через образование стабильных комплексов между остатками 5-аза-2'-дезоксицитидина в ДНК и ферментом, тем самым имитируя стабильное промежуточное соединение переходного состояния, когда они связаны с ферментом метилтрансферазой.

Следующим средством, которое может содержаться в стимулирующей фармацевтической композиции по настоящему изобретению, либо само по себе, либо в комбинации с 5-аза-2'-дезоксицитидином и/или 5-азацитидином, является трихостатин A (TSA).

"Фактор вытеснения фосфодиэстеразы", содержащийся в стимулирующей фармацевтической композиции, как определено в настоящем документе, относится к соединению, которое способно нарушать или прекращать взаимодействие фосфодиэстераз, в частности PDE4D7, с партнером по взаимодействию или взаимодействующими соединениями. Такой процесс может в конечном итоге приводить к связыванию PDE, в частности PDE4D7, с отличающимися партнерами по взаимодействию, чем прежде и, следовательно, к перераспределению PDE. Такие новые партнеры по взаимодействию могут изолировать PDE, в частности PDE4D7, и соответственно модифицировать клеточное поведение, например обеспечивать влияние на связывание рецептора или другие последующие виды активности. Примерами партнеров белков, которые могут быть вовлечены в такую реакцию вытеснения и/или способны изолировать PDE, в частности PDE4D7, являются заякоривающие белки, такие как AKAP, каркасные белки, такие как DISC1, бета-аррестин или RACK1, регуляторные белки, такие как XAP2/AIP/ARA9, связывающие cAMP белки, такие как субъединицы PKA-R или EPAC или рецепторы, такие как бета-1 адренорецептор, а также ферменты, такие как ERK.

Предпочтительными факторами вытеснения фосфодиэстеразы являются пептиды, пептидомиметики, низкомолекулярные соединения, антитела и аптамеры.

"Пептид" в контексте вытесняющего фосфодиэстеразу фактора относится к участку из аминокислот, присутствующему в молекуле фосфодиэстеразы или соответствующему молекуле фосфодиэстеразы, в частности PDE4D7, или взаимодействующему или изолирующему белок, как определено в настоящем документе выше. Участок аминокислот, содержащийся в пептиде, может иметь длину от 5 до 100 аминокислот, предпочтительно, от 10 до 50 аминокислот, более предпочтительно, от 20 до 30 аминокислот. Участки могут быть полностью идентичными PDE или взаимодействующему с ней белку или его части или они могут содержать изменения последовательности. Например, пептидная последовательность может содержать модифицированные аминокислотные остатки во вплоть до 25% всех положений, предпочтительно, модификации, которые не изменяют структурные свойства или связывающие свойства молекулы. Аминокислотная последовательность, присутствующая в пептиде, альтернативно, может представлять собой пространственные домены PDE или взаимодействующего с ней белка и соответственно содержит соседние аминокислотные участки, которые не граничат в первичной последовательности молекулы.

"Пептидомиметик" в контексте вытесняющего фосфодиэстеразу фактора относится к небольшой подобной белку цепи, сконструированной, чтобы имитировать пептид. Такой пептидомиметик может быть получен модификацией существующего пептида, например, пептида, как определено в настоящем документе выше, для изменения свойств молекулы. Может быть получен пептидомиметик модификацией, которая изменяет стабильность или связывающую способность молекулы. Эти модификации, как правило, вовлекают изменения пептида, которые не встречаются в природе. Например, пептидомиметик по настоящему изобретению может иметь измененные пептидные остовы или он может содержать неприродные аминокислоты. Предпочтительно, пептидомиметик по настоящему изобретению может представлять собой молекулу фосфодиэстеразы, в частности, PDE4D7, или взаимодействующий с ней или изолирующей ее белок, как определено в настоящем документе выше.

В одном из вариантов осуществления настоящего изобретения пептидомиметик может блокировать взаимодействие с PDE, в частности PDE4D7, и взаимодействующим с ней соединением. В другом варианте осуществления настоящего изобретения пептидомиметик может усиливать взаимодействие между PDE, в частности PDE4D7, и взаимодействующим с ней соединением.

Способы и технологии для получения пептидомиметиков, а также анализы для тестирования пептидомиметиков известны специалисту в данной области.

"Низкомолекулярные соединения" в контексте вытесняющего фосфодиэстеразу фактора, как используют в настоящем документе, относятся к небольшому органическому соединению, которое предпочтительно, является биологически активным, т.е. к биомолекуле, но предпочтительно, не является полимером. Такое органическое соединение может обладать любой подходящей формой или химическим свойством. Соединение может представлять собой природное соединение, например вторичные метаболиты, или искусственное соединение, которое разработано и получено de novo. В одном из вариантов осуществления настоящего изобретения низкомолекулярное соединение способно блокировать взаимодействие между PDE, в частности PDE4D7, и взаимодействующей с ней молекулой. В другом варианте осуществления настоящего изобретения низкомолекулярное соединение может повышать взаимодействие между PDE, в частности PDE4D7, и взаимодействующей с ней молекулой. Способы и технологии идентификации и получения низкомолекулярных соединений, а также анализы для тестирования низкомолекулярных соединений, известны специалисту в данной области.

"Антитело" или "аптамер" в контексте вытесняющего фосфодиэстеразу фактора относится к специфичному к PDE4D7 антителу или варианту или фрагменту антитела, как определено в настоящем документе выше, или к специфичному к PDE4D7 аптамеру, как определено в настоящем документе выше, обладающим способностью нарушать или прекращать взаимодействие между PDE, в частности PDE4D7, и одним или несколькими из взаимодействующими с ней соединений. Альтернативно, эти термины также могут относиться к антителам или аптамерам, связывающимся с любым одним или нескольким из взаимодействующих с PDE4D7 соединений, как описано в настоящем документе выше, аналогично обладающим способностью нарушать или прекращать взаимодействие между PDE, в частности PDE4D7, и одним или несколькими из взаимодействующих с ней соединений. Способы получения и тестирования антител или аптамеров описаны в настоящем документе выше и/или известны специалисту в данной области.

В следующем предпочтительном варианте осуществления указанную ингибиторную фармацевтическую композицию, как определено выше, или указанную стимулирующую фармацевтическую композицию, как определено выше, можно использовать для лечения рака предстательной железы в зависимости от уровня экспрессии PDE4D7, где указанный уровень экспрессии определяют и/или подвергают мониторингу согласно стадиям:

(a) определение уровня PDE4D7 в образце;

(b) определение уровня экспрессии эталонного гена в образце; и

(c) нормализация измеренного уровня экспрессии PDE4D7 к экспрессии эталонного гена. Уровень PDE4D7 можно определять по уровню нуклеиновой кислоты, белка или активности, как описано в настоящем документе выше. Предпочтительным является определение количества транскрипта(ов) и/или белка PDE4D7. Кроме того, можно определять уровень эталонного гена, как определено в настоящем выше. Предпочтительным эталонным геном в контексте этого варианта осуществления является PDE4D5, как описано в настоящем документе выше.

Термин "в зависимости от уровня экспрессии PDE4D7" означает, что выбор для введения ингибиторной фармацевтической композиции или стимулирующей фармацевтической композиции можно проводить после того, как уровень PDE4D7 был определен в образце, предпочтительно, по сравнению с эталонным геном, таким как PDE4D5.

В особенно предпочтительном варианте осуществления настоящего изобретения в случае увеличенных и/или увеличивающихся уровней PDE4D7 можно вводить ингибиторную фармацевтическую композицию по настоящему изобретению, и в случае сниженных и/или снижающихся уровней PDE4D7 можно вводить стимулирующую фармацевтическую композицию по настоящему изобретению.

Термин "увеличенный", как используют в этом контексте, означает, что уровень экспрессии гена PDE4D7 в тестируемом образце повышен, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем 50% по сравнению с экспрессией PDE4D7 в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз, или по меньшей мере в 10 раз или более по сравнению с экспрессией PDE4D7 в контрольном образце; или когда экспрессия гена PDE4D7 повышена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем на 50% по сравнению с экспрессией эталонного гена в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз, или по меньшей мере в 10 раз или более повышена по сравнению с экспрессией эталонного гена. В конкретном варианте осуществления экспрессию эталонного гена также можно нормализовать или корректировать относительно экспрессии дополнительных генов или маркеров, например, генов домашнего хозяйства. В качестве предпочтительного контрольного образца или эталонной точки можно использовать незлокачественную контрольную здоровую ткань, ткань или клетки, происходящие от здорового индивидуума или ткани доброкачественной опухоли или данные, полученные для них. Альтернативно, также можно использовать любой другой контрольный образец или контрольную точку.

Термин "увеличение" относится к соответствующим образом определенным величинам экспрессии, которые имеют тенденцию к усилению в течением определенного периода времени, т.е. которые становятся более высокими после повторяющихся стадий определения, например, каждые 4 недели, 6 недель, два месяца, 4 месяца, 6 месяцев, 8 месяцев, 12 месяцев, 1,5 лет, 2 лет, 2,5 лет и т.д. "Увеличивающийся" уровень экспрессии PDE4D7 может быть соответственно повышен на от 0,5 до более чем 100% при каждой сессии тестирования, предпочтительно, он может быть повышен на 10%, 20%, 30%, 40%, 50% и т.д. Увеличение само по себе зависит от частоты тестирования и его значимость можно корректировать соответствующим образом, как известно специалисту в данной области.

В предпочтительном варианте осуществления увеличенный или увеличивающийся уровень PDE4D7 можно определять на ранних стадиях развития рака предстательной железы, т.е. вплоть до той стадии, которую имеет гормон-чувствительный рак предстательной железы. Альтернативно, гистологическое определение может обеспечить независимую информацию в отношении стадии опухоли предстательной железы. В зависимости от такого независимого определения можно диагностировать стадию доброкачественной опухоли предстательной железы или стадию гормон-зависимой опухоли. В этой ситуации увеличенный или увеличивающийся уровень PDE4D7 (по сравнению с незлокачественным или здоровым контролем или стадией) может инициировать введение ингибиторной фармацевтической композиции по настоящему изобретению.

Альтернативно, можно дополнительно определять уровень PSA. В случае, если определяют низкий уровень PSA ниже 2,0-3,0 нг/мл, увеличенный или увеличивающийся уровень PDE4D7 может инициировать введение ингибиторной фармацевтической композиции по настоящему изобретению.

Термин "сниженный", как используют в этом контексте, означает, что уровень экспрессии гена PDE4D7 в тестируемом образце снижен, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более чем на 50% по сравнению с экспрессией PDE4D7 в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз или по меньшей мере в 10 раз или более по сравнению с экспрессией PDE4D7 в контрольном образце; или что экспрессия гена PDE4D7 снижена, например, на 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50% или более 50% по сравнению с экспрессией эталонного гена в контрольном образце, или по меньшей мере в 0,1 раза, по меньшей мере в 0,2 раза, по меньшей мере в 1 раз, по меньшей мере в 2 раза, по меньшей мере в 5 раз, или по меньшей мере в 10 раз или более снижена по сравнению с экспрессией эталонного гена. В конкретном варианте осуществления экспрессию эталонного гена также можно нормализовать или корректировать относительно экспрессии дополнительных генов или маркеров, например, генов домашнего хозяйства. В качестве предпочтительного контрольного образца или эталонной точки можно использовать злокачественный контроль, в частности, ткань гормон-чувствительного или гормон-зависимого рака предстательной железы, или данные, полученные для них. Альтернативно, также можно использовать любой другой контрольный образец или контрольную точку.

Термин "снижение" относится к соответственно определенным величинам экспрессии, которые имеют тенденцию к тому, чтобы становиться ниже в течение определенного периода времени, т.е. которые становятся более низкими после повторяющихся стадий определения, например, каждые 4 недели, 6 недель, два месяца, 4 месяца, 6 месяцев, 8 месяцев, 12 месяцев, 1,5 лет, 2 лет, 2,5 лет и т.д. "Увеличивающийся" уровень экспрессии PDE4D7 может быть соответственно повышен на от 0,5 до более чем 100% при каждой сессии тестирования, предпочтительно, он может быть повышен на 10%, 20%, 30%, 40%, 50% и т.д. Снижение само по себе зависит от частоты тестирования и его значимость можно соответствующим образом корректировать, как известно специалисту в данной области.

В предпочтительном варианте осуществления сниженный или снижающийся уровень PDE4D7 можно определять после увеличения PDE4D7 вплоть до стадии опухоли, когда уже определен гормон-чувствительный рак предстательной железы. Альтернативно, гистологическое определение может обеспечить независимую информацию в отношении стадии опухоли предстательной железы. В зависимости от такого независимого определения можно диагностировать стадию гормон-чувствительной опухоли. В этой ситуации сниженный или снижающийся уровень PDE4D7 (по сравнению с начальной стадией опухоли) может инициировать введение стимулирующей фармацевтической композиции по настоящему изобретению.

Альтернативно, можно дополнительно определять уровень PSA в крови. В случае определения уровня PSA приблизительно 20 нг/мл, например, 17, 18, 19, 20, 21, 22, 23, 24, 25 нг/мл и т.д. и/или выше, сниженный или снижающийся уровень PDE4D7 может инициировать введение стимулирующей фармацевтической композиции по настоящему изобретению.

Следующий конкретный вариант осуществления настоящего изобретения предусматривает способ мониторинга развития рака предстательной железы, который охватывает определение PDE4D7, предпочтительно, в комбинации с определением эталонного гена, как описано в настоящем документе выше, в течение определенного периода времени, т.е. после повторяющихся стадий определения, например, каждые 4 недели, 6 недель, два месяца, 4 месяца, 6 месяцев, 8 месяцев, 12 месяцев, 1,5 лет, 2 лет, 2,5 лет, 3 лет, 4 лет или любого другого подходящего периода времени и т.д. Способ может обеспечить данные, демонстрирующие увеличение или снижение уровня PDE4D7 по сравнению с контролями, например, незлокачественными контролями, злокачественными контролями или с более ранними данными, полученными для того же индивидуума. Эти данные можно использовать для изображения или получения кривой экспрессии PDE4D7 с течением времени. С помощью подходящих статистических способов, известных специалисту в данной области, можно определять положение в указанной кривой. В зависимости от положения на указанной кривой, т.е. от положения в возрастающей части или убывающей части указанной кривой, можно диагностировать присутствие или развитие в будущем гормон-зависимого/гормон-чувствительный рака предстательной железы или гормон-резистентного рака предстательной железы. Соответственно, предусматривается применение как ингибиторных фармацевтических композиций по настоящему изобретению, так и стимулирующих фармацевтических композиций по настоящему изобретению. Предпочтительно, любое такое определение можно комбинировать с определением вторичных биомаркеров, например, маркеров рака предстательной железы, в частности PSA. В случае низких уровней PSA (вплоть до от 2,0 до 4,0 нг/мл) данные для PDE4D7 можно анализировать в отношении раннего рака предстательной железы, т.е. доброкачественного или гормон-зависимого/гормон-чувствительного рака предстательной железы. В случае более высоких уровней PSA (более чем приблизительно 20 нг/мл, например, приблизительно 30, 40 или 50 нг/мл) данные для PDE4D7 можно анализировать в отношении более развернутых стадий рака предстательной железы, т.е. гормон-резистентного рака предстательной железы.

Фармацевтическую композицию по настоящему изобретению можно вводить пациенту, индивидууму или лицу с помощью различных систем для доставки, известных специалисту в данной области, например, посредством инкапсулирования в липосомы, микрочастицы, микрокапсулы, рекомбинантные клетки, способные экспрессировать соединение, рецептор-опосредуемого эндоцитоза, конструирования нуклеиновой кислоты в качестве части ретровирусного или другого вектора и т.д. Способы введения могут быть местными, энтеральными, парентеральными и могут включать внутрикожный, внутримышечный, внутрибрюшинный, внутривенный, подкожный, интраназальный, ингаляционный, эпидуральный и пероральный пути. Композицию можно вводить любым удобным путем, например, путем инфузии или болюсной инъекции, путем всасывания через эпителиальные или кожно-слизистые выстилки (например, слизистую оболочку полости рта, ректальную или кишечную слизистую оболочку и т.д.) или путем ингаляции, и ее можно вводить вместе с другими биологически активными средствами. Введение может быть системным или местным. Предпочтительным способом местного введения является введение путем прямой инъекции.

В другом варианте осуществления фармацевтическую композицию можно доставлять непосредственно во внутренние органы, полости тела и т.п. с использованием устройств для визуализации, используемых для направления иглы для инъекции непосредственно в представляющую интерес область. Фармацевтическую композицию также можно вводить в пораженные области во время хирургического вмешательства. В другом варианте осуществления композицию можно доставлять в систему с контролируемым высвобождением.

Предпочтительно, фармацевтическая композиция находится в форме, которая подходит для перорального, местного или системного введения. В предпочтительном варианте осуществления фармацевтическую композицию вводят местно, перорально или системно.

В конкретном варианте осуществления настоящего изобретения ингибиторную фармацевтическую композицию можно вводить после иммуноанализа для стратификации индивидуума, или способ идентификации индивидуума в отношении того, подходит ли он для лечения рака предстательной железы, как описано в настоящем документе выше, проводят, в частности, при классификации индивидуума как имеющего увеличенный уровень PDE4D7. В следующем варианте осуществления фармацевтическая композиция содержит терапевтически эффективное количество ингредиентов фармацевтической композиции по настоящему изобретению, как определено в настоящем документе выше, и фармацевтически приемлемый носитель. Термин "фармацевтически приемлемый" означает одобренный регуляторным органом или другой общепризнанной фармакопеей для применения у животных, и более конкретно у человека. Термин "носитель" относится к разбавителю, адъюванту, эксципиенту или носителю, с которым вводят терапевтическое средство. Такой носитель является фармацевтически приемлемым, т.е. является нетоксичным для реципиента в используемой дозировке и концентрации.

Как правило, ингредиенты предоставляют либо по отдельности, либо смешанными в единичную дозированную форму, например, в качестве сухого лиофилизированного порошка или не содержащего воду концентрата в герметично закрытом контейнере, таком как ампула или саше, на которых указано количество активного вещества.

Фармацевтическая композиция по изобретению может быть изготовлена в качестве нейтральной или солевой формы.

Предпочтительно, фармацевтическую композицию можно вводить непосредственно или в комбинации с любым подходящим адъювантом, известным специалисту в данной области. Композицию по настоящему изобретению можно вводить животному, предпочтительно, млекопитающему. Термин "млекопитающее", как используют в настоящем документе, обладает тем же значением, которое обычно подразумевает специалист в данной области. В частности, "млекопитающее" охватывает человека.

Термин "введенный" означает введение терапевтически эффективной дозы упомянутой выше композиции. Под "терапевтически эффективным количеством" подразумевают дозу, которая приводит к эффектам, для которых ее вводят, предпочтительно, этим эффектом является снижение уровня и деградация PDE4D7. Точная доза зависит от цели лечения, и ее может устанавливать специалист в данной области с использованием известных способов. Как известно в данной области и описано выше, может быть необходима коррекция для системной относительно локальной доставки, по возрасту, массе тела, общему состоянию здоровья, полу, режиму питания, времени введения, взаимодействию лекарственных средств и тяжести состояния, и ее могут проводить с помощью стандартного экспериментирования специалисты в данной области.

Концентрацию активных ингредиентов или соединений фармацевтической композиции по настоящему изобретению можно далее корректировать в соответствии с предполагаемым режимом дозирования, предполагаемой длительностью применения, точным количеством и соотношением всех ингредиентов композиции и другими факторами и параметрами, известными специалисту в данной области.

Активные вещества или соединения по настоящему изобретению можно вводить отдельно или в комбинации с другими способами лечения. В предпочтительном варианте осуществления фармацевтическую композицию по настоящему изобретению можно вводить в комбинации с лечением злокачественной опухоли, например, традиционным лечением рака предстательной железы.

Фармацевтическая композиция по настоящему изобретению также может содержать любой подходящий консервант, известный специалисту в данной области.

Более того, препараты по изобретению также могут содержать соединения, которые обладают антиоксидантным, улавливающим свободные радикалы, антиэритематозным, противовоспалительным или антиаллергенным действием, для дополнения или усиления их действия.

В другом предпочтительном варианте осуществления настоящего изобретения активные компоненты фармацевтической композиции, как определено в настоящем документе выше, можно подвергать слиянию с подходящим белком-носителем, например, с белками Fc-рецепторов Ig или полимерными рецепторами Ig. Предпочтительно, в качестве слитых белков могут быть предоставлены доминантно-негативные формы PDE4D7 или их биологически активные эквиваленты, как определено в настоящем документе выше. Партнер по слиянию может быть предоставлен на N- или C-конце.

Если фармацевтическая композиция по настоящему изобретению подлежит введению в форме живой клетки или живого лекарственного средства, как определено в настоящем документе, трансформированные и подготовленные клетки можно вводить пациенту в любой подходящей форме, известной специалисту в данной области. Предпочтительно, живые лекарственные средства можно вводить в форме композиции, содержащей микроорганизм, например Lactobacillus, как описано выше, в количестве от 102 до 1012 клеток, предпочтительно, от 103 до 108 клеток.

В следующем предпочтительном варианте осуществления настоящего изобретения соотношение между двумя или более ингредиентами в фармацевтической композиции или лекарственными средствами можно подходящим образом корректировать в соответствии со знаниями специалиста в данной области.

Подходящие анализы необязательно можно использовать, чтобы помочь идентифицировать оптимальные соотношения и/или диапазоны дозирования для ингредиентов фармацевтических композиций по настоящему изобретению. Точная доза и соотношение между ингредиентами фармацевтической композиции, как определено в настоящем документе выше, для применения в составе могут зависеть, среди прочих, от пути введения, и точного типа заболевания или нарушения, и они должны быть установлены в соответствии с мнением специалиста в данной области и обстоятельств для каждого пациента. Эффективные дозы или соотношения ингредиентов можно экстраполировать из кривых доза-эффект, полученных в тест-системах in vitro или в модельных тест-системах (на животных).

Характерная доза может находиться, например, в диапазоне от 0,001 до 1000 мкг; однако предусмотрены дозы ниже или выше этого иллюстративного диапазона, особенно с учетом вышеупомянутых факторов.

В другом аспекте настоящее изобретение относится к медицинскому набору, содержащему ингредиент ингибиторной или стимулирующей фармацевтической композиции по настоящему изобретению. Предпочтительно, настоящее изобретение относится к медицинскому набору для лечения или профилактики агрессивного гормон-чувствительного рака предстательной железы, содержащему по меньшей мере один элемент, выбранный из группы, состоящей из (a) соединения, непосредственно ингибирующего активность PDE4D7, предпочтительно, антагониста ферментативной активности PDE4D7; (b) соединения, косвенно ингибирующего активность PDE4D7; (c) доминантно-негативной формы белка PDE4D7 или ее биологически активного эквивалента; (d) нуклеиновой кислоты, кодирующей и экспрессирующей доминантно-негативную форму PDE4D7; (e) miРНК, специфичной к PDE4D7; (f) антисмысловой молекулы для PDE4D7; (g) siРНК, специфичной к PDE4D7; (h) аптамера, специфичного к продукту экспрессии PDE4D7 или к белку PDE4D7; (i) низкомолекулярного соединения или пептидомиметика, способных специфично связываться с белком PDE4D7; и (j) антитела, специфичного к белку PDE4D7, и/или варианта антитела, специфичного к белку PDE4D7.

Медицинский набор можно использовать в контексте введения фармацевтической композиции, как определено в настоящем документе выше. В частности, набор по настоящему изобретению можно использовать для лечения или профилактики рака предстательной железы, например агрессивного гормон-чувствительного рака предстательной железы.

Ингредиенты медицинского набора, по настоящему изобретению, могут содержаться в одном или нескольких контейнерах или в отдельных элементах. Предпочтительно, они могут быть изготовлены в качестве фармацевтических композиций или лекарственных средств, более предпочтительно, они могут быть изготовлены, как описано в настоящем документе выше в контексте фармацевтических композиций по настоящему изобретению, например, они могут содержать подходящие фармацевтические носители и т.д. Особенно предпочтительными являются составы для местного введения, как упоминалось в настоящем документе выше в контексте фармацевтических композиций по изобретению. Медицинский набор по настоящему изобретению необязательно также может содержать документацию, в которой описано применение или использование медицинского набора и его компонентов. Предпочтительно, инструкции, содержащиеся в медицинском наборе по настоящему изобретению, могут содержать рекомендованные варианты лечения, режимы дозирования и т.д. Медицинский набор также может содержать листок-вкладыш с инструкцией и/или он может обеспечивать дополнительную информацию в отношении применения, дозировки и т.д.

Медицинский набор по настоящему изобретению можно вводить пациенту согласно любому подходящему режиму дозирования, известному специалисту в данной области. Медицинский набор или компоненты набора можно, предпочтительно, вводить один раз в неделю, более предпочтительно, 2 раза, 3 раза, 4 раза, 5 раз или 6 раз в неделю и, наиболее предпочтительно, каждые сутки и/или 2 раза в сутки или более часто, если нет иных указаний. По мере прохождения лечения дозировки можно вводить со значительно более длительными интервалами и при необходимости их можно вводить со значительно более короткими временными интервалами, например, несколько раз в сутки. Предпочтительно, мониторинг ответа на лечение можно проводить с использованием описанных в настоящем документе способов и, кроме того, способов, известных специалистам в данной области и дозировки можно соответствующим образом оптимизировать, например, по времени, количеству и/или композиции. Мониторинг хода лечения можно проводить путем периодической оценки. Также предусматривается, что медицинский набор также используют в подходах совместной терапии, т.е. при совместном введении с другими медикаментами или лекарственными средствами, например, антибиотиками, противовирусными лекарственными средствами или IgG- или IgA-иммуноглобулинами, цитотоксическими лекарственными средствами против злокачественной опухоли и, предпочтительно, в случае, если лекарственное средство включает ингибиторную фармацевтическую композицию, антигормональные лекарственные средства, более предпочтительно, антиандрогены, как упоминается в настоящем документе выше.

В следующем конкретном аспекте настоящее изобретение относится к набору, содержащему ингредиенты для определения экспрессии PDE4D7, как определено в настоящем документе выше, вместе с ингредиентами медицинского набора для лечения рака предстательной железы, в частности, агрессивного гормон-чувствительного рака предстательной железы, как определено в настоящем документе выше.

В следующем особенно предпочтительном варианте осуществления настоящего изобретения злокачественная опухоль, подлежащая диагностике, обнаружению, мониторингу или прогнозированию или прогрессирование которой подвергают диагностике, обнаружения, мониторингу или прогнозированию, или которая подлежит лечению с помощью фармацевтической композиции, упомянутой выше, или способа лечения по настоящему изобретению, представляет собой гормон-чувствительный рак предстательной железы стадии с I по IV, гормон-чувствительный рецидивирующий рак предстательной железы, или гормон-чувствительный метастазирующий рак предстательной железы.

"Гормон-чувствительный рак предстательной железы стадии с I по IV", как используют в настоящем документе, означает рак предстательной железы, который можно классифицировать согласно классификации TNM от International Union Against Cancer (UICC) на стадии с I по IV. Предпочтительно, термин относится к классификации рака предстательной железы, в соответствии со следующей схемой классификации T - первичной опухоли предстательной железы:

TX. Первичную опухоль нельзя оценить.

T0. Нет признаков первичной опухоли.

T1. Клинически бессимптомная опухоль, не пальпируемая или не видимая при визуализации.

T1a. Случайное нахождение опухоли в 5% или менее подвергнутой резекции ткани.

T1b. Случайное нахождение опухоли в более чем 5% подвергнутой резекции ткани.

T1c. Опухоль, идентифицированная пункционной биопсией (например, вследствие повышенного PSA).

T2. Опухоль, ограниченная предстательной железой (опухоль, встречающуюся в одной или обеих долях при пункционной биопсии, но не являющуюся пальпируемой или видимой при визуализации, классифицируют как T1c).

T2a. Опухоль вовлекает половину одной доли или менее.

T2b. Опухоль вовлекает более половины одной доли, но не обе доли.

T2c. Опухоль вовлекает обе доли.

T3. Опухоль выходит за пределы капсулы предстательной железы (инвазию в верхушку предстательной железы, или в (но не за пределы) капсулу предстательной железы, классифицируют не как T3, а как T2).

T3a. Распространение за пределы капсулы (одностороннее или двухстороннее).

T3b. Инвазия опухолью семенного пузырька(ов).

T4. Фиксированная опухоль или инвазия в соседние структуры, отличные от семенных пузырьков: шейку мочевого пузыря, внешний сфинктер, прямую кишку, поднимающую мышцу или стенку таза.

N1. Инвазия опухоли в регионарный лимфатический узел(узлы).

M1a. Инвазия опухоли в нерегионарный лимфатический узел(узлы).

M1b. Инвазия опухолью кости(ей).

M1c. Инвазия опухолью другой области(ей).

G Гистопатологическая классификация.

GX. Нельзя оценить степень.

G1. Хорошо дифференцированная (небольшая анаплазия) (2-4 Gleason).

G2. Умеренно дифференцированная (умеренная анаплазия) (5-6 Gleason).

G3-4. Слабо дифференцированная/недифференцированная (выраженная анаплазия) (7-10 Gleason),

где категории T отражают физикальное обследование, визуализацию, эндоскопию, биопсию и биохимические тесты, категории N отражают физикальное обследование и визуализирующие тесты, и категории M отражают физикальное обследование, визуализацию, исследования скелета и биохимические тесты, и где стадии с I по IV злокачественного рака предстательной железы соответствуют следующей схеме:

Стадия I: T1a; N0; M0; G1
Стадия II: T1a; N0; M0; G2, 3-4, или
T1b. c; N0; M0; любая степень G, или
T1. T2; N0; M0; любая степень G
Стадия III T3; N0; M0; любая степень G
Стадия IV T4; N0; M0; любая степень G, или
Любая степень T; N1; M0; любая степень G, или
Любая степень T; любая степень N; М1; любая степень G,

где стадия IV не включает гормон-резистентный рак предстательной железы.

"Гормон-чувствительный рецидивирующий рак предстательной железы", как используют в настоящем документе, означает рак предстательной железы, рост и прогрессирование которого регулируется и зависит от мужского полового гормона. Предпочтительным примером такого мужского полового гормона является андроген.

"Гормон-чувствительный метастазирующий рак предстательной железы", как используют в настоящем документе, означает рак предстательной железы, рост и прогрессирование которого не регулируется и не зависит от мужского полового гормона. Предпочтительным примером такого мужского полового гормона является андроген.

Следующие примеры и фигуры предоставлены только для иллюстративных целей. Таким образом, понятно, что примеры и фигуры не следует истолковывать, как ограничивающие. Специалист в данной области способен предусмотреть дальнейшие модификации принципов, представленных в настоящем документе.

ПРИМЕРЫ

Пример 1 - количественный анализ способом RT-PCR

РНК от индивидуума и из образцов, представленных на фиг. 1A и B, выделяли и транскрибировали стандартными способами в кДНК.

qRT-PCR: материалы и способы

Образцы РНК обрабатывали ДНК-азой для обеспечения отсутствия контаминации ДНК. Перед синтезом кДНК образцы РНК обрабатывали DNAseI (In Vitrogen) в течение 30 мин при 37°C. Затем 1 мкг образца РНК обрабатывали Superscript Vilo (In Vitrogen) для синтеза первой цепи ДНК для анализа способом qPCR в соответствии с руководством изготовителей. Затем образцы ДНК обрабатывали РНК-азой H1 в течение 30 мин при 37°C.

Полученную ДНК разбавляли до конечной концентрации 50-60 нг/мкл, из которых 5 мкл добавляли в каждую реакционную лунку 96-луночного оптического реакционного планшета.

Количественные реакции ПЦР проводили с использованием устройства ABI Prism 7300 в объеме реакции 15 мкл согласно следующему протоколу:

7,5 мкл Platinum qPCR SuperMix-UDG с ROX (InVitrogen)

2,2 мкл не содержащей нуклеаз воды

0,1 мкл зонда в концентрации 100 пмоль/мкл

0,1 мкл прямого праймера в концентрации 100 пмоль/мкл

0,1 мкл обратного праймера в концентрации 100 пмоль/мкл

Общий объем каждой реакционной лунки составлял 15 мкл, включая кДНК.

Сам ПЦР анализировали в течение 40 циклов по следующей программе:

Стадия Повторения Температура Время
1 1 50 2 секунды
2 1 95 2 минуты
3 40 95 15 секунд
60 1 минута

Праймеры и зонды для qRT-PCR (TAQMAN)

Для RT-PCR использовали следующие олигонуклеотидные праймеры и зонды для PDE4D7:

Прямой праймер 5'-TGCCTCTGAGGAAACACTAC-3' (SEQ ID NO:3), обратный праймер 5'-GCTGAATATTGCGACATGAAAG-3' (SEQ ID NO:4), приводящие к продукту длиной 101.

В качестве зонда использовали последовательность 5'-CCAGTAATGAAGAGGAAGACCCTTTCCGC-3' (SEQ ID NO:5).

Наборы зондов были сконструировали для нацеливания на уникальные N-концевые области изоформы PDE. Ампликон конструировали так, чтобы он находился в оптимальном диапазоне для технологии анализов Taqman на ABI Prism. Все анализы проводили в четырех экземплярах для максимального увеличения целостности данных. Также был включен эталонный зонд GAPDH, против которого сравнивали все последовательные данные.

qRT-PCR: анализ данных

Для нормализации и сравнения различных экспериментов RT-PCR выполняли подход -ddCt. Величины Ct получали путем выявления порога вручную, где набор зондов амплифицировался экспоненциально при сравнимой эффективности. В частности, проводили следующие стадии:

1) Вычисляли разность в количестве циклов (Ct) между эталоном и представляющим интерес геном (GAPDH вычитали из представляющего интерес гена) с получением dCt для экспериментального образца (ES).

2) Один образец отбирали в качестве стандарта для сравнения против (LNCaP) (C) и вычисляли его dCt.

3) Изменение в разности количества циклов может быть установлено как dCt(ES)-dCt(C) = ddCt

4) Конечные сравнимые величины экспрессии могут быть установлены как 2-ddCt для учета удвоения ДНК после каждого цикла, таким образом, демонстрируя количество мРНК по сравнению с LNCaP.

Это действие дало величину по сравнению с LNCaP (которая имеет величину 1), т.е. любую величину > 1 считали увеличением экспрессии, величину < 1 считали снижением экспрессии.

Таким образом, было принято, что эффективность удлинения всех реакцией ПЦР находится в определенном диапазоне, приводящим к величине 1.

Процентный подход для нормализации и сравнения различных экспериментов RT-PCR

Для каждого набора зондов получали величину Ct (количество циклов). Ее получали нахождением исходного уровня, который пересекал кривые амплификации в ходе их экспоненциальной фазы. Исходные уровни получали динамически в соответствии с кривыми, полученными для каждого эксперимента. Затем величины Ct (пересечение или циклы) для GOI вычитали из величины Ct для стандарта GAPDH.

Согласно формуле Ct(GAPDH) - Ct(GOI) = dCt, учитывая, что величины Ct для GOI всегда превышают величину эталонного гена, величина dCt дала отрицательные числа, т.е. величину -dCt. Исходя из эффекта удвоения каждого цикла, были определены абсолютные величины согласно сравнительной величине экспрессии = 2-dCt.

Вследствие того, что при этом вычислении получают очень низкие величины, эту величину умножают на 1000 для удобства.

Коробчатая диаграмма относительных уровней экспрессии PDE4D7 против GAPDH нормальных, доброкачественных и злокачественных образцов ткани предстательной железы, могут быть установлены из фиг. 2. В частности, на этой фигуре представлено сравнение между нормальными/контрольными образцами ткани (7), образцами доброкачественной ткани (31) и образцами злокачественной ткани (10). Результаты был получены на основе T-критерия (2-сторонними) со значением p доброкачественных против злокачественных образцов (разность медиан), составляющим 0,00025. На фиг. показано, что существует значительное увеличение относительной экспрессии между нормальной и доброкачественной тканью с одной стороны и злокачественной тканью предстательной железы с другой стороны.

Диаграмма разброса относительных уровней экспрессии PDE4D7 против GAPDH для нормальных, доброкачественных и злокачественных образцов ткани предстательной железы представлена на фиг. 3. На этой фигуре указаны индивидуальные относительные величины экспрессии PDE4D7 в нормальной, доброкачественной и злокачественной тканях. Величины экспрессии приведены относительно экспрессии GAPDH. Результаты демонстрируют, что применение произвольного предела 4,7 обеспечивает специфичность диагностического теста для различения между доброкачественными и злокачественными образцами предстательной железы, составляющую 92% при чувствительности 70%.

Соответствующий анализ на основе ROC-кривой экспрессии PDE4D7 в доброкачественных против злокачественных образцах предстательной железы представлен на фиг. 4. Здесь относительные величины экспрессии PDE4D7 доброкачественных против злокачественных образцов тканей предстательной железы анализировали путем нанесения на график классификаций FP относительно TP на основе соответствующей экспрессии PDE4D7 (по сравнении с GAPDH) в доброкачественной против злокачественной тканях предстательной железы (см. коробчатую диаграмму выше). AUC (площадь под кривой) вычисляли как 0,91.

Для целей иллюстрации и сравнения коробчатая диаграмма величин PSA человека в крови у 90 мужчин с доброкачественным и различными стадиями злокачественного заболевания предстательной железы представлены на фиг. 5. На этой фигуре проведено сравнение между мужчинами с доброкачественным заболеванием предстательной железы (30), мужчин со злокачественным заболеванием предстательной железы (30) с небольшими злокачественными опухолями и мужчин со злокачественным заболеванием предстательной железы (30), с существенными опухолями. На этой фигуре показано, что возрастание экспрессии от доброкачественных опухолей предстательной железы к злокачественным опухолям менее выражено по сравнению с результатами для PDE4D7.

Соответствующий анализ на основе ROC-кривой уровней PSA в крови у мужчин с доброкачественным против различных стадий злокачественного заболевания предстательной железы представлен на фиг. 6. Здесь величины экспрессии PSA в крови у мужчин с доброкачественными (30) против злокачественных (30 небольших, 30 существенных злокачественных опухолей, см. коробчатую диаграмму выше) образцов предстательной железы анализировали путем нанесения на график классификаций FP против TP на основе величин PSA в крови при доброкачественном заболевании против злокачественного. AUC (площадь под кривой) была вычислена как 0,7.

Пример 2 -обнаружение PDE4D7 и PDE4D5 в количественных анализах RT-PCR с образцами тканей человека (панели I и II тканей рака предстательной железы человека Origene)

Относительную экспрессию гена PDE4D7 человека и PDE4D5 человека в качестве эталонного гена оценивали в панелях от различных пациентов.

Материалы и способы

Детальное описание образцов, использованных для измерений qPCR в эксперименте по экспрессии гена PDE, приведено в таблицах 1 и 2, ниже:

Таблица 1
Панель I тканей рака предстательной железы человека Origene (HPRT501, Origene Inc):
пол возраст ткань внешний вид диагноз степень опухоли нормальный очаг повреждения опухоль
Мужской 67 Предстательная железа/
Предстательная железа
Нормальный Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 100 0 0
Мужской 68 Предстательная железа/
Предстательная железа
Нормальный Аденокарцинома предстательной железы Показатель Gleason 4+3=7/10 100 0 0
Мужской 53 Предстательная железа/
Предстательная железа
Нормальный Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 100 0 0
Мужской 65 Предстательная железа/
Предстательная железа
Нормальный Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 100 0 0
Мужской 48 Предстательная железа/
Предстательная железа
Нормальный Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 100 0 0
Мужской 68 Предстательная железа/
Предстательная железа
Нормальный Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 100 0 0
Мужской 76 Предстательная железа/
Предстательная железа
Нормальный Аденокарцинома предстательной железы Показатель Gleason 4+3=7/10 100 0 0
Мужской 60 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 0 100 0
Мужской 70 Предстательная железа/
Предстательная железа
Очаг повреждения Карцинома мочевого пузыря AJCC G3: Слабо дифференцированная 0 100 0
Мужской 74 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 0 100 0
Мужской 66 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 4+3=7/10 0 100 0
Мужской 72 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 0 0 100
Мужской 63 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 25 75 0
Мужской 55 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 0 100 0
Мужской 70 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 0 100 0
Мужской 68 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 0 100 0
Мужской 66 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 2+2=4/10 0 100 0
Мужской 76 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Не указано 0 100 0
Мужской 71 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 0 100 0
Мужской 56 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 0 100 0
Мужской 61 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 4+3=7/10 0 100 0
Мужской 63 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 25 15 60
Мужской 70 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 25 5 70
Мужской 68 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 30 0 65
Мужской 61 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 10 0 70
Мужской 59 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 4+5=9/10 10 0 80
Мужской 61 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 5 0 85
Мужской 63 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 5 0 80
Мужской 53 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 4+3=7/10 0 100 0
Мужской 66 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 3+5=8/10 0 100 0
Мужской 61 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 4+3=7/10 0 100 0
Мужской 65 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 4+4=8/10 0 100 0
Мужской 64 Предстательная железа/
Предстательная железа
Очаг повреждения Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 0 100 0
Мужской 48 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 4+5=9/10 5 0 75
Мужской 65 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 4+4=8/10 0 0 90
Мужской 61 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 4+4=8/10 10 0 80
Мужской 51 Предстательная железа/
Предстательная железа
Очаг повреждения Карцинома мочевого пузыря, уротелиальная AJCC G4: Недифференцированная 0 100 0
Мужской 76 Предстательная железа/
Предстательная железа
Очаг повреждения Гиперплазия предстательной железы, атипичная НУЛЕВАЯ 0 100 0
Мужской 62 Предстательная железа/
Предстательная железа
Очаг повреждения Гиперплазия предстательной железы НУЛЕВАЯ 0 100 0
Мужской 72 Предстательная железа/
Предстательная железа
Очаг повреждения Гиперплазия предстательной железы НУЛЕВАЯ 0 100 0
Мужской 71 Предстательная железа/
Предстательная железа
Очаг повреждения Гиперплазия предстательной железы НУЛЕВАЯ 0 100 0
Мужской 76 Предстательная железа/
Предстательная железа
Очаг повреждения Железистая гиперплазия предстательной железы НУЛЕВАЯ 0 100 0
Мужской 71 Предстательная железа/
Предстательная железа
Очаг повреждения Гиперплазия предстательной железы НУЛЕВАЯ 0 100 0
Мужской 76 Предстательная железа/
Предстательная железа
Очаг повреждения Гиперплазия предстательной железы НУЛЕВАЯ 45 55 0
Мужской 76 Предстательная железа/
Предстательная железа
Очаг повреждения Гиперплазия предстательной железы НУЛЕВАЯ 0 100 0
Мужской 56 Предстательная железа/
Предстательная железа
Очаг повреждения Гиперплазия предстательной железы НУЛЕВАЯ 0 100 0
Мужской 85 Предстательная железа/
Предстательная железа
Очаг повреждения Аденома предстательной железы НУЛЕВАЯ 0 100 0
Мужской 72 Предстательная железа/
Предстательная железа
Очаг повреждения Гиперплазия предстательной железы НУЛЕВАЯ 0 100 0
Таблица 2
Панель II тканей рака предстательной железы человека Origene (HPRT502, Origene Inc)
пол возраст ткань внешний вид диагноз на основании образца после подтверждения патологии степень опухоли нормальный очаг повреждения опухоль
Мужской 53 Предстательная железа/
Предстательная железа
Нормальный В нормальных пределах Не применимо 100 0 0
Мужской 48 Предстательная железа/
Предстательная железа
Нормальный В нормальных пределах Не применимо 100 0 0
Мужской 68 Предстательная железа/
Предстательная железа
Нормальный В нормальных пределах Не применимо 100 0 0
Мужской 76 Предстательная железа/
Предстательная железа
Нормальный В нормальных пределах Не применимо 100 0 0
Мужской 53 Предстательная железа/
Предстательная железа
Нормальный В нормальных пределах Не применимо 100 0 0
Мужской 68 Предстательная железа/
Предстательная железа
Нормальный В нормальных пределах Не применимо 100 0 0
Мужской 74 Предстательная железа/
Предстательная железа
Нормальный В нормальных пределах Не применимо 100 0 0
Мужской 72 Предстательная железа/
Предстательная железа
Нормальный В нормальных пределах Не применимо 100 0 0
Мужской 62 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 50 0 50
Мужской 54 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 20 0 60
Мужской 56 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 0 25 75
Мужской 56 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 10 0 90
Мужской 55 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 45 0 40
Мужской 63 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 20 0 80
Мужской 53 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 40 0 60
Мужской 64 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 0 0 90
Мужской 68 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 0 0 95
Мужской 63 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+3=6/10 60 0 40
Мужской 66 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 0 5 60
Мужской 70 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason 3+4=7/10 25 0 65
Мужской 65 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 3+4=7/10 0 30 70
Мужской 64 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 3+3=6/10 0 0 90
Мужской 54 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 4+3=7/10 30 0 40
Мужской 64 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 3+4=7/10 0 0 80
Мужской 62 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 4+3=7/10 0 0 95
Мужской 62 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 4+3=7/10 0 0 90
Мужской 61 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 3+4=7/10 0 0 90
Мужской 62 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 3+5=8/10 0 0 80
Мужской 53 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 3+4=7/10 0 0 90
Мужской 58 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 4+3=7/10 0 0 90
Мужской 57 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 4+5=9/10 0 60 40
Мужской 65 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 3+3=6/10 0 55 45
Мужской 53 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 3+3=6/10 0 0 95
Мужской 61 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 3+4=7/10 0 0 90
Мужской 73 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 3+4=7/10 0 0 90
Мужской 52 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 4+4=8/10 0 0 85
Мужской 64 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 4+3=7/10 0 0 90
Мужской 54 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 5+4=9/10 0 0 90
Мужской 61 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 3+2=5/10 20 0 80
Мужской 61 Предстательная железа/
Предстательная железа
Очаг повреждения Гиперплазия предстательной железы Показатель Gleason: 4+3=7/10 0 100 0
Мужской 54 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 4+3=7/10 0 0 80
Мужской 62 Предстательная железа/ лимфоузел Опухоль Аденокарцинома предстательной железы, метастазирование Не указано 0 0 95
Мужской 64 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 4+3=7/10 0 0 90
Мужской 87 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 5+4=9/10 0 0 80
Мужской 76 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 3+4=7/10 0 0 90
Мужской 71 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 2+3=5/10 0 0 80
Мужской 77 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 4+4=8/10 10 0 90
Мужской 83 Предстательная железа/
Предстательная железа
Опухоль Аденокарцинома предстательной железы Показатель Gleason: 5+4=9/10 40 0 60

Панели I и II тканей рака предстательной железы человека Origene, использованные для всех описанных ниже экспериментов, содержат образцы, которые происходят от пациентов-мужчин (возраст 48-87). Столбец "ткань" определяет ткань, которая была взята в ходе хирургической операции. Колонка "внешний вид" указывает на патологический статус среза ткани, которую использовали для выделения РНК и которую в итоге использовали для измерений способом qPCR. "Нормальный" в этом контексте означает нормальную соседнюю ткань (NAT), которая представляет собой ткань, взятую из хирургического материала (обычно при радикальной простатэктомии или TURP (трансуретральной резекции предстательной железы)), но которая имеет внешний вид с нормальной/здоровой морфологией и гистологией и, таким образом, использована в качестве контроля. Определение "очага повреждения" является следующим: не неопластическая ткань, которая не является нормальной в том, что в ней присутствует некоторый тип патологической диагностической аномалии (но не опухоль). Это включает такие гистопатологии, как воспаление или доброкачественная гиперплазия (примеры: колит, болезнь Крона, эндометриоз, эмфизема, бронхит). "Опухоль" определяют как неопластическую ткань, которая может быть либо доброкачественной, либо злокачественной на основе диагноза патологии (например, аденома, аденокарцинома, саркома). В столбце "диагноз" описана фактическая причина хирургической операции (например, рак мочевого пузыря для пациента 9, но также была взята ткань рака предстательной железы). В столбце "степень опухоли" описан показатель Gleason, если он применим (т.е., в случае опухолевой ткани). Столбцы "нормальный", "очаг повреждения" и "опухоль" определяют процент соответствующей ткани, найденной при гистологии в срезе ткани, использованном для выделения РНК. Панель I тканей рака предстательной железы человека Origene включает 7 нормальных образцов (нормальная соседняя ткань, NAT), 11 образцов с гиперплазией (BPH - доброкачественная гиперплазия предстательной железы), 20 образцов очагов повреждения, и 10 образцов опухоли предстательной железы. Среди образцов опухолей, 7 происходят из опухолей, которые имели показатель Gleason 7 или более. Панель II тканей рака предстательной железы человека Origene включает 8 нормальных образцов (нормальная соседняя ткань), 1 образец с гиперплазией (BPH - доброкачественная гиперплазия предстательной железы), и 39 образцов опухоли предстательной железы. Среди образцов опухоли, 10 происходят от доноров показателем Gleason, ранжированным вплоть до 6, и 29 происходят из опухолей, которые имели показатель Gleason 7 или более.

Последовательности праймеров, использованных для PDE4D5 человека: последовательность смыслового праймера: GCAGCATGAGAAGTCCAAGA (SEQ ID NO:7), последовательность антисмыслового праймера: TGTATGTGCCACCGTGAAAC (SEQ ID NO:8), последовательность зонда: TCGGTTTCTCCCAAGCTCTCTCCAGTGATAAACCGA (FAM-меченный) (SEQ ID NO:9).

Последовательности праймеров, использованные для PDE4D7 человека:

последовательность смыслового праймера: CGGAATGGAACCCTATCTTGTC (SEQ ID NO:10);

последовательность антисмыслового праймера: TTGGTCGTTGAATGTTCTCTGAT (SEQ ID NO:11);

последовательность зонда: CCTCTCGCCTTCAGACAGTTGGAACAAGGAGAGG (FAM-меченный) (SEQ ID NO:12).

Специфические праймеры PDE4D7 и PDE4D5 (SEQ ID NO:7, 8, 10 и 11) предварительно смешивали с зондами FAM для проведения количественной ПЦР в реальном времени (qPCR), и использовали в разведении 1:20 согласно описанию производителя (PrimerDesign, UK). Образцы кДНК человека (см. таблицы 1 и 2) помещали в стандартные готовые для qPCR 96-луночные микропланшеты для титрования (MT). 48 образцов ткани, полученных от 48 различных пациентов, помещали в 96-луночный MT-планшет, где каждая из использованных 48 лунок на планшет содержала приблизительно 2-3 нг кДНК, обратно транскрибированной с РНК.

Содержание кДНК в каждой лунке нормализовывали на основе qPCR для гена домашнего хозяйства, такого как ген бета-актина, GAPDH, бета-2-микроглобулина, так чтобы дальнейшая нормализация содержания кДНК не требовалась.

В каждую из используемых лунок MT-планшета добавляли 15 мкл основной смеси Applied Biosystems' GeneAmp mastermix (2x), 13,5 мкл воды, не содержащей РНК-азы/ДНК-азы, и 2 мкл предварительной смеси PrimerDesign PerfectProbe primermix (PrimerDesign, UK). Все образцы анализировали по следующему протоколу ПЦР: 2 мин при 50°С, 10 мин при 95°C, 15 с при 95°C, 30 с при 50°С при одновременной регистрации флуоресценции, 15 с при 72°C и последние три стадии повторяли 50 раз.

Для всех вычислений величин относительной экспрессии гена, использовали следующую процедуру: Величины CT 40 или выше или ниже 16 исключили вследствие плохого качества. (Гены, исследованные здесь, имели среднюю величину CT ~31). Для нормализации величин CT для различных планшетов qPCR, вычисляли срединную величину CT для "нормальных" образцов тканей, и определяли относительные величины экспрессии для образцов "очага повреждения", "гиперплазии", а также "опухоли", относительно этой величины путем вычисления соотношения между величинами CT для образцов "очага повреждения", "гиперплазии", а также "опухоли" и величиной CT для "нормальных" образцов тканей. Как правило, это приводило к относительным величинам экспрессии ~1. В случае когда экспрессию генов анализировали многократно (с использованием множества планшетов для одной и той же панели), относительные величины экспрессии для каждого индивидуального образца усредняли.

Относительная экспрессия PDE4D5 человека в ткани предстательной железы человека

Уровень экспрессии гена изоформы PDE4D5 человека определяли на тканях предстательной железы человека, как описано выше. Относительные уровни экспрессии определяли в четырех определенных тканях предстательной железы ("нормальная", "очаг повреждения", "гиперплазия", "опухоль"). Уровни экспрессии для групп "очаг повреждения", "гиперплазия" и "опухоль" вычисляли, как описано выше в качестве нормализованной величины путем получения соотношения величин CT для ткани каждого отдельного пациента в группах "очаг повреждения", "гиперплазия", "опухоль" относительно срединной величины CT группы "нормальный". То же самое проводили для ткани каждого индивидуального пациента группы "нормальный", так что срединная величина экспрессии для этой группы составляет 1.

Как может быть установлено из фиг. 7 и 8, нельзя было выявить существенную экспрессию PDE4D5 человека для нарушенных тканей предстательной железы (очаг повреждения, гиперплазия и опухоль) по сравнению с нормальной тканью предстательной железы. Все величины p для сравнения нарушенных, но не злокачественных тканей (очаг повреждения, гиперплазия) против опухолевой ткани составили >0,5.

Относительная экспрессия PDE4D7 человека в ткани предстательной железы человека

Уровень экспрессии гена изоформы PDE4D7 человека определяли на тканях предстательной железы, как описано выше. Относительные уровни экспрессии определяли в четырех определенных тканях предстательной железы ("нормальная", "очаг повреждения", "гиперплазия", "опухоль"). Уровни экспрессии для групп "очаг повреждения", "гиперплазия" и "опухоль" вычисляли, как описано выше в качестве нормализованной величины путем получения соотношения величин CT для ткани каждого отдельного пациента в группах "очаг повреждения", "гиперплазия", "опухоль" относительно срединной величины CT группы "нормальный". То же самое проводили для ткани каждого индивидуального пациента группы "нормальный", так что срединная величина экспрессии для этой группы составляет 1.

T-критерий Стьюдента использовали, чтобы увидеть, является ли экспрессия гена PDE4D7 человека в среднем значимо повышенной в различных опухолевых тканях по сравнению с нормальной тканью предстательной железы. Величины p, полученные после различных попарных сравнений составляли: T-критерий для доброкачественного образца (очаг повреждения + гиперплазия) против опухоли: p = 0,0035; T-критерий для нормального образца против опухоли: p = 0,092; T-критерий для гиперплазии против опухоли: p=0,040; и T-критерий для очага повреждения против опухоли: p=0,031.

Как можно установить из фиг. 9 и 10 и указанных значений p, может быть выявлена значимо отличающаяся экспрессия PDE4D7 человека для нарушенных тканей предстательной железы (очаг повреждения, гиперплазия) по сравнению со злокачественной тканью предстательной железы.

Анализ экспрессии PDE4D7 с помощью рабочей характеристической кривой (ROC)

После этого проводили анализ с помощью рабочей характеристической кривой (ROC) для определения AUC (площадь под кривой) для различных попарных сравнений. Рабочие характеристические кривые для экспрессии гена PDE-4D7 для оценки диагностической мощности представлены на фиг. 11. ROC-анализ обеспечил доказательство того, что дифференциация между доброкачественной и злокачественной тканью предстательной железы на основе уровней экспрессии PDE4D7 возможна со специфичностью (уровень ложноположительных результатов) >80% при чувствительности (уровень ложноотрицательных результатов) ~80%.

Индекс PDE предстательной железы (PPI) - относительная экспрессия PDE4D7 человека в ткани предстательной железы человека, нормализованная относительно PDE4D5 человека, для эффективного различения между доброкачественными и злокачественными заболеваниями предстательной железы.

Уровень экспрессии генов изоформ PDE4D7 человека и PDE4D5 человека определяли на тканях предстательной железы человека, как описано выше. Относительные уровни экспрессии определяли в четырех определенных тканях предстательной железы ("нормальная", "очаг повреждения", "гиперплазия", "опухоль"). Относительный уровень экспрессии PDE4D7 вычисляли путем вычитания индивидуальных величин CT для PDE4D7 из индивидуальных величин CT для PDE4D5. Как правило, это приводит к распределению "нормальных" величин экспрессии около 0 (от -2 до +2). Кроме того, оптимальная пороговая величина между неопухолевым ("нормальный", "очаг повреждения", "гиперплазия") и опухолевым ("опухоль") образцами представляет собой величину от -1 до +1.

Этот подход преимущественно позволяет сравнение величин CT для PDE4D7 против внутреннего контроля, а именно PDE4D5. Таким образом, не является необходимой нормализация образцов соответствующих клинических групп пациентов относительно количества нормальных образцов, которые не всегда могут быть доступны в реальных условиях тестирования. Этот тест можно проводить в качестве простого анализа с PDE4D5 человека в качестве внутреннего эталонного контроля с получением индекса PDE предстательной железы, который определяют как дельта(Ct[PDE4D5 человека] - Ct[PDE4D7 человека]).

Экспериментально получали индекс PDE предстательной железы так, что наиболее оптимальный предел для различения между злокачественным и доброкачественным заболеваниями предстательной железы составлял от -2 до +2, предпочтительно, 0 (ноль). Пороговая величина анализа может быть установлена на основе исторических данных, измеренных на ретроспективно полученных клинических образцах. Интерпретация PPI является таковой, что любая положительная величина приводит к увеличенному риску присутствия злокачественной опухоли у пациента, в то время как любая отрицательная величина приводит к сниженному риску присутствия злокачественности, но скорее указывает на присутствие незлокачественного очага повреждения в предстательной железе.

T-критерий Стьюдента использовали для определения статистической значимости отличий средних величин экспрессии между различными клиническими группами пациентов. T-критерий Стьюдента указывает на то, что вероятность того, что средняя величина для групп "очаг повреждения + гиперплазия" отличается случайно, равна p=2,28E-11. Для различения между группами "нормальный" и "опухоль": p=0,0003.

Как можно установить из фиг. 12 и 13 и указанных величин p, может быть выявлена высоко значимо отличающаяся экспрессия PDE4D7 человека для нарушенных тканей предстательной железы (очаг повреждения, гиперплазия) по сравнению со злокачественной тканью предстательной железы.

Анализ экспрессии PDE4D7 с помощью рабочей характеристической кривой (ROC)

После этого проводили анализ с помощью рабочей характеристической кривой (ROC) для определения AUC (площадь под кривой) для различных попарных сравнений. Рабочие характеристические кривые для экспрессии гена PDE-4D7 для оценки диагностической мощности представлены на фиг. 14. ROC-анализ обеспечил доказательство того, что дифференциация между доброкачественной и злокачественной тканью предстательной железы на основе уровней экспрессии PDE4D7 возможна со специфичностью (уровень ложноположительных результатов) >80% при чувствительности (уровень ложноотрицательных результатов) ~80%.

Анализ индекса PDE предстательной железы - мультиплексный анализ qPCR PDE4D5 человека и PDE4D7 человека

Для упрощения процедуры тестирования для определения PPI из экспрессии как PDE4D5, так и PDE4D7, был разработан мультиплексный анализ для определения величин CT для обоих генов в единой реакции qPCR.

Использовали те же праймеры и зонды для PDE4D5 и PDE4D7, как указано выше, единственным изменением была отличающаяся флуоресцентная метка зонда для PDE4D5 человека. В частности, краситель FAM зонда заменили на краситель Cy5 (с максимальным испусканием при 670 нм, против максимального испускания при 518 нм FAM), чтобы было можно измерить оба гена в едином мультиплексном анализе qPCR. Праймеры PDE4D5 и PDE4D7 получали от PrimerDesign, UK и они были доставлены с предварительно смешанными зондами.

Было выявлено, что для анализов с предварительно смешанными праймерами/зондами оптимальным является соотношение 1:1,5 PDE4D5:PDE4D7. Авторы изобретения соответственно добавили 1 и 1,5 мкл предварительно смешанных праймеров/зондов для анализа соответственно к общей смеси для ПЦР с конечным анализируемым объемом 30 мкл.

Процедуру ПЦР проводили согласно инструкциям изготовителя: 2 мин при 50°С, 10 мин при 95°C, 15 с при 95°C, 30 с при 50°С при регистрации флуоресценции (FAM & Cy5), 15 с при 72°C и последние три стадии повторяли 50 раз.

T-критерий Стьюдента проводят для определения статистической значимости отличий в средних величинах экспрессии между различными клиническими группами пациентов. T-критерий Стьюдента указывает на то, что вероятность того, что средняя величина для групп "очаг повреждения + гиперплазия" отличается случайно, равна p=5,70E-06.

Как может быть установлено из фиг. 15 и 16 и указанных величин p, можно было выявить высоко значимую отличающуюся экспрессию PDE4D7 человека для нарушенных тканей предстательной железы (очаг повреждения, гиперплазия) по сравнению со злокачественной тканью предстательной железы на основе измерения в мультиплексном анализе для определения индекса PDE предстательной железы.

Анализ экспрессии PDE4D7 с помощью рабочей характеристической кривой (ROC)

После этого проводили анализ с помощью рабочей характеристической кривой (ROC) для определения AUC (площадь под кривой) для различных попарных сравнений. Рабочие характеристические кривые для экспрессии гена PDE-4D7 для оценки диагностической мощности представлены на фиг. 17. ROC-анализ обеспечил доказательство того, что дифференциация между доброкачественной и злокачественной тканью предстательной железы на основе уровней экспрессии PDE возможна со специфичностью (уровень ложноположительных результатов) >80% при чувствительности (уровень ложноотрицательных результатов) ~80%.

Пример 3 - эффект ролипрама на пролиферацию клеток рака предстательной железы

Для анализа Xcelligence клетки LNCaP выращивали при 37°C, 5% CO2, из объема для посева с 5000 клеток. Конечный объем для посева составил 200 мкл. 96-луночные планшеты E-Plate были получены от Roche (каталожный No 05232368001). Данные о росте получали в процессе измерений электрического импеданса в реальном времени. Измерения проводили через 12 часов после первоначальной фазы посева в анализе, т.е. через 12 часов - 60 часов - так чтобы исследовать пролиферативный потенциал, но не морфологическое изменение. Клетки анализировали без присутствия андрогенов. Значимость дифференциальных скоростей роста вычисляли с использованием T-критерия только для величин в трех экземплярах. Как можно установить из фиг. 18, инкубация клеток рака предстательной железы LNCaP с 10 мкМ селективного ингибитора PDE4 ролипрама приводит к значимому подавлению (p<0,01) пролиферации клеток при измерении в реальном времени роста клеток. Уровень среднего ингибирования пролиферации клеток составляет приблизительно 50%, что может привести к IC50 для соединения ~10 мкМ. По сравнению с IC50 in vitro для 50% ингибирования PDE4 in vitro ~2 мкМ, IC50 in vivo, равная 10 мкМ, позволила авторам настоящего изобретения заключить, что эффект ингибирования пролиферации в значительной степени является следствием активности PDE4.

Для анализа роста с помощью MTT клетки LNCaP выращивали при 37°C, 5% CO2, из объема посева 5000 клеток. Конечный объем посева составил 200 мкл. Реагенты для анализа пролиферации были получены от Promega (каталожный no G3582). Данные о росте были получены в ходе измерений A590 Abs. Измерения проводили через 48 часов после первоначального посева. Клетки анализировали в отсутствие андрогенов. Значимость конечных данных A590 вычисляли с использованием T-критерия только для величин в трех экземплярах. Как может быть установлено из фиг. 19 инкубация клеток рака предстательной железы LNCaP с 10 мкМ селективного ингибитора PDE4 ведет к значимому подавлению (p<0,01) пролиферации клеток при конечном измерении роста клеток. Уровень среднего ингибирования пролиферации клеток составляет приблизительно 50%, что может привести к IC50 соединения ~10 мкМ. По сравнению с IC50 in vitro для 50% ингибирования PDE4 in vitro ~2 мкМ, IC50 in vivo, равная 10 мкМ, позволила авторам настоящего изобретения заключить, что эффект ингибирования пролиферации в значительной степени является следствием активности PDE4.

Заявка включает следующие дополнительные варианты осуществления:

Вариант 1: Фосфодиэстераза 4D7 (PDE4D7) для применения в качестве маркера агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы с экспрессией в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

Вариант 2: Композиция для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, содержащая аффинный лиганд в виде нуклеиновой кислоты и/или пептидный аффинный лиганд для продукта экспрессии или белка PDE4D7.

Вариант 3: Композиция согласно варианту 2, где указанный аффинный лиганд в виде нуклеиновой кислоты или пептидный аффинный лиганд модифицирован, чтобы он функционировал в качестве контрастного средства.

Вариант 4: Композиция согласно варианту 2, где указанный аффинный лиганд представляет собой набор олигонуклеотидов, специфичный к продукту экспрессии PDE4D7, зонд, специфичный к продукту экспрессии PDE4D7, аптамер, специфичный к продукту экспрессии PDE4D7 или к белку PDE4D7, антитело, специфичное к белку PDE4D7, и/или вариант антитела, специфичный к белку PDE4D7.

Вариант 5: Применение PDE4D7 в качестве маркера для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы.

Вариант 6: Способ обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, включающий по меньшей мере стадию определения уровня PDE4D7 в образце.

Вариант 7: Способ согласно варианту 6, где стадию определения проводят путем измерения уровней нуклеиновой кислоты или белка или путем определения биологической активности PDE4D7.

Вариант 8: Способ согласно варианту 7, где указанный способ включает дополнительную стадию сравнения измеренных уровней нуклеиновой кислоты или белка или измеренной биологической активности с контрольным уровнем.

Вариант 9: Способ диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, где указанный способ различает между доброкачественным и агрессивным гормон-чувствительным раком предстательной железы, включающий стадии

(a) определение уровня PDE4D7 в образце путем измерения уровня(ей) нуклеиновой кислоты или белка или путем определения биологической активности PDE4D7,

(b) определение уровня экспрессии гена домашнего хозяйства в образце путем измерения уровня(ей) нуклеиновой кислоты или белка или путем определения биологической активности гена домашнего хозяйства, предпочтительно, GAPDH;

(c) нормализация измеренного уровня(ей) нуклеиновой кислоты или белка или измеренной биологической активности PDE4D7 относительно экспрессии гена домашнего хозяйства, предпочтительно, GAPDH; и

(d) сравнение нормализованного уровня экспрессии с заданной пороговой величиной, где указанная пороговая величина составляет приблизительно от 0,1 до 100, предпочтительно, приблизительно 4,7, выбранной так, чтобы исключить доброкачественную опухоль предстательной железы, где нормализованный уровень экспрессии выше пороговой величины указывает на агрессивный гормон-чувствительный рак предстательной железы.

Вариант 10: Способ сбора данных, включающий по меньшей мере стадии:

(a) тестирование индивидуума в отношении экспрессии PDE4D7; и

(b) сравнение экспрессии, определенной на стадии (a), с контрольным уровнем.

Вариант 11: Применение варианта 2 или способа по любому из вариантов 6-10, где диагностику, обнаружение, мониторинг, прогнозирование или получение данных проводят на образце, полученном от индивидуума.

Вариант 12: Иммуноанализ для обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, включающий по меньшей мере стадии

(a) тестирование в образце, полученном от индивидуума, экспрессии PDE4D7,

(b) тестирование в контрольном образце экспрессии PDE4D7,

(c) определение отличий в экспрессии PDE4D7 на стадиях (a) и (b); и

(d) принятие решения о наличии или стадии злокачественной опухоли или прогрессировании злокачественной опухоли, исходя из результатов, полученных на стадии (c),

где указанные стадии тестирования основаны на применении антитела, специфично связывающегося с PDE4D7.

Вариант 13: Применение или способ согласно варианту 11 или иммуноанализ согласно варианту 12, где указанный образец представляет собой образец ткани, биоптат, образец мочи, образец осадка мочи, образец крови, образец слюны, образец семенной жидкости, или образец, содержащий циркулирующие опухолевые клетки.

Вариант 14: Фармацевтическая композиция, содержащая по меньшей мере один элемент, выбранный из группы из:

(a) соединение, непосредственно ингибирующее активность PDE4D7, предпочтительно, антагонист ферментативной активности PDE4D7;

(b) соединение, косвенно ингибирующее активность PDE4D7;

(c) доминантно-негативная форма белка PDE4D7 или ее биологически активный эквивалент;

(d) нуклеиновая кислота, кодирующая и экспрессирующая доминантно-негативную форму PDE4D7;

(e) miРНК, специфичная к PDE4D7;

(f) антисмысловая молекула для PDE4D7;

(g) siРНК, специфичная к PDE4D7;

(h) аптамер, специфичный к продукту экспрессии PDE4D7 или к белку PDE4D7;

(i) низкомолекулярное соединение или пептидомиметик, способные специфично связываться с белком PDE4D7; и

(j) антитело, специфичное к белку PDE4D7, и/или вариант антитела, специфичный к белку PDE4D7.

Вариант 15: Фармацевтическая композиция для лечения или профилактики агрессивного гормон-чувствительного рака предстательной железы, содержащая по меньшей мере один элемент, выбранный из группы:

(a) соединение, непосредственно ингибирующее активность PDE4D7, предпочтительно, антагонист ферментативной активности PDE4D7;

(b) соединение, косвенно ингибирующее активность PDE4D7;

(c) доминантно-негативная форма белка PDE4D7 или ее биологически активный эквивалент;

(d) нуклеиновая кислота, кодирующая и экспрессирующая доминантно-негативную форму PDE4D7;

(e) miРНК, специфичная к PDE4D7;

(f) антисмысловая молекула для PDE4D7;

(g) siРНК, специфичная к PDE4D7;

(h) аптамер, специфичный к продукту экспрессии PDE4D7 или к белку PDE4D7;

(i) низкомолекулярное соединение или пептидомиметик, способные специфично связываться с белком PDE4D7; и

(j) антитело, специфичное к белку PDE4D7, и/или вариант антитела, специфичный к белку PDE4D7;

Вариант 16: Применение

(a) соединения, непосредственно ингибирующего активность PDE4D7, предпочтительно, антагониста ферментативной активности PDE4D7;

(b) соединения, косвенно ингибирующего активность PDE4D7;

(c) доминантно-негативной формы белка PDE4D7 или ее биологически активного эквивалента;

(d) нуклеиновой кислоты, кодирующей и экспрессирующей доминантно-негативную форму PDE4D7;

(e) miРНК, специфичной к PDE4D7;

(f) антисмысловой молекулы для PDE4D7;

(g) siРНК, специфичной к PDE4D7;

(h) аптамера, специфичного к продукту экспрессии PDE4D7 или к белку PDE4D7;

(i) низкомолекулярного соединения или пептидомиметика, способных специфично связываться с белком PDE4D7; и/или

(j) антитела, специфичного к белку PDE4D7, и/или варианта антитела, специфичного к белку PDE4D7,

для получения фармацевтической композиции для лечения или профилактики агрессивного гормон-чувствительного рака предстательной железы.

Вариант 17: Применение антитела, специфичного к белку PDE4D7, и/или варианта антитела, специфичного к белку PDE4D7, для обнаружения, диагностики, мониторинга или прогнозирования злокачественной опухоли или для лечения злокачественной опухоли, предпочтительно, рака предстательной железы, более предпочтительно, агрессивного гормон-чувствительного рака предстательной железы.

Вариант 18: Фосфодиэстераза согласно варианту 1, композиция согласно любому из вариантов 2-4, применение согласно варианту 5, 11 или 13, способ согласно любому из вариантов 6-11 или 13, иммуноанализ согласно любому из вариантов 12 или 13, фармацевтическая композиция согласно варианту 14 или 15, или применение варианта 16 или 17, где указанный агрессивный гормон-чувствительный рак предстательной железы представляет собой гормон-чувствительный рак предстательной железы стадии I-IV, гормон-чувствительный рецидивирующий рак предстательной железы или гормон-чувствительный метастазирующий рак предстательной железы.

1. Применение фосфодиэстеразы 4D7 (PDE4D7) в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы,
где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы и экспрессии в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

2. Применение по п. 1, где указанный агрессивный гормон-чувствительный рак предстательной железы представляет собой гормон-чувствительный рак предстательной железы стадии I-IV, гормон-чувствительный рецидивирующий рак предстательной железы или гормон-чувствительный метастазирующий рак предстательной железы.

3. Применение PDE4D7 в качестве маркера для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или для диагностики, обнаружения, мониторинга или прогнозирования прогрессирования в агрессивный гормон-чувствительный рак предстательной железы,
где PDE4D7 используется как маркер агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы и экспрессии в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

4. Применение по п. 3, где указанный агрессивный гормон-чувствительный рак предстательной железы представляет собой гормон-чувствительный рак предстательной железы стадии I-IV, гормон-чувствительный рецидивирующий рак предстательной железы или гормон-чувствительный метастазирующий рак предстательной железы.

5. Способ обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или диагностики, обнаружения, мониторинга или прогнозирования прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, включающий по меньшей мере:
(a) стадию определения уровня PDE4D7 в образце; и
(b) стадию сравнения уровня, определенного на стадии (а), с контрольным уровнем,
где PDE4D7 используется как маркер агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы и экспрессии в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

6. Способ по п. 5, где указанное тестирование или определение экспрессии проводят или дополнительно проводят измерением уровней нуклеиновой кислоты или белка или путем определения биологической активности PDE4D7 или эталонного гена.

7. Способ по п. 6, где указанный способ или иммуноанализ включает дополнительную стадию сравнения измеренных уровней нуклеиновой кислоты или белка или измеренной биологической активности с контрольным уровнем.

8. Способ по п. 7, где указанный образец представляет собой образец ткани, биоптат, образец мочи, образец осадка мочи, образец крови, образец слюны, образец семенной жидкости, образец, содержащий циркулирующие опухолевые клетки, или образец, содержащий секретируемые предстательной железой экзосомы.

9. Способ по п. 7, где указанный агрессивный гормон-чувствительный рак предстательной железы представляет собой гормон-чувствительный рак предстательной железы стадии I-IV, гормон-чувствительный рецидивирующий рак предстательной железы или гормон-чувствительный метастазирующий рак предстательной железы.

10. Способ диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или диагностики, мониторинга или прогнозирования прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, где указанный способ позволяет отличить доброкачественную опухоль предстательной железы от агрессивного гормон-чувствительного рака предстательной железы, включающий стадии:
(a) определения уровня PDE4D7 в образце;
(b) определения уровня экспрессии эталонного гена в образце;
(c) нормализации измеренного уровня экспрессии PDE4D7 к экспрессии эталонного гена; и
(d) сравнения нормализованного уровня экспрессии с заданной пороговой величиной, выбранной так, чтобы исключить доброкачественную опухоль предстательной железы, где нормализованный уровень экспрессии, который выше пороговой величины, указывает на агрессивный гормон-чувствительный рак предстательной железы, где указанная пороговая величина составляет приблизительно от около -2 до около +2, предпочтительно, приблизительно равна 0,
где PDE4D7 используется как маркер агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы и экспрессии в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

11. Способ по п. 10, где указанный эталонный ген представляет собой другую фосфодиэстеразу, предпочтительно, PDE4D5, или ген домашнего хозяйства, предпочтительно, GAPDH или PBGD.

12. Способ по п. 10, где указанный способ или иммуноанализ включает дополнительную стадию определения уровня специфического антигена предстательной железы (PSA).

13. Способ по п. 12, где уровень PSA от 2,5 до 4 нг/мл указывает на агрессивный гормон-чувствительный рак предстательной железы.

14. Способ получения данных, включающий по меньшей мере стадии:
(a) тестирование у индивидуума экспрессии PDE4D7; и
(b) сравнение экспрессии, определенной на стадии (а), с контрольным уровнем,
где PDE4D7 используется как маркер агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы и экспрессии в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

15. Иммуноанализ для обнаружения, диагностики, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы или для обнаружения, диагностики, мониторинга или прогнозирования прогрессирования в агрессивный гормон-чувствительный рак предстательной железы, включающий по меньшей мере стадии:
(a) тестирование в образце, полученном от индивидуума, экспрессии PDE4D7,
(b) тестирование в контрольном образце экспрессии PDE4D7,
(c) определение отличий в экспрессии PDE4D7 на стадиях (а) и (b); и
(d) принятие решения о наличии или стадии агрессивного гормон-чувствительного рака предстательной железы или прогрессировании в агрессивный гормон-чувствительный рак предстательной железы, исходя из результатов, полученных на стадии (с),
где указанные стадии тестирования основаны на применении антитела, специфично связывающегося с PDE4D7,
где PDE4D7 используется как маркер агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы и экспрессии в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

16. Иммуноанализ по п. 15, где указанный образец представляет собой образец ткани, биоптат, образец мочи, образец осадка мочи, образец крови, образец слюны, образец семенной жидкости, образец, содержащий циркулирующие опухолевые клетки, или образец, содержащий секретируемые предстательной железой экзосомы.

17. Иммуноанализ по п. 15, где указанный агрессивный гормон-чувствительный рак предстательной железы представляет собой гормон-чувствительный рак предстательной железы стадии I-IV, гормон-чувствительный рецидивирующий рак предстательной железы или гормон-чувствительный метастазирующий рак предстательной железы.

18. Иммуноанализ для установления различия доброкачественной опухоли предстательной железы и агрессивного гормон-чувствительного рака предстательной железы, включающий стадии
(a) определения уровня PDE4D7 в образце;
(b) определения уровня экспрессии эталонного гена в образце;
(c) нормализации измеренного уровня экспрессии PDE4D7 к экспрессии эталонного гена; и
(d) сравнения нормализованного уровня экспрессии с заданной пороговой величиной, выбранной так, чтобы исключить доброкачественную опухоль предстательной железы, где нормализованный уровень экспрессии, который выше пороговой величины, указывает на агрессивный гормон-чувствительный рак предстательной железы, где указанная пороговая величина составляет приблизительно от около -2 до около +2, предпочтительно, приблизительно равна 0,
где PDE4D7 используется как маркер агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы и экспрессии в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

19. Иммуноанализ по п. 18, где указанное тестирование или определение экспрессии проводят или дополнительно проводят измерением уровней нуклеиновой кислоты или белка или путем определения биологической активности PDE4D7 или эталонного гена.

20. Иммуноанализ по п. 19, где указанный способ или иммуноанализ включает дополнительную стадию сравнения измеренных уровней нуклеиновой кислоты или белка или измеренной биологической активности с контрольным уровнем.

21. Иммуноанализ по п. 18, где указанный эталонный ген представляет собой другую фосфодиэстеразу, предпочтительно, PDE4D5, или ген домашнего хозяйства, предпочтительно, GAPDH или PBGD.

22. Способ идентификации индивидуума, подходящего для терапии агрессивного гормон-чувствительного рака предстательной железы, включающий:
(a) тестирование в образце, полученном от индивидуума, экспрессии PDE4D7;
(b) тестирование в указанном образце экспрессии эталонного гена и/или в контрольном образце экспрессии PDE4D7, где указанный эталонный ген представляет собой другую фосфодиэстеразу, предпочтительно PDE4D5, или ген домашнего хозяйства, предпочтительно GAPDH или PBGD;
(c) классификацию уровней экспрессии стадии (а) относительно уровней на стадии (b); и
(d) идентификацию индивидуума, который подходит для получения терапии агрессивного гормон-чувствительного рака предстательной железы, где образец индивидуума классифицирован как имеющий увеличенный уровень экспрессии PDE4D7,
где PDE4D7 используется как маркер агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы и экспрессии в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

23. Иммуноанализ для стратификации индивидуума или группы индивидуумов с агрессивным гормон-чувствительным раковым заболеванием предстательной железы, включающий:
(a) тестирование в образце, полученном от индивидуума, экспрессии PDE4D7;
(b) тестирование в указанном образце экспрессии эталонного гена и/или в контрольном образце экспрессии PDE4D7, где указанный эталонный ген представляет собой другую фосфодиэстеразу, предпочтительно PDE4D5, или ген домашнего хозяйства, предпочтительно GAPDH или PBGD;
(c) определение отличий в экспрессии PDE4D7 на стадиях (а) и экспрессии PDE4D7 и/или эталонного гена на стадии (b); и
(d) стратификацию индивидуума или группы индивидуумов для терапии агрессивного гормон-чувствительного рака предстательной железы исходя из результатов, полученных на стадии (с), где образец индивидуума имеет повышенный уровень экспрессии PDE4D7,
где PDE4D7 используется как маркер агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы и экспрессии в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

24. Иммуноанализ по п. 23, где указанный способ или иммуноанализ включает дополнительную стадию определения уровня простатспецифического антигена (PSA).

25. Иммуноанализ по п. 24, где уровень PSA от 2,5 до 4 нг/мл указывает на агрессивный гормон-чувствительный рак предстательной железы.

26. Применение по меньшей мере одного элемента, выбранного из группы:
(a) доминантно-негативная форма белка PDE4D7 или ее биологически активный эквивалент;
(b) нуклеиновая кислота, кодирующая и экспрессирующая доминантно-негативную форму PDE4D7;
для получения ингибиторной фармацевтической композиции для лечения или профилактики агрессивного гормон-чувствительного рака предстательной железы,
где указанная фармацевтическая композиция используется для лечения рака предстательной железы в зависимости от экспрессии уровня PDE4D7, где указанный уровень экспрессии определяют и/или проводят мониторинг в соответствии со следующими стадиями (а)-(с):
(a) определения уровня PDE4D7 в образце;
(b) определения уровня экспрессии эталонного гена в образце;
(c) нормализации измеренного уровня экспрессии PDE4D7 к экспрессии эталонного гена;
где PDE4D7 используется как маркер агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы и экспрессии в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

27. Применение по п. 26, где в случае увеличенных и/или увеличивающихся уровней PDE4D7 вводят указанную ингибиторную фармацевтическую композицию.

28. Применение по п. 26, где указанный агрессивный гормон-чувствительный рак предстательной железы представляет собой гормон-чувствительный рак предстательной железы стадии I-IV, гормон-чувствительный рецидивирующий рак предстательной железы или гормон-чувствительный метастазирующий рак предстательной железы.

29. Стимулирующая фармацевтическая композиция для лечения или профилактики агрессивного гормон-чувствительного рака предстательной железы, отличающаяся тем, что содержит по меньшей мере один элемент, выбранный из группы:
(a) белок PDE4D7 или его биологически активный эквивалент;
(b) нуклеиновая кислота, кодирующая и экспрессирующая PDE4D7;
где указанная стимулирующая фармацевтическая композиция используется для лечения рака предстательной железы в зависимости от экспрессии уровня PDE4D7, где указанный уровень экспрессии определяют и/или проводят мониторинг в соответствии со следующими стадиями (а)-(с):
(a) определения уровня PDE4D7 в образце;
(b) определения уровня экспрессии эталонного гена в образце;
(c) нормализации измеренного уровня экспрессии PDE4D7 к экспрессии эталонного гена;
где PDE4D7 используется как маркер агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы и экспрессии в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

30. Способ по п. 22 и иммуноанализа по п. 23, где терапия рака предстательной железы включает введение фармацевтической композиции по п. 26 в комбинации с дополнительной терапией злокачественной опухоли, предпочтительно, лучевой терапией или химиотерапией.

31. Применение антитела, специфичного к белку PDE4D7, и/или варианта антитела, специфичного к белку PDE4D7, для обнаружения, диагностики, мониторинга или прогнозирования злокачественной опухоли или для лечения агрессивного гормон-чувствительного рака предстательной железы, где вариант антитела, специфичный в отношении белка PDE4D7, представляет собой вариант моноклонального или поликлонального антитела или фрагмента, предпочтительно, одноцепочечное антитело, диатело, миниантитело, scFv, антитело sc(Fv)2, Fab-фрагмент или F(ab')2-фрагмент, основанные на моноклональном специфическом в отношении PDE4D7 антителе, иммунопрепараты на основе модульного белка с малым размером молекул (SMIP), слитые белки связывающего домена иммуноглобулина, камелизованные антитела или содержащие VHH антитела,
где PDE4D7 используется как маркер агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера увеличена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы и экспрессии в нормальной ткани или ткани доброкачественной опухоли предстательной железы.

32. Применение по п. 31, где указанный агрессивный гормон-чувствительный рак предстательной железы представляет собой гормон-чувствительный рак предстательной железы стадии I-IV, гормон-чувствительный рецидивирующий рак предстательной железы или гормон-чувствительный метастазирующий рак предстательной железы.



 

Похожие патенты:

Изобретение относится к области биохимии. Заявлен способ молекулярно-генетического внутривидового типирования Vibrio cholerae O1 и O139 серогрупп.

Изобретение относится к области биотехнологии, а именно к способу определения эффективной терапевтической дозы противоэпилептического препарата и риска развития побочных эффектов.

Изобретение относится к области биотехнологии, в частности к набору синтетических олигонуклеотидов для выявления видовой принадлежности володушки многожильчатой (Bupleurum multinerve DC.), включающий проведение полимеразной цепной реакции с фрагментом ITS2 ядерной ДНК.

Биомаркер // 2573925
Изобретение относится к области биотехнологии, конкретно к маркерам рака, и может быть использовано в медицине. Выявление белка Engrailed-2 (EN2) или кодирующей его нуклеиновой кислоты в образце тканей мочевого пузыря или мочи от пациента может быть использовано в диагностике рака мочевого пузыря или для идентификации пациента, имеющего риск развития рака мочевого пузыря, а также для мониторинга прогрессирования рака мочевого пузыря у пациента или мониторинга эффективности лечения рака мочевого пузыря.

Изобретение относится к области генной инженерии, конкретно к получению натрийуретического пептида C-типа (CNP), и может быть использовано в медицине. Получают пептид структуры PGQEHPNARKYKGANKKGLSKGCFGLKLDRIGSMSGLGC (Pro-Gly-CNP37), который используют для лечения дегенеративных костных патологий, отвечающих на CNP.

Изобретение относится к области биохимии, в частности к способу определения зиготности растения сои, включающего арилоксиалканоатдиоксигеназу (AAD-12) с SEQ ID NO: 1, где указанное растение содержит трансгенную конструкцию, включающую ген AAD-12, состоящий из остатков 2731-9121 SEQ ID NO: 1, и указанная трансгенная конструкция фланкирована 5′-фланкирующей геномной ДНК сои и 3′-фланкирующей геномной ДНК сои, где указанная 5′-фланкирующая геномная ДНК содержит остатки 1-2730 SEQ ID NO: 1, указанная 3′-фланкирующая геномная ДНК содержит остатки 9122-10212 SEQ ID NO: 1, а также к комплекту для его выполнения.

Группа изобретений относится к области молекулярной биологии. Сущность изобретения состоит в подавлении активности активированного онкогена AML-ETO методом РНК-интерференции в злокачественных кроветворных клетках, полученных от больных лейкозом, с использованием конструкции малой шпилечной РНК, встроенной в лентивирусный вектор pLSLP-AML-ETO-shRNA, кодируемой нуклеотидной последовательностью двухцепочечной ДНК, представляющей собой: 5′-р-gatccgCCTCGAAATCGTACTGAGActtcctgcaa TCTCAGTACGATTTCGAGGtttttg-3′ (смысловая цепь), 5′-р-aattcaaaaaCCTCGAAATCGTACT GAGAttgcaggaagTCTCAGTACGATTTCGAGGcg-3′ (антисмысловая цепь).

Изобретение относится к биотехнологии и касается библиотеки нуклеотидных последовательностей в составе клонировочного плазмидного вектора. Целью изобретения является конструирование олигонуклеотидных праймеров для получения библиотеки полноразмерных генов, кодирующих иммунодоминантные белки р17, р30, р54, р60, р72 вируса АЧС.

Изобретение относится к области биотехнологии, а именно к набору для выявления ДНК вируса оспы свиней методом полимеразной цепной реакции в реальном времени. Набор включает олигонуклеотидные праймеры и флуоресцентно-меченый зонд следующего состава: SPVU - 5' - gta сса ttt tgg agg аса cg - 3', SPVD - 5' - ttc aat aaa tcg cca gtt gta с - 3', SPVZ - 5'- [FAM] ggt acc ata tct ata tat ccc tgt tg [BHQ1] - 3'.

Изобретение относится к области биотехнологии. Способ обнаружения вещества, которое опосредует положительную регуляцию транскрипции гена биологического маркера, или определения, опосредует ли вещество положительную регуляцию транскрипции гена биологического маркера, состоит из следующих этапов: обеспечение первой системы анализа, включающей последовательность мРНК, которая содержит область, кодирующую первый репортерный белок, функционально связанную с промотором первого биологического маркера; обеспечение второй системы анализа, включающей вторую последовательность мРНК, которая содержит область, кодирующую второй репортерный белок, функционально связанную с промотором второго биологического маркера; осуществление контакта указанной второй системы анализа с веществом; осуществления контакта указанной первой системы анализа со стандартным веществом или контрольным веществом и определение уровней транскрипции указанных первой и второй последовательностей мРНК.

Изобретение относится к биотехнологии. Предложен способ получения (3aS,7aR)-гексагидроизобензофуран-1(3Н)-она.

Изобретение относится к биотехнологии и представляет собой молекулу ДНК, которая кодирует полипептид, обладающий фосфолипазной активностью, по существу без липазной активности, причем последовательность молекулы ДНК предпочтительно происходит из Aspergillus и более предпочтительно из Aspergillus fumigatus.

Изобретение относится к биотехнологии и представляет собой новую фитазу с повышенной термостабильностью. Изобретение касается также применения фитазы в корме для животных для снижения содержания фосфата в навозе, а также в кормовых добавках и кормах для животных.

Изобретение относится к области молекулярной биологии, биохимии и генной инженерии. Предложены нуклеиновая кислота, характеризующаяся нуклеотидной последовательностью, кодирующей белок, который состоит из аминокислотной последовательности с делецией, заменой или добавлением одной или более аминокислот в аминокислотной последовательности SEQ ID NO: 2 или SEQ ID NO: 7 и обладает активностью фосфатазы фосфатидной кислоты, соответствующий белок, рекомбинантный вектор, клетка для экспрессии белка и способ получения композиции жирной кислоты.
Изобретение относится к биотехнологии. Предложен ферментный биокатализатор в виде наноразмерных частиц для детоксификации фосфорорганических соединений in vivo.

Настоящее изобретение относится к области биотехнологии и может быть использовано в пищевой промышленности. Из Mortierella alpina получен новый ген, который кодирует фосфатазу фосфатидной кислоты (ЕС 3.1.3.4), определена открытая рамка считывания и выведена аминокислотная последовательность фермента, названного MaPAP1.

Изобретение относится к области биотехнологии и представляет собой штамм бактерий Bacillus subtilis ВКПМ В-11270 - продуцент фермента фосфолипазы C. При ферментации полученного штамма в 3 л лабораторном ферментере в минимальной среде при температуре 30°C, активность фермента в культуральной жидкости достигает уровня 210 ЕД/мл.
Изобретение относится к фармацевтической промышленности, а именно к способу получения плацентарной щелочной фосфатазы. Способ получения плацентарной щелочной фосфатазы заключается в том, что гомогенизируют отмытую от крови плаценту человека, экстрагируют гомогенат в растворе хлорида калия, центрифугируют полученный экстракт, прогревают, центрифугируют, полученный надосадок после первичного прогревания экстракта повторно прогревают в присутствии сульфата кадмия с последующим быстрым охлаждением колбы, добавляют сульфат аммония, отделяют осадок центрифугированием, надосадочную жидкость подвергают гидрофобной хроматографии на колонке, а ферментсодержащий элюат подвергают очистке препаративным электрофорезом в полиакриламидном геле, окрашивают гель, содержащий фермент, и под визуальным контролем, вырезают окрашенные фракции щелочной фосфатазы.

Изобретение относится к области биотехнологии. .

Изобретение относится к области биотехнологии. .

Изобретение относится к области биохимии, в частности к молекулам нуклеиновой кислоты для модуляции экспрессии генов-мишеней. Заявлена двухцепочечная молекула нуклеиновой кислоты для ингибирования экспрессии гена белка теплового шока 47 (hsp47).
Наверх