Набор синтетических олигонуклеотидов для выявления видовой принадлежности володушки многожильчатой (bupleurum multinerve dc.)


 


Владельцы патента RU 2573937:

федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Алтайский государственный университет" (RU)

Изобретение относится к области биотехнологии, в частности к набору синтетических олигонуклеотидов для выявления видовой принадлежности володушки многожильчатой (Bupleurum multinerve DC.), включающий проведение полимеразной цепной реакции с фрагментом ITS2 ядерной ДНК. При этом для идентификации используют видоспецифичные участки для создания прямого, обратного праймеров и разрушаемого зонда, где в качестве прямого праймера - последовательность ДНК со следующим нуклеотидным составом: 5′-TATCCCGGCTCTCGCATCGA-3′; обратного праймера - последовательность ДНК со следующим нуклеотидным составом: 5′-GACGAGGCACGGGAGGTCAG-3′, разрушаемого зонда последовательность ДНК со следующим нуклеотидным составом: (флуоресцентная метка)-5′-CCGTGAACCATCGAGTTTTT-3′-(гаситель). Изобретение позволяет эффективно идентифицировать видовую принадлежность володушки многожильчатой (Bupleurum multinerve DC.) в ходе проведения скрининга растительного сырья. 1 ил., 1 пр.

 

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии. Использование набора синтетических олигонуклеотидов позволяет достоверно идентифицировать видовую принадлежность лекарственного растения володушки многожильчатой (Bupleurum multinerve DC.). Изобретение может быть использовано для выявления видовой принадлежности данного растения; в ходе проведения скрининга растительного сырья, для контроля на соответствие состава, декларированного производителем.

Среди большого количества методов генодиагностики с целью идентификации присутствия ДНК интересующего вида растений в образце, в качестве основы нашего изобретения был принят формат ПЦР с детекцией в режиме реального времени на основе разрушаемого зонда. ПЦР в реальном времени имеет преимущество перед обычными ПЦР-системами идентификации - отсутствие необходимости последующего анализа, что минимизирует риск контаминации в лаборатории. Характерна также повышенная чувствительность и отсутствие ложноположительного результата при неспецифичном отжиге праймеров. Кроме того, следует отметить обеспеченность практически всех молекулярно-генетических диагностических лабораторий оборудованием, необходимым для проведения ПЦР с детекцией в режиме реального времени и широкое использование метода в клинической диагностике и органами госконтроля.

На основе анализа возможных методов детекции продукта полимеразной цепной реакции нами выбран метод на основе разрушаемого зонда, на основе того, что он относится к специфичным методам детекции, возможности свободного его использования без нарушения авторских и смежных прав (первоначально система разрушаемого зонда предложена и 1991 году, при этом все патенты на настоящий момент закончили свое действие).

Техническим результатом заявляемого изобретения является разработка праймеров и разрушаемых зондов на основе данных видоспецифичных нуклеотидных последовательностей ядерной ДНК растений. В качестве видоспецифичных участков нами используется ITS2 фрагмент ядерной ДНК (internal transcribed spacer 2), обладающий большой копийностью в геноме [Alvarez, I. & Wendel, J.F. (2003) Ribosomal ITS sequences and plant phylogenetic inference // Mol. Phylogenet. Evol. 29, 417-434], и используемый в проектировании системы ДНК-баркодинга. В этом регионе показана высокая вариабельность и потенциальная применимость в качестве маркерного участка [Stoeckle, Μ. (2003) Use of DNA barcodes to identify flowering plants // Bioscience 53, 2-3].

Прототип - рассмотрим идентификацию лекарственных растений с использованием фрагмента ITS2, амплифицированного специфичными праймерами [Chiou SJ, Yen JH, Fang CL, Chen HL, Lin TY Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers // Planta Med. 2007, Oct; 73(13): 1421-6. Epub 2007 Oct 1]. В прототипе используются специфичные наборы праймеров BEL-1/BEL-3 и BEL-2/BEL-3 для амплификации ITS2 участка рДНК 55 лекарственных растений.

Принципиальные отличия прототипа от заявленного изобретения следующие: идентифицируются лекарственные растения с нуклеотидными последовательностями специфичных праймеров, отличные от заявленных. Набор синтетических олигонуклеотидов для выявления видовой принадлежности лекарственного растения - володушки многожильчатой (Bupleurum multinerve DC.), предназначенный для проведения полимеразной цепной реакции фрагмента ITS2 ядерной ДНК, включающий для идентификации данного растения видоспецифичные праймеры прямой, обратный праймеры и разрушаемый зонд:

в качестве прямого праймера используется последовательность ДНК со следующим нуклеотидным составом: 5′-TATCCCGGCTCTCGCATCGA-3′,

в качестве обратного праймера используется последовательность ДНК со следующим нуклеотидным составом: 5′-GACGAGGCACGGGAGGTCAG-3′,

в качестве разрушаемого зонда используется последовательность ДНК со следующим нуклеотидным составом: (флуоресцентная метка)-5′-CCGTGAACCATCGAGTTTTT-3′-(гаситель).

Работа над созданием праймеров строится следующим образом.

1) С помощью открытых и коммерческих баз данных нуклеотидных последовательностей различных видов растений либо в результате самостоятельного определения нуклеотидной последовательности растений выбирается участок генома, встречающийся у всех видов.

2) На основании выбранного участка генома с помощью специального программного обеспечения или вручную подбирается последовательность олигонуклеотидов, используемых для проведения ПНР-реакции (2 праймера и зонд). На данном этапе работа заключается в создании выравнивания многих последовательностей и выборе участка последовательности, где присутствуют отличия для создания прямого, обратного праймеров и зонда. Выравнивание геномных последовательностей означает сравнение последовательностей многих видов друг с другом, поиск гомологичных для растений участков.

3) Изготовление праймеров и зонда производится на автоматических синтезаторах.

4) С помощью практических экспериментов доказывается пригодность подобранных последовательностей для конкретных целей.

Анализ нуклеотидного полиморфизма последовательности ITS2 на основании данных NCBI () и секвенированных de novo последовательностей видов, не размещенных в генбанке, позволяет применить данные последовательности в качестве основы для создания праймеров. Для детекции накопления продукта ПЦР в ходе реакции используют технологию с разрушаемым зондом (Holland Ρ Μ, Abramson R D, Watson R, Gelfand D H. Detection of specific polymerase chain reaction product by utilizing the 5′-3′ exonuclease activity of Thermus aquaticus DNA polymerase. // Proc Natl Acad Sci USA. 1991 August 15; 88(16): 7276-7280).

В качестве флуоресцентной метки используют, например, FAM, в качестве гасителя BHQ1 (возможны другие комбинации флуорофоров и гасителей, и это не является предметом охраны авторских прав).

Аналогичные наборы, реакционные смеси, праймеры для амплификации и выявления видовой принадлежности володушки многожильчатой (Bupleurum multinerve DC.) неизвестны.

Ход работы с применением набора синтетических олигонуклеотидов для амплификации состоит из следующих шагов.

Пример

1) Растительный материал перед проведением ПЦР с помощью заявляемого набора проводится через процедуру пробоподготовки с использованием набора Diamont DNA kit, в соответствии с инструкцией производителя; в ходе этой процедуры из растительного материала выделяется ДНК, которую в свою очередь используют для ПЦР.

2) Полимеразную цепную реакцию проводят на амплификаторе CFX96 (Bio-Rad, USA). Амплификация проводится по следующей программе: 1 цикл: 95°С - 3 мин; 40 циклов: 95°С - 10 сек, 58°С - 30 сек (на данной стадии производится сканирование уровня флуоресценции). Инкубационная смесь, конечным объемом 25 мкл, содержит: 14,1 мкл H2O; 2 мкл ДНК; 2,5 мкл 10Х буфер; 2,5 мкл 25 мМ MgCl2; по 1 мкл 10 мМ каждого праймера; 0,5 мкл. зонда; 1,2 мкл 20 мМ dNTPs; 0,2 мкл Taq-полимеразы. Результат амплификации определяют по нарастанию уровня флуоресценции, рис. 1.

Набор синтетических олигонуклеотидов для выявления видовой принадлежности лекарственного растения - володушки многожильчатой (Bupleurum multinerve DC.), предназначенный для проведения полимеразной цепной реакции с детекцией в режиме реального времени.). Набор включает видоспецифичные участки для создания прямого, обратного праймеров и разрушаемого зонда, а именно прямой праймер 5′-TATCCCGGCTCTCGCATCGA-3′, обратный праймер 5′-GACGAGGCACGGGAGGTCAG-3′, в качестве разрушаемого зонда (флуоресцентная метка)-5′-CCGTGAACCATCGAGTTTTT-3′-(гаситель). Набор обладает высокой чувствительностью и специфичностью, позволяющий быстро и достоверно провести идентификацию рассмотренного лекарственного растения.

Набор синтетических олигонуклеотидов для выявления видовой принадлежности володушки многожильчатой (Bupleurum multinerve DC.), включающий проведение полимеразной цепной реакции с фрагментом ITS2 ядерной ДНК, отличающийся тем, что для идентификации используют видоспецифичные участки для создания прямого, обратного праймеров и разрушаемого зонда, где в качестве прямого праймера - последовательность ДНК со следующим нуклеотидным составом: 5′-TATCCCGGCTCTCGCATCGA-3′; обратного праймера - последовательность ДНК со следующим нуклеотидным составом: 5′-GACGAGGCACGGGAGGTCAG-3′, разрушаемого зонда последовательность ДНК со следующим нуклеотидным составом: (флуоресцентная метка)-5′-CCGTGAACCATCGAGTTTTT-3′-(гаситель).



 

Похожие патенты:

Биомаркер // 2573925
Изобретение относится к области биотехнологии, конкретно к маркерам рака, и может быть использовано в медицине. Выявление белка Engrailed-2 (EN2) или кодирующей его нуклеиновой кислоты в образце тканей мочевого пузыря или мочи от пациента может быть использовано в диагностике рака мочевого пузыря или для идентификации пациента, имеющего риск развития рака мочевого пузыря, а также для мониторинга прогрессирования рака мочевого пузыря у пациента или мониторинга эффективности лечения рака мочевого пузыря.

Изобретение относится к области генной инженерии, конкретно к получению натрийуретического пептида C-типа (CNP), и может быть использовано в медицине. Получают пептид структуры PGQEHPNARKYKGANKKGLSKGCFGLKLDRIGSMSGLGC (Pro-Gly-CNP37), который используют для лечения дегенеративных костных патологий, отвечающих на CNP.

Изобретение относится к области биохимии, в частности к способу определения зиготности растения сои, включающего арилоксиалканоатдиоксигеназу (AAD-12) с SEQ ID NO: 1, где указанное растение содержит трансгенную конструкцию, включающую ген AAD-12, состоящий из остатков 2731-9121 SEQ ID NO: 1, и указанная трансгенная конструкция фланкирована 5′-фланкирующей геномной ДНК сои и 3′-фланкирующей геномной ДНК сои, где указанная 5′-фланкирующая геномная ДНК содержит остатки 1-2730 SEQ ID NO: 1, указанная 3′-фланкирующая геномная ДНК содержит остатки 9122-10212 SEQ ID NO: 1, а также к комплекту для его выполнения.

Группа изобретений относится к области молекулярной биологии. Сущность изобретения состоит в подавлении активности активированного онкогена AML-ETO методом РНК-интерференции в злокачественных кроветворных клетках, полученных от больных лейкозом, с использованием конструкции малой шпилечной РНК, встроенной в лентивирусный вектор pLSLP-AML-ETO-shRNA, кодируемой нуклеотидной последовательностью двухцепочечной ДНК, представляющей собой: 5′-р-gatccgCCTCGAAATCGTACTGAGActtcctgcaa TCTCAGTACGATTTCGAGGtttttg-3′ (смысловая цепь), 5′-р-aattcaaaaaCCTCGAAATCGTACT GAGAttgcaggaagTCTCAGTACGATTTCGAGGcg-3′ (антисмысловая цепь).

Изобретение относится к биотехнологии и касается библиотеки нуклеотидных последовательностей в составе клонировочного плазмидного вектора. Целью изобретения является конструирование олигонуклеотидных праймеров для получения библиотеки полноразмерных генов, кодирующих иммунодоминантные белки р17, р30, р54, р60, р72 вируса АЧС.

Изобретение относится к области биотехнологии, а именно к набору для выявления ДНК вируса оспы свиней методом полимеразной цепной реакции в реальном времени. Набор включает олигонуклеотидные праймеры и флуоресцентно-меченый зонд следующего состава: SPVU - 5' - gta сса ttt tgg agg аса cg - 3', SPVD - 5' - ttc aat aaa tcg cca gtt gta с - 3', SPVZ - 5'- [FAM] ggt acc ata tct ata tat ccc tgt tg [BHQ1] - 3'.

Изобретение относится к области биотехнологии. Способ обнаружения вещества, которое опосредует положительную регуляцию транскрипции гена биологического маркера, или определения, опосредует ли вещество положительную регуляцию транскрипции гена биологического маркера, состоит из следующих этапов: обеспечение первой системы анализа, включающей последовательность мРНК, которая содержит область, кодирующую первый репортерный белок, функционально связанную с промотором первого биологического маркера; обеспечение второй системы анализа, включающей вторую последовательность мРНК, которая содержит область, кодирующую второй репортерный белок, функционально связанную с промотором второго биологического маркера; осуществление контакта указанной второй системы анализа с веществом; осуществления контакта указанной первой системы анализа со стандартным веществом или контрольным веществом и определение уровней транскрипции указанных первой и второй последовательностей мРНК.

Изобретение относится к биотехнологии и представляет собой выделенную нуклеиновую кислоту для типирования и/или маркировки штаммов Bifidobacterium lactis, состоящую из последовательности локуса CRISPR В.lactis, выбранной из группы, состоящей из a) Balal (SEQ ID NO: 1); b) последовательности повтора Balal, выбранной из последовательности SEQ ID NO: 2 и ее вариантов; c) последовательности спейсера Balal, выбранной из SEQ ID NO:3-24; где варианты последовательности SEQ ID NO: 2 выбраны из группы, состоящей из: замены Т в положении 12, замены Т в положении 14 и замены А в положении 36.
Изобретение относится к биотехнологии, а именно к способу диагностики хронической сердечной недостаточности (ХСН). Способ включает исследование крови человека методом полимеразной цепной реакции с гибридизационно-флуоресцентной детекцией продуктов амплификации.
Изобретение относится к биотехнологии, а именно к способу диагностики хронической сердечной недостаточности (ХСН). Способ включает исследование крови человека методом полимеразной цепной реакции с гибридизационно-флуоресцентной детекцией продуктов амплификации.

Изобретение относится к области биотехнологии, а именно к способу определения эффективной терапевтической дозы противоэпилептического препарата и риска развития побочных эффектов. Способ включает забор биологического материала, проведение полимеразной цепной реакции по генам-кандидатам, последующий анализ их аллельных вариантов и, путем сопоставления выявленного аллельного полиморфизма с данными о его влиянии на эффективную терапевтическую дозу и возникновении побочных эффектов, расчет эффективной терапевтической дозы противоэпилептического препарата и определение риска развития побочных эффектов. Предложенное изобретение позволяет с высокой точностью определять эффективную терапевтическую дозу и наличие риска развития побочных эффектов. 4 з.п. ф-лы, 5 табл., 2 пр.

Изобретение относится к области биохимии. Заявлен способ молекулярно-генетического внутривидового типирования Vibrio cholerae O1 и O139 серогрупп. Способ включает выделение ДНК из исследуемого штамма V. cholerae серогруппы O1 или O139, постановку ПЦР со специфическими праймерами и учет реакции путем электрофореза. Амплификацию исследуемой ДНК проводят сконструированными специфическими праймерами к каждому из шести INDEL-генов, а именно к генам ompU, 1606, eamA, 096, CoA и cheA, каждый из которых имеет по две дискриминируемых аллели. Учет результатов типирования проводят как визуальную идентификацию после электрофореза, причем для каждого исследуемого штамма устанавливают уникальный INDEL-генотип по двум или большему числу INDEL-генов. Путем сравнения выявленных INDEL-генотипов устанавливают общее или различное происхождение исследуемых штаммов V.cholerae O1 и O139 серогрупп. Изобретение позволяет выявлять уникальные генетические маркеры штаммов V.cholerae серогрупп O1 и O139, что может быть использовано в практике работы специализированных учреждений, занимающихся мониторингом за холерой. 1 ил., 4 табл., 3 пр.

Настоящее изобретение относится к фосфодиэстеразе 4D7 (PDE4D7) для применения в качестве маркера для агрессивного гормон-чувствительного рака предстательной железы, где экспрессия маркера повышена при сравнении экспрессии в ткани агрессивного гормон-чувствительного рака предстательной железы с экспрессией в нормальной ткани или ткани доброкачественной опухоли предстательной железы, и к применению PDE4D7 в качестве диагностического маркера для агрессивного гормон-чувствительного рака предстательной железы. Также настоящее изобретение относится к композиции для диагностики, обнаружения, мониторинга или прогнозирования агрессивного гормон-чувствительного рака предстательной железы, к соответствующему способу обнаружения, к способу, позволяющему различить доброкачественный и агрессивный гормон-чувствительный рак предстательной железы, и к способу сбора данных, а также к соответствующим иммуноанализам. Также настоящее изобретение относится к способу идентификации индивидуума, соответствующего требованиям для агрессивного гормон-чувствительного рака предстательной железы, а также к иммуноанализу для стратификации индивидуума с таким раком предстательной железы. Кроме того, настоящее изобретение относится к фармацевтическим композициям и к их применению для лечения агрессивного гормон-чувствительного рака предстательной железы. Изобретение позволяет эффективно диагносцировать гормон-чувствительный рак предстательной железы. 12 н. и 20 з.п. ф-лы, 19 ил., 2 табл., 3 пр.

Изобретение относится к области биотехнологии, а именно к способу выявления РНК вируса бешенства и набору, который используется в данном способе. Способ включает проведение ОТ-ПЦР с олигонуклеотидными праймерами. Праймеры имеют следующие нуклеотидные последовательности: fp_850_gp_rabv 5' TTAGACTTATGGATGGAACATGGGT 3', rp_850_gp_rabv 5' AGTGACTGACACCTCCCTCCCT 3', fp_350_gp_rabv 5'TCAGACGAAATTGAGCACCTTGT3', rp_350_gp_rabv 5'ACCTCCCCCCAACTCTTAAACA3'. ОТ-ПЦР проводят в два раунда, при этом в случае положительной реакции синтезируется фрагмент, соответствующий размеру в первом раунде - 755 п.н., во втором - размеру 259 п.н. Предложенное изобретение позволяет проводить выявление РНК штаммов и изолятов вируса бешенства различного происхождения на ранних этапах клинического проявления, а также снизить себестоимость диагностики. 2 н.п. ф-лы, 2 ил., 3 табл., 4 пр.

Настоящее изобретение относится к биотехнологии и представляет собой способ мониторинга экспрессии представляющего интерес гена полипептида CADM1, Rb, ZMYND10, RASSF5, PTEN, SERPINB5, EPB41L3 или DAPK1 для определения терапевтического эффекта соединения при лечении заболевания, связанного с экспрессией указанного представляющего интерес гена полипептида. Для осуществления указанного способа в клетку методом трансфекции с помощью липосомных капсул вводят молекулу нуклеиновой кислоты, содержащую промоторную последовательность, функционально связанную с последовательностью, кодирующей указанный представляющий интерес ген полипептида, и с последовательностью, кодирующей флуоресцентный полипептид-репортер. Затем проводят контактирование клетки с исследуемым соединением. До и после указанного контактирования проводят детекцию флуоресцентного полипептида-репортера в указанной клетке неинвазивным способом формирования оптического изображения и определяют изменение экспрессии указанного представляющего интерес гена, индуцированного указанным соединением. В качестве исследуемого соединения может быть использована РНКи, структура которой соответствует одному представляющему интерес гену, для выявления самой эффективной РНКи для лечения заболевания. Настоящее изобретение позволяет определять характер экспрессии в течение времени воздействия определенным препаратом и оперативно корректировать ход течения болезни. 3 н.п. ф-лы, 1 ил., 1 пр.

Изобретение относится к биохимии. Описан способ получения кукурузного растения с улучшенной оптимизаций водопотребления и растение, полученное таким способом. Изобретение позволяет получать растения, обладающие повышенной засухоустойчивостью. 3 н. и 11 з.п. ф-лы, 6 ил., 13 табл., 13 пр.

Изобретение относится к области медицины и предназначено для ПЦР-диагностики гена резус-фактора плода по крови беременной женщины. Предложен набор с лиофилизированными праймерами, содержащий готовые к амплификации реакционные пробирки с лиофилизированными праймерами и праймерами-зондами для экзонов RHD-5 и RHD-7 гена RHD. Все смеси в реакционных пробирках подготовлены для реакции в необходимых объемах, подвергнуты заморозке в жидком азоте, затем высушены по программе лиофилизации. Изобретение обеспечивает создание набора, эффективного для ПЦР-диагностики гена резус-фактора плода по крови беременной женщины с увеличенным сроком годности, с возможностью транспортировки в дальние регионы без строгого соблюдения температурного режима. 1 табл.

Изобретение относится к области биотехнологии, а именно к способу поиска белков-мишеней, запускающих процесс канцерогенеза, в образцах тканей индивидуального пациента, для последующей противоопухолевой фармакотерапии. Определяют методом секвенирования транскриптомные данные об уровнях экспрессии генов в образцах. Получают набор активированных генно-регуляторных сетей, состоящих из центрального гена регулятора и регулируемых им генов. Определяют из транскриптомных данных дифференциально экспрессированные гены. Определяют методами секвенирования изменения в последовательностях ДНК, представленных в виде набора однонуклеотидных полиморфизмов в образцах. Определяют среди найденных генетических вариантов гены-драйверы. Проводят поиск канонических сигнальных путей, значимо обогащенных ранее найденными центральными генами регуляторами экспрессии, дифференциально экспрессированными генами, генами с идентифицированными однонуклеотидными полиморфизмами и инделами, генами-драйверами. Проводят поиск методом перебора в составе идентифицированных сигнальных путей существующих белков-мишеней для лекарственных препаратов, предназначенных для противоопухолевой терапии. Предложенное изобретение позволяет с высокой эффективностью найти белки-мишени, запускающие процесс канцерогенеза, в образцах тканей индивидуального пациента. 1 ил., 5 табл.

Изобретение относится к области биохимии, в частности к способу определения зиготности растения кукурузы, содержащего трансгенную конструкцию, содержащую ген арилоксиалканоатдиоксигеназы, где указанный способ включает: получение образца геномной ДНК от указанного растения кукурузы; получение приведенного в контакт образца посредством контактирования указанного образца ДНК с первым праймером и вторым праймером и флуоресцентным зондом, определение зиготности указанного растения кукурузы, а также к набору для его осуществления. Изобретение позволяет эффективно определять зиготность растения кукурузы, содержащего ген арилоксиалканоатдиоксигеназы. 2 н. и 13 з.п. ф-лы, 3 ил., 1 табл., 1 пр.

Предложенная группа изобретений относится к области медицины. Предложен способ прогнозирования у пациента с влажной возрастной дегенерацией желтого пятна (AMD) повышенной вероятности эффекта от лечения высокоаффинным антителом против VEGF, в частности, ранибизумабом. Предложен набор, содержащий первый олигонуклеотид и вторые олигонуклеотиды, специфичные для аллелей полиморфизма гена BATF, соответствующего rs175714. Если генотип содержит АА или AG, у пациента прогнозируют повышенную вероятность эффекта от указанного лечения. Предложенная группа изобретений обеспечивает эффективные средства и методы для прогнозирования повышенной вероятности эффекта от лечения у пациента с влажной AMD. 2 н. и 7 з.п. ф-лы, 1 ил., 5 табл., 1 пр.
Наверх