Антитела против а2 тенасцина с и способы их применения



Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения
Антитела против а2 тенасцина с и способы их применения

 


Владельцы патента RU 2584597:

РОШ ГЛИКАРТ АГ (CH)

Настоящее изобретение относится к области иммунологии и биотехнологии. Предложены антитела к А2 домену тенасцина-С (TNC A2), а также выделенный полинуклеотид, вектор экспрессии, клетка-хозяин и способы получения антитела по изобретению. Кроме того, рассмотрена фармацевтическая композиция и применение антитела по изобретению для изготовления или производства лекарственного средства, в том числе применяемого для лечения заболевания, характеризующегося экспрессией TNC А2 или для индукции цитолиза опухолевой клетки или стромальной опухолевой клетки. Данное изобретение может найти дальнейшее применение в терапии и диагностике различных заболеваний, связанных с TNC А2. 11 н. и 25 з.п. ф-лы, 8 ил., 8 табл., 11пр.

 

ОБЛАСТЬ ТЕХНИКИ

Настоящее изобретение относится к антителам, специфичным к А2 домену тенасцина-С (TNC А2). Кроме того, изобретение относится к полинуклеотидам, кодирующим такие антитела, а также векторам и клетам-хозяевам, содержащим такие полинуклеотиды. Изобретение также относится к способам получения антител и способам их применения в лечении заболеваний.

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

Тенасцин С и антитела к Тенасцину С

Тенасцины представляют собой высоко консервативное семейство крупных мультимерных гликопротеинов внеклеточного матрикса (ЕСМ), которое обнаруживается у позвоночных. У млекопитающих было идентифицировано 4 паралога тенасцина, получившие обозначения тенасцин-С, тенасцин-R, тенасцин-Х и тенасцин-W. Белки семейства тенасцинов имеют общую первичную структуру, содержащую N-концевые гептадные повторы, подобные эпидермальному фактору роста (EGF) повторы, повторы фибронектиновых доменов III типа и С-концевой фибриноген-подобный глобулярный домен. Через N-концевой олигомеризующий домен отдельные субъединицы объединяются в тримеры или даже гексамеры, как в случае тенасцина-С.

У млекопитающих мономеры тенасцина-С как правило имеют 14,5 EGF-подобных повторов и 8 повторов фибронектиновых доменов III типа, характерные для всех изоформ тенасцина-С. Однако, до 9 дополнительных повторов фибронектиновых доменов III типа (домены от А1 до D) могут независимо друг от друга как входить в состав, так и исключаться в процессе альтерантивного сплайсинга, образуя большое количество изоформ тенасцина-С (см., например, Hsia and Schwarzbauer, J Biol Chem 280, 26641-26644 (2005)).

Тенасцин-С транзиторно экспрессируется в ходе развития эмбриона, но практически отсутствует в тканях взрослого организма. Тем не менее, он вновь появляется в тканях, претерпевающих процесс ремоделирования, в том числе при некоторых патологических состояниях, таких как заживление ран, воспаление и рак (см. обзор Chiquet-Ehrismann & Chiquet, J Pathol 200, 488-499 (2003)).

Важное значение имеет высокий уровень экспрессии тенасцина-С в большинстве злокачественных солидных новообразований, включая новообразования мозга, молочных желез, толстого кишечника, легких, кожи и других органов (см. обзор Orend and Chiquet-Ehrismann, Cancer Letters 244, 143-163 (2006)), где он может экспрессироваться в трансформированных эпителиальных клетках, а также в стромальных клетках в микроокружения опухоли (Yoshida et al., J Pathol 182, 421-428 (1997), Hanamura et al., Int J Cancer 73, 10-15 (1997)). В частности, "крупные изоформы" тенасцина-С, содержащие образованные путем альтернативного сплайсинга домены от А1 до D, экспрессируются в инвазивных карциномах, будучи при этом практически недетектируемыми в здоровых тканях взрослого организма (Borsi et al., Int J Cancer 52, 688-692 (1992), Carnemolla et al., EurJ Biochem 205, 561-567 (1992)).

Такой профиль экспрессии делает тенасцин-С, и в частности его домены, образованные путем альтернативного сплайсинга, антигенами привлекательными для приложений, ориентированных на опухоли, и соответственно был разработан ряд антител к нескольким доменам белка (см., например, Brack et al., Clin Cancer Res 12, 3200-3208 (2006) или ЕР 1 817 345, в которых описаны антитела к А1 домену тенасцина-С; Silacci et al., Prot Eng Des Sel 19, 471-478 (2006), или ЕР 1 173 766, в котором описаны антитела к С домену тенасцина-С; публикацию Wang et al., Hybridoma 29, 13-16 (2010), в которой описано антитело к D домену тенасцина-С; или публикацию Balza et al., FEBS 332, 39-43 (1993), в которой описаны несколько антител к различным доменам тенасцина человека).

Недавно было описано антитело, распознающее специфичный эпитоп А2 домена тенасцина-С человека (WO 2009/089998).

Гликозилирование антител

Олигосахаридный компонент может оказывать существенное влияние на свойства, определяющие эффективность применяемого в терапевтических целях гликопротеина, включая физическую стабильность, устойчивость к действию протез, взаимодействие с иммунной системой, фармакокинетику и специфическую биологическую активность. Данные свойства могут зависеть не только от присутствия или отсутствия, но также от специфической структуры олигосахаридов. Можно вывести некоторые закономерности между структурой олигосахаридов и функциями гликопротеинов. Например, олигосахариды определенной структуры обеспечивают быстрый клиренс гликопротеинов из кровотока за счет взаимодействия с определенными белками, связывающими углеводы, тогда как другие могут связываться антителами и запускать нежелательные иммунные реакции (Jenkins et al., Nature Biotechnol 14, 975-81 (1996)).

Антитела типа IgGI, наиболее часто применяемые в иммунотерапии онкологических заболеваний, представляют собой гликопротеины, имеющие консервативный сайт N-связанного гликозилирования по Asn 297 в каждом СН2 домене. Два сложных двухантенных олигосахарида, присоединенные к Asn 297, располагаются между двумя СН2 доменами, образуя многочисленные контакты с полипептидным остовом и их присутствие имеет принципиальное значение для способности антитела проявлять эффекторные функции, такие как антитело-зависимая клеточная цитотоксичность (ADCC) (Lifely et al., Glycobiology 5, 813-822 (1995); Jefferis et al., Immunol Rev 163, 59-76 (1998); Wright and Morrison, Trends Biotechnol 15, 26-32 (1997)). Исследования в области белковой инженерии показали, что FcyR взаимодействует с нижним шарнирным участком СН2 домена IgG (Lund et al., J. Immunol. 157:4963-69 (1996)). Однако для связывания FcyR также требуется наличие олигосахаридов в участке СН2 (Lund et al., J. Immunol. 157:4963-69 (1996); Wright and Morrison, Trends Biotech. 15:26-31 (1997)), что позволяет предположить, что как олигосахарид, так и полипептид могут непосредственно участвовать в формировании сайта взаимодействия или что олигосахарид необходим для поддержания активной конформации СН2 полипептида. Модификация олигосахаридной структуры таким образом может рассматриваться как способ повышения аффинности взаимодействия между IgGI и FcyR и повышения ADCC активности IgGI.

Один из способов значительно повысить эффективность моноклональных антител - это усиление их естественных клеточно-опосредованных эффекторных функций путем модификации их олигосахаридного компонента, согласно публикации Umana et al., Nat Biotechnol 17, 176-180 (1999) и патенту США No.6,602,684 (WO 99/54342), описание которых включено сюда во всей полноте путем ссылок. Umana et al. показали, что повышенная экспрессия β(1,4)-N-ацетилглюкозаминилтрансферазы III (GnTIII), гликозилтрансферазы, катализирующей образование разветвленных олигосахаридов, в клетках яичнников китайского хомячка (СНО) существенно повышает in vitro ADCC активность антител, продуцируемых этими клетками. Повышенная экспрессия GnTIII в продуцирующих клеточных линиях позволяет получить антитела, обогащенные разветвленными олигосахаридами, которые кроме этого, как правило, являются нефукозилированными и относятся к гибридному типу. Если кроме GnTIII, в продуцирующих клеточных линиях повышена экспрессия маннозидазы II (ManII), это позволяет получить антитела, обогащенные сложными нефукозилированными разветвленными олигосахаридами (Ferrara et al., Biotechn Bioeng 93, 851-861 (2006)). Оба типа антител обладают повышенной ADCC, по сравнению с антителами, в которых гликаны не подвергались модификации, но только антитела, в которых большинство N-гликанов относятся к сложным, способны индуцировать значительную комплемент-зависимую цитотоксичность (Ferrara et al., Biotechn Bioeng 93, 851-861 (2006)). Изменения в составе углеводного компонента при Asn 297 или его удаление также влияют на связывание Fc-домена антитела с рецептором Fcγ (FcγR) и компонентом C1q комплемента, что имеет важное значение для ADCC и CDC, соответственно (Umana et al., Nat Biotechnol 17, 176-180 (1999); Davies et al., Biotechnol Bioeng 74, 288-294 (2001); Mimura et al., J Biol Chem 276, 45539-45547 (2001); Radaev et al., J Biol Chem 276, 16478-16483 (2001); Shields et al., J Biol Chem 276, 6591-6604 (2001); Shields et al., J Biol Chem 277, 26733-26740 (2002); Simmons et al., J Immunol Methods 263, 133-147 (2002)).

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

В настоящем изобретении предложены антитела, специфично связывающие А2 домен тенасцина-С, обладающие высокой аффинностью и/или усиленной эффекторной функцией.

В одном аспекте изобретения описано антитело, специфично связывающее TNC А2, и содержащее по меньшей мере один (т.е. один, два, три, четыре, пять или шесть) участков, определяющих комплементарность (CDRs), представленных в SEQ ID NOs 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45 и 47. В одном воплощении антитело содержит три определяющих комплементарность участка тяжелой цепи CDRs (т.е. HCDR1, HCDR2 и HCDR3) и/или три определяющих комплементарность участка легкой цепи CDRs (т.е. LCDR1, LCDR2 и LCDR3), выбранных из SEQ ID NOs 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45 и 47. В более конкретном воплощении антитело содержит вариабельный участок тяжелой цепи антитела и/или вариабельный участок легкой цепи антитела, в частности, вариабельные участки легкой, и тяжелой цепей, выбранные из последовательностей вариабельных участков тяжелой и легкой цепей, представленных в SEQ ID NOs 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89 и 91. В одном воплощении антитело содержит Fc фрагмент, в частности Fc фрагмент IgG. В следующем воплощении антитело представляет собой полноразмерное антитело, в частности, антитело класса IgG. В другом воплощении антитело содержит константный участок человеческого антитела. В одном воплощении антитело представляет собой человеческое антитело. В одном воплощении антитело модифицируют с использованием гликоинженерии для получения модифицированных олигосахаридов в Fc фрагменте. В одном воплощении антитело имеет повышенное содержание нефукозилированных и/или разветвленных олигосахаридов в Fc фрагменте по сравнению с антителом, не модифицированным с использованием гликоинженерии. В следующем воплощении антитело имеет повышенную эффекторную функцию и/или повышенную аффинность связывания Fc рецепторов. В конкретном воплощении повышенная эффекторная функция представляет собой повышенную антитело-зависимую клеточную цитотоксичность (ADCC). В следующем воплощении антитело связывает TNC A2 человека с константой диссоциации Ко менее чем приблизительно 1 мкМ, предпочтительно менее чем приблизительно 100 нМ, наиболее предпочтительно менее чем приблизительно 1 нМ. В одном воплощении антитело представляет собой антитело, подвергнутое аффинному созреванию. В одном воплощении антитело связывается с TNC A2 в тканях человека.

В других аспектах изобретение также относится к полипептидам, полинуклеотидам, клеткам-хозяевам и векторам экспрессии, касающимся антител. В следующем аспекте изобретение относится к способам получения антител. В следующем аспекте изобретение направлено на способы применения антител, в частности, лечение заболеваний, характеризующихся экспрессией TNC A2, таких как онкологические заболевания.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

На Фигуре 1 представлены результаты анализа кинетики связывания Fab фрагментов против TNC A2, подвергнутых аффинному созреванию, и TNC A2 человека (hu) с помощью метода поверхностного плазменного резонанса (SPR). Представлены обработанные данные кинетики связывания для клона 2В10_С3В6 (а), клона 2В10_6А12 (б), клона 2В10_С3А6 (в), клона 2B10_07D8 (D), клона 2B10_01F7 (Е) и клона 2В10_6Н10 (F). Сглаженные линии отображают глобальную аппроксимацию данных с использованием модели взаимодействия в соотношении 1:1.

На Фигуре 2 (а) показаны результаты анализа кинетики связывания Fab фрагментов клона 2В10 против TNC A2 с TNC A2 человека, мыши и яванского макака с помощью метода SPR. На панели (б) показаны результаты анализа кинетики связывания IgG человека клона 2В10 против TNC A2 с TNC A2 человека, мыши и яванского макака с помощью метода SPR, согласно описанию в Примере 7.

На Фигуре 3 (а) показаны результаты иммуногистохимического анализа нормальной (верхние панели) и опухолевой (нижние панели) ткани матки человека при увеличении 100Х (левые панели) и 400Х (средние панели), при взаимодействии с вариабельными участками 2В10 в составе Fab фрагмента, сшитого с FLAG фрагментом (SHD2B10-FLAG). Правые панели: контроль, увеличение 100Х. На Фигуре 3 (b) показан уровень экспрессии TNC A2 в образцах различных тканей человека, выраженный в % от общей площади окрашиваемой поверхности при взаимодействии с вариабельными участками 2В10 в составе Fab фрагмента, сшитого с FLAG фрагментом (SHD2B10-FLAG). Образцы различных тканей человека от здоровых лиц и онкологических больных были окрашены SHD2B10-FLAG Fab фрагментом согласно описанию в Примере 8.

На Фигуре 4, А-N, показаны результаты иммуногистохимического окрашивания тканей человека при увеличении 100Х (левые панели) и 400Х (средние панели) с применением IgG мыши SHD2B10, согласно описанию в Примере 8. Окрашивание с помощью изотипического контрольного антитела показано при увеличении 100Х (правые панели). Верхние панели: нормальная ткань, нижние панели: опухолевая ткань. (А) мозг, (В) молочная железа, (С) толстый кишечник, (D) почки, (Е) печень, (F) легкие, (G) яичники, (Н) поджелудочная железа, (I) предстательная железа, (J) скелетные мышцы, (К) кожа, (L) тонкий кишечник, (М) желудок, (N) матка.

На Фигуре 5 показано связывание IgG человека, полученного на основе 2В10, с TNC A2, экспрессируемым клетками глиобластомы U87MG, по результатам проточной цитофлуориметрии (см. Пример 9). Показана средняя интенсивность флуоресценции клеток, обработанных различными концентрациями IgG 2В10 в сравнении с необработанными клетками и клетками, окрашенными только вторичным атителом (отрицательный контроль).

На Фигуре 6 показаны очистка и анализ человеческих IgG 2В10 дикого типа. А) Этап очистки с помощью аффинной хроматографии с протеином А. В) Этап очистки с помощью эксклюзионной хроматографии. С) Анализ с помощью электрофореза в полиакриламидном геле. Ход эксперимента описан в Примере 1.

На Фигуре 7 показаны очистка и анализ модифицированного с использованием гликоинженерии человеческого IgG 2B10. А) Этап очистки с помощью аффинной хроматографии с протеином А. В) Этап очистки с помощью эксклюзионной хроматографии. С) Анализ с помощью электрофореза в полиакриламидном геле. D) Анализ с помощью эксклюзионной хроматографии. Ход эксперимента описан в Примере 1.

На Фигуре 8 показано связывание антитела 2B10 против TNC A2 в виде дикого типа (wt) и в модифицированной с использованием гликоинженерии (де) версии с TNC A2 на клетках U87MG.

СВЕДЕНИЯ. ПОДТВЕРЖДАЮЩИЕ ВОЗМОЖНОСТЬ ОСУЩЕСТВЛЕНИЯ ИЗОБРЕТЕНИЯ

I. Определения

"Акцепторные каркасные участки человека" в целях данного описания представляют собой каркасные участки, содержащие аминокислотную последовательность каркасного участка вариабельного домена легкой цепи (VL) или каркасные участки вариабельного домена тяжелой цепи (VH), полученные на основе каркасных участков иммуноглобулина человека или консенсусных каркасных участков человека, определение которым приведено ниже. Акцепторные каркасные последовательности, "полученные на основе" каркасной последовательности иммуноглобулина человека или консенсусных каркасных участков человека, могут содержать ту же аминокислотную последовательность или могут иметь измененную аминокислотную последовательность. В некоторых воплощениях число аминокислотных замен равно 10 или менее, 9 или менее, 8 или менее, 7 или менее, 6 или менее, 5 или менее, 4 или менее, 3 или менее, или 2 или менее. В некоторых воплощениях акцепторная последовательность каркасных участков VL идентична последовательности каркасных участков VL иммуноглобулина человека или консенсусной последовательности каркасных участков человека.

"Аффинность" обозначает суммарную силу всех нековалентных взаимодействий между одним сайтом связывания молекулы (например, антитела) и ее партнером по связыванию (например, антигеном). Если не указано иначе, термин "аффинность связывания" согласно использованию здесь обозначает собственную аффинность связывания, которая отражает взаимодействие между членами связывающей пары (например, антителом и антигеном) в соотношении 1:1. Аффинность молекулы X к своему партнеру Y может в общем виде быть представлена константой диссоциации (KD), которая представляет собой соотношение констант скоростей диссоциации и ассоциации (koff и kon, соответственно). Таким образом, равные аффинности могут характеризоваться различными константами скоростей реакции, при условии что соотношение констант скоростей остается неизменным. Аффинность может быть измерена общепринятыми способами известными в данной области техники, включая описанные здесь. Определенные иллюстративные и приведенные в качестве примеров воплощения для измерения аффинности связывания описаны ниже.

Антитело "подвергнутое аффинному созреванию" обозначает антитело с одной или несколькими модификациями (например, с мутациями аминокислот) в одном или нескольких гипервариабельных участках (HVRs) (например, CDRs), по сравнению с материнским антителом, не имеющим таких модификаций, такие модификации приводят к повышению аффинности антитела к антигену. Как правило, антитело, подвергнутое аффинному созреванию, связывается с теми же эпитопами, что и родительское антитело.

Термины "антитело к TNC А2" и "антитело, связывающее А2 домен Тенасцина-С" обозначают антитело, способное связывать TNC A2 с достаточной аффинностью таким образом, что антитело может применяться в качестве диагностического и/или терапевтического агента для нацеленного воздействия на TNC А2. В одном воплощении степень связывания антитела к TNC A2 с неродственным TNC A2 белком составляет менее 10% от связывания антитела с TNC A2, измеренного, например, с помощью радиоиммуннологического анализа (RIA). В некоторых воплощениях антитело, которое связывает TNC A2 имеет константу диссоциации (KD)≤1 мкМ, ≤100 нМ, ≤10 нМ, ≤1 нМ, ≤0,1 нМ, и 0,01 нМ, или ≤0,001 нМ (например, 10-8 М или менее, например, от 10-8 М до 10-13 М, например, от 10-9 М до 10-13 М). В некоторых воплощениях антитело к TNC A2 связывает эпитоп TNC A2, который является консервативным у TNC A2 различных биологических видов.

Термин "антитело" здесь используется в широком смысле и включает антитела с различной структурой, включая моноклональные антитела, поликлональные антитела, мультиспецифичные антитела (например, биспецифичные антитела) и фрагменты антител, при условии, что они проявляют желаемую антиген-связывающую активность, но не ограничивается ими. Термин также включает фрагменты антител, имеющие Fc фрагмент и гибридные белки, содержащие участок, эквивалентный Fc фрагменту иммуноглобулина.

"Фрагмент антитела" обозначает молекулу, отличную от интактного антитела, содержащую часть интактного антитела, связывающего антиген, с которым связывается интактное антитело. Примеры фрагментов антитела включают Fv, Fab, Fab', Fab'-SH, F(ab')2, молекулы одноцепочечных антител (например, scFv), диатела и мультиспецифичные антитела, образованные из фрагментов антител, но не ограничиваются ими.

"Антитело, связывающееся с тем же эпитопом", что и референсное антитело, обозначает антитело, блокирующее связывание референсного антитела с его антигеном в тестах конкурентного связывания на 50% или более, и наоборот, референсное антитело блокирует связывание антитела с его антигеном в тестах конкурентного связывания на 50% или более. Примеры тестов конкурентного связывания приводятся ниже.

Термин "антиген-связывающий домен" обозначает часть антиген-связывающей молекулы, содержащую область, которая специфично связывает и является комплементарной к целому антигену или его части. В случаях, когда антиген имеет большие размеры, антиген-связывающая молекула может связывать только отдельную часть антигена, которая называется эпитопом. Антиген-связывающий домен может быть образован, например, одним или несколькими вариабельными доменами антитела (также называемыми вариабельными участками антитела). Предпочтительно, антиген-связывающий домен содержит вариабельный участок легкой цепи антитела (VL) и вариабельный участок тяжелой цепи антитела (VH).

Термин "химерное" антитело обозначает антитело, в котором часть тяжелой и/или легкой цепи получена из конкретных источников или биологических видов, тогда как оставшаяся часть тяжелой и/или легкой цепи получена из другого источника или биологического вида. Для химерных антител, например, компоненты не связывающие антиген могут быть получены у большого количества биологических видов, включая приматов, таких как шимпанзе и человек. Гуманизированные антитела являются наиболее предпочтительной формой химерных антител.

"Класс" антитела обозначает тип константного домена или константного участка его тяжелой цепи. Существует пять основных классов антител: IgA, IgD, IgE, IgG и IgM, и некоторые из них могут быть подразделены на подклассы (изотипы), например, IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2. Константные домены тяжелой цепи, соответствующие различным классам иммуноглобулинов, обозначаются α, δ, ε, γ и µ, соответственно.

Термин "цитотоксичный агент" здесь используется для обозначения вещества, ингибирующего или предотвращающего осуществление клеточной функции и/или вызывающего гибель или разрушение клетки. Цитотоксичные агенты включают радиоактивные изотопы (например, At211, I131, I125, Y90, Re186, Re188, Sm153, Bi212, P32, Pb212 и радиоактивные изотопы Lu); химиотерапевтические агенты или лекарственные препараты (например, метотрексат, адриамицин, алкалоиды барвинка (винкристин, винбластин, этопозид), доксорубицин, мелфалан, митомицин С, хлорамбуцил, даунорубицин или другие интеркалирующие агенты); агенты, ингибирующие рост; ферменты и их фрагменты, такие как нуклеолитические ферменты; антибиотики; токсины, такие как низкомолекулярные токсины или энзиматически активные токсины бактериального, грибкового, растительного или животного происхождения, включая фрагменты и/или их варианты; и различные противоопухолевые или противораковые агенты, описанные ниже, но не ограничиваются ими.

"Эффекторные функции" относятся к формам биологической активности, связанным с Fc фрагментом антитела, различающимся у антител различных изотипов. Примеры эффекторных функций антител включают: связывание C1q и комплемент-зависимую цитотоксичность (CDC); связывание Fc рецептора; антитело-зависимую клеточную цитотоксичность (ADCC); фагоцитоз; секрецию цитокинов; опосредованный иммунными комплексами захват антигена антиген-презентирующими клетками; снижение экспрессии рецепторов клеточной поверхности (например, В-клеточных рецепторов); и В-клеточную активацию.

"Эффективное количество" агента, например, фармацевтического препарата, обозначает количество, эффективное для достижения желаемого терапевтического или профилактического результата в необходимых дозировках и в течение необходимого периода времени.

Термин "Fc фрагмент" здесь используется для обозначения С-концевого участка тяжелой цепи иммуноглобулина, содержащего по меньшей мере часть константного участка. Термин включает нативную последовательность Fc фрагментов и вариантов Fc фрагментов. В одном воплощении Fc фрагмент тяжелой цепи IgG человека простирается от Cys226 или от Рго230 до карбокси-конца тяжелой цепи. Однако, С-концевой лизин (Lys447) Fc фрагмента может присутствовать или отсутствовать. Если не указано иначе, нумерация аминокислотных остатков в Fc фрагменте или в константном участке производится в соответствии с системой нумерации EU, также носящей название «EU index», согласно описанию Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991.

"Участок, эквивалентный Fc фрагменту иммуноглобулина" включает естественным образом возникающие аллельные варианты Fc фрагмента иммуноглобулина, а также варианты, имеющие модификации, приводящие к появлению замен, вставок, или делеций, существенно не понижающих способность иммуноглобулина опосредовать эффекторные функции (такие как антитело-зависимая клеточная цитотоксичность). Например, одна или более аминокислот могут быть удалены из N-конца или С-конца Fc фрагмента иммуноглобулина без существенной потери биологической функции. Такие варианты могут быть отобраны согласно общим правилам, известным в данной области техники, с тем, чтобы их влияние на активность было минимальным (см., например, Bowie, J. U. et al., Science 247:1306-10 (1990)).

"Каркасные участки" или "FR" обозначают остатки вариабельного домена, отличные от остатков гипервариабельного участка (HVR) (или CDR). FR вариабельного домена, как правило, состоит из 4 FR доменов: FR1, FR2, FR3 и FR4. Соответственно, последовательности HVR и FR, в составе VH (или VL), как правило, появляются в следующей последовательности: FR1-H1(L1)-FR2-H2(L2)-FR3-H3(L3)-FR4.

Термины "полноразмерное антитело", "интактное антитело" и "полное антитело" здесь используются взаимозаменяемо и обозначают антитело, имеющее структуру в значительной степени схожую со структурой нативного антитела или имеющее тяжелые цепи, содержащие Fc фрагмент, как описано здесь.

Термины "клетка-хозяин", "линия клеток-хозяев" и "культура клеток-хозяев" используются взаимозаменяемо и обозначают клетки, в которые была внедрена экзогенная нуклеиновая кислота, включая потомство таких клеток. Клетки-хозяева включают "трансформанты" и "трансформированные клетки", включающие первично трансформированные клетки и их потомков, независимо от числа пассажей. Потомство может быть не полностью идентично родительской клетке по содержанию нуклеиновой кислоты, но может содержать мутации. Сюда также включаются мутантные потомки, имеющие такие же функции или биологическую активность при скрининге или отборе, как и исходные трансформированные клетки. В одном воплощении клетки-хозяева подвергают генетической модификации для получения антитела с модифицированными олигосахаридами. В некоторых воплощениях клетки-хозяева подвергали дальнейшей модификаци для повышения уровней экспрессии одного или нескольких полипептидов, обладающих активностью β(1,4)-N-ацетилглюкозаминилтрансферазы III (GnTIII). Клетки-хозяева включают культивируемые клетки, например, культивируемые клетки млекопитающих, такие как клетки СНО, клетки ВНК, клетки NSO, клетки SP2/0, клетки миеломы YO, клетки миеломы мыши Р3Х63, клетки PER, клетки PER.C6 или клетки гибридомы, клетки дрожжей, клетки насекомых и клетки растений, если перечислить только некоторые из них, а также клетки организма трансгенного животного, трансгенного растения или культивируемых растительных или животных тканей.

"Человеческое антитело" представляет собой антитело, обладающее аминокислотной последовательностью, соответствующей последовательности антитела, продуцируемого в организме или в клетках человека или полученное из источника, не относящегося к человеку, но задействующего репертуар антител человека или иные последовательности, кодирующие антитела человека. Данное определение антитела человека в частности исключает гуманизированные антитела, содержащие антиген-связывающие остатки, не являющиеся человеческими.

"Консенсусные каркасные участки человека" это каркасные участки, представляющие наиболее часто встречающиеся аминокислотные остатки в наборе последовательностей каркасных участков VL или VH иммуноглобулинов человека. Как правило, последовательности VL или VH иммуноглобулинов человека выбирают из подгруппы последовательностей вариабельных доменов. Как правило, подгруппа последовательностей представляет собой подгруппу согласно описанию Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, NIH Publication 91-3242, Bethesda MD (1991), vols.1-3. В одном воплощении, подгруппой для VL является подгруппа каппа I, согласно Kabat et al., см выше. В одном воплощении, подгруппой для VH является подгруппа III, согласно Kabat et al., см выше.

"Гуманизированное" антитело обозначает химерное антитело, содержащее аминокислотные остатки гипервариабельных участков, не являющихся человеческими и аминокислотные остатки каркасных участков человека. В определенных воплощениях гуманизированное антитело содержит по существу все из по меньшей мере одного, а обычно двух вариабельных доменов, в которых все или по существу все гипервариабельные участки (например, CDRs) соответствуют участкам антитела, не являющимся человеческими, и все или по существу все каркасные участки соответствуют участкам человеческого антитела. Гуманизированное антитело может содержать по меньшей мере часть константного участка антитела, полученного из антитела человека. "Гуманизированная форма" антитела, например, антитела не являющегося человеческим, обозначает антитело, прошедшее гуманизацию.

Термин "гипервариабельный участок" или "HVR", используемый здесь, обозначает каждый из участков вариабельного домена антитела, имеющих гипервариабельную последовательность и/или формирующих петли определенной структуры ("гипервариабельные петли"). Как правило, нативные состоящие из четырех цепей антитела имеют 6 HVRs; три в VH (Н1, Н2, Н3), и три в VL (L1, L2, L3). Как правило, HVRs содержат аминокислотные остатки гипервариабельных петель и/или "участков определяющих комплементаность" (CDRs), последние характеризуются наибольшей вариабельностью последовательности и/или задействованы в распознавании антигена. За исключением CDR1 в VH, CDRs как правило содержат аминокислотные остатки, формирующие гипервариабельные петли. Гипервариабельные участки (HVRs) также обозначаются участками, определяющими комплементарность (CDRs), и эти термины здесь используются взаимозаменяемо для обозначения частей вариабельного участка, формирующих антиген-связывающие участки. Эти конкретные участки были описаны в публикациях Kabat et al., U.S. Dept. of Health and Human Services, "Sequences of Proteins of Immunological Interest" (1983) и Chothia et al., J. Mol. Biol. 196:901-917 (1987), и при сравнении друг с другом данные определения включают перекрывающиеся группы аминокислотных остатков. Тем не менее, использование любого из определений для обозначения CDR антитела или его вариантов находится в рамках термина согласно использованию в настоящем документе. Соответствующие аминокислотные участки, содержащие CDRs, согласно любой из вышеупомянутых ссылок, представлены ниже в Таблице 1 для сравнения. Точные номера аминокислотных остатков, содержащих конкретные CDR, могут варьировать в зависимости от последовательности и размера CDR. Специалисты в данной области могут стандартным способом определить, какие аминокислотные остатки содержат конкретный CDR по указанной аминокислотной последовательности вариабельного участка антитела.

Таблица 1.
Определения CDR1
CDR Kabat Chothia AbM2
VH CDR1 31-35 26-32 26-35
VH CDR2 50-65 52-58 50-58
VH CDR3 95-102 95-102 95-102
VL CDR1 24-34 26-32 24-34
VL CDR2 50-56 50-52 50-56
VL CDR3 89-97 91-96 89-97
1Нумерация всех определений CDR в Таблице 1 соответствует системе нумерации, разработанной Кабат и др. (см. ниже).
2"AbM" с прописной буквой "b" согласно использованию в Таблице 1 обозначают CDRs в соответствии с программой моделирования антител "AbM" Oxford Molecular.

Kabat et al. также разработали систему нумерации для последовательностей вариабельных участков, которую можно применить для любого антитела. Любой специалист в данной области может однозначно "пронумеровать по системе Кабат" любую последовательность вариабельного участка, не основываясь на каких-либо экспериментальных данных помимо имеющихся для самой последовательности. Согласно использованию здесь, "нумерация согласно Кабат" относится к системе нумерации, разработанной Кабат и др., U.S. Dept. of Health and Human Services, "Sequence of Proteins of Immunological Interest" (1983). Если не указано иначе, ссылки на номера позиций конкретных аминокислотных остатков в вариабельном участке антитела указаны в соответствии с системой нумерации согласно Кабат.

CDRs также включают "остатки, определяющие специфичность" или "SDRs," которые представляют собой остатки, контактирующие с антигеном. SDRs находятся в составе участков CDRs, обозначаемых «укороченными CDRs», или а-CDRs (от англ. abbreviated-CDRs). Как правило, только от одной пятой до одной трети остатков в заданном CDR принимают участие в связывании антигена. Определяющие специфичность аминокислотные остатки в конкретном CDR могут быть идентифицированы, например, путем компьютерного моделирования межатомных контактов в трехмерной модели и определения вариабельности последовательности в положении заданного аминокислотного остатка в соответствии с методами, описанными Padlan et al., FASEB J. 9(1):133-139 (1995). Приведенные в качестве примера a-CDRs (a-CDR-U, a-CDR-L2, a-CDR-L3, a-CDR-H1, a-CDR-H2 и a-CDR-Н3) образованы аминокислотными остатками в положениях 31-34 в L1, 50-55 в L2, 89-96 в L3, 31-35 В в Н1, 50-58 в Н2 и 95-102 в Н3 (см. Almagro and Fransson, Front. Biosci. 13:1619-1633 (2008).) Если не указано иначе, HVR остатки и иные остатки вариабельного домена (например, остатки каркасного участка) здесь пронумерованы в соответствии с Kabat et al., см. выше.

"Конъюгат антитела" представляет собой антитело, конъюгированное с цитотоксическим агентом.

"Индивид" или "субъект" является млекопитающим. Млекопитающие включают одомашненных животных (например, коров, овец, кошек, собак и лошадей), приматов (например, людей и не относящихся к человеку приматов, таких как обезьяны), кроликов и грызунов (например, мышей и крыс), но не ограничиваются ими. В определенных воплощениях индивидом или субъектом является человек.

"Выделенное" антитело обозначает антитело, изолированное от компонентов его естественного окружения. В некоторых воплощениях антитело очищено до степени чистоты более чем 95% или 99% согласно определению, например, электрофоретическими (например, электрофорезом в полиакриламидном геле, изоэлектрическим фокусированием (IEF), капиллярным электрофорезом) или хроматографическими (например, ионообменной или обратнофазной ВЭЖХ) способами. Для обзора способов оценки чистоты антител см., например, Flatman et al., J. Chromatogr. В 848:79-87 (2007).

"Выделенный" полинуклеотид обозначает молекулу полинуклеотида, изолированную от компонентов его естественного окружения. Выделенный полинуклеотид включает молекулу полинуклеотида, содержащуюся в клетках, как правило содержащих молекулу полинуклеотида, при этом молекула полинуклеотида находится внехромосомно или в участке хромосомы, отличном от естественного положения на хромосоме.

"Выделенный полинуклеотид, кодирующий антитело к TNC A2" обозначает одну или несколько полинуклеотидных молекул, кодирующих тяжелые и легкие цепи антитела (или их фрагменты), включая такую(ие) полинуклеотидную(ые) молекулу(ы) в одном векторе или в разных векторах, при этом такая(ие) полинуклеотидная(ые) молекула(ы) находится в одном или нескольких местоположениях в клетке-хозяине.

Термин "моноклональное антитело" здесь используется для обозначения антитела, полученного из популяции по существу гомогенных антител, т.е. отдельные антитела, составляющие популяцию, идентичны и/или связывают один эпитоп, за исключением возможных вариантов антител, например, содержащих мутации, которые возникают естественным путем или в ходе получения препарата моноклонального антитела, при этом подобные варианты, как правило, присутствуют в минорных количествах. В противоположность препаратам поликлональных антител, обычно содержащим различные антитела, направленные против различных детерминант (эпитопов), каждое моноклональное антитело в препарате моноклональных антител направлено против единственной детерминанты или антигена. Таким образом, определение "моноклональное" указывает на характер антитела, полученного из по существу гомогенной популяции антител, и не должно рассматриваться как необходимость получения антитела определенным способом. Например, моноклональные антитела, предназначенные для применения в соответствии с настоящим изобретением, могут быть произведены с помощью различных технологий, включая гибридомную технологию, технологию рекомбинантной ДНК, технологию фагового дисплея и технологии с использованием трансгенных животных, имеющих все локусы человеческих иммуноглобулинов или их часть, но не ограничиваясь ими; данные способы и другие приведенные в качестве примера способы производства моноклональных антител здесь описаны.

"Голое антитело" обозначает антитело, не конъюгированное с гетерологичным компонентом (например, цитотоксичным компонентом) или радиоактивной меткой. Голое антитело может присутствовать в фармацевтической композиции.

"Нативные антитела" обозначают молекулы иммуноглобулинов, возникающие естественным образом и имеющим различные структуры. Например, нативные антитела класса IgG являются гетеротетрамерными гликопротеинами весом приблизительно 150000 дальтон, состоящими из двух идентичных легких цепей и двух идентичных тяжелых цепей, связанных дисульфидной связью. В направлении от N- к С-концу каждой тяжелой цепи расположен вариабельный участок (VH), также обозначаемый вариабельным тяжелым доменом или вариабельным доменом тяжелой цепи, за которым следуют три константных домена (СН1, СН2 и СН3), также обозначаемые константными участками тяжелой цепи. Аналогично, в направлении от N- к С-концу каждой легкой цепи расположен вариабельный участок (VL), также обозначаемый вариабельным легким доменом или вариабельным доменом легкой цепи, за которым расположен константный легкий домен (CL), также обозначаемый константным участком легкой цепи. Легкая цепь антитела может относиться к одному из двух типов, обозначаемых каппа (κ) и лямбда (λ), в зависимости от аминокислотной последовательности ее константного домена.

"Отсутствие существенной кросс-реактивности" означает, что молекула (например, антитело) не распознает или не связывает специфически антиген, отличный от истинного антигена-мишени молекулы (например, антиген близкородственный антигену-мишени), в частности, при сравнении с этим антигеном-мишенью. Например, антитело может связывать от менее чем приблизительно 10% до менее чем приблизительно 5% антигена, отличного от истинного антигена-мишени, или может связывать указанный антиген, отличный от истинного антигена-мишени в количестве, выбранном из группы, состоящей из менее чем приблизительно 10%, 9%, 8% 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0,5%, 0,2% или 0,1%, предпочтительно менее чем приблизительно 2%, 1% или 0,5%, и наиболее предпочтительно менее чем приблизительно 0,2% или 0,1% антигена, отличного от истинного антигена-мишени.

Термин "листовка-вкладыш" используется для обозначения инструкций, обычно вкладываемых в коммерческую упаковку терапевтических продуктов, содержащих информацию о показаниях к применению, способах применения, дозировках, введении, комбинированной терапии, противопоказаниях и/или предупреждениях, касающихся применения таких терапевтических продуктов.

Термин "родительское" антитело относится к антителу, которое используют как стартовое или как основу для изготовления варианта.

"Процент (%) идентичности аминокислотной последовательности" относительно референсной полипептидной последовательности определяется как процент аминокислотных остатков в кандидатной последовательности, которые идентичны аминокислотным остаткам в референсной полипептидной последовательности после выравнивания последовательностей и расстановки пробелов (гэпов), если это необходимо для достижения наибольшего процента идентичности последовательностей, и без принятия каких-либо консервативных замен за часть идентичной последовательности. Выравнивание в целях определения процента идентичности аминокислотной последовательности может выполняться различными способами, известными в данной области техники, например, с помощью общедоступных компьютерных программ, таких как BLAST, BLAST-2, ALIGN или Megalign (DNASTAR). Специалисты в данной области могут определить надлежащие параметры для выравнивания последовательностей, включая любые алгоритмы, необходимые для достижения максимального выравнивания по всей длине сравниваемых последовательностей. Для целей настоящего описания, значения % идентичности аминокислотной последовательности получены при помощи компьютерной программы для сравнения последовательностей ALIGN-2. Компьютерная программа для сравнения последовательностей ALIGN-2 была разработана в компании Genentech, Inc., исходный код был представлен вместе с пользовательской документацией в бюро по охране авторских прав США, Washington D.C., 20559, где было зарегистрировано авторское право под номером TXU510087. Доступ к программе ALIGN-2 можно получить в компании Genentech, Inc., South San Francisco, California, или код программы может быть скомпилирован на основе исходного кода. Программа ALIGN-2 должна быть скомпилирована для работы на платформе UNIX, включая платформу digital UNIX V4.0D. Все параметры для сравнения последовательностей заданы программой ALIGN-2 и остаются неизменными.

В случаях когда ALIGN-2 используется для сравнения аминокислотных последовательностей, процент идентичности заданной аминокислотной последовательности А к последовательности В, с последовательностью В, или по сравнению с заданной аминокислотной последовательностью В (что можно также сформулировать как заданная аминокислотная последовательность А, имеющая или содержащая определенный процент идентичной аминокислотной последовательности к последовательности В, с последовательностью В, или по сравнению с заданной аминокислотной последовательностью В) рассчитывается по формуле:

X/Y×100

где Х это число аминокислотных остатков, которые были расценены программой для выравнивания последовательностей ALIGN-2 как абсолютные совпадения при выравнивании А и В в рамках этой программы, и где Y это общее число аминокислотных остатков в В. Следует принимать во внимание, что когда длина аминокислотной последовательности А не равна длине аминокислотной последовательности В, процент идентичности аминокислотной последовательности А с последовательностью В не будет равен проценту идентичности аминокислотной последовательности В с последовательностью А. Если отдельно не указано иначе, все значения % идентичности аминокислотных последовательностей, приведенные здесь, получены согласно описанию в предыдущем параграфе о применении компьютерной программы ALIGN-2.

Аналогично, под нуклеиновой кислотой или полинуклеотидом, имеющим нуклеотидную последовательность, «идентичную», например, по меньшей мере на 95% к референсной нуклеотидной последовательности по настоящему изобретению, подразумевается, что нуклеотидная последовательность полинуклеотида идентична референсной последовательности, за исключением того, что полинуклеотидная последовательность может включать до пяти точечных мутаций на каждые 100 нуклеотидов референсной нуклеотидной последовательности. Другими словами, для получения полинуклеотида, имеющего нуклеотидную последовательность по меньшей мере на 95% идентичную референсной нуклеотидной последовательности, до 5% нуклеотидов в референсной последовательности могут быть удалены или заменены другими нуклеотидами, или нуклеотиды в количестве до 5% от общего числа нуклеотидов в референсной последовательности могут быть вставлены в референсную последовательность. Данные модификации референсной последовательности могут возникать в 5' или 3' концевых положениях референсной нуклеотидной последовательности или в любом участке между этими концевыми положениями, и располагаться как по отдельности среди аминокислотных остатков референсной последовательности, так и в виде одной или нескольких смежных групп в составе референсной последовательности. Является ли какой-либо конкретный полинуклеотид или полипептид по меньшей мере на 80%, 85%, 90%, 95%, 96%, 97%, 98% или 99% идентичным нуклеотидной последовательности или полипептидной последовательности по настоящему изобретению, на практике можно определить известным способом с при помощи известных компьютерных программ, таких как перечисленные выше.

Термин "фармацевтическая композиция " относится к композиции, которая находится в такой форме, что обеспечивает эффективную биологическую активность содержащегося в нем активного ингредиента, и не содержит дополнительных компонентов, которые являются неприемлемо токсичными в отношении субъекта, которому будет вводиться композиция.

"Фармацевтически приемлемый носитель" относится к ингредиенту в фармацевтической композиции, отличному от активного ингредиента, который является нетоксичным в отношении субъекта. Фармацевтически приемлемый носитель включает, буфер, эксципиент, стабилизатор или консервант, но не ограничивается ими.

Термин "А2 домен Тенасцина-С (TNC A2)" здесь используется для обозначения любого нативного TNC A2 любого позвоночного, включая млекопитающих, таких как приматы (например, человек) и грызуны (например, мыши и крысы), если не указано иначе. Термин включает "полноразмерный", не прошедший процессинг TNC A2, а также любые формы TNC A2, полученные в результате процессинга в клетке. Термин также включает естественным путем возникающие варианты TNC A2, например, сплайс-варианты или аллельные варианты. Аминокислотная последовательность приведенного в качестве примера TNC A2 человека (имеющего на С-конце пептиды с коммерческими названиями avi-tag и 6×His-tag) приведена в SEQ ID NO:97. В молекуле Тенасцина-С человека домен A2 является вторым (с N-конца) из возможных девяти образованных в результате альтернативного сплайсинга фибронектиновых доменов III типа, иможет находиться между пятым и шестым константными фибронектиновыми доменами III типа (схематичное изображение доменной структуры тенасцина-С, представлено, например, Orend and Chiquet-Ehrismann, Cancer Letters 244, 143-163 (2006). Аналогично, в молекуле тенасцина-С мыши А2 домен является вторым из возможных шести образованных в результате альтернативного сплайсинга фибронектиновых доменов III типа (описано, например, Joestnerand Faissner, J Biol Chem 274, 17144-17151 (1999)).

Используемые здесь термины "лечение" (и его грамматические производные, такие как "лечить" или "проводить лечение") обозначают клиническое вмешательство в попытке изменить естественный ход заболевания индивида, которому проводится лечение и могут осуществляться как для профилактики, так и при наличии патологического состояния. Желательные эффекты от лечения включают предупреждение возникновения или повторного проявления заболевания, облегчение симптомов, уменьшение любых прямых или непрямых патологических последствий заболевания, предупреждение метастазирования, снижение скорости прогрессирования заболевания, улучшение или временное облегчение состояния, а также ремиссию или улучшение прогноза, но не ограничиваются ими. В некоторых воплощениях антитела по изобретению применяют, чтобы отсрочить развитие заболевания или чтобы замедлить прогрессирование заболевания.

Термин "вариабельный участок" или "вариабельный домен" обозначают домен легкой или тяжелой цепи антитела, задействованный в связывании антитела с антигеном. Вариабельные домены тяжелой цепи и легкой цепи (VH и VL, соответственно) нативного антитела, как правило, имеют одинаковую структуру, при этом каждый домен содержит четыре консервативных каркасных участка (FRs) и три гипервариабельных участка (HVRs) (см., например, Kindt et al. Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91 (2007)). Единственного VH или VL домена может быть достаточно для обеспечения антиген-связывающей специфичности. Более того, антитела, связывающие конкретный антиген, могут быть выделены при помощи VH или VL домена антитела, связывающего этот же антиген, при скрининге библиотеки на комплементарные VL или VH домены, соответственно. См., например, Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991).

Термин "вектор", используемый здесь, относится к молекуле нуклеиновой кислоты, способной передавать другую нуклеиновую кислоту, с которой он связан. Термин включает вектор как само-реплицирующуюся структуру нуклеиновой кислоты, а также вектор, инкорпорированный в состав генома клетки-хозяина, в которую он был введен. Некоторые векторы способны направлять экспрессию нуклеиновых кислот, с которыми они операбельно связаны. Такие векторы здесь обозначаются "экспрессирующие векторы".

Термин "полипептид, обладающий активностью GnTIII", используемый здесь, относится к полипептидам, которые способны катализировать присоединение остатка N-ацетилглюкозамина (GlcNAc) в β-1-4 положении к β-связанному остатку маннозы триманнозильного ядра N-связанных олигосахаридов. Сюда входят гибридные полипептиды, проявляющие ферментативную активность, схожую, но не обязательно идентичную с активностью β(1,4)-N-ацетилглюкозаминилтрансферазы III, также известной под названием β-1,4-маннозил-гликопротеин 4-бета-N-ацетилглюкозаминил-трансферазы (ЕС 2.4.1.144), в соответствии с Номенклатурой Комитета Международного Общества Биохимии и Молекулярной Биологии (NC-IUBMB), определяемую в конкретных биологических тестах, с учетом или без учета дозозависимости. В случаях, когда дозозависимость существует, она может не быть идентичной таковой GnTIII, но скорее в значительной мере быть схожей с дозозависимостью при заданной активности, по сравнению с GnTIII (т.е., кандидатный полипептид будет проявлять большую активность или не более чем приблизительно в 25 раз меньшую, и предпочтительно, не более чем приблизительно в 10 раз меньшую активность, и наиболее предпочтительно, не более чем приблизительно в 3 раза меньшую активность по сравнению с GnTIII).

Термин "домен, отвечающий за локализацию в комплексе Гольджи", используемый здесь, обозначают аминокислотную последовательность полипептида-резидента комплекса Гольджи, отвечающего за заякоривание полипептида в определенном местоположении в составе комплекса Гольджи. Как правило, отвечающие за локализацию домены содержат N-концевые "хвосты" фермента.

Термины "инженерия, инжиниринг, инженерная" используемые здесь, в частности с префиксом "глико-," а также термин "инженерия гликозилирования" подразумевают любые манипуляции с профилем гликозилирования естественного или рекомбинантного полипептида или его фрагмента. Инженерия гликозилирования включает метаболическую инженерию гликозилирующего аппарата клетки, включая генетические манипуляции с путями синтеза олигосахаридов для модификации гликозилирования гликопротеинов, экспрессируемых клетками. Кроме того, инженерия гликозилирования подразумевает влияние мутаций и клеточного окружения на гликозилирование. В одном воплощении инженерия гликозилирования представляет собой модификацию гликозилтрансферазной активности. В конкретном воплощении результатом инженерии является модификация глюкозаминилтрансферазной активности и/или фукозилтрансферазной активности.

Термин "Fc-опосредованная клеточная цитотоксичность", используемый здесь, включает антитело-зависимую клеточную цитотоксичность (ADCC) и клеточную цитотоксичность, опосредованную растворимым сшитым с Fc-фрагментом белком, содержащим Fc-фрагмент человека. Она представляет собой иммунный механизм, приводящий к лизису "клеток-мишеней" при участии " эффекторных клеток иммунной системы человека".

Термин "эффекторные клетки иммунной системы человека", используемый здесь, обозначает популяцию лейкоцитов, экспонирующих на своей поверхности Fc рецепторы, при помощи которых они связывают Fc-фрагменты антител или сшитые с Fc-фрагментом белки и осуществляют эффекторные функции. Такая популяция может включать мононуклеарные клетки периферической крови (РВМС) и/или естественные киллерные клетки (NK), но не ограничивается ими.

Термин "клетки-мишени", используемый здесь, обозначает клетки, с которыми специфично связываются антиген-связывающие молекулы, содержащие Fc фрагмент (например, антитела или их фрагменты, содержащие Fc фрагмент), или сшитые с Fc-фрагментом белки. Антиген-связывающие молекулы или сшитые с Fc-фрагментом белки связывают клетки-мишени через белковую часть, расположенную к N-концу от Fc фрагмента.

Термин "повышенная Fc-опосредованная клеточная цитотоксичность", используемый здесь, обозначает увеличение количества "клеток-мишеней", лизируемых за определенное время и при определенной концентрации антитела или сшитого с Fc-фрагментом белка в среде, окружающей клетки-мишени, за счет Fc-опосредованной клеточной цитотоксичности, механизм которой описан выше, и/или уменьшение концентрации антитела или сшитого с Fc-фрагментом белка в среде, окружающей клетки-мишени, необходимой для лизиса определенного количества "клеток-мишеней" за определенное время благодаря механизму Fc-опосредованной клеточной цитотоксичности. Повышение Fc-опосредованной клеточной цитотоксичности определяется относительно клеточной цитотоксичности, опосредованной той же антиген-связывающей молекулой или сшитым с Fc-фрагментом белком, которые получены в клетках-хозяевах того же типа, и для получения, очистки, формуляции и хранения которых использовали одни и те же стандартные способы (известные специалистам в данной области), но при этом продуцирующие их клетки, не подвергались модификации для изменения профиля гликозилирования (например, для экспрессии гликозилтрансферазы, GnTIII, или других гликозилтрансфераз) описанными здесь способами.

Под "антителом, имеющим повышенную антитело-зависимую клеточную цитотоксичность (ADCC)" подразумевают антитело, которое согласно данному здесь определению, имеет повышенную ADCC, определенную любым подходящим способом, известным специалистам в данной области. Один из возможных in vitro тестов на определение ADCC заключается в следующем:

1) в тесте используют клетки-мишени, экспрессирующие антиген-мишень, распознаваемый антиген-связывающим участком антитела;

2) в качестве эффекторных клеток в тесте используют мононуклеарные клетки периферической крови человека (PBMCs), выделенные из крови здоровых доноров, выбранных случайным образом;

3) тест проводят в соответствии со следующим протоколом:

i) выделение РВМС проводят при помощи стандартной процедуры центрифугирования в градиенте плотности и ресуспендируют в культуральной среде RPMI до концентрации 5×106 клеток/мл;

ii) клетки-мишени выращивают с помощью стандартных способов культивирования, собирают в фазе экспоненциального роста, при этом их жизнеспособность должна составлять более 90%, отмывают в культуральной среде RPMI, проводят мечение 51Cr (100 микро-Кюри), двукратно отмывают культуральной средой и ресуспендируют клетки в культуральной среде до концентрации 105 клеток/мл;

iii) переносят по 100 мкл полученной суспензии клеток-мишеней в лунки 96-луночного планшета для микротитрования;

iv) антитело серийно разводят от 4000 нг/мл до 0,04 нг/мл в среде для культивирования и добавляют по 50 мкл полученного раствора антитела к клеткам-мишеням в 96-луночный планшет для микротитрования антитело в различных концентрациях, перекрывающих весь диапазон концентраций, указанный выше, тестирование проводят в трипликатах;

v) в качестве контроля с максимальным высвобождением (MR) используют 3 дополнительные лунки планшета, содержащие меченые клетки-мишени, к которым вместо раствора антитела (см. п iv выше) добавляют по 50 мкл 2% (в объемном отношении) водного раствора неионного детергента (Nonidet, Sigma, St. Louis);

vi) в качестве контроля спонтанного высвобождения (SR) используют 3 дополнительные лунки планшета, содержащие меченые клетки-мишени, к которым вместо раствора антитела (см. п iv выше) добавляют по 50 мкл среды для культивирования RPMI;

vii) затем 96-луночный планшет для микротитрования центрифугируют при скорости 50×g в течение 1 минуты и инкубируют в течение 1 часа при 4°С;

viii) в каждую лунку добавляют по 50 мкл суспензии РВМС (см. п iv выше) для получения соотношения между эффекторными клетками и клетками-мишенями 25:1 и планшет помещают в инкубатор с содержанием 5% CO2 в атмосфере и температурой 37°С на 4 часа;

ix) из каждой лунки отбирают бесклеточный супернатант и при помощи гамма-счетчика замеряют испускаемую в ходе эксперимента радиоактивность (ER);

х) для каждой концентрации антитела рассчитывают количество специфически лизированных клеток (в процентах) по формуле (ER-MR)/(MR-SR)×100, где ER - средняя радиоактивность, измеренная для данной концентрации антитела (см пункт ix выше), MR - средняя радиоактивность, измеренная (см пункт ix выше) для контроля MR (см пункт v выше), а SR - средняя радиоактивность, измеренная (см пункт ix выше) для контроля SR (см пункт vi выше);

4) "повышенная ADCC" определяется либо как увеличение максимального уровня специфического лизиса (в %), наблюдавшегося в диапазоне концентраций антитела, исследованных выше, и/или как уменьшение концентрации антитела, требующейся для достижения половины от максимального уровня специфического лизиса, наблюдавшегося в диапазоне концентраций антитела, исследованных выше. Повышение ADCC определяется относительно ADCC, измеренной в вышеупомянутом тесте, опосредованной тем же антителом, полученным в клетках-хозяевах того же типа, и для получения, очистки, формуляции и хранения которого использовали одни и те же стандартные способы, известные специалистам в данной области, причем клетки, продуцирующие это антитело, не подвергались модификации для повышения экспрессии GnTIII.

II. Композиции и способы

Тенасцин-С, в частности А2 домен и другие образованные путем альтернативного сплайсинга домены тенасцина-С, специфично экспрессируются в определенных патологических условиях, но по существу отсутствуют в здоровых тканях взрослого организма, таким образом, антитела, нацеленные на данный антиген, имеют большой терапевтический потенциал. В настоящем изобретении предложены антитела, связывающиеся с А2 доменом тенасцина-С, в частности, антитела с высокой аффинностью и выраженными эффекторными функциями. Антитела по изобретению могут применяться, например, в диагностике и лечении заболеваний, для которых характерна экспрессия TNC А2, например, онкологических заболеваний.

А. Примеры антител к TNC A2

В настоящем изобретении предложены антитела, специфично связывающиеся с А2 доменом тенасцина С (TNC A2). В частности, в настоящем изобретении предложены антитела, специфично связывающие TNC A2, причем указанные антитела модифицируют с использованием гликоинженерии для повышения эффекторной функции.

В одном воплощении антитела к TNC A2 по изобретению включают по меньшей мере один (например, один, два, три, четыре, пять или шесть) определяющий комплементарность участок (CDR) тяжелой или легкой цепи, выбранный из группы SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45 и SEQ ID NO:47, или его варианты или укороченные формы, содержащие по меньшей мере, определяющие комплементарность остатки (SDRs) указанного CDR. В одном воплощении антитело к TNC A2 по изобретению содержит по меньшей мере один (например, один, два, три, четыре, пять или шесть) определяющий комплементарность участок (CDR) тяжелой или легкой цепей, выбранный из группы SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45 и SEQ ID NO:47, причем антитело не содержит комбинацию CDR1 тяжелой цепи (HCDR1), выбранного из группы SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, CDR2 тяжелой цепи (HCDR2), выбранного из группы SEQ ID NO:9, SEQ ID NO:15 и SEQ ID NO:21, CDR3 тяжелой цепи (HCDR3) по SEQ ID NO:27, CDR1 легкой цепи (LCDR1) по SEQ ID NO:29, CDR2 легкой цепи (LCDR2) по SEQ ID NO:35, и CDR3 легкой цепи (LCDR3) по SEQ ID NO:47.

В одном воплощении по меньшей мере один указанный CDR представляет собой CDR тяжелой цепи, в частности CDR3 тяжелой цепи по SEQ ID NO:27. В другом воплощении антитело содержит по меньшей мере один CDR тяжелой цепи и по меньшей мере один CDR легкой цепи, в частности CDR3 тяжелой цепи по SEQ ID NO:27 и CDR3 легкой цепи по SEQ ID NO:47.

В одном воплощении антитело по изобретению содержит по меньшей мере один, по меньшей мере два или по меньшей мере три последовательности CDR тяжелой цепи (HCDR), выбранные из (a) HCDR1, содержащего аминокислотную последовательность, выбранную из группы SEQ ID NO:3, SEQ ID NO:5 и SEQ ID NO:7; (6) HCDR2 содержащего аминокислотную последовательность, выбранную из группы SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23 и SEQ ID NO:25; и (в) HCDR3, содержащего аминокислотную последовательность по SEQ ID NO:27. В следующем воплощении антитело содержит вариабельный участок тяжелой цепи, содержащий (a) CDR1 тяжелой цепи, выбранный из группы SEQ ID NO:3, SEQ ID NO:5 и SEQ ID NO:7; (6) CDR2 тяжелой цепи, выбранный из группы SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23 и SEQ ID NO:25; и (в) CDR3 тяжелой цепи по SEQ ID NO:27, или их варианты или укороченные формы, содержащие по меньшей мере SDRs указанных CDRs.

В одном воплощении антитело по изобретению содержит по меньшей мере одну, по меньшей мере две, или все три последовательности CDR легкой цепи (LCDR), выбранные из (a) LCDR1, содержащего аминокислотную последовательность, выбранную из группы SEQ ID NO:29, SEQ ID NO:31 и SEQ ID NO:33; (6) LCDR2 содержащего аминокислотную последовательность, выбранную из группы SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43 и SEQ ID NO:45; и (в) LCDR3 содержащего аминокислотную последовательность по SEQ ID NO:47. В следующем воплощении антитело содержит вариабельный участок легкой цепи, содержащий (а) CDR1 легкой цепи, выбранный из группы SEQ ID NO:29, SEQ ID NO:31 и SEQ ID NO:33; (6) CDR2 легкой цепи, выбранный из группы SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43 и SEQ ID NO:45; и (в) CDR3 легкой цепи по SEQ ID NO:47, или их варианты или укороченные формы, содержащие по меньшей мере SDRs указанных CDRs.

В одном воплощении антитело по изобретению содержит вариабельный участок тяжелой цепи, содержащий CDR1 тяжелой цепи, выбранный из группы SEQ ID NO:3, SEQ ID NO:5 и SEQ ID NO:7; CDR2 тяжелой цепи, выбранный из группы SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23 и SEQ ID NO:25; и CDR3 тяжелой цепи по SEQ ID NO:27, и вариабельный участок легкой цепи, содержащий CDR1 легкой цепи, выбранный из группы SEQ ID NO:29, SEQ ID NO:31 и SEQ ID NO:33; CDR2 легкой цепи, выбранный из группы SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43 и SEQ ID NO:45; и CDR3 легкой цепи по SEQ ID NO:47, или их варианты или укороченные формы, содержащие по меньшей мере SDRs указанных CDRs.

В другом воплощении антитело по изобретению содержит вариабельный участок тяжелой цепи, содержащий CDR1 тяжелой цепи, выбранный из группы SEQ ID NO:3, SEQ ID NO:5 и SEQ ID NO:7; CDR2 тяжелой цепи, выбранный из группы SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23 и SEQ ID NO:25; и CDR3 тяжелой цепи по SEQ ID NO:27, и вариабельный участок легкой цепи, содержащий CDR1 легкой цепи, выбранный из группы SEQ ID NO:29, SEQ ID NO:31 и SEQ ID NO:33; CDR2 легкой цепи, выбранный из группы SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43 и SEQ ID NO:45; и CDR3 легкой цепи по SEQ ID NO:47, причем указанное антитело не содержит комбинацию CDR1 тяжелой цепи (HCDR1), выбранного из группы SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, CDR2 тяжелой цепи (HCDR2), выбранного из группы SEQ ID NO:9, SEQ ID NO:15 и SEQ ID NO:21, CDR3 тяжелой цепи (HCDR3) по SEQ ID NO:27, CDR1 легкой цепи (LCDR1) по SEQ ID NO:29, CDR2 легкой цепи (LCDR2) по SEQ ID NO:35, и CDR3 легкой цепи (LCDR3) по SEQ ID NO:47.

В определенном воплощении антитело по изобретению содержит вариабельный участок тяжелой цепи, содержащий CDR1 тяжелой цепи, выбранный из группы SEQ ID NO:3, SEQ ID NO:5 и SEQ ID NO:7; CDR2 тяжелой цепи, выбранный из группы SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:23 и SEQ ID NO:25; и CDR3 тяжелой цепи по SEQ ID NO:27, и вариабельный участок легкой цепи, содержащий CDR1 легкой цепи по SEQ ID NO:29, CDR2 легкой цепи по SEQ ID NO:35, и CDR3 легкой цепи по SEQ ID NO:47. В другом определенном воплощении антитело по изобретению содержит вариабельный участок тяжелой цепи, содержащий CDR1 тяжелой цепи, выбранный из группы SEQ ID NO:3, SEQ ID NO:5 и SEQ ID NO:7; CDR2 тяжелой цепи, выбранный из группы SEQ ID NO:9, SEQ ID NO:15 и SEQ ID NO:21; и CDR3 тяжелой цепи по of SEQ ID NO:27, и вариабельный участок легкой цепи, содержащий CDR1 легкой цепи, выбранный из группы SEQ ID NO:29, SEQ ID NO:31 и SEQ ID NO:33; CDR2 легкой цепи, выбранный из группы SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43 и SEQ ID NO:45; и CDR3 легкой цепи по SEQ ID NO:47. В еще одном определенном воплощении антитело по изобретению содержит вариабельный участок тяжелой цепи, содержащий CDR1 тяжелой цепи, выбранный из группы SEQ ID NO:3, SEQ ID NO:5 и SEQ ID NO:7; CDR2 тяжелой цепи, выбранный из группы SEQ ID NO:9, SEQ ID NO:15 и SEQ ID NO:21; и CDR3 тяжелой цепи по SEQ ID NO:27, и вариабельный участок легкой цепи, содержащий CDR1 легкой цепи по SEQ ID NO:29, CDR2 легкой цепи по SEQ ID NO:35; и CDR3 легкой цепи по SEQ ID NO:47.

В одном воплощении антитело по изобретению содержит вариабельный участок тяжелой цепи (VH), содержащий аминокислотную последовательность, имеющую по меньшей мере приблизительно 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности с последовательностью, выбранной из группы SEQ ID NO:59, SEQ ID NO:67 и SEQ ID NO:63. В одном воплощении антитело содержит вариабельный участок тяжелой цепи, содержащий аминокислотную последовательность, выбранную из группы: SEQ ID NO:59, SEQ ID NO:67 и SEQ ID NO:63.

В некоторых воплощениях последовательность VH, имеющая по меньшей мере 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности имеет замены (например, консервативные замены), инсерции или делеции по сравнению с референсной последовательностью, но антитело к TNC A2, имеющее такую последовательность, сохраняет способность связывать TNC A2. В некоторых воплощениях, в общей сложности от 1 до 10 аминокислот в последовательности SEQ ID NO 59, 63 или 67 подвергается замене, инсерции и/или делеции. В некоторых воплощениях замены, инсерции или делеции возникают в участках за пределами HVRs или CDRs (т.е., в каркасных участках). Возможно, антитело к TNC A2 по изобретению содержит последовательность VH no SEQ ID NO 59, 63 или 67, включая пост-трансляционные модификации этой последовательности. В конкретном воплощении VH содержит один, два или три CDRs тяжелой цепи, выбранные из последовательностей, приведенных в SEQ ID NOs 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25 и 27 для HCDR1, HCDR2 и HCDR3.

В другом воплощении антитело по изобретению содержит вариабельный участок легкой цепи, содержащий аминокислотную последовательность, имеющую по меньшей мере приблизительно 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности с последовательностью, выбранной из группы SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85 и SEQ ID NO:89. В следующем воплощении антитело содержит вариабельный участок легкой цепи, содержащий аминокислотную последовательность, выбранную из группы: SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85 и SEQ ID NO:89.

В некоторых воплощениях последовательность VL, имеющая по меньшей мере 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности имеет замены (например, консервативные замены), инсерции или делеции по сравнению с референсной последовательностью, но антитело к TNC A2, содержащее эту последовательность, сохраняет способность связывать TNC A2. В определенных воплощениях в общей сложности от 1 до 10 аминокислотных остатков в последовательностях SEQ ID NO 55, 57, 69, 73, 77, 81, 85 или 89 подвергается замене, инсерции и/или делеции. В некоторых воплощениях замены, инсерции или делеции возникают в участках за пределами HVRs или CDRs (т.е., в каркасных участках). Возможно, антитело к TNC A2 по изобретению содержит последовательность VL no SEQ ID NO 55, 57, 69, 73, 77, 81, 85 или 89, включая пост-трансляционные модификации этой последовательности. В конкретном воплощении VL содержит один, два или три CDRs легкой цепи, выбранные из последовательностей приведенных в SEQ ID NOs 29, 31, 33, 35, 37, 39, 41, 43, 45 и 47 для LCDR1, LCDR2 и LCDR3.

В другом аспекте предложено антитело к TNC A2, содержащее VH, как в любом из описанных выше воплощений и VL, как в любом из описанных выше воплощений. В одном воплощении антитело содержит вариабельный участок тяжелой цепи, содержащий аминокислотную последовательность, которая по меньшей мере приблизительно на 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или 100% идентична последовательности, выбранной из группы: SEQ ID NO:59, SEQ ID NO:67 и SEQ ID NO:63, и вариабельный участок легкой цепи, содержащий аминокислотную последовательность, которая по меньшей мере приблизительно на 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или 100% идентична последовательности, выбранной из группы: SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85 и SEQ ID NO:89. В одном воплощении антитело содержит последовательности VH и VL по SEQ ID NO 59, 63 или 67 и SEQ ID NO 55, 57, 69, 73, 77, 81, 85 или 89, соответственно, включая пост-трансляционные модификации этих последовательностей.

В одном воплощении антитело содержит вариабельный участок тяжелой цепи, содержащий аминокислотную последовательность, выбранную из группы: SEQ ID NO:59, SEQ ID NO:67 и SEQ ID NO:63, и вариабельный участок легкой цепи, содержащий аминокислотную последовательность, выбранную из группы: SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85 и SEQ ID NO:89, причем указанное антитело не содержит комбинацию вариабельного участка тяжелой цепи, содержащего аминокислотную последовательность по SEQ ID NO:59 и вариабельного участка легкой цепи, содержащего аминокислотную последовательность по SEQ ID NO:55 или SEQ ID NO:57.

В определенном воплощении антитело по изобретению содержит вариабельный участок тяжелой цепи, содержащий аминокислотную последовательность SEQ ID NO:59 и вариабельный участок легкой цепи, содержащий аминокислотную последовательность, выбранную из группы SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85 и SEQ ID NO:89. В другом определенном воплощении антитело по изобретению содержит вариабельный участок тяжелой цепи, содержащий аминокислотную последовательность по SEQ ID NO:63 или SEQ ID NO:67 и вариабельный участок легкой цепи, содержащий аминокислотную последовательность по SEQ ID NO:57. В следующем определенном воплощении антитело по изобретению содержит вариабельный участок тяжелой цепи, содержащий аминокислотную последовательность по SEQ ID NO:59 и вариабельный участок легкой цепи, содержащий аминокислотную последовательность по SEQ ID NO:55 или SEQ ID NO:57. В конкретном воплощении антитело по любому из вышеупомянутых воплощений дополнительно содержит Fc фрагмент или участок, эквивалентный Fc фрагменту иммуноглобулина.

В одном воплощении антитело по изобретению содержит Fc фрагмент, в частности, Fc фрагмент IgG, более конкретно Fc фрагмент IgG1.

В конкретном воплощении антитело по изобретению представляет собой полноразмерное антитело, в частности, антитело класса IgG, более конкретно антитело изотипа lgG1. В другом воплощении антитело по изобретению представляет собой фрагмент антитела, выбранный из группы: scFv фрагмента, Fv фрагмента, Fab фрагмента и F(ab')2 фрагмента. В следующем воплощении антитело по изобретению представляет собой фрагмент антитела, имеющий Fc фрагмент или гибридный белок, содержащий участок, эквивалентный Fc фрагменту иммуноглобулина. В одном воплощении антитело по изобретению представляет собой моноклональное антитело.

В одном воплощении антитело по изобретению представляет собой химерное, более конкретно гуманизированное антитело. В конкретном воплощении антитело по изобретению представляет собой человеческое антитело. В другом воплощении антитело по изобретению содержит константный участок человека. В одном воплощении антитело по изобретению содержит Fc фрагмент человека, предпочтительно Fc фрагмент IgG человека, более конкретно Fc фрагмент IgG1 человека.

В одном воплощении антитело по изобретению содержит константный участок тяжелой цепи, когда указанный константный участок представляет собой константный участок IgG человека, в частности, константный участок IgG1 человека, содержащий Fc фрагмент. В определенном воплощении антитело содержит константный участок тяжелой цепи, содержащий аминокислотную последовательность по SEQ ID NO:93. В другом определенном воплощении антитело по изобретению содержит константный участок легкой цепи, содержащий аминокислотную последовательность по SEQ ID NO:95. в следующем определенном воплощении антитело по изобретению содержит константный участок тяжелой цепи, содержащий аминокислотную последовательность по SEQ ID NO:93, и константный участок легкой цепи, содержащий аминокислотную последовательность по SEQ ID NO:95.

В конкретном воплощении изобретения предложено антитело, специфично связывающееся с TNC A2, где указанное антитело содержит а) вариабельный участок тяжелой цепи, содержащий аминокислотную последовательность, которая по меньшей мере приблизительно на 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или 100% иденична последовательности, выбранной из группы SEQ ID NO:59, SEQ ID NO:67 и SEQ ID NO:63, или вариабельный участок легкой цепи, содержащий аминокислотную последовательность, которая по меньшей мере приблизительно на 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или 100% идентична последовательности, выбранной из группы SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85 и SEQ ID NO:89, или их комбинацию, и б) Fc фрагмент или участок, эквивалентный Fc фрагменту иммуноглобулина.

В одном воплощении антитело по изобретению содержит Fc фрагмент, причем указанный Fc фрагмент представляет собой модифицированный с использованием гликоинженерии Fc фрагмент. В следующем воплощении антитело по изобретению является модифицированным с использованием гликоинженерии и имеет модифицированные олигосахариды в Fc фрагменте. В определенном воплощении антитело имеет повышенное содержание разветвленных олигосахаридов в Fc фрагменте по сравнению с не модифицированным с использованием гликоинженерии антителом. В более конкретном воплощении по меньшей мере приблизительно 10%, приблизительно 15%, приблизительно 20%, приблизительно 25%, приблизительно 30%, приблизительно 35%, приблизительно 40%, приблизительно 45%, приблизительно 50%, приблизительно 55%, приблизительно 60%, приблизительно 65%, приблизительно 70%, приблизительно 75%, приблизительно 80%, приблизительно 85%, приблизительно 90%, приблизительно 95% или приблизительно 100%, предпочтительно по меньшей мере приблизительно 50%, более предпочтительно по меньшей мере приблизительно 70%, из N-связанных олигосахаридов в Fc фрагменте антитела представляют собой разветвленные олигосахариды. Разветвленные олигосахариды могут быть гибридными или сложными.

В другом определенном воплощении антитело по изобретению имеет повышенное содержание нефукозилированных олигосахаридов в Fc фрагменте по сравнению с не модифицированным с использованием гликоинженерии антителом. В более конкретном воплощении по меньшей мере приблизительно 20%, приблизительно 25%, приблизительно 30%, приблизительно 35%, приблизительно 40%, приблизительно 45%, приблизительно 50%, приблизительно 55%, приблизительно 60%, приблизительно 65%, приблизительно 70%, приблизительно 75%, приблизительно 80%, приблизительно 85%, приблизительно 90%, приблизительно 95% или приблизительно 100%, предпочтительно по меньшей мере приблизительно 50%, более предпочтительно по меньшей мере приблизительно 70% из N-связанных олигосахаридов в Fc фрагменте антитела являются нефукозилированными. Нефукозилированные олигосахариды могут быть гибридными или сложными.

В конкретном воплощении антитело по изобретению имеет повышенное содержание нефукозилированных разветвленных олигосахаридов в Fc фрагменте по сравнению с не модифицированным с использованием гликоинженерии антителом. В частности, антитело содержит Fc фрагмент, в котором по меньшей мере приблизительно 10%, приблизительно 15%, приблизительно 20%, приблизительно 25%, приблизительно 30%, приблизительно 35%, приблизительно 40%, приблизительно 45%, приблизительно 50%, приблизительно 55%, приблизительно 60%, приблизительно 65%, приблизительно 70%, приблизительно 75%, приблизительно 80%, приблизительно 85%, приблизительно 90%, приблизительно 95% или приблизительно 100%, предпочтительно по меньшей мере приблизительно 15%, более предпочтительно по меньшей мере приблизительно 25%, по меньшей мере приблизительно 35% или по меньшей мере приблизительно 50% из N-связанных олигосахаридов являются нефукозилированными и разветвленными. Нефукозилированные разветвленные олигосахариды могут быть гибридными или сложными.

В одном воплощении антитело по изобретению имеет повышенную эффекторную функцию и/или повышенную аффинность связывания Fc рецепторов. Повышенная эффекторная функция и/или повышенное связывание Fc рецепторов могут быть результатом, например, модификации с использованием гликоинженерии антител и/или афинного созревания антител. В одном воплощении повышенная эффекторная функция и/или повышенное связывание Fc рецепторов является результатом модификации с использованием гликоинженерии Fc фрагмента антитела. В другом воплощении повышенная эффекторная функция и/или повышенное связывание Fc рецептора является результатом сочетания увеличения аффинности и модификации с использованием гликоинженерии. Повышенная эффекторная функция может включать одну или несколько из перечисленных ниже функций: повышенную Fc-опосредованную клеточную цитотоксичность (включая повышенную антитело-зависимую клеточную цитотоксичность (ADCC)), усиленный антитело-зависимый фагоцитоз клеток (ADCP), повышенную секрецию цитокинов, усиленный захват антигена антиген-презентирующими клетками, опосредованный иммунными комплексами, повышенное связывание с NK клетками, повышенное связывание с макрофагами, повышенное связывание с моноцитами, повышенное связывание с полиморфноядерными клетками, активацию сигнальных путей, индуцирующую апоптоз, повышенное образование поперечных связей между антителами, связанными с мишенями, ускоренное созревание дендритных клеток или усиленный прайминг Т клеток, но не ограничивается ими. В конкретном воплощении повышенная эффекторная функция представляет собой повышенную ADCC. Повышенное связывание Fc рецепторов предпочтительно является повышенным связыванием с активирующим Fc рецептором, наиболее предпочтительно, с FcγRIIIa.

В одном воплощении антитело по изобретению не вызывает клинически значимых проявлений токсичности при введении индивиду в терапевтически эффективном количестве.

В одном воплощении антитело по изобретению представляет собой антитело, подвергнутое аффинному созреванию. В следующем воплощении антитело по изобретению связывает А2 домен тенасцина С (TNC A2) с константной диссоциации (KD) менее чем приблизительно от 1 мкМ до приблизительно 0,001 нМ, в частности с KD менее чем приблизительно 100 нМ, менее чем приблизительно 20 нМ, менее чем приблизительно 10 нМ, или менее чем приблизительно 1 нМ. В одном воплощении антитело по изобретению связывает A2 домен TNC A2 человека, мыши и яванского макака. В одном воплощении, антитело по изобретению связывает A2 домен TNC A2 человека и яванского макака. В более конкретном воплощении антитело по изобретению связывает A2 домен TNC A2 человека и яванского макака с Ко менее чем приблизительно 20 нМ, менее чем приблизительно 10 нМ, или менее чем приблизительно 1 нМ. Значения Ко определяют при помощи метода поверхностного плазменного резонанса, с использованием антител в виде Fab или IgG, предпочтительно в виде IgG.

В одном воплощении, антитело к TNC A2 по изобретению связывает TNC A2 в тканях человека.

В конкретном воплощении изобретения предложено антитело, которое специфично связывается с A2 доменом тенасцина С (TNC A2), где указанное антитело содержит вариабельный участок тяжелой цепи, содержащий аминокислотную последовательность, выбранную из группы SEQ ID NO:59, SEQ ID NO:67 и SEQ ID NO:63, вариабельный участок легкой цепи, содержащий аминокислотную последовательность, выбранную из группы SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85 и SEQ ID NO:89, и Fc фрагмент IgG человека, и где указанное антитело возможно модифицировано с использованием гликоинженерии для повышения эффекторной функции и/или аффинности связывания Fc рецепторов. В другом конкретном воплощении изобретения предложено антитело, которое специфично связывается с A2 доменом тенасцина С (TNC A2), где указанное антитело содержит вариабельный участок тяжелой цепи, содержащий аминокислотную последовательность, выбранную из группы SEQ ID NO:59, SEQ ID NO:67 и SEQ ID NO:63, вариабельный участок легкой цепи, содержащий аминокислотную последовательность, выбранную из группы SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85 и SEQ ID NO:89 и Fc фрагмент IgG человека, и где указанное антитело имеет повышенное содержание нефукозилированных олигосахаридов и/или повышенное содержание разветвленных олигосахаридов в указанном Fc фрагменте.

В одном аспекте изобретения предложено антитело, специфично связывающееся с А2 доменом тенасцина С (TNC A2), где указанное антитело получено из родительского антитела, содержащего CDR1 тяжелой цепи по SEQ ID NO:3, CDR2 тяжелой цепи по SEQ ID NO:9, CDR3 тяжелой цепи по SEQ ID NO:27, CDR1 легкой цепи по SEQ ID NO:29, CDR2 легкой цепи по SEQ ID NO:35 и CDR3 легкой цепи по SEQ ID NO:47, и где указанное антитело содержит по меньшей мере одну аминокислотную замену по меньшей мере в одном CDR тяжелой или легкой цепи родительского антитела. Например, антитело может содержать по меньшей мере один, например, приблизительно от одного до десяти (например, приблизительно 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10), и, в частности, от приблизительно двух до приблизительно пяти замен в одном или более гипервариабельных участках или CDRs (например, 1, 2, 3, 4, 5 или 6 гипервариабельных участках или CDRs) родительского антитела. В некоторых воплощениях любые одна или несколько аминокислот родительского антитела, предложенного выше, заменены в следующих позициях CDR:

- CDR2 тяжелой цепи (SEQ ID NO:9): позиции 1, 6 и 8

- CDR1 легкой цепи (SEQ ID NO:29): позиции 5 и 9

- CDR1 легкой цепи (SEQ ID NO:35): позиции 1, 2 и 3

В некоторых воплощениях замены являются консервативными заменами, согласно описанию здесь. В некоторых воплощениях любые одна или несколько из следующих замен могут быть выполнены в любой комбинации:

- CDR2 тяжелой цепи (SEQ ID NO:9): G1A или V, F6L, T8I

- CDR1 легкой цепи (SEQ ID NO:29): G5S, D9V

- CDR1 легкой цепи (SEQ ID NO:35): A1D, A2S или V, S3Y или Т

Кроме этого, антитело может также содержать одну или более вставок, делеций и/или замен в одном или нескольких каркасных участках как тяжелой, так и легкой цепей, в сравнении с родительским антителом. В одном воплощении, по меньшей мере одна указанная аминокислотная замена в по меньшей мере одном CDR вносит вклад в увеличение аффинности связывания антитела по сравнению с его родительским антителом. В другом воплощении указанное антитело имеет аффинность к TNC A2, увеличенную по меньшей мере от 2- до 10-раз по сравнению с родительским антителом (при сравнении антитела по изобретению и родительского антитела, в одинаковом формате, например, в формате Fab). Более того, антитело, полученное из родительского антитела, может иметь любые описанные в предыдущих параграфах признаки, относящиеся к антителу по изобретению, как в отдельности, так и в сочетании.

В настоящем изобретении также предложены полинуклеотиды, кодирующие антитела, специфично связывающиеся с А2 доменом тенасцина-С. В одном аспекте изобретение касается выделенного полинуклеотида, кодирующего полипептид, формирующий часть антитела к TNC А2 по изобретению, как здесь описано выше. В одном воплощении выделенный полинуклеотид кодирует тяжелую цепь антитела и/или легкую цепь антитела, формирующие часть антитела к TNC A2 по изобретению, как описано выше.

В одном воплощении изобретение касается выделенного полинуклеотида, содержащего последовательность, кодирующую один или более (например, один, два, три, четыре, пять или шесть) участков, определяющих комплементарность (CDRs) тяжелой или легкой цепи, приведенных в SEQ ID NOs 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45 и 47, или их варианты или укороченные формы, содержащие по меньшей мере определяющие специфичность остатки (SDRs) указанных CDR. В другом воплощении полинуклеотид содержит последовательность, кодирующую три CDRs тяжелой цепи (например, HCDR1, HCDR2 и HCDR3) или три CDRs легкой цепи (например, LCDR1, LCDR2 и LCDR3), выбранные из SEQ ID NOs 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45 и 47, или их варианты или укороченные формы, содержащие по меньшей мере SDRs каждого из трех указанных участков, определяющих комплементарность. В следующем воплощении полинуклеотид содержит последовательность, кодирующую три CDRs тяжелой цепи (например, HCDR1, HCDR2 и HCDR3) и три CDRs легкой цепи (например, LCDR1, LCDR2 и LCDR3), выбранные из SEQ ID NOs 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45 и 47. В конкретном воплощении полинуклеотид, кодирующий один или более CDRs, содержит последовательность, которая по меньшей мере приблизительно на 90%, 95%, 96%, 97%, 98%, 99% или 100% идентична одной или нескольким нуклеотидным последовательностям CDR по SEQ ID NOs 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 49, 50, 51, 52, 53 и 54.

В следующем воплощении полинуклеотид содержит последовательность, кодирующую вариабельный участок тяжелой цепи, выбранный из группы SEQ ID NO:59, SEQ ID NO:67 и SEQ ID NO:63, и/или последовательность, кодирующую вариабельный участок легкой цепи, выбранный из группы SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85 и SEQ ID NO:89. В конкретном воплощении полинуклеотид, кодирующий вариабельный участок тяжелой и/или легкой цепи, содержит последовательность, выбранную из группы нуклеотидных последовательностей вариабельных участков, состоящей из SEQ ID NOs 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90 и 92, или их комбинаций.

В определенном воплощении полинуклеотид содержит последовательность, кодирующую вариабельный участок тяжелой цепи, выбранный из группы SEQ ID NO:59, SEQ ID NO:67 и SEQ ID NO:63, и последовательность, кодирующую константный участок тяжелой цепи, в частности, константный участок тяжелой цепи человека. В конкретном воплощении указанный константный участок тяжелой цепи представляет собой константный участок тяжелой цепи IgG, в частности, константный участок тяжелой цепи IgG1 человека, содержащий Fc фрагмент. В определенном воплощении указанный константный участок тяжелой цепи содержит последовательность по SEQ ID NO:93. В другом определенном воплощении полинуклеотид содержит последовательность, кодирующую вариабельный участок легкой цепи, выбранный из группы SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85 и SEQ ID NO:89, и последовательность, кодирующую константный участок легкой цепи, в частности, константный участок легкой цепи человека. В определенном воплощении указанный константный участок легкой цепи содержит последовательность по SEQ ID NO:95.

В одном воплощении изобретение касается композиции, содержащей первый выделенный полинуклеотид, кодирующий полипептид, содержащий аминокислотную последовательность, которая по меньшей мере приблизительно на 90%, 95%, 96%, 97%, 98%, 99% или 100% идентична последовательности, выбранной из группы, состоящей из SEQ ID NO:59, SEQ ID NO:67 и SEQ ID NO:63, и второй выделенный полинуклеотид, кодирующий полипептид, содержащий аминокислотную последовательность, которая по меньшей мере приблизительно на 90%, 95%, 96%, 97%, 98%, 99% или 100% идентична последовательности, выбранной из группы, состоящей из SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:69, SEQ ID NO:73, SEQ ID NO:77, SEQ ID NO:81, SEQ ID NO:85 и SEQ ID NO:89.

В одном воплощении, изобретение касается композиции, содержащей первый выделенный полинуклеотид, содержащий последовательность, которая по меньшей мере приблизительно на 90%, 95%, 96%, 97%, 98%, 99% или 100% идентична последовательности, выбранной из группы, состоящей из SEQ ID NO:60, SEQ ID NO:68, и SEQ ID NO:64, и второй выделенный полинуклеотид, содержащий последовательность, которая по меньшей мере приблизительно на 90%, 95%, 96%, 97%, 98%, 99% или 100% идентична последовательности, выбранной из группы, состоящей из SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:78, SEQ ID NO:82, SEQ ID NO:86 и SEQ ID NO:90.

В следующем аспекте изобретение также касается выделенных полипептидов, кодируемых любым из полинуклеотидов согласно изобретению и описанию выше.

В следующем аспекте антитело к TNC A2 по любому из вышеуказанных воплощений может обладать любыми признаками, в отдельности или в сочетании, согласно описанию ниже в Разделах 1-6:

1. Аффинность антитела

В некоторых воплощениях предложенное здесь антитело имеет константу диссоциации (KD) ≤1 мкМ, ≤100 нМ, ≤10 нМ, ≤1 нМ, ≤0,1 нМ, ≤0,01 нМ или s 0,001 нМ (например, 10-8М или менее, например, от 10-8 М до 10-13 М, например, от 10-9 М до 10-13 М). Предпочтительно, предложенные здесь антитела связывают A2 домен тенасцина-С (TNC A2), в частности, TNC A2 человека с Ко менее 1 нМ, при определении с помощью метода поверхностного плазмонного резонанса (SPR).

Согласно одному воплощению KD измеряют при помощи метода поверхностного плазмонного резонанса. Определение может проводиться, например, с использованием прибора BIACORE®-T100 (GE Healthcare) при 25°С при иммобилизации биотинилированного антигена на поверхности стрептавидинового чипа для достижения уровня связывания ~80 единиц RU. Вкратце, для иммобилизации антиген разводят в 10 мМ HEPES, 150 мМ NaCl, 3 мМ EDTA, 0,05% сурфактант Р20, рН 7,4, до концентрации 0,1 мкг/мл перед инжектированием со скоростью 10 мкл/мин, для достижения уровня связывания белка приблизительно 80 единиц RU. Последовательности аминокислот и ДНК конструкции подходящих антигенов показаны в SEQ ID NOs 99-104. Для определения кинетики инжектируют серию двукратных разведении Fab (1,56 нМ до 100 нМ) или IgG (0,9 нМ до 25 нМ) в 10 мМ HEPES, 150 мМ NaCl, 3 мМ EDTA, 0,05% сурфактант Р20, рН 7,4 при 25°С со скоростью приблизительно 50 мкл/мин. Время связывания и диссоциации составляет 180 сек, между двумя циклами выполняют регенерацию при помощи раствора 10 мМ глицина рН 1,5 в течение 60 сек. Скорости ассоциации (kon) и диссоциации (koff) рассчитывают с использованием простой модели связывания один к одному, предложенной Ленгмюром (при помощи программного обеспечения BIACORE® T100 Evaluation версия 1.1.1) при одновременной аппроксимации сенсограмм ассоциации и диссоциации. Константу равновесной диссоциации (Ко) рассчитывают как отношение koff/kon. См., например, Chen et al., J. Mol. Biol. 293:865-881 (1999)..

2. Фрагменты антител

В некоторых воплощениях предложенное здесь антитело предствляет собой фрагмент антитела. Фрагменты антител включают Fab, Fab', Fab'-SH, F(ab')2, Fv и scFv фрагменты, а также другие фрагменты, описанные ниже, но не ограничиваются ими. Обзор некоторых фрагментов антител представлен в публикации Hudson et al. Nat. Med. 9:129-134 (2003) или Carter, Nat. Rev. Immunol. 6:343-357 (2006).

Одноцепочечные Fv или scFv фрагменты содержат VH домен и VL домен в виде одной полипептидной цепи. Как правило, VH и VL домены соединены при помощи линкерной последовательности. Обзор scFv фрагментов представлен, например, Pluckthun, in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., (Springer-Verlag, New York), pp.269-315 (1994); см. также WO 93/16185; и патенты США 5,571,894 и 5,587,458. В патенте США 5,869,046 обсуждаются Fab и F(ab')2 фрагменты, содержащие аминокислотные остатки эпитопа связывания «рецептора спасения» и имеющие повышенное время полужизни in vivo.

Диатела являются фрагментами антител с двумя антиген-связывающими сайтами, которые могут быть бивалентными или биспецифичными. См., например, ЕР 404,097; WO 1993/01161; Hudson et al., Nat. Med. 9:129-134 (2003); и Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993). Триатела и тетратела антитела также описаны Hudson et al., Nat. Med. 9:129-134 (2003).

Миниантитело представляет собой бивалентное гомодимерное производное scFv, имеющее в качестве участка димеризации константный участок, как правило, СН3 участок иммуноглобулина, предпочтительно IgG, более предпочтительно IgG1. Как правило, константный участок соединен с scFv через шарнирный участок и/или линкерный участок. Примеры белковых миниантител могут быть найдены в публикации Ни et al., Cancer Res. 56: 3055-61 (1996).

Однодоменные антитела представляют собой фрагменты антител, содержащие весь вариабельный домен тяжелой цепи или его часть или весь вариабельный домен легкой цепи антитела или его часть. В некоторых воплощениях однодоменные антитела представляют собой однодоменные антитела человека (Domantis, Inc., Waltham, MA; см., например, патент США 6,248,516 В1).

Фрагменты антител могут быть получены при помощи различных методик, включая протеолитическое расщепление интактного антитела, а также продукцию в рекомбинантных клетках-хозяевах (например, E. coli или фагах), согласно описанию здесь, но не ограничиваясь ими.

3. Химерные и гуманизированные антитела

В некоторых воплощениях предложенное здесь антитело представляет собой химерное антитело. Некоторые химерные антитела описаны, например, в патенте США 4,816,567; и Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)). В одном примере химерное антитело содержит вариабельный участок, не являющийся человеческим (например, вариабельный участок полученный у мыши, крысы, хомяка, кролика или не являющегося человеком примата, например, обезьяны) и константный участок человека. В следующем примере химерное антитело представляет собой антитело "с переключенным классом", у которого класс или подкласс были изменены по сравнению с родительским антителом. Химерные антитела включают также их антиген-связывающие фрагменты.

В некоторых воплощениях химерное антитело представляет собой гуманизированное антитело. Как правило, антитело, не являющееся человеческим, подвергают гуманизации, чтобы снизить иммуногенность для человека, при этом сохраняя специфичность и аффинность родительского антитела, не являющегося человеческим. Как правило, гуманизированное антитело содержит один или более вариабельных доменов, в которых HVRs, например, CDRs, (или их части) получены из антитела, не являющегося человеческим, а каркасные участки FRs (или их части) получены на основе последовательностей антитела человека. Возможно гуманизированное антитело также содержит по меньшей мере часть константного участка человека. В некоторых воплощениях некоторые остатки FR в гуманизированном антителе заменены соответствующими остатками антитела, не являющегося человеческим (например, антитела из которого получены аминокислотные остатки HVR), например, для восстановления или улучшения специфичности или аффинности антитела. Гуманизацию можно осуществлять различными способами, включая (а) пересаживание целиком вариабельных доменов, не являющихся человеческими на константные участки человека с получением химерных антител, (б) пересаживания только CDRs, не являющихся человеческими (например, антитела-донора) на каркасные участки и константные участки человека (например, антитела-реципиента) с сохранением или без сохранения ключевых остатков каркасных участков (например, тех, которые важны для сохранения хорошей аффинности связывания антигена или функций антитела), (в) пересаживания только участков, определяющих специфичность (SDRs или a-CDRs; остатков, имеющих ключевое значение для взаимодействия антиген-антитело), не являющихся человеческими на каркасные участки и константные участки человека, или (г) трансплантации не являющихся человеческими вариабельных доменов целиком, но "укрывания" их антропоморфными участками путем замены поверхностных аминокислотных остатков, но не ограничиваясь ими. Гуманизированные антитела и способы их получения представлены, например, в обзоре, Almagro and Fransson, Front. Biosci. 13:1619-1633 (2008), и более подробно описаны, например, Riechmann et al., Nature 332:323-329 (1988); Queen et al., Proc. Nat'l Acad. Sci. USA 86:10029-10033 (1989); в патентах США 5, 821,337, 7,527,791, 6,982,321 и 7,087,409; Jones et al., Nature 321:522-525 (1986); Morrison et al., Proc. Natl. Acad. Sci. 81:6851-6855 (1984); Morrison and Oi, Adv. Immunol. 44:65-92 (1988); Verhoeyen et al., Science 239:1534-1536 (1988); Padlan, Molec. Immun. 31(3):169-217 (1994); Kashmir! et al., Methods 36:25-34 (2005) (описание пересадки SDR (a-CDR)); Padlan, Mol. Immunol. 28:489-498 (1991) (описание "изменения поверхности"); Dall'Acqua et al., Methods 36:43-60 (2005) (описание "рекомбинации FR"); и Osbourn et al., Methods 36:61-68 (2005) и Klimka et al., Br. J. Cancer 83:252-260 (2000) (описание "направленного отбора" для рекомбинации FR).

Каркасные участки человека, которые могут быть использованы для гуманизации, включают: каркасные участки, выбранные при помощи метода "максимального соответствия" (см., например, Sims et al. J. Immunol. 151:2296 (1993)); каркасные участки, полученные из консенсусных последовательностей человеческих антител с вариабельными участками легкой или тяжелой цепей определенной подгруппы (см., например, Carter et al. Proc. Natl. Acad. Sci. USA, 89:4285 (1992); и Presta et al. J. Immunol., 151:2623 (1993)); зрелые каркасные участки человека (с соматическими мутациями) или каркасные участки зародышевой линии (неперестроенные) (см., например, Almagro and Fransson, Front. Biosci. 13:1619-1633 (2008)); и каркасные участки, полученные при скрининге библиотек FR (см., например, Васа et al., J. Biol. Chem. 272:10678-10684 (1997) и Rosok et al., J. Biol. Chem. 271:22611-22618 (1996)), но не ограничиваются ими.

4. Человеческие антитела

В некоторых воплощениях предложенное здесь антитело представляет собой человеческое антитело. Человеческие антитела могут быть получены при помощи различных способов, известных в данной области техники. Человеческие антитела описаны van Dijk and van de Winkel, Curr. Opin. Pharmacol. 5: 368-74 (2001) и Lonberg, Curr. Opin. Immunol. 20:450-459 (2008).

Человеческие антитела могут быть получены путем введения иммуногена трансгенному животному, модифицированному для получения интактных человеческих антител или интактных антител с вариабельными участками человека в ответ на введение антигена. Такие животные обычно имеют все локусы иммуноглобулинов человека или их часть, заменяющие локусы эндогенных иммуноглобулинов, которые находятся вне хромосом или интегрированы случайным образом в хромосомы животных. У таких трансгенных мышей локусы эндогенных иммуноглобулинов обычно бывают инактивированы. Обзор способов получения человеческих антител в трансгенных животных представлен Lonberg, Nat. Biotech. 23:1117-1125 (2005). См. также, например, патенты США 6,075,181 и 6,150,584, описывающие технологию XENOMOUSE™; патент США 5,770,429, описывающий технологию humab®; патент США 7,041,870 описывающий технологию K-М MOUSE® и заявку на патент США US 2007/0061900, описывающий технологию VelociMouse®). Вариабельные участки человека в интактных антителах, полученных в таких животных, могут быть далее модифицированы, например, путем комбинации с различными константными участками человека.

Антитела человека могут также быть получены при помощи гибридомной технологии. Клеточные линии миеломы человека и гетеромиеломы мышь-человек были описаны (см., например, Kozbor J. Immunol., 133: 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp.51-63 (Marcel Dekker, Inc., New York, 1987); и Boerner et al., J. Immunol., 147: 86 (1991).) Человеческие антитела, полученные с применением технологии В-клеточной гибридомы человека также описаны Li et al., Proc. Natl. Acad. Sci. USA, 103:3557-3562 (2006). Дополнительные способы включают те, что описаны, например, в патенте США 7,189,826 (описание получения моноклональных антител человека класса IgM из гибридомных клеточных линий) и Ni, Xiandai Mianyixue, 26(4):265-268 (2006) (описание гибридом человек-человек). Технология человеческих гибридом (технология триом) также описана Vollmers and Brandlein, Histology and Histopathology, 20(3):927-937 (2005) и Vollmers and Brandlein, Methods and Findings in Experimental and Clinical Pharmacology. 27(3): 185-91 (2005).

Человеческие антитела могут быть получены путем выделения последовательностей вариабельного домена Fv клона, выбранных из созданных на основе генов человека библиотек фагового дисплея. Такие последовательности вариабельных доменов затем могут быть объединены с необходимым константным доменом человека. Технологии для отбора человеческих антител из библиотек антител описаны ниже.

5. Антитела, полученные из библиотек

Антитела по изобретению могут быть выделены путем скрининга комбинаторных библиотек на антитела с желаемой активностью или активностями. Например, в данной области техники известно большое количество способов создания библиотек фагового дисплея и скрининга таких библиотек на антитела, обладающие желаемыми характеристиками связывания. Такие способы рассматриваются, например, в обзоре Hoogenboom et al. in Methods in Molecular Biology 178:1-37 (O'Brien et al., ed., Human Press, Totowa, NJ, 2001) и также описываются, например McCafferty et al., Nature 348:552-554; Clackson et al., Nature 352: 624-628 (1991); Marks et al„ J. Mol. Biol. 222: 581-597 (1992); Marks and Bradbury, in Methods in Molecular Biology 248:161-175 (Lo, ed., Human Press, Totowa, NJ, 2003); Sidhu et al., J. Mol. Biol. 338(2): 299-310 (2004); Lee et al., J. Mol. Biol. 340(5): 1073-1093 (2004); Fellouse, Proc. Natl. Acad. Sci. USA 101(34): 12467-12472 (2004); и Lee et al., J. Immunol. Methods 284(1-2): 119-132 (2004).

При некоторых способах фагового дисплея спектры генов VH и VL клонируют отдельно при помощи полимеразной цепной реакции (PCR) и рекомбинируют случайным образом в библиотеках фагового дисплея, и затем проводят их скрининг на связывание фаговой частицы с антигеном, согласно описанию Winter et al., Ann. Rev. Immunol., 12: 433-455 (1994). Как правило, фаги экспонируют фрагменты антител либо в виде одноцепочечных Fv (scFv) фрагментов, либо в виде Fab фрагментов. Библиотеки на основе генов, полученных из иммунизированных доноров, позволяют получить высокоаффинные антитела к иммуногену без необходимости создания гибридом. В альтернативном случае, для получения единого источника антител к широкому спектру «чужих» и «своих» антигенов можно клонировать первичный репертуар генов (например, человеческих), согласно описанию Griffiths et al., EMBO J, 12: 725-734 (1993). Наконец, «наивные» или первичные библиотеки также могут быть синтезированы путем клонирования неперестроенных сегментов, включающих V-гены стволовых клеток, и использования праймеров PCR, содержащих случайные последовательности, которые кодируют высоковариабельные CDR3 участки и обеспечивают перестройку in vitro, согласно описанию Hoogenboom and Winter, J. Mol. Biol., 227: 381-388 (1992). Публикации, описывающие фаговые библиотеки человеческих антител, включают, например, патент США 5,750,373 и публикации 2005/0079574, 2005/0119455, 2005/0266000, 2007/0117126, 2007/0160598, 2007/0237764, 2007/0292936 и 2009/0002360.

Антитела или фрагменты антител, выделенные из библиотек человеческих антител, здесь считаются человеческими антителами или фрагментами человеческих антител.

6. Мультиспецифичные антитела

В некоторых воплощениях предложенное здесь антитело представляет собой мультиспецифичное антитело, например, биспецифичное антитело. Мультиспецифичные антитела представляют собой моноклональные антитела, имеющие связывающие валентности по меньшей мере для двух различных сайтов. В некоторых воплощениях одна из связывающих валентностей предназначена для TNC A2, а другая - для любого другого антигена. В некоторых воплощениях биспецифичные антитела могут связывать два различных эпитопа TNC A2. Биспецифичные антитела также могут применяться для локализации цитотоксических агентов на клетках, экспрессирующих TNC A2. Биспецифичные антитела могут быть получены в виде полноразмерных антител или фрагментов антител.

Технологии получения мультиспецифичных антител включают рекомбинантную ко-экспрессию двух пар тяжелая цепь-легкая цепь иммуноглобулинов, имеющих разную специфичность (см. Milstein and Cuello, Nature 305:537 (1983), WO 93/08829, и Traunecker et al., EMBO J. 10:3655 (1991)) и инженерию "knob-in-hole" (см., например, патент США 5,731,168). Мультиспецифичные антитела также могут быть получены за счет наведения электростатических зарядов для получения молекул антител с гетеродимерными Fc-фрагментами (W02009/089004A1); сшивания двух или более антител или фрагментов (см., например, патент США 4,676,980, и Brennan et al., Science 229:81 (1985)); использования «лейциновых застежек» для получения биспецифичных антител (см., например, Kostelny et al., J. Immunol. 148(5): 1547-1553 (1992)); с помощью технологии "диател" для получения фрагментов биспецифичных антител (см., например, Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993)); использования одноцепочечных Fv (sFv) димеров (см., например, Gruber et al., J. Immunol. 152:5368 (1994)); и получения триспецифичных антител, например, согласно описанию Tutt et al. J. Immunol. 147:60 (1991), но не ограничиваются ими.

Рекомбинантные антитела с тремя или более функциональными сайтами связывания антигенов, включая антитела типа "Octopus antibodies," также включены сюда (см., например, US 2006/0025576A1).

Антитело или фрагмент здесь также включают "FAb двойного действия" или "DAF" (от англ. "Dual Acting FAb"), содержащие антиген-связывающий сайт, связывающий TNC A2, а также другой отличный антиген (см., например, US 2008/0069820).

7. Варианты антител

В некоторых воплощениях рассматриваются варианты аминокислотных последовательностей антител. Например, может требоваться улучшение аффинности связывания и/или других биологических свойств антитела. Аминокислотные последовательности вариантов антитела могут быть получены путем введения соответствующих модификаций в нуклеотидную последовательность, кодирующую антитело, или путем белкового синтеза. Такие модификации включают, например, делеции и/или инсерции и/или замены остатков в составе аминокислотной последовательности антитела. Для получения конечной конструкции можно осуществлять любые комбинации делеции, инсерции и замен, при условии, что конечная конструкция обладает желаемыми характеристиками, например, связыванием антигена.

а) Варианты с заменами, инсерциями и делениями

В некоторых воплощениях предложены варианты антитела, имеющие одну или более аминокислотных замен. Сайты, представляющие интерес для проведения замещающего мутагенеза включают HVRs и FRs.

Аминокислотные замены могут приводить к замещению одной аминокислоты на другую аминокислоту с аналогичной структурой и/или химическими свойствами, например, консервативные замены аминокислот."Консервативные" аминокислотные замены можно проводить, основываясь на сходстве в полярности, заряде, растворимости, гидрофобности, гидрофильности и/или амфипатических характеристиках задействованных аминокислотных остатков. Например, неполярные (гидрофобные) аминокислоты включают аланин, лейцин, изолейцин, валин, фенилавланин, триптофан и метионин; полярные нейтральные аминокислоты включают серин, треонин, цистеин, тирозин, аспарагин и глутамин; положительно заряженные (основные) аминокислоты включают аргинин, лизин и гистидин; а отрицательно заряженные (кислые) аминокислоты включают аспарагиновую кислоту и глутаминовую кислоту. Консервативные замены представлены в Таблице 2 под заголовком "предпочтительные замены". Более значительные замены представлены в Таблице 2 под заголовком "примеры замен", и подробнее описаны ниже, со ссылкой на классы боковых цепей аминокислот. Аминокислотные замены можно вводить в антитело, представляющее интерес, и проводить скрининг полученных продуктов на предмет желаемой активности, например, сохранения/улучшения связывания антигена, понижения иммуногенности или повышения ADCC или CDC.

Таблица 2.
Исходная аминокислота Примеры замен Предпочтительные замены
Ala (а) Val; Leu; Ile Val
Arq (R) Lys; Gln; Asn Lys
Asn (N) Gln; His; Asp, Lys; Arg Gln
Asp (D) Glu; Asn Glu
Cys (в) Ser; Ala Ser
Gln (Q) Asn; Glu Asn
Glu (E) Asp; Gln Asp
Gly (G) Ala Ala
His (H) Asn; Gln; Lys; Arg Arg
Ile (I) Leu; Val; Met; Ala; Phe; Norleucine Leu
Leu (L) Norleucine; Ile; Val; Met; Ala; Phe Ile
Lys (K) Arg; Gln; Asn Arg
Met (M) Leu; Phe; lie Leu
Phe (F) Trp; Leu; Val; Ile; Ala; Tyr Tyr
Pro (P) Ala Ala
Ser (S) Thr Thr
Thr (T) Val; Ser Ser
Trp (W) Tyr; Phe Tyr
Tyr (Y) Trp; Phe; Thr; Ser Phe
Val (V) Ile; Leu; Met; Phe; Ala; Norleucine Leu

Аминокислотные остатки можно сгруппировать в соответствии общими свойствами боковых цепей:

(1) гидрофобные: Норлейцин, Met, Ala, Val, Leu, Ile;

(2) нейтральные гидрофильные: Cys, Ser, Thr, Asn, Gln;

(3) кислые: Asp, Glu;

(4) основные: His, Lys, Arg;

(5) влияющие на ориентацию цепи: Gly, Pro;

(6) ароматические: Trp, Туг, Phe.

Неконсервативные замены влекут за собой замещение представителя одного из этих классов на представителя другого класса. Например, аминокислотные замены могут также приводить к замещению одной аминокислоты на другую аминокислоту, имеющую иную структуру и/или химические свойства, например, замещение аминокислоты из одной группы (например, полярной) на другую аминокислоту из другой группы (например, основную). Допустимые вариации могут быть установлены экспериментальным путем при системном осуществлении инсерций, делеций или замен аминокислот в полипептидной молекуле при помощи технологии рекомбинантных ДНК и исследования активности полученных рекомбинантных вариантов.

Один вид замещения включает замещение одного или нескольких остатков гипервариабельного участка родительского антитела (например, гуманизированного или человеческого антитела). Как правило, полученный(е) вариант(ы), отбираемые для дальнейшего изучения, имеют изменения (например, улучшение) определенных биологических свойств (например, повышенную аффинность, пониженную иммуногенность) по отношению к родительскому антителу и/или в значительной степени сохраняют определенные биологические свойства родительского антитела. Примером варианта замещения является антитело, подвергнутое аффинному созреванию, которое может быть легко получено, например, при помощи технологии увеличения аффинности с использованием фагового дисплея, подробно описанной здесь. Вкратце, один или более остатков HVR подвергают мутации и проводят скрининг вариантов антитела экспрессируемых фагом по определенной биологической активности (например, аффинности связывания).

Изменения (например, замены) могут осуществляться внутри HVRs, например, для увеличения аффинности антитела. Такие изменения можно проводить в "горячих точках" HVR, т.е. в остатках, кодируемых кодонами, которые в процессе соматического созревания с высокой частотой подвергаются мутациям (см., например, Chowdhury, Methods Mol. Biol. 207:179-196 (2008)), и/или SDRs (a-CDRs), а у полученных вариантов VH или VL изучать аффинность связывания. Осуществление аффинного созревания путем конструирования и повторного отбора из вторичных библиотек было описано, например, Hoogenboom et al. in Methods in Molecular Biology 178:1-37 (O'Brien et al., ed., Human Press, Totowa, NJ, (2001).) В некоторых воплощениях для осуществления аффинного созревания повышают изменчивость вариабельных генов, выбранных для осуществления аффинного созревания, при помощи любого из существующих разнообразных методов (например, ПЦР пониженной точности, рекомбинации цепей или олигонуклеотид-направленного мутагенеза). После этого создается вторичная библиотека. Затем проводят скрининг библиотеки для выявления любых вариантов антител с необходимой аффинностью. Другой способ повышения изменчивости включает методы, нацеленные на изменение HVR, при которых рандомизируют несколько остатков HVR (например, 4-6 остатков одновременно). HVR остатки, задействованные в связывании антигена, могут быть специально идентифицированы, например, при помощи аланин-сканирующего мутагенеза или моделирования. В частности, изменениям часто подвергаются CDR-H3 и CDR-L3.

В некоторых воплощениях замены, инсерции или делеции могут возникать в составе одного" или нескольких HVRs, при условии, что такие изменения существенным образом не снижают способность антитела связывать антиген. Например, могут быть выполнены консервативные замены в HVRs (например, консервативные замены, описанные здесь), которые существенным образом не снижают аффинность связывания. Такие замены могут располагаться за пределами "горячих точек" HVR или SDRs. В некоторых воплощениях, каждый HVR либо остается без изменений, либо содержит не более одной, двух или трех аминокислотных замен в составе вариантов последовательностей VH и VL, приведенных выше.

Полезный способ определения остатков или участков антитела, которые могут быть мишенями направленного мутагенеза, называется "аланин-сканирующий мутагенез", описанный Cunningham and Wells (1989) Science, 244:1081-1085. В этом методе выявляют аминокислотный остаток или группу таргетных остатков (например, заряженные остатки, такие как Arg, Asp, His, Lys и Glu) и замещают нейтральным или отрицательно заряженными аминокислотами (например, аланином или полиаланином), чтобы выяснить, изменится ли взаимодействие антитела с антигеном. Дальнейшие замены могут затрагивать аминокислоты в позициях, которые демонстрируют сенситивность при первоначальных заменах. Дополнительно или альтернативно, может оказаться полезным провести анализ кристаллической структуры комплекса антиген-антитело для выявления точек контакта между антителом и антигеном. Такие остатки, задействованные в контактах, а также соседние с ними остатки могут быть выбраны в качестве кандидатов для замещения. Можно проводить скрининг вариантов с целью выявления у них наличия желаемых свойств.

Инсерции в аминокислотные последовательности включают сшивки в амино- и/или карбокси-терминальных участках, составляющие по длине от одного остатка до полипептидов, содержащих сотни или более остатков, а также инсерции внутри последовательности одного или нескольких аминокислотных остатков. Примеры инсерции в терминальных участках включают антитело с N-концевым остатком метионила. Другие варианты молекулы антитела с инсерциями включают сшивание N- или С-конца антитела с ферментом (например, ADEPT) или полипептидом, приводящее к повышению времени полужизни антитела в сыворотке.

б) Варианты гликозилирования

В некоторых воплощениях модификации олигосахаридов в составе антитела по изобретению могут выполняться для создания вариантов антител с улучшением некоторых свойств.

В одном аспекте настоящего изобретения предложены гликоформы антител к TNC A2, обладающие повышенной эффекторной функцией, включая антитело-зависимую клеточную цитотоксичность. Гликоинженерия антител была описана ранее. См., например, патент США 6,602,684, включенный сюда во всей полноте путем ссылки. Способы получения антител к TNC A2 в клетках-хозяевах, имеющих измененную активность генов, задействованных в процесс гликозилирования, также здесь подробно описаны (см, например, раздел, озаглавленный ниже "Рекомбинантные способы и композиции").

Молекула IgG несет два N-связанных олигосахарида в своем Fc фрагменте, по одному на каждой тяжелой цепи. Как любой гликопротеин, антитело вырабатывается как популяция гликоформ, имеющих одинаковые полипептидные скелеты, но различные олиосахариды, присоединенные к сайтам гликозилирования. Олигосахариды, обычно находящиеся в Fc фрагменте сывоторочных IgG, являются сложными двухантенными (Wormald et al., Biochemistry 36:130-38 (1997) и имеют низкое содержание концевых сиаловых кислот и биссекторного N-ацетилглюкозамина (GlcNAc) и различную степень галактозилирования по концевой аминокислоте и фукозилирования в центральной части (присоединения фукозы к остаткам GlcNAc в "остове" двухантенной структуры олигосахарида). В некоторых исследованиях предполагается, что минимальная углеводная структура, необходимая для связывания FcγR, находится в центральной части молекулы олигосахарида. Lund et al., J. Immunol. 157:4963-69 (1996).

Клеточные линии мыши или хомяка, используемые в промышленности и научных учреждениях для получения антител, как правило производят белки, в которых необходимые олигосахаридные детерминанты присоединены к сайтам Fc фрагмента. Однако, экспрессируемые в этих клеточных линиях IgG не имеют биссекторного GlcNAc, присутствующего в небольшом количестве в сывороточных IgGs. Lifely et al., Glycobiology 318:8)3-22 (1995). В ходе N-гликозилирования присоединение биссекторного GlcNAc осуществляет GnTIII. Schachter, Biochem. Cell Biol. 64:163-81 (1986).

Umana et al. использовали одну линию клеток СНО, продуцирующих антитела, созданную ранее для регулируемой извне экспрессии различных количеств клонированного гена фермента GnTIII (Umana, P., ef al., Nature Biotechnol. 17:176-180 (1999)). Этот подход впервые показал точную корреляцию между экспрессией гликозилтрансферазы (например, GnTIII) и ADCC активности модифицированного антитела. Таким образом, в изобретении рассматриваются антитела к TNC A2, содержащие Fc фрагмент или участок, эквивалентный Fc фрагменту, с измененным профилем гликозилирования, полученным в результате изменения уровня экспрессии гена гликозилтрансферазы в антитело-продуцирующих клетках-хозяевах. В определенном воплощении изменение уровня экспрессии гена представляет собой повышение активности GnTIII. Повышенная активность GnTIII приводит к повышению процентного содержания разветвленных олигосахаридов, а также к понижению процентного содержания фукозилированных олигосахаридов в Fc фрагменте антитела. Такое антитело или его фрагмент имеют повышенную аффинность связывания Fc рецепторов и повышенную эффекторную функцию.

Предложены антитела с разветвленными олигосахаридами, например, в которых двухантенные олигосахариды присоединенные к Fc фрагменту антитела разделены GlcNAc. Такие варианты антител могут иметь пониженную степень фукозилирования и/или повышенную ADCC функцию. Примеры таких вариантов антител описаны, например, в WO 2003/011878 (Jean-Mairet et al.); патенте США 6,602,684 (Umana et al.); и US 2005/0123546 (Umana et al.).

В одном воплощении антитела к TNC A2 по изобретению имеют повышенное содержание разветвленных олигосахаридов в Fc фрагменте в результате модификации их олигосахаридов способами по настоящему изобретению. В одном воплощении процентное содержание разветвленных N-связанных олигосахаридов в Fc фрагменте антитела к TNC A2 по изобретению составляет по меньшей мере приблизительно от 10% до приблизительно 100%, в частности по меньшей мере приблизительно 50%. более конкретно по меньшей мере приблизительно 60%, по меньшей мере приблизительно 70%, по меньшей мере приблизительно 80% или по меньшей мере приблизительно 90-95% от общего содержания олигосахаридов. Разветвленные олигосахариды могут быть гибридными или сложными.

В другом воплощении антитела к TNC A2 по изобретению имеют повышенное содержание нефукозилированных олигосахаридов в Fc фрагменте вследствие модификации их олигосахаридов способами по настоящему изобретению. В одном воплощении процентное содержание нефукозилированных олигосахаридов составляет по меньшей мере приблизительно от 20% до приблизительно 100%, в частности по меньшей мере приблизительно 50%, по меньшей мере приблизительно от 60% до приблизительно 70%, и более конкретно, по меньшей мере приблизительно 75%. Нефукозилированные олигосахариды могут быть гибридными или сложными.

Количество фукозы определяется путем расчета среднего количества фукозы в составе углеводной цепи при Asn297, относительно суммарного содержания всех гликоструктур, присоединенных к Asn297 (например, сложных, гибридных и структур с высоким содержанием маннозы) при определении на масс-спектрометре MALDI-TOF, согласно описанию, например, в WO 2008/077546. Asn297 обозначает аспарагиновый остаток, расположенный приблизительно в положении 297 в составе Fc фрагмента (согласно нумерация EU остатков Fc фрагмента); однако, Asn297 также может располагаться приблизительно на ±3 аминокислоты выше или ниже положения 297, т.е. между положениями 294 и 300, из-за небольших вариаций последовательности антител. Относительное количество фукозы представляет собой процентное содержание структур, содержащих фукозу, относительно всех гликоструктур, найденных в образце, обработанном N-гликозидазой F (например, сложных, гибридных и имеющих высокое содержание маннозы структур) по результатам масс-спектрометрии MALDI-TOF. Такие варианты с различным фукозилированием могут иметь повышенную ADCC активность.

Технология гликоинженерии, которая может применяться в отношении антител к TNC A2 по настоящему изобретению, была подробно описана в патенте США 6,602,684, заявке на патент США 2004/0241817 А1, заявке на патент США 2003/0175884 А1, предварительной заявке на патент США 60/441,307 и WO 2004/065540, описание каждой из которых включено сюда во всей полноте путем ссылок. Антитела к TNC A2 по настоящему изобретению в альтернативном случае могут быть модифицированы с использованием гликоинженерии для уменьшения количества остатков фукозы в составе Fc фрагмента согласно методикам, изложенным в заявке на патент США 2003/0157108 (Genentech), или ЕР 1176195 А1, WO 03/084570, WO 03/085119 и заявках на патент США 2003/0115614, 2004/093621, 2004/110282, 2004/110704, 2004/132140, Niwa et al., J Immunol Methods 306, 151/160 (2006), патенте США 6,946,292 (Kyowa). Модифицированные с использованием гликоинженерии антитела к TNC A2 по изобретению также могут быть получены в экспрессирующих системах, производящих модифицированные гликопротеины, таких которые указаны в заявке на патент США 60/344,169 и WO 03/056914 (GlycoFi, Inc.) или в WO 2004/057002 и WO 2004/024927 (Greenovation).

Следующие примеры публикаций, описывающих "дефукозилированные" или "лишенные фукозы" варианты антител включают: WO 2000/61739; WO 2001/29246; US 2002/0164328; US 2004/0109865; WO 2005/035586; WO 2005/035778; WO 2005/053742; WO 2002/031140; Okazaki et al. J. Mol. Biol. 336:1239-1249 (2004); Yamane-Ohnuki et al. Biotech. Bioeng. 87: 614 (2004). Примеры клеточных линий, способных продуцировать дефукозилированные антитела, включают клетки Lec13 СНО, у которых нарушено фукозилирование белков (Ripka et al. Arch. Biochem. Biophys. 249:533-545 (1986); заявки на патент США US 2003/0157108 А1, Presta, L; и WO 2004/056312 А1, Adams et al., особенно Пример 11), и клеточные линии с нокаутом, например, гена альфа-1,6-фукозилтрансферазы, FUT8, клетки СНО с нокаутом (см., например, Yamane-Ohnuki et al. Biotech. Bioeng. 87: 614 (2004); Kanda, Y. et al., Biotechnol. Bioeng., 94(4):680-688 (2006); и WO 2003/085107).

В конкретном воплощении антитела к TNC A2 по изобретению имеют повышенное содержание нефукозилированных разветвленных олигосахаридов в Fc фрагменте. Нефукозилированные разветвленные олигосахариды могут быть либо гибридными, либо сложными. В частности, способы по настоящему изобретению могут применяться для получения антител к TNC A2, в которых по меньшей мере приблизительно от 10% до приблизительно 100%, в частности по меньшей мере приблизительно 15%, более конкретно по меньшей мере приблизительно от 20% до приблизительно 25%, и более конкретно по меньшей мере приблизительно от 30% до приблизительно 35% олигосахаридов в Fc фрагменте антиген-связывающей молекулы являются нефукозилированными и разветвленными. Антитела к TNC A2 по настоящему изобретению могут также содержать Fc фрагмент, в котором по меньшей мере приблизительно от 10% до приблизительно 100%, в частности по меньшей мере приблизительно 15%, более конкретно по меньшей мере приблизительно от 20% до приблизительно 25%, и более конкретно по меньшей мере приблизительно от 30% до приблизительно 35% олигосахаридов в Fc фрагменте антитела являются нефукозилированными гибридными и разветвленными.

В некоторых воплощениях предложенное антитело модифицировано для повышения или понижения степени гликозилирования антитела. Добавление или удаление сайтов гликозилирования антитела может легко достигаться за счет изменения аминокислотной последовательности таким образом, что создаются или удаляются один или несколько сайтов гликозилирования.

Также предложены варианты антител, имеющие по меньшей мере один остаток галактозы в составе олигосахаридов, присоединенных к Fc фрагменту. Такие варианты антител могут иметь улучшенную CDC активность. Такие варианты антител описаны, например, в WO 1997/30087 (Patel et al.); WO 1998/58964 (Raju, S.); и WO 1999/22764 (Raju, S.).

Повышение ADCC или других эффекторных функций антител к TNC A2 по настоящему изобретению может также достигаться за счет повышения аффинности антиген-связывающей молекулы к TNC A2, например, за счет аффинного созревания или иных способов улучшения аффинности (см. Tang et al., J. Immunol. 2007, 179:2815-2823), или посредством модификации аминокислот в Fc фрагменте, согласно описанию ниже. Настоящее изобретение также включает комбинации этих подходов.

в) Варианты с измененными Fc фрагментами

В некоторых воплощениях в Fc фрагменте предложенного здесь антитела модифицируют одну или несколько аминокислот, таким образом получая вариант с измененным Fc фрагментом. Вариант с измененным Fc фрагментом может содержать последовательность Fc фрагмента человека (например, Fc фрагмента IgG1, IgG2, IgG3 или IgG4 человека), имеющую модификацию (например, замену) аминокислоты в одном или нескольких положениях.

В некоторых воплощениях изобретения рассматриваются варианты антитела, имеющие некоторые, но не все эффекторные функции, делающие его привлекательным кандидатом для приложений, в которых важно время полужизни антитела in vivo, но некоторые эффекторные функции (такие как функция комплемента или ADCC) являются несущественными или вредными. Для подтверждения факта снижения CDC и/или ADCC активности могут выполняться тесты определения цитотоксичности in vitro и/или in vivo. Например, тесты связывания Fc рецепторов (FcR) могут выполняться для подтверждения того, что у антитела отсутствует связывание FcyR (следовательно, предполагается отсутствие ADCC активности), но сохраняется способность связывать FcRn. NK клетки, первичные клетки, опосредующие ADCC, экспрессируют только FcyRIII, тогда как моноциты экспрессируют FcγRI, FcγRII и FcγRIII. Данные по экспрессии FcR гемопоэтическими клетками обобщены в Таблице 3 на стр.464 публикации Ravetch and Kinet, Annu. Rev. Immunol. 9:457-492 (1991). Не являющиеся исчерпывающими примеры in vitro тестов для определения ADCC активности молекулы, представляющей интерес, описаны в патенте США 5,500,362 (см., например, Hellstrom, I. et al. Proc. Nat'l Acad. Sci. USA 83:7059-7063 (1986)) и Hellstrom, I et al., Proc. Nat'l Acad. Sci. USA 82:1499-1502 (1985); 5,821,337 (см. Bruggemann, M. et al., J. Exp. Med. 166:1351-1361 (1987)). Альтернативно, могут применяться нерадиоактивные методы (см., например, нерадиоактивный метод определения цитотоксичности для проточной цитометрии ACTI™ (CellTechnology, Inc. Mountain View, CA; и нерадиоактивный метод определения цитотоксичности CytoTox 96® (Promega, Madison, WI). Эффекторные клетки, которые могут применяться в таких тестах, включают мононуклеарные клетки периферической крови (РВМС) и естественные киллерные клетки (NK). Дополнительно или альтернативно ADCC активность молекулы, представляющей интерес, может определяться in vivo, например, в животных моделях, таких, как описаны Clynes et al. Proc. Nat'l Acad. Sci. USA 95:652-656 (1998). Также могут выполняться тесты связывания C1q для подтверждения того, что антитело неспособно связывать C1q и, следовательно, не обладает CDC активностью. См., например, иммуноферментное определение связывания C1q и С3с в WO 2006/029879 и WO 2005/100402. Для оценки активации комплемента может выполняться определение CDC (см., например, Gazzano-Santoro etal., J. Immunol. Methods 202:163 (1996); Cragg, M.S. et al., Blood 101:1045-1052 (2003); и Cragg, M.S. and M.J. Glennie, Blood 103:2738-2743 (2004)). Также можно исследовать связывание FcRn и определять кпиренс/время полужизни in vivo с помощью методов, известных в данной области техники (см., например, Petkova, S.B. et al., Int'l. Immunol. 18(12):1759-1769 (2006)).

Антитела с пониженной эффекторной функцией включают антитела с заменой в Fc фрагменте одного или нескольких из остатков 238, 265, 269, 270, 297, 327 и 329 (патент США 6,737,056). Такие Fc-мутанты включают Fc-мутантов с заменами аминокислот в одном или нескольких положениях из 265, 269, 270, 297 и 327, включая так называемые "DANA" Fc мутанты с заменами остатков 265 и 297 на аланин (патент США 7,332,581).

Описаны некоторые варианты антител с улучшенным или пониженным связыванием FcRs. (См., например, патент США 6,737,056; WO 2004/056312 и Shields et al., J. Biol. Chem. 9(2): 6591-6604 (2001).)

В некоторых воплощениях вариант антитела содержит Fc фрагмент с заменой одной или нескольких аминокислот, повышающими ADCC, например, заменами в положениях 298, 333 и/или 334 Fc фрагмента (EU нумерация остатков).

В некоторых воплощениях модификации произведенные в Fc фрагменте, приводят к изменению (т.е. либо улучшению, либо понижению) связывания C1q и/или комплемент-зависимой цитотоксичности (CDC), например, согласно описанию в патенте США 6,194,551, WO 99/51642 и Idusogie et al. J. Immunol. 164:4178-4184(2000).

Антитела с увеличенным временем полужизни и улучшенным связыванием неонатального Fc рецептора (FcRn), отвечающего за передачу материнских IgGs плоду (Guyer et al., J. Immunol. 117:587 (1976) и Kim et al., J. Immunol. 24:249 (1994)), описаны в US2005/0014934A1 (Hinton et al.). Эти антитела содержат Fc фрагмент с одной или несколькими заменами, которые приводят к улучшению связывания Fc фрагмента с FcRn. Такие Fc-варианты включают варианты с заменами в Fc фрагменте одного или нескольких остатков из: 238, 256, 265, 272, 286, 303, 305, 307, 311, 312, 317, 340, 356, 360, 362,376, 378, 380, 382,413,424 или 434, например, замену в Fc фрагменте остатка 434 (патент США 7,371,826).

Другие примеры, касающиеся вариантов с измененными Fc фрагментами, представлены также в заявках на патент США 60/439,498; 60/456,041; 60/514,549; или WO 2004/063351 (варианты с измененными Fc фрагментами, имеющие повышенную аффинность связывания благодаря модификациям аминокислот); или заявка на патент США 10/672,280 или WO 2004/099249 (Fc-варианты с измененным связыванием FcγR благодаря модификации аминокислот), Duncan & Winter, Nature 322:738-40 (1988); патент США 5,648,260; патент США 5,624,821 и WO 94/29351.

г) Модифицированные цистеином варианты антител

В некоторых воплощениях может быть целесообразным создание модифицированных цистеином антител, например, "thioMAbs," в которых один или несколько остатков антитела замещены на цистеиновые остатки. В конкретных воплощениях замещенные остатки располагаются в доступных сайтах антитела. При замене этих остатков на цистеин реакционно-способные тиоловые группы размещаются в доступных сайтах антитела и могут использоваться для конъюгирования антитела с другими компонентами, например, компонентами лекарств или фрагментами линкер-лекарство, для создания конъюгата антитела, согласно описанию ниже. В некоторых воплощениях один или несколько из следующих остатков могут быть заменены на цистеин: V205 (нумерация по Кабат) легкой цепи; А118 (нумерация EU) тяжелой цепи; и S400 (нумерация EU) Fc фрагмента тяжелой цепи. Модифицированные цистеином антитела могут быть получены, как описано, например, в патенте США 7,521,541.

д) Производные антител

В некоторых воплощениях предложенное здесь антитело может быть также модифицировано с целью введения дополнительных небелковых компонентов, известных в данной области техники и легко доступных. Компоненты, подходящие для получения производных антитела, включают водорастворимые полимеры, но не ограничиваются ими. Не являющиеся исчерпывающими примеры водорастворимых полимеров включают полиэтиленгликоль (PEG), сополимеры этиленгликоля и пропиленгликоля, карбоксиметилцеллюлозу, декстран, поливиниловый спирт, поливинилпирролидон, поли-1,3-диоксолан, поли-1,3,6-триоксан, сополимер этилена и малеинового ангидрида, полиаминокислоты (как гомополимеры, так и случайные сополимеры) и декстран или поли(n-винил пирролидон)полиэтиленгликоль, гомополимеры пропропиленгликоля, сополимеры пролипропиленоксида и этилен оксида, полиоксиэтилированные полиолы (например, глицерол), поливиниловый спирт и их смеси, но не ограничиваются ими. Пропиональдегид полиэтиленгликоля может иметь преимущества при производстве благодаря своей стабильности в воде. Полимер может иметь любой молекулярный вес и может быть разветвленным или неразветвленным. Число полимеров, присоединенных к антителу, может варьировать и в случае присоединения более одного полимера, их молекулы могут быть идентичными или различаться. Как правило, число и/или тип полимеров, применяемых для получения производных, может определяться исходя из того, какие конкретные свойства или функции антитела, нуждаются в улучшении и того, будет ли производное антитела применяться в терапии при определенных условиях, и т.д., но не ограничиваться данными соображениями.

В другом воплощении предложены конъюгаты антитела и небелковые компоненты, которые могут быть избирательно нагреты под воздействием радиации. В одном воплощении, небелковый компонент представляет собой углеродную нанотрубку (Kam et al., Proc. Natl. Acad. Sci. USA 102:11600-11605 (2005)). Радиационное воздействие может иметь любую длину волны, включая, но не ограничиваясь длинами волн, не повреждающими обычные клетки, но нагревающими небелковый компонент до температуры, которая вызывает гибель клеток, расположенных вблизи небелкового компонента антитела.

Б. Рекомбинантные способы и композиции

Антитела могут быть получены с применением рекомбинантных способов и композиций, например, описанных в патенте США 4,816,567. В одном воплощении предложен выделенный полинуклеотид, кодирующий антитело к TNC A2, описанное здесь. Такой полинуклеотид может кодировать аминокислотную последовательность, содержащую VL и/или аминокислотную последовательность, содержащую VH антитела (например, легкую и/или тяжелую цепи антитела). В следующем воплощении предложены один или более векторов (например, клонирующие векторы или экспрессирующие векторы), содержащие такой полинуклеотид. В следующем воплощении предложены клетки-хозяева, содержащие такой полинуклеотид или вектор. В одном из таких воплощений клетка-хозяин содержит (например, в результате трансформации): (1) вектор, содержащий полинуклеотид, кодирующий аминокислотную последовательность, содержащую VL антитела и аминокислотную последовательность, содержащую VH антитела (например, полицистронный вектор), или (2) первый вектор, содержащий полинуклеотид, кодирующий аминокислотную последовательность, содержащую VL антитела и второй вектор, содержащий полинуклеотид, кодирующий аминокислотную последовательность, содержащую VH антитела. В одном воплощении клетка-хозяин представляет собой эукариотическую клетку, в частности, клетку млекопитающего, например, клетку яичника китайского хомячка (СНО), клетку почки новорожденного хомяча (ВНК) или лимфоидную клетку (например, Y0, NS0, Sp20 cell). В одном воплощении предложен способ получения антитела к TNC A2, где способ включает культивирование клеток-хозяев, содержащих полинуклеотид, кодирующий антитело, согласно описанию выше, при условиях, подходящих для экспрессии антитела, и возможно, выделение антитела из клеток-хозяев (или среды культивирования клеток-хозяев).

Для получения антитела к TNC A2 рекомбинантным способом один или несколько полинуклеотид(ов), кодирующих антитело, например, согласно описанию выше, выделяют и вставляют в один или несколько векторов для дальнейшего клонирования и/или экспрессии в клетках-хозяевах. Для конструирования векторов экспрессии, содержащих кодирующую последовательность антитела к TNC A2 наряду с соответствующими сигнальными последовательностями, контролирующими транскрипцию/трансляцию, могут применяться способы, хорошо известные специалистам в данной области. Эти способы включают in vitro технологию рекомбинантных ДНК, методы синтеза и рекомбинацию in iwo/генетическую рекомбинацию. См., например, методы, описанные Maniatis etal., molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory, N.Y. (1989) и Ausubel et al., current protocols in molecular biology, Greene Publishing Associates and Wiley Interscience, N.Y (1989).

В одном воплощении, один или несколько полинуклеотидов, кодирующих антитело к TNC A2, могут экспрессироваться под контролем конститутивного промотора или, в альтернативном случае, в системе регулируемой экспрессии. Подходящие системы регулируемой экспрессии включают тетрациклин-регулируемую систему экспрессии, экдизон-индуцибельную систему экспрессии, систему экспрессии «lac-switch», глюкокортикоид-индуцибельную систему экспрессии, систему с промотором, индуцируемым при изменении температуры и металлотионеин металл-индуцибельную систему экспрессии, но не ограничиваются ими. В случаях, когда в системе клеток-хозяев содержатся несколько различных полинуклеотидов, кодирующих антитело по настоящему изобретению, некоторые из них могут экспрессироваться под контролем конститутивного промотора, тогда как другие экспрессируются под контролем регулируемого промотора.

Клетки-хозяева, подходящие для клонирования или экспрессии векторов, кодирующих антитело, включают клетки прокариот или эукариот, описанные здесь. Например, антитела могут производиться в бактериях, в частности, когда гликозилирование и эффекторные функции Fc не являются необходимыми. Для экспрессии фрагментов антител и полипептидов в бактериях см., например, патенты США 5,648,237, 5,789,199 и 5,840,523. (см. также Charlton, Methods in Molecular Biology, Vol.248 (B.K.C. Lo, ed., Humana Press, Totowa, NJ, 2003), стр.245-254, описывающие экспрессию фрагментов антител в Е. coli.). После экспрессии антитело может быть выделено из бактериальной массы в виде растворимой фракции и затем очищено.

Кроме прокариот в качестве хозяев для клонирования или экспрессии векторов, кодирующих антитела, подходят микроорганизмы-эукариоты, такие как мицелиальные грибы или дрожжи, включая штаммы грибов и дрожжей, у которых пути гликозилирования были "гуманизированы" для обеспечения продукции антитела с частично или полностью человеческим профилем гликозилирования. См. Gerngross, Nat. Biotech. 22:1409-1414 (2004) и Li et al., Nat. Biotech. 24:210-215 (2006). Такие системы экспрессии также описаны в заявке на патент США 60/344,169 и WO 03/056914 (способы получения гликопротеинов, подобных человеческим, в эукариотических клетках-хозяевах, не являющихся человеческими).

Клетки-хозяева, подходящие для экспрессии гликозилированных антител также получают из многоклеточных организмов (беспозвоночных и позвоночных). Примеры клеток беспозвоночных включают клетки растений и насекомых. Также были найдены многочисленные штаммы бакуловирусов, которые могут использоваться совместно с клетками насекомых, в частности, для трансфекции клеток Spodoptera frugiperda.

Культуры клеток растений также могут использоваться в качестве хозяев. См, например, патенты США 5,959,177, 6,040,498, 6,420,548, 7,125,978 и 6,417,429 (описывающие технологию PLANTIBODIES™ для получения антител в трансгенных растениях).

Клетки позвоночных также могут использоваться в качестве хозяев. Например, могут применяться клеточные линии млекопитающих, адаптированные для роста в суспензии. Другими примерами клеточных линий млекопитающих, используемых в качестве хозяев являются линия клеток почки обезьяны CV1, трансформированная SV40 (COS-7); линия эмбриональных клеток почки человека (клетки 293 или 293Т, согласно описанию, например, Graham et al., J. Gen Virol. 36:59 (1977)); клеток почки новорожденного хомяка (ВНК); мышиные клетки сертоли (клетки ТМ4 согласно описанию, например Mather, Biol. Reprod. 23:243-251 (1980)); клетки почки обезьяны (CV1); клетки почки африканской зеленой мартышки (VERO-76); клетки карциномы шейки матки человека (HELA); клетки почки собаки (MDCK); клетки печени крысы буффало (BRL 3А); клетки легких человека (W138); клетки печени человека (Нер G2); клетки опухоли мышиной молочной железы (ММТ 060562); клетки TRI, согласно описанию, например Mather et al.. Annals N.Y. Acad. Sci. 383:44-68 (1982); клетки MRC 5; и клетки FS4. Другие клеточные линии млекопитающих, используемые в качестве хозяев, включают клетки яичников китайского хомячка (СНО), включая клетки DHFR- CHO (Uriaub et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980)); и линии клеток миеломы, такие как Y0, NS0 и Sp2/0. Обзор некоторых клеточных линий млекопитающих, подходящих в качестве хозяев для получения антител представлен, например, Yazaki and Wu, Methods in Molecular Biology, Vol.248 (B.K.C. Lo, ed., Humana Press, Totowa, NJ), стр.255-268 (2003).

Стабильная экспрессия, как правило, более предпочтительна по сранению с транзиторной экспрессией, поскольку обычно она позволяет добиться более воспроизводимых результатов, а также более пригодна для широкомасштабного производства; однако, решение о том, что транзиторная экспрессия является предпочтительной в конкретной ситуации, находится в компетенции специалистов.

Настоящее изобретение также касается способа модификации профиля гликозилирования антител к TNC A2 по настоящему изобретению, продуцируемых в клетках-хозяевах, включая экспрессию в указанных клетках-хозяевах одного или нескольких полинуклеотидов, кодирующих антитело к TNC A2 и один или несколько полинуклеотидв, кодирующих полипептид с гликозилтрансферазной активностью или вектор, содержащий такие полинуклеотиды. Как правило, для создания клеточных линий, продуцирующих антитела к TNC A2 с измененным профилем гликозилирования, можно использовать культивируемые клеточные линии любого типа, включая клеточные линии, описанные выше. Предпочтительные клеточные линии включают клетки СНО, клетки ВНК, клетки NSO, клетки SP2/0, клетки миеломы YO, клетки мышиной миеломы РЗХ63, клетки PER, клетки PER.C6 или клетки гибридомы, а также другие клетки млекопитающих. Полипептиды с гликозилтрансферазной активностью включают β(1,4)-N-ацетилглюкозаминилтрансферазу III (GnTIII), α-маннозидазу II (ManII), β(1,4)-галактозилрансферазу (GalT), β(1,2)-N-ацетилглюкозаминилтрансферазу I (GnTI) и β(1,2)-N-ацетилглюкозаминилтрансферазу II (GnTII). В одном воплощении клетки-хозяева экспрессируют комбинацию полинуклеотидов, кодирующих полинуклеотиды с гликозилтрансферазной активностью (например, GnTIII и Man II). Аналогично, способ также включает экспрессию одного или нескольких полинуклеотидов, кодирующих антитело к TNC A2 в клетках-хозяевах, у которых ген гликозилтрансферазы был разрушен или инактивирован иным образом (например, клетках-хозяевах, в которых был произведен нок-аут гена, кодирующего а1,6 фукозилтрансферазу олигосахаридного ядра). В конкретном воплощении антитела к TNC A2 по настоящему изобретению могут быть получены в клетках-хозяевах, которые также экспрессируют полинуклеотид, кодирующий полипептид, обладающий активностью GnTIII, для модификации профиля гликозилирования указанных антител. В определенном воплощении полипептид, имеющий активность GnTIII, представляет собой гибридный полипептид, содержащий отвечающий за локализацию в комплексе Гольджи домен полипептида-резидента комплекса Гольджи. В другом конкретном воплощении экспрессия антитела к TNC А2 по настоящему изобретению в клетках-хозяевах, экспрессирующих полинуклеотид, кодирующий полипептид, обладающий активностью GnTIII, позволяет получить антитела к TNC A2 с повышенной аффинностью связывания Fc рецепторов и/или повышенной эффекторной функцией. Соответственно, в одном воплощении настоящее изобретение касается клеток-хозяев, включающих (а) один или несколько выделенных полинуклеотидов, содержащих последовательность, кодирующую полипептид, обладающий активностью GnTIII; и (б) один или несколько полинуклеотидов, кодирующих антитело к TNC A2 по настоящему изобретению. В конкретном воплощении полипептид, обладающий активностью GnTIII, представляет собой гибридный полипептид, содержащий каталитический домен GnTIII и отвечающий за локализацию в комплексе Гольджи домен гетерологичного полипептида-резидента комплекса Гольджи. В частности, указанный отвечающий за локализацию в комплексе Гольджи домен представляет собой отвечающий за локализацию в комплексе Гольджи домен маннозидазы II. Способы создания таких гибридных полипептидов и их применения для получения антител с повышенной эффекторной функцией описаны в WO 2004/065540, предварительной заявке на патент США 60/495,142 и в публикации заявки США 2004/0241817, описание которых включено сюда во всей их полноте путем ссылок. В другом воплощении клетки-хозяева дополнительно содержат выделенный полинуклеотид, содержащий последовательность, кодирующую полипептид, обладающий активностью маннозидазы II (ManII). Полинуклеотиды, кодирующие полипептиды, как и полинуклеотиды, кодирующие антитело к TNC A2, могут экспрессироваться под контролем конститутивного промотора, или, в альтернативном случае, в системе регулируемой экспрессии. Такие системы известны в данной области техники и включают системы, описанные выше.

Клетки-хозяева, содержащие кодирующую последовательность анитела к TNC A2 и/или кодирующую последовательность полипептидов, обладающих гликозилтрансферазной активностью, и экспрессирующих биологически активные продукты генов, могут быть идентифицированы, например, посредством ДНК-ДНК или ДНК-РНК гибридизации; по наличию или отсутствию функции "маркерного" гена; оценке уровня транскрипции, определяемой по экспрессии соответствующих транскриптов мРНК в клетках-хозяевах; или детекции генных продуктов с помощью иммунологического определения или по их биологической активности - эти способы хорошо известны в данной области техники. Активность GnTIII или Man II может быть обнаружена, например, с помощью пектина, который связывается с продуктом биосинтеза GnTIII или ManII, соответственно. Примером такого лектина является лектин Е4-РНА, который предпочтительно связывается с олигосахаридами, содержащими биссекторный GlcNAc. Продукты биосинтеза (т.е. определенные структуры олигосахаридов) полипептидов, обладающих активностью GnTIII или ManII, могут также быть обнаружены с помощью масс-спектрометрического анализа олигосахаридов, высвобождаемых из гликопротеинов, образованных клетками, экспрессирующими указанные полипептиды. В альтернативном случае можно использовать функциональный тест, позволяющий измерить повышенное связывание с Fc рецептором или повышенную эффекторную функцию, опосредованную антителами, полученными в генно-модифицированных клетках, содержащих полинуклеотид, кодирующий полипептид, обладающий активностью GnTIII.

Настоящее изобретение также касается способа получения антитела к TNC А2, имеющего модифицированные олигосахариды, включая (а) культивирование клеток-хозяев генно-модифицированных с целью экспрессии по меньшей мере одного полинуклеотида, кодирующего полипептид, обладающий гликозилтрансферазной активностью при условиях, позволяющих получить антитело к TNC А2 согласно настоящему изобретению, где указанный полипетид, обладающий гликозилтрансферазной активностью, экспрессируется в количестве, достаточном для модификации олигосахаридов в Fc фрагменте указанного антитела к TNC A2, вырабатываемого указанными клетками-хозяевами; и (б) выделение указанного антитела к TNC A2. В одном воплощении полипептид, обладающий гликозилтрансферазной активностью, представляет собой GnTIII. В другом воплощении существует два полипептида, обладающих гликозилтрансферазной активностью. В конкретном воплощении два полипептида, обладающих гликозилтрансферазной активностью, представляют собой GnTIII и ManII. В другом воплощении полипептид, обладающий гликозилтрансферазной активностью, представляет собой гибридный полипептид, содержащий каталитический домен GnTIII. В более конкретном воплощении гибридный полипептид также содержит отвечающий за локализацию в комплексе Гольджи домен пептида-резидента комплекса Гольджи. В частности, отвечающий за локализацию в комплексе Гольджи домен представляет собой отвечающий за локализацию в комплексе Гольджи домен маннозидазы II или GnTI, более конкретно, отвечающий за локализацию домен маннозидазы II. Альтернативно, отвечающий за локализацию в комплексе Гольджи домен выбран из группы, состоящей из: отвечающего за локализацию домена маннозидазы I, отвечающего за локализацию домена GnTII, и отвечающего за локализацию домена α1,6 фукозилтрансферазы олигосахаридого ядра.

В конкретном воплощении модифицированное антитело к TNC A2, полученное в клетках-хозяевах или способами, описанными выше, имеет константный участок IgG или его фрагмент, содержащий Fc-домен. В другом конкретном воплощении антитело к TNC A2 представляет собой гуманизированное или человеческое антитело или его фрагменты, содержащие Fc-домен.

Антитело к TNC A2 с измененным профилем гликозилирования, полученное в клетках-хозяевах или способами, описанными выше, как правило, проявляет повышенную аффинность связывания Fc рецепторов и/или повышенную эффекторную функцию вследствие модификаций клеток-хозяев (например, за счет экспрессии гена гликозилтрансферазы). Предпочтительно, повышенная аффинность связывания Fc рецепторов представляет собой связывание с активирующим Fey рецептором, наиболее предпочтительно, с FcγRIIIa рецептором. Повышенная эффекторная функция предпочтительно представляет собой усиление одной или нескольких функций из перечисленных ниже: повышенной антитело-зависимой клеточной цитотоксичности, усиленного антитело-зависимого клеточного фагоцитоза (ADCP), повышенной секреции цитокинов, усиленного захвата антигена антиген-презентирующии клетами, опосредованного иммунными комплексами, повышенной Fc-опосредованной клеточной цитотоксичности, повышенного связывания с NK клетками, повышенного связывания с макрофагами, повышенного связывания с полиморфноядерными клетками (PMNCs), повышенного связывания с моноцитами, повышенного сшивания связанных с мишенями антител, активацию сигнальных путей, индуцирующую апоптоз, ускоренного созревания дендритных клеток и усиленного прайминга Т клеток.

В. Тесты

Для антител к TNC A2, предложенных здесь, можно проводить идентификацию, скрининг или исследование характеристик физических/химических свойств и/или биологической активности посредством различных тестов, известных в области техники.

1. Тесты связывания и другие тесты

В одном аспекте определяют антиген-связывающую активность антитела по изобретению, например, такими известными способами как иммуноферментный анализ, вестерн-блоттинг и т.д.

В другом аспекте для идентификации антител, конкурирующих за связывание TNC A2 с другим специфичным антителом к TNC A2, могут применяться тесты конкурентного связывания. В некоторых воплощениях такое конкурирующее антитело связывается с тем же эпитопом (например, линейным или конформационным эпитопом), с которым связано другое упомянутое антитело специфичное к TNC A2. Подробнее примеры способов картирования эпитопов, с которым связывается антитело, описаны Morris (1996) "Epitope Mapping Protocols," in Methods in Molecular Biology vol. 66 (Humana Press, Totowa, NJ).

В приведенном в качестве примера тесте конкурентного связывания иммобилизованный TNC A2 инкубируют с раствором, содержащим первое меченое антитело, связывающееся с TNC A2 (например, антитело 2В10, описанное в Примерах) и второе немеченое антитело, у которого определяют способность конкурировать с первым антителом за связывание с TNC A2. Второе антитело может находиться в супернатанте гибридом. В качестве контроля иммобилизованный TNC A2 инкубируют с раствором, содержащим первое меченое антитело, но не содержащим второго немеченого антитела. После инкубации в условиях, позволяющих связаться первому антителу с TNC A2, избыток несвязанного антитела удаляют, и определяют количество метки, связавшейся с иммобилизованным TNC A2. Если количество метки, связавшейся с иммобилизованным TNC A2, существенно снижается в исследуемом образце по отношению к контрольному образцу, это указывает на то, что второе антитело конкурирует с первым антителом за связывание с TNC A2. См. Harlow and Lane (1988) Antibodies: A Laboratory Manual ch.14 (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY).

2. Исследование активности

В одном аспекте предложены тесты для выявления биологической активности антител к TNC A2. Биологическая активность может включать, например, лизис клеток-мишеней, антитело-зависимую клеточную цитотоксичность (ADCC), комплемент-зависимую цитотоксичность (CDC) или индукцию апоптоза. Также предложены анитела, проявляющие такую биологическую активность in vivo и/или in vitro.

В некоторых воплощениях исследуют биологическую активность антитела по изобретению. Примеры тестов для исследования ADCC описаны здесь ранее (см. в разделе "Определения": "антитела, имеющие повышенную ADCC") и в Примере 11. Тесты для исследования цитолиза (например, по высвобождению LDH) или апоптоза (например, с помощью теста TUNEL) хорошо известны в данной области техники. Тесты для определения ADCC или CDC также описаны в WO 2004/065540 (см. Пример 1 там же), описание которого включено сюда во всей полноте путем ссылки.

Г. Конъюгаты антител

В изобретении также предложены конъюгаты, содержащие антитела к TNC А2, конъюгированные с одним или несколькими цитотоксическими агентами, например, химиотерапевтическими агентами или лекарственными препаратами, подавляющими рост агентами, токсинами (например, белковыми токсинами, энзиматически активными токсинами бактериального, грибкового, растительного или животного происхождения и их фрагментами) или радиоактивными изотопами.

В одном воплощении антитело в составе конъюгата антитела с лекарственным препаратом (ADC) конъюгировано с одним или несколькими лекарственными препаратами, включая майтансиноид (см. патенты США 5,208,020, 5,416,064, а также ЕР 0425235 В1); ауристатин, например, лекарственные фрагменты DE и DF монометилауристатина (ММАЕ и MMAF) (см. патенты США 5,635,483 и 5,780,588 и 7,498,298); доластатин, калихеамицин или их производные (см. патенты США 5,712,374, 5,714,586, 5,739,116, 5,767,285, 5,770,701, 5,770,710, 5,773,001 и 5,877,296; Hinman et al., Cancer Res. 53:3336-3342 (1993); и Lode et al., Cancer Res. 58:2925-2928 (1998)); антрациклин, например, дауномицин или доксорубицин (см. Kratz et al., Current Med. Chem. 13:477-523 (2006); Jeffrey et al., Bioorganic & Med. Chem. Letters 16:358-362 (2006); Torgov et al., Bioconj. Chem. 16:717-721 (2005); Nagy et al., Proc. Natl. Acad. Sci. USA 97:829-834 (2000); Dubowchik et al., Bioorg. & Med. Chem. Letters 12:1529-1532 (2002); King et al., J. Med. Chem. 45:4336-4343 (2002); и патент США 6,630,579); метотрексат; виндезин; таксан, например, доцетаксел, паклитаксел, а также препараты ларотаксел, тезетаксел (tesetaxel), ортатаксел; трихотецен; и СС1065, но не ограничиваясь ими.

В другом воплощении конъюгат антитела содержит антитело по настоящему описанию, конъюгированное с энзиматически активным токсином или его фрагментом, включая А-цепь дифтерийного токсина, несвязывающие активные фрагменты дифтерийного токсина, А-цепь экзотоксина (из Pseudomonas aeruginosa), А-цепь рицина, А-цепь абрина, А-цепь модецина, альфа-сарцин, белки Aleurites fordii, белки диантины, белки Phytolaca americana (PAPI, PAPII и РАР-S), ингибитор Momordica charantia, курицин, кротин, ингибитор Sapaonaria officinalis, гелонин, митогеллин, ретстриктоцин, феномицин, эномицин и трихотецены, но не ограничиваясь ими.

В другом воплощении конъюгат антитела содержит антитело по данному описанию, конъюгированное с радиоактивным изотопом и формирующее «радиоконъюгат». Для получения радиоактивных конъюгатов существует большое разнообразие радиоактивных изотопов. Примеры их включают At211, I131, I125, Y90, Re186, Re188, Sm153, Bi212, P32, Pb212 и радиоактивные изотопы Lu. Если для детекции применяется радиоконъюгат, он может содержать радиоактивный изотоп для проведения сцинтиграфического исследования, например, tc99m или 1123, или спиновую метку для проведения исследования методом ядерного магнитного резонанса (NMR) (также известного под названием магнитного резонансного исследования), например, иод-123, иод-131, индий-111, фтор-19, углерод-13, азот-15, кислород-17, гадолиний, марганец или железо.

Конъюгаты антитела с цитотоксическим агентом могут быть получены с применением различных бифункциональных белок-связывающих агентов, таких как N-сукцинимидил-3-(2-пиридилдитио)-пропионат (SPDP), сукцинимидил-4-(N-малеимидометил) циклогексан-1-карбоксилат (SMCC), иминотиолан (IT), бифункциональных производных имидоэфиров (таких как диметил адипимидат HCI), активных эфиров (таких как дисукцинимидил суберат), альдегидов (таких как глутаральдегид), бис-азидо соединений (таких как бис (р-азидобензоил) гександиамин), производных бисдиазония (таких как бис-(р-диазониумбензоил)-этилендиамин), диизоцианатов (таких как толуэн 2,6-диизоцианат) и бис-активных соединений фтора (таких как 1,5-дифлуоро-2,4-динитробензен). Например, иммунотоксин рицина может быть получен согласно описанию Vitetta et al., Science 238:1098 (1987). Меченая углеродом-14 1-изотиоцианатобензил-3-метилдиэтилен триаминопентауксусная кислота (MX-DTPA) является примером хелатирующего агента для конъюгирования меченого радиоактивным изотопом нуклеотида с антителом. См. WO 94/11026. Линкер может быть "расщепляемым линкером", способствующим высвобождению цитотоксического лекарственного препарата в клетках. Например, могут использоваться кислотный лабильный линкер, пептидазный лабильный линкер, фотолабильный линкер, диметиловый линкер или дисульфид-содержащий линкер (Chari et al., Cancer Res. 52:127-131 (1992); патент США 5,208,020).

Конъюгаты антител в данном документе рассматриваются явным образом, но не ограничиваются такими конъюгатами, полученными с помощью образующих поперечные связи реагентов, включающих, но не ограничивающихся BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, сульфо-EMCS, сульфо-GMBS, сульфо-KMUS, сульфо-MBS, сульфо-SIAB, сульфо-SMCC и сульфо-SMPB и SVSB (сукцинимидил-(4-винилсульфон)-бензоат), доступных из коммерческих источников (например, Pierce Biotechnology, Inc., Rockford, IL, U.S.A).

Д. Способы и композиции для диагностики и детекции

В некоторых воплощениях любое из предложенных здесь антител к TNC A2 может применяться для детекции наличия TNC A2 в биологическом образце. Термин "детекция", используемый здесь включает количественное или качественное определение. В некоторых воплощениях биологический образец включает клетки или ткани, например, клетки или ткани мозга, молочной железы, толстого кишечника, почки, печени, легких, яичников, поджелудочной железы, предстательной железы, скелетных мышц, кожи, тонкого кишечника, желудка или матки, включая также клетки или ткани опухолей этих органов.

В одном воплощении предложено антитело к TNC A2, которое может найти применение в способах диагностики или детекции. В следующем аспекте предложен способ детекции наличия TNC A2 в биологическом образце. В некоторых воплощениях способ включает инкубацию биологического образца, возможно с контрольным образцом, с антителом к TNC A2 согласно описанию здесь в условиях, обеспечивающих связывание антитела к TNC A2 с TNC A2, и определение, сформировался ли комплекс между антителом к TNC A2 и TNC A2. Такой способ может представлять собой способ для применения in vitro или in vivo. В одном воплощении антитело к TNC A2 применяют для отбора субъектов, подходящих для лечения с применением антитела к TNC A2, например, когда TNC A2 является биомаркером для отбора пациентов.

Примеры нарушений, которые можно диагностировать с применением антитела по изобретению, включают нарушения, связанные с экспрессией TNC A2, например, онкологические заболевания и воспалительные состояния.

В одном аспекте предложен способ диагностики заболевания у субъекта, указанный способ включает введение указанному субъекту эффективного количества диагностического агента, где указанный диагностический агент содержит антитело к TNC A2, согласно описанию здесь, и метку, как правило, визуализирующий агент, позволяющий детектировать комплекс указанного диагностического агента с TNC A2.

В некоторых воплощениях предложены меченые антитела к TNC A2. Метки включают детектируемые напрямую метки или компоненты (например, флуоресцентные, хромофорные, электронно-плотные, хемилюминесцентные и радиоактивные метки), а также компоненты, например, ферменты или лиганды, которые детектируют опосредовано, например, при помощи ферментативной реакции или молекулярного взаимодействия, но не ограничиваются ими. Примеры меток включают радиоизотопы 32?, 14С, 125I, 3H и 131I, флуорофоры, например, редкоземельные хелаты или флуоресцеин и его производные, родамин и его производные, дансил, умбеллиферон, люциферазы, например, люциферазу светлячка и бактериальную люциферазу (патент США 4,737,456), люциферин, 2,3-дигидрофталазиндионы, пероксидазу хрена (HRP), щелочную фосфатазу, р-галактозидазу, глюкоамилазу, лизоцим, сахаридоксидазы, например, глюкозооксидазу, галактозооксидазу и глюкозо-6-фосфат дегидрогеназу, гетероциклические оксидазы, такие как уриказу и ксантин-оксидазу, связанные с ферментом, использующим пероксид водорода для окисления хромогена, таким как пероксидаза хрена, лактопероксидаза или микропероксидаза, биотин/авидин, спиновые метки, бактериофаговые метки, стабильные свободные радикалы, и им подобные, но не ограничиваются ими.

Е. Фармацевтические композиции

Фармацевтические композиции антител к TNC A2 согласно данному описанию изготавливают путем смешивания такого антитела, имеющего необходимую степень чистоты, с одним или несколькими возможными фармацевтически приемлемыми носителями (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), в форме лиофилизированного препарата или водного раствора. Фармацевтически приемлемые носители, как правило, являются нетоксичными для реципиентов в используемых дозировках и концентрациях и включают: буферы, например, фосфатный, цитратный, ацетатный и содержащие другие органические кислоты; антиоксиданты, включая аскорбиновую кислоту и метионин; консерванты (такие как октадецилдиметилбензил аммоний хлорид; хлорид гексаметония; хлорид бензалкония; хлорид бензетония; фенол, бутил или бензиловый спирт; алкил парабены, такие как метил или пропил парабен; катехол; резорцинол; циклогексанол; 3-пентанол; и м-крезол); низкомолекулярные (содержащие менее 10 остатков) полипептиды; протеины, такие как сывороточный альбумин, желатин или иммуноглобулины, гидрофильные полимеры, такие как поливинилпирролидон; аминокислоты, такие как глицин, глутамин, аспарагин, гистидин, аргинин или лизин; моносахариды, дисахариды и другие углеводы, включая глюкозу, маннозу или декстрины; хелатирующие агенты, такие как EDTA; сахара, такие как сахарозу, маннитол, трегалозу или сорбитол; солеобразующие противоионы, такие как натрий; комплексы с металлами (например, комплексы Zn-белок); и/или неионные поверхностно-активные вещества, такие как полиэтиленгликоль (PEG), но не ограничиваются ими. Примеры фармацевтически приемлемых носителей здесь также включают диспергирующие агенты, такие как активные в нейтральных условиях растворимые гликопротеины гиалуронидазы (sHASEGP), например, растворимые гликопротеины гиалуронидазы РН-20 человека, такие как rHuPH20 (HYLENEX®, Baxter International, Inc.). Примеры некоторых sHASEGPs и способов их применения, включая rHuPH20, описаны в публикациях 2005/0260186 и 2006/0104968. В одном аспекте sHASEGP дополнительно комбинирован с одним или более гликозаминогликаназами, такими как хондроитиназы.

Примеры лиофилизированных композиций антител описаны в патенте США 6,267,958. Водные композиции антител включают описанные в патенте США 6,171,586 и WO 2006/044908, последние включают гистидин-ацетатный буфер.

Композиции здесь могут также содержать несколько активных ингредиентов, предпочтительно имеющих комплементарную активность и не оказывающих друг на друга отрицательного влияния, что бывает необходимо при конкретных показаниях к терапии. Например, если заболеванием, подлежащим лечению, является рак, может быть целесообразно также ввести один или более противораковых агентов, например, химиотерапевтический агент, ингибитор пролиферации опухолевых клеток или активатор апоптоза опухолевых клеток. Такие активные ингредиенты соответственно находятся в комбинации в количествах, эффективных для намеченного использования.

Активные ингредиенты могут быть заключены в микрокапсулы, приготовленные, например, с помощью технологии коацервации или полимеризации на границе раздела фаз, например, в микрокапсулы гидроксиметилцеллюлозы или желатина и микрокапсулы поли-(метилметацилата), соответственно, в коллоидные системы доставки лекарственных препаратов (например, липосомы, альбуминовые микросферы, микроэмульсии, наночастицы и нанокапсулы) или в макроэмульсии. Такие методики описаны в Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).

Могут быть изготовлены композиции с пролонгированным высвобождением. Примеры подходящих композиций с пролонгированным высвобождением включают полупроницаемые матрицы твердых гидрофобных полимеров, содержащих антитело, в которых матрицы находятся в форме профилированных изделий, например, в виде пленок или микрокапсул.

Композиции, применяющиеся для введения in vivo, как правило, стерильны. Стерильность может быть достигнута, например, путем фильтрации через стерильные фильтрующие мембраны.

Молекулы, описанные здесь, могут находиться в различных лекарственных формах, включая водные растворы или суспензии, таблетки, пилюли, порошки, суппозитории, полимерные микрокапсулы или микрочастицы, липосомы и растворы для инъекций или инфузий, но не ограничиваясь ими. Предпочтительная форма зависит от способа введения и терапевтического применения, но как правило, представляет раствор для инъекций или инфузий.

Ж. Терапевтические способы и композиции

Любое из предложенных здесь антител к TNC A2 или фармацевтических композиций, содержащих антитела к TNC A2, могут применяться в терапевтических способах.

Предложенные здесь антитела к TNC A2 могут применяться для лечения заболеваний, характериющихся экспрессией TNC A2, в частности, аномальной экспрессией (например, сверхэкспрессией или иным паттерном экспрессии в клетке) TNC A2 по сравнению с нормальными тканями, состоящими из клеток того же типа. Многие опухоли человека имеют аномальную экспрессию TNC A2 (например, сверхэкпрессию) по сравнению с не относящимися к опухоли тканями из клеток того же типа. Таким образом, предложенные здесь антитела к TNC A2, могут быть особенно полезны для предупреждения образования опухолей, эрадикации опухолей и ингибирования роста опухолей или метастазирования. Предложенные здесь антитела к TNC A2 могут быть полезны для лечения любых опухолей, экспрессирующих TNC A2. Некоторые опухолевые заболевания, которые можно лечить с применением предложенных здесь антител к TNC A2, включают, например, рак легких, рак толстого кишечника, рак желудка, рак молочной железы, раковые образования головы и шеи, рак кожи, рак печени, рак почек, рак предстательной железы, рак поджелудочной железы, рак мозга, опухоли скелетных мышц.

Описанные здесь антитела к TNC A2 могут применяться для подавления роста опухоли или уничтожения опухолевых клеток. Например, антитела к TNC A2 могут связывать TNC A2, расположенный на клеточной мембране или поверхности раковых клеток (опухолевых клеток или клеток опухолевой стромы), и запускать, например, ADCC или другой вид опосредованного клетками-эффекторами уничтожения раковых клеток.

Альтернативно, антитела к TNC A2 могут применяться для блокирования функций TNC A2, в частности, путем физического препятствования его связыванию с другим соединением. Например, антиген-связывающие молекулы могут применяться для блокирования опосредованной TNC A2 адгезии, распластывания или миграции клеток.

В одном аспекте предложено антитело к TNC A2 для применения в качестве лекарства. В следующих аспектах предложено антитело к TNC A2 для применения в лечении заболеваний, характеризующихся экспрессией TNC A2. В некоторых воплощениях предложено антитело к TNC A2 для применения в способе лечения. В некоторых воплощениях изобретения предложено антитело к TNC A2 для применения в способе лечения индивида, имеющего заболевание, характеризующееся экспрессией TNC A2, включающем введение индивиду эффективного количества антитела к TNC A2. В одном таком воплощении способ также включает введение индивиду эффективного количества по меньшей мере одного дополнительного терапевтического агента, например, согласно описанию ниже. В следующих воплощениях изобретения предложено антитело к TNC A2 для индукции цитолиза. В некоторых воплощениях изобретения предложено антитело к TNC A2 для применения в способе индукции цитолиза у индивида, включая введение индивиду эффективного количества антитела к TNC A2 для индукции цитолиза. "Индивидом" согласно любому их вышеперечисленных воплощений предпочтительно является человек. "Заболеванием, характеризующимся экспрессией TNC A2" согласно любому из вышеперечисленных воплощений, предпочтительно является рак, наиболее предпочтительно рак, выбранный из группы рака легких, рака толстого кишечника, рака желудка, рака молочной железы, опухолевых образований головы и шеи, рака кожи, рака печени, рака почек, рака предстательной железы, рака поджелудочной железы, рака мозга, опухолей скелетных мышц. "Клетка" согласно любому из вышеперечисленных воплощений, предпочтительно представляет собой клетку, находящуюся в опухоли, например, опухолевую клетку или клетку опухолевой стромы, наиболее предпочтительно, опухолевую клетку. "Экспрессия TNC A2" согласно любому из вышеперечисленных воплощений, предпочтительно представляет собой аномальную экспрессию, например, сверхэкспрессию или иной паттерн экспрессии в клетке по сравнению с нормальной тканью, состоящей из того же типа клеток.

В следующем аспекте изобретения предложено применение антитела к TNC А2 в производстве или изготовлении лекарств. В одном воплощении лекарство предназначается для лечения заболевания, характеризующегося экспрессией TNC А2. В следующем воплощении лекарство предназначено для применения в способе лечения заболевания, характеризующегося экспрессией TNC A2, включающем введение эффективного количества лекарства индивиду, имеющему заболевание, характеризующееся экспрессией TNC A2. В одном таком воплощении способ также включает введение индивиду эффективного количества по меньшей мере одного дополнительного терапевтического агента, например, согласно описанию ниже. В следующем воплощении лекарство предназначено для индукции цитолиза. В следующем воплощении лекарство предназначено для применения в способе индукции цитолиза у индивида, включающем введение индивиду эффективного количества лекарства для индукции цитолиза. "Индивидом" согласно любому из вышеперечисленных воплощений предпочтительно является человек. "Заболеванием, характеризующимся экспрессией TNC A2" согласно любому из вышеперечисленных воплощений предпочтительно является рак, наиболее предпочтительно рак, выбранный из группы рака легких, рака толстого кишечника, рака желудка, рака молочной железы, рака кожи, рака печени, рака почек, рака предстательной железы, рака поджелудочной железы, рака мозга, опухолей скелетных мышц. "Клетка" согласно любому из вышеперечисленных воплощений, предпочтительно представляет собой клетку, находящуюся в опухоли, например, опухолевую клетку или клетку опухолевой стромы, наиболее предпочтительно, опухолевую клетку. "Экспрессия TNC A2" согласно любому из вышеперечисленных воплощений, предпочтительно представляет собой аномальную экспрессию, например, сверхэкспрессию или иной паттерн экспрессии в клетке по сравнению с нормальной тканью, состоящей из того же типа клеток.

В следующем аспекте изобретения предложен способ лечения заболевания, характеризующегося экспрессией TNC A2. В одном воплощении способ включает введение индивиду, имеющему такое заболевание, характеризующееся экспрессией TNC A2 эффективного количества антитела к TNC A2. В одном таком воплощении способ также включает введение индивиду эффективного количества по меньшей мере одного дополнительного терапевтического агента, согласно описанию ниже. В следующем воплощении изобретения предложен способ индукции цитолиза у индивида. В одном воплощении способ включает введение индивиду эффективного количества антитела к TNC A2 для индукции цитолиза. "Индивидом" согласно любому из вышеперечисленных воплощений может быть человек. "Заболеванием, характеризующимся экспрессией TNC A2" согласно любому из вышеперечисленных воплощений предпочтительно является рак, наиболее предпочтительно рак, выбранный из группы рака легких, рака толстого кишечника, рака желудка, рака молочной железы, рака кожи, рака печени, рака почек, рака предстательной железы, рака поджелудочной железы, рака мозга, опухолей скелетных мышц. "Клетка" согласно любому из вышеперечисленных воплощений, предпочтительно представляет собой клетку, находящуюся в опухоли, например, опухолевую клетку или клетку опухолевой стромы, наиболее предпочтительно, опухолевую клетку. "Экспрессия TNC A2" согласно любому из вышеперечисленных воплощений, предпочтительно представляет собой аномальную экспрессию, например, сверхэкспрессию или иной паттерн экспрессии в клетке по сравнению с нормальной тканью, состоящей из того же типа клеток.

В следующем аспекте изобретения предложены фармацевтические композиции, содержащие любое из предложенных здесь антител к TNC A2, например, для применения в любом из вышеперечисленных терапевтических способов. В одном воплощении фармацевтическая композиция содержит любое из предложенных здесь антител к TNC A2 и один или несколько фармацевтически приемлемых носителей. В другом воплощении фармацевтическая композиция содержит любое из предложенных здесь антител к TNC A2 и по меньшей мере один дополнительный терапевтический агент, например, согласно описанию ниже.

Антитела по изобретению могут применяться в лечении либо отдельно, либо в комбинации с другими агентами. Например, антитело по изобретению может быть одновременно введено по меньшей мере с одним дополнительным терапевтическим агентом. В некоторых воплощениях дополнительный терапевтический агент представляет собой противоопухолевый агент. Подходящими противоопухолевыми агентами, например, являются химиотерапевтические агенты, ингибиторы пролиферации опухолевых клеток или активаторы апоптоза опухолевых клеток.

Такие комбинированные терапии, упомянутые выше, включают комбинированное введение (когда два или более терапевтических агентов включены в состав одного или нескольких препаратов) и раздельное введение, когда введение антитела по изобретению может осуществляться до, одновременно и/или после введения дополнительного терапевтического агента и/или адьюванта. Антитела по изобретению также могут применяться в комбинации с лучевой терапией.

Антитело по изобретению (и любой дополнительный терапевтический агент) могут быть введены любым подходящим способом, включая парентеральное, внутрилегочное и интраназальное и, при необходимости местного лечения, внутриочаговое введение. Парентеральное введение включает внутримышечное, внутривенное, внутриартериальное, интраперитонеальное или подкожное введение. Как правило, предпочтительным является внутривенное введение. Однако, интраперитонеальный способ может оказаться наиболее полезным, например, в лечении опухолей толстой и прямой кишки. Дозирование может выполняться любым подходящим способом, например, посредством инъекций, таких как внутривенные или подкожные инъекции, в некоторой степени завися от того, является ли введение кратковременным или длительным. Рассматриваются различные режимы дозирования, включая однократное или многократное введение через различные промежутки времени, болюсное введение и пульсовое введение, но не ограничиваясь ими.

Антитела по изобретению должны изготавливаться, дозироваться и вводиться в соответствии с надлежащей медицинской практикой. Факторы, которые необходимо при этом учитывать, включают конкретное заболевание, подлежащее лечению, конкретное млекопитающее, принимающее лечение, клиническое состояние индивидуального пациента, причину нарушения, место введения агента, способ введения, схему введения и другие факторы, известные медицинскому персоналу. Антитело не обязательно, но возможно находится в сочетании с одним или несколькими агентами, используемыми на данный момент для предупреждения или лечения обсуждаемого нарушения. Эффективное количество этих иных агентов зависит от количества антитела, присутствующего в препарате, типа нарушения или лечения и других факторов, обсуждавшихся выше. Они как правило применяются в таких же дозировках и вводятся такими же способами, как описанные здесь, или как приблизительно от 1 до 99% описанных здесь дозировок, или в любой дозировке и любым способом, который эмпирически/клинически считаются подходящими.

Соответствующая дозировка антитела по изобретению (при использовании отдельно или в комбинации с одним или несколькими дополнительными терапевтическими агентами) для предупреждения или лечения заболевания будет зависеть от типа заболевания, подлежащего лечению, типа антитела, тяжести и течения заболевания, от того, вводят ли антитело в превентивных или в терапевтических целях, от предшествующего лечения, истории болезни пациента и ответа на антитело, а также от выбора лечащего врача. Соответственно, антитело вводят пациенту единовременно или на протяжении серии процедур. В зависимости от типа и тяжести заболевания приблизительно от 1 мкг/кг до 15 мг/кг (например, 0,1 мг/кг-10 мг/кг) антитела может служить возможной исходной дозировкой для введения пациенту, как, например, в виде одного или нескольких отдельных введений, так и в виде длительной инфузии. Одна типичная дозировка может варьировать от приблизительно 1 мкг/кг до 100 мг/кг или более, в зависимости от упомянутых выше факторов. При повторном введении на протяжении нескольких дней или более, в зависимости от патологического состояния, лечение должно длиться до тех пор, когда наступит желаемое подавление симптомов заболевания. Одним из примеров дозировки антитела может быть диапазон от приблизительно 0,05 мг/кг до приблизительно 10 мг/кг. Таким образом, пациенту могут быть введены одна или более доз, составляющих приблизительно 0,5 мг/кг, 2,0 мг/кг, 4,0 мг/кг или 10 мг/кг (или любые их комбинации). Эти дозы могут быть введены с перерывами, например, каждую неделю или каждые три недели (например, таким образом, чтобы пациент получил приблизительно от двух до двадцати, или, например, приблизительно шесть доз антитела). Может производиться введение первоначальной ударной дозы, за которой следует введение одной или нескольких более низких доз. Однако, могут применяться и другие режимы дозирования. Успех данного лечения легко отслеживается при помощи известных методик и тестов.

Очевидно, что любой из вышеупомянутых композиций или терапевтических способов может осуществляться с применением конъюгата антитела по изобретению вместо или в дополнение к антителу к TNC A2.

3. Изделия

В другом аспекте изобретения предложены изделия, содержащие материалы, полезные для лечения, предупреждении и/или диагностики нарушений, описанных выше. Изделия включают контейнер и этикетку или листовку-вкладыш на контейнере или внутри него. Подходящие контейнеры включают, например, бутыли, флаконы, шприцы, пакеты с раствором для внутривенного введения и т.д. Контейнеры могут быть изготовлены из различных материалов, таких как стекло или пластик. Контейнер содержит композицию, которая самостоятельно или в комбинации с другой композицией является эффективной при лечении, предупреждении и/или диагностике патологических состояний, и может иметь отверстие для стерильного доступа (например, контейнер может представлять собой пакет с раствором для внутривенного введения или флакон с пробкой, которую можно проткнуть иглой для подкожных инъекций). По меньшей мере один активный агент в композиции представляет собой антитело по изобретению. На этикетке или листовке-вкладыше указано, что композицию применяют для лечения предпочтительного патологического состояния. Кроме того, изделие может содержать (а) первый контейнер с содержащейся в нем композицией, где композиция содержит антитело по изобретению и (б) второй контейнер с содержащейся в нем композицией, где композиция содержит цитотоксический или иной терапевтический агент. Изделие в данном воплощении изобретения может также содержать листовку-вкладыш, с указанием, что композиции могут применяться в лечении конкретного патологического состояния. Альтернативно или дополнительно изделие может также содержать второй (или третий) контейнер, содержащий фармацевтически-приемлемый буфер, например бактериостатическую воду для инъекций (BWFI), фосфатно-солевой буфер, раствор Рингера и раствор декстрозы. Оно может также содержать другие материалы, привлекательные с коммерческой и с потребительской точки зрения, включая другие буферы, растворители, фильтры, иглы и шприцы.

Очевидно, что любое из вышеупомянутых изделий может содержать конъюгат антитела по изобретению вместо или в дополнение к антителу к TNC A2.

III. ОПИСАНИЕ ПРИМЕРОВ ОСУЩЕСТВЛЕНИЯ ИЗОБРЕТЕНИЯ

Ниже приведены примеры способов и композиций по изобретению. Очевидно, что с учетом общего описания, приведенного выше, могут осуществляться многие другие воплощения.

Пример 1

Технология рекомбинантной ДНК

Для манипуляций с ДНК применяли стандартные методы, описанные Sambrook, J. et al., Molecular cloning: A laboratory manual; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989. Реагенты для молекулярной биологии применяли согласно инструкциям производителя. Последовательности ДНК определяли посредством секвенирования двуцепочечной матрицы. В некоторых случаях требуемые генетические сегменты были получены из синтетических олигонуклеотидов и ПЦР продуктов посредством автоматизированного синтеза генов компанией Geneart AG (Regensburg, Germany). Генетические сегменты, фланкированные одиночными сайтами рестрикции эндонуклеаз, клонировали в плазмиды pGA18 (ampR). Плазмидную ДНК выделяли из трансформированных бактерий и определяли концентрацию при помощи УФ спектрометрии. Последовательности ДНК субклонированных генетических фрагментов проверяли путем секвенирования ДНК. Генетические сегменты конструировали с подходящими сайтами рестрикции для возможности их субклонировать в соответствующие векторы экспрессии.

Общая информация, касающаяся нуклеотидных последовательностей легкой и тяжелой цепей иммуноглобулина человека представлена Kabat, E.A. et al., (1991) Sequences of Proteins of Immunological Interest, Fifth Ed., NIH Publication No 91-3242. Для экспрессии все конструкции содержали 5'-концевую последовательность ДНК, кодирующую лидерный пептид, обеспечивающий секрецию белков в эукариотических клетках. Примеры лидерных пептидов и последовательности кодирующих их полинуклеотидов представлены в SEQ ID NOs 107-115.

Получение (модифицированных с использованием гликоинженерии) антител

Полные последовательности ДНК тяжелой и легкой цепей антитела были получены путем субклонирования вариабельных участков внутри рамки считывания, с предварительной вставкой либо константного участка тяжелой цепи, либо константного участка легкой цепи в соответствующий экспрессирующий вектор-реципиент млекопитающего. Экспрессия антитела находилась под контролем MPSV промотора и в составе вектора имелась синтетическая поли-А сигнальная последовательность на 3' конце CDS. Кроме этого, каждый вектор содержал последовательность EBV OriP.

Антитела получали путем ко-трансфекции клеток HEK293-EBNA векторами экспрессии, кодирующими антитела млекопитающих, при помощи кальций-фосфатной трансфекции. Клетки HEK293-EBNA трансфецировали в фазе экспоненциального роста кальций-фосфатным методом. Альтернативно, клетки НЕК293, растущие в суспензии, трансфецировали с помощью полиэтиленимина. Для продукции не модифицированного с использованием гликоинженерии антитела клетки трансфецировали только векторами экспрессии, содержащими тяжелую или легкую цепь антитела, при соотношении 1:1.

Для продукции модифицированного с использованием гликоинженерии антитела клетки ко-трансфецировали двумя дополнительными плазмидами, одной для экспрессии гибридного GnTIII полипептида (вектор, экспрессирующий GnT-III), и одной для экспрессии маннозидазы II (вектор, экспрессирующий маннозидазу II комплекса Гольджи) в соотношении 4:4:1:1, соответственно. Клетки культивировали в виде адгезивного монослоя в культуральных флаконах с использованием культуральной среды DMEM с добавлением 10% эмбриональной телячьей сыворотки (FCS) и трансфецировали при конфлюентности от 50 до 80%. Для трансфекции клеток во флаконе Т150 высевали 15 млн клеток за 24 часа до трансфекции в 25 мл культуральной среды DMEM с добавлением эмбриональной телячьей сыворотки (в конечной концентрации 10% V/V) и помещали клетки на ночь в инкубатор с температурой 37°С и содержанием 5% CO2 в атмосфере. Для каждого флакона Т150 смешивали раствор ДНК, CaCl2 и воду в пропорции: 94 мкг общей плазмидной векторной ДНК, содержащей поровну векторы, экспрессирующие легкую и тяжелую цепи, воду до конечного объема 469 мкл и 469 мкл раствора 1М CaCl2. К этому раствору добавляли 938 мкл раствора 50 мМ HEPES, 280 мМ NaCl, 1,5 мМ Na2HPO4 с рН 7,05, немедленно перемешивали в течение 10 сек и оставляли при комнатной температуре на 20 сек. Раствор разводили в 10 мл DMEM с добавлением 2% эмбриональной телячьей сыворотки и вносили во флаконы Т150 взамен имеющейся там среды. Затем добавляли дополнительно 13 мл среды для трансфекции. Клетки инкубировали при 37°С, 5% CO2 в течение от 17 до 20 часов, затем среду заменяли на 25 мл DMEM с 10% FCS. Кондиционированную культуральную среду собирали приблизительно через 7 дней после смены среды, центрифугировали в течение 15 мин при 210×g, раствор стерилизовали фильтрацией (0,22 мкм фильтр) и добавляли азид натрия в конечной концентрации 0,01% w/v и хранили при 4°С.

Секретированные лишенные фукозы антитела дикого типа или модифицированные с использованием гликоинженерии выделяли из клеточных супернатантов при помощи аффинной хроматографии с протеином A (HiTrap ProtA, GE Healthcare). Вкратце, колонку уравновешивали 20 мМ фосфата натрия, 20 мМ цитрата натрия, рН 7,5, загружали клеточный супернатант, промывали первый раз 20 мМ раствором фосфата натрия, 20 мМ цитрата натрия рН 7,5, и второй раз 13,3 мМ раствором фосфата натрия, 20 мМ цитрата натрия, 500 мМ хлорида натрия, рН 5,45. Антитела элюировали 20 мМ цитрата натрия, 100 мМ хлорида натрия, 100 мМ глицина, рН 3. На последующем этапе эксклюзионной хроматоргафии на колонке HiLoad Superdex 200 (GE Healthcare) буфер заменяли на раствор 25 мМ фосфат калия, 125 мМ хлорид натрия, 100 мМ глицина с рН 6,7 или альтернативно, на раствор 140 мМ хлорида натрия, 20 мМ гистидина с рН 6,0 и собирали очищенные мономерные IgG1 антитела. При необходимости между двумя стандартными этапами очистки включали дополнительный этап катионнообменной хроматографии.

Концентрацию белка в очищенных белковых образцах определяли путем измерения оптической плотности (OD) при 280 нм, используя молярный коэффициент экстинкции, рассчитанный на основе аминокислотной последовательности. Степень чистоты и молекулярный вес антител анализировали при помощи электрофореза в полиакриламидном геле в присутствии или отсутствии восстанавливающего агента (5 мМ 1,4-дитиотрейтола) и окрашивания Coomassie (SimpleBlue™ SafeStain from Invitrogen). Гели NuPAGE® Pre-Cast (Invitrogen, USA) использовали согласно инструкции производителя (4-20% Трис-глициновые гели или 3-12% Бис-Трис). Содержание агрегатов в образцах антител анализировали с использованием аналитических колонок для эксклюзионной хроматографии Superdex 200 10/300GL (GE Healthcare, Sweden) в проточном буфере 2 мМ MOPS, 150 мМ NaCl, 0,02% NaN3, pH 7,3 при 25°С. Целостность аминокислотного скелета восстановленных легкой и тяжелой цепей проверяли с помощью масс-спектрометрии на аппарате NanoElectrospray Q-TOF после удаления N-гликанов с помощью ферментативной обработки Пептид-N-Гликозидазой F (Roche Molecular Biochemicals).

Результаты очистки и анализа человеческих IgG анител 2В10 дикого типа и модифицированного с использованием гликоинженерии показаны на Фигурах 6 и 7.

Олигосахариды, присоединенные к Fc фрагменту антител, анализировали при помощи масс-спектрометрии MALDI TOF согласно описанию ниже. Олигосахариды отщепляли от антител путем энзиматического расщепления PNGaseF. Полученный в результате расщепления раствор, содержащий высвобожденные Олигосахариды, либо подготавливали непосредственно для масс-спектрометрического анализа на MALDI TOF, либо расщепляли далее при помощи EndoH гликозидазы перед подготовкой образцов для масс-спектрометрического анализа на MALDI TOF.

Анализ гликоструктуры (модифицированных с использованием гликоинженерии)антител

Для определения относительного соотношения структур олигосахаридов, содержащих и не содержащих фукозу (a-fucose), проводили анализ высвобожденных гликанов из очищенного продукта антител при помощи масс-спектрометрии MALDI-Tof. Образец антител (около 50 мкг) инкубировали в течение ночи при 37°С с 5 мЕ N-Гликозидазы F (QAbio; PNGaseF: E-PNG01) в 2 мМ Tris, pH 7,0, для отщепления олигосахарида от белкового скелета. Для дезаминирования гликанов добавляли уксусную кислоту до конечной концентрации 150 мМ и инкубировали в течение 1 ч при 37°С. Для анализа с применением масс-спектрометрии MALDI TOF 2 мкп образца смешивали на мишени MALDI с 2 мкл матричного раствора DHB (раствор 2,5-дигидробензойной кислоты [Bruker Daltonics #201346] в смеси 50% этанол/5 мМ NaCl с концентрацией 4 мг/мл) и анализировали на масс-спектрометре MALDI TOF Autoflex II [Bruker Daltonics]. Как правило, в одном эксперименте анализировали по 50-300 отпечатков. Полученные спектры обрабатывали при помощи программы «flex analysis» (Bruker Daltonics) и определяли массу, соответствующую каждому зарегистрированному пику. Затем пики соотносили с углеводными структурами, содержащими или не содержащими фукозу (a-fucose) путем сравнения расчетной и ожидаемой массы для соответствующих структур (например, сложных, гибридных, а также с низким или высоким содержанием маннозы, соответственно, с фукозой и без).

Для определения соотношения гибридных структур образцы антител расщепляли одновременно с помощью N-Гликозидазы F и Эндо-Гликозидазы Н [QAbio; EndoH: E-EH02]. N-Гликозидада F высвобождает все N-связанные гликановые структуры (сложные, гибридные, а также с низким или высоким содержанием маннозы) из белкового скелета, а Эндо-Гликозидаза Н дополнительно отщепляет все гликаны гибридного типа между двумя остатками N-ацетилглюкозамина (GlcNAc) на восстанавливающем конце гликана. Эти продукты расщепления в дальнейшем обрабатывали и анализировали при помощи масс-спектрометрии MALDI TOF таким же образом, как описано выше для образцов после расщепления N-Гликозидазой F. Путем сравнения спектров, полученных при расщеплении N-Гликозидазой F и при одновременном расщеплении N-гликозидазой F/Эндо Н, оценивали относительное содержание гибридных структур по степени снижения уровня сигналов, характерных для определенных углеводных структур. Относительное количество каждой углеводной структуры рассчитывали по соотношению высоты пика, соответствующего каждой отдельной структуре, и суммы высоты пиков всех идентифицированных олигосахаридов. Количество фукозы выражали в виде процентной доли структур, содержащих фукозу, относительно всех углеводных структур, идентифицированных в образце, обработанном N-Гликозидазой F (например, сложных, гибридных, а также с низким или высоким содержанием маннозы, соответственно). Отсутствие фукозилирования (non-fucosylation) количественно выражали в виде процентной доли структур, не содержащих фукозу, относительно всех углеводов, идентифицированных в образце, обработанном N-Гликозидазой F (например, сложных, гибридных, а также с низким или высоким содержанием маннозы, соответственно).

Степень отсутствия фукозилирования для человеческого IgG антитела 2В10, определенная при помощи масс-спектрометрии MALDI-TOF, составляла 8,1% для варианта дикого типа и 83% для варианта, модифицированного с использованием гликоинженерии.

Пример 2

Конструирование универсальных библиотек Fab

Универсальные библиотеки антител в формате Fab конструировали на основе генов человека в конфигурации зародышевой линии, составляя следующие пары V-доменов: Vk3_20 легкой каппа цепи с VH3_23 тяжелой цепи для библиотеки DP47-3 и Vk1_17 легкой каппа цепи с VH1_69 тяжелой цепи для библиотеки DP88-3. См. SEQ ID NOs 1 и 2.

Обе библиотеки были рандомизированы в пределах CDR3 легкой цепи (L3) и CDR3 тяжелой цепи (Н3) и были собраны из 3 фрагментов на библиотеку посредством сплайсинга с использованием ПЦР с перекрывающимися праймерами, или SOE-PCR (от англ. Splicing by Overlapping Extension). Фрагмент 1 содержит 5' конец гена антитела, включая рандомизированный домен L3, фрагмент 2 является центральным константным фрагментом, охватывающим домены от L3 до Н3, тогда как фрагмент 3 содержит рандомизированный домен НЗ и 3' часть гена антитела.

Для создания фрагментов библиотек использовали следующие комбинации праймеров для библиотеки DP47-3: фрагмент 1 (LMB3-LibL1b_new), фрагмент 2 (MS63-MS64), фрагмент 3 (Lib2H-fdseqlong). См. Таблицу 3. Для создания фрагментов библиотек использовали следующие комбинации праймеров для библиотеки DP88-3: фрагмент 1 (LMB3-RJH_LIB3), фрагмент 2 (RJH31-RJH32) и фрагмент 3 (LIB88_2-fdseqlong). См. Таблицу 4.

Таблица 3.
Праймеры, использованные в библиотеке DP47-3 SEQ ID NO
LMB3 CAGGAAACAGCTATGACCATGATTAC 116
LibL1_bnew CACTTTGGTCCCCTGGCCGAACGTMNNGGGMNNMN NMNNACCCTGCTGACAGTAATACACTGC 117
MS63 TTTCGCACAGTAATATACGGCCGTGTCC 118
MS64 ACGTTCGGCCAGGGGACCAAAGTGG 119
Lib2H GGCCGTATATTACTGTGCGAAANNKNNKNNKNNKNN KTTTGACTACTGGGGCCAAGGAAC 120
fdseqlong GACGTTAGTAAATGAATTTTCTGTATGAGG 121
Таблица 4.
Праймеры, использованные в библиотеке DP88-3 SEQ ID NO
LMB3 CAGGAAACAGCTATGACCATGATTAC 116
RJHJ_LIB3 GACTTTGGTGCCCTGGCCAAACGT MNN GGG MNN MNN ACC MNN CTGCAAGCAGTAATAGGTGGCAAAATC 122
RJH31 ACGTTTGGCCAGGGCACCAAAGTCGAG 123
RJH32 TCTCGCACAGTAATACACGGCGGTGTCC 124
LIB88_2 GGACACCGCCGTGTATTACTGTGCGAGA-[(33% GAC Asp; 26% GGT Gly; 10% GAA Glu; 9% CGT Arg; 7% Lys; 6% GTT Val; 5% TCT Ser; 4% CTG Leu)1 -(23% GGT Gly; 17% TAC Туг; 16% TCT Ser; 11% GCT Ala; 9% CGT Arg; 7% AAC Asn; 6% ACT Thr; 6% GTT Val; 5% CCG Pro)8]-TTTGACTACTGGGGCCAAGGGACCACCGTGACCGTCTCC 125
fdseqlong GACGTTAGTAAATGAATTTTCTGTATGAGG 121

Протокол ПЦР для создания фрагментов библиотеки включал следующие этапы: первоначальная денатурация в течение 5 мин при 94°С; 25 циклов по 1 мин при 94°С, 1 мин при 58°С и 1 мин при 72°С; финальная элонгация в течение 10 мин при 72°С. Для сборки полного продукта в ПЦР в качестве матрицы использовали 3 фрагмента в эквимолярных количествах. Протокол ПЦР, позволяющей получить полный продукт, включал: первоначальную денатурацию в течение 3 мин при 94°С и 5 циклов по 30 сек при 94°С, 1 мин при 58°С и 2 мин при 72°С. На этом этапе добавляли праймеры, комплементарные последовательности за пределами фрагментов 1-3 и проводили дополнительно 20 циклов перед финальной элонгацией в течение 10 мин при 72°С.

После сборки достаточного количества конструкций полноразмерных рандомизированных Fab, проводили расщепление конструкции Fab с помощью NcoI/NotI для библиотеки DP47-3 и с помощью NcoI/NheI для библиотеки DP88-3 параллельно с аналогичной обработкой акцепторного фагмидного вектора. Для библиотеки DP47-3 проводили лигирование 22,8 мкг библиотеки Fab с 16,2 мкг фагмидного вектора. Для библиотеки DP88-3 проводили лигирование 30,6 мкг библиотеки Fab с 30,6 мкг фагмидного вектора.

Очищенные продукты лигирования использовали для 68 трансформаций библиотеки DP47-3 и 64 трансформаций библиотеки DP88-3, соответственно, для получения итоговых библиотек DP47-3 размером 4,2×1010 и DP88-3 размером 3,3×109. Фагмидные частицы, экспонирующие библиотеки Fab, выделяли и очищали при помощи PEG/NaCl для последующего использования в селекции.

Пример 3

Селекция клона 2В10 антитела к TNC A2 (первичная селекция)

Селекцию проводили при помощи TNC-A2 человека, экспрессированного в E. coli, который субклонировали в 5' положении относительно avi-tag и 6xhis-tag. См. SEQ ID NO:97.

Антиген биотинилировали in vivo сразу после экспрессии. Селекцию проводили в растворе согласно следующему протоколу: (i) связывание - 1012 фагмидных частиц библиотеки DP88-3 и 100 нМ биотинилированного TNC A2 человека в течение 0,5 ч в общем объеме 1 мл; (ii) захват биотинилированного TNC-A2 человека и связанного с ним фага на магнитных частицах, покрытых стрептавидином, добавленных в количестве 5,4×107, в течение 10 мин; (iii) отмывка частиц с помощью 5×1 мл PBS/Tween20 и 5×1 мл PBS; (iv) элюирование фаговых частиц при добавлении 1 мл 100 мМ TEA (триэтиламина) в течение 10 мин и нейтрализация при добавлении 500 мкл 1М Tris/HCl pH 7,4; и (v) повторное инфицирование клеток Е. coli штамма TG1 в лог-фазе, инфицирование хелперным фагом VCSM13 и последующая преципитация фагмидных частиц с помощью PEG/NaCl для применения в последующих раундах селекции.

Селекцию проводили в ходе 3 раундов, с применением постоянных концентраций антигена 100 нМ. Во 2 раунде осуществляли захват комплексов антиген:фаг на нейтравидиновые планшеты вместо стрептавидиновых частиц. Специфически связавшиеся комплексы определяли при помощи иммуноферментного анализа следующим образом: 100 нМ биотинилированного TNC-A2 человека вносили по 100 мкл в каждую лунку нейтравидиновых планшетов.

Добавляли бактериальный супернатант, содержащий Fab, и определяли связывание Fab при помощи Flag-эпитопа с применением конъюгированного с пероксидазой вторичного анти-Flag антитела. После идентификации клон 2В10 экспрессировали в бактериальных клетках, в культуре объемом 0,5 л, очищали путем аффинной хроматографии и затем характеризовали с помощью SPR-анализа на приборе BIACORE T100. См. SEQ ID NOs:56 и 60.

Пример 4

Конструирование библиотек для осуществления аффинного созревания антител к TNC A2 на основе клона 2В10

Библиотеку для осуществления аффинного созревания конструировали на основе антитела пре-селекционированного при первичной селекции TNC A2. Более конкретно, она была основана на родительском клоне 2В10 и состояла из двух суббиблиотек: 1) VL суб-библиотеки, рандомизированной в пределах CDR1 и CDR2 легкой цепи (L1/L2) и 2) VH суб-библиотеки, рандомизированной в пределах CDR1 и CDR2 тяжелой цепи (Н1/Н2). Эти суб-библиотеки пулировали сразу после трансформации. Каждая из этих суб-библиотек была сконструирована в ходе 4 последовательных этапов амплификации и сборки. Для библиотек L1/L2: 1) амплификация фрагмента 1 (LMB3 - AM_Vk1A30_L1_ba) и фрагмента 2 (RJH50 (Vk1A30_L1/L2_fo) - RJH51 (Vk1A30_BsiWI_ba)), 2) сборка фрагментов 1 и 2 с помощью внешних праймеров LMB3 и RJH51 (Vk1A30_BsiWI_ba) для получения матрицы для 3) амплификация фрагмента 3 (LMB3 - AM_Vk1A30_L2_ba) и фрагмента 4 (RJH52 (VMA30J-2/L3) - RJH51 (Vk1A30_BsiWI_ba)) и 4) финальная сборка фрагментов 3 и 4 с применением тех же внешних праймеров, что и ранее. Для библиотек Н1/Н2: 1) амплификация фрагмента 1 (RJH53 -AM_DP88_H1_ba_opt) и фрагмента 2 (RJH54(DP88_H1/H2_fo) - MS52), 2) сборка фрагментов 1 и 2 с применением внешних праймеров RJH53 и MS52 для создания матрицы для 3) амплификация фрагмента 3 (RJH53 - AM_DP88_H2_ba) и фрагмента 4 (RJH55 (DP88_H2H3_fo) - MS52) и 4) окончательная сборка фрагментов 3 и 4 с применением тех же внешних праймеров, что и выше. Продукты окончательной сборки расщепляли с помощью Ncol/BsiWI для суббиблиотек VL и MunI и NheI для суб-библиотек VH и клонировали в векторы-акцепторы, расщепленные аналогичным образом. Полученная библиотека содержала 1,16×1010 отдельных клонов.

Таблица 5.
Праймеры, использованные в L1/L2 библиотеках для осуществления аффинного созревания 2В10, связывающегося с TNC A2 SEQ ID NO
LMB3 CAGGAAACAGCTATGACCATGATTAC 116
AM Vk1A30 L1_ba CCTGGCTTCTGCTGGTACCAGCCTAAATCATTA CGAATGCCCTGACTTGCCCGGCAGGTGATG 126
RJH50(Vk1A30 L1/L2_fo) GCTGGTACCAGCAGAAGCCAGGGAAAG 127
RJH51 (Vk1A30_ GGTGCAGCCACCGTACGCTTGATCTC 128
BsiWI ba)
AM_Vk1A30_L2 ba CTTGATGGGACGCCACTCTGCAAACTGGACGC AGCATAGATCAGGCGCTTAGGGGCTTTCC 129
RJH52(Vk1A30_L2/L3) TTGCAGAGTGGCGTCCCATCAAGGTTC 130
Подчеркнуто: 60% исходных оснований и 40% рандомизированных по V Выделено жирным шрифтом: 60% исходных оснований и 40% рандомизированных по N
Таблица 6.
Праймеры, использованные в Н1/Н2 библиотеках для осуществления аффинного созревания 2В10, связывающегося с TNC A2 SEQ ID NO
RJH53 CATCAGGGCCTGAGCTCGCCCGTCAC 131
AM_DP88_H1b_a_opt GTCCAGGGGCCTGTCGCACCCAGCTTATAGCG TAGCTGCTGAATGTGCCTCCGGAGGCCTTG 132
RJH54 (DP88_H1/Н2_fo) ATAAGCTGGGTGCGACAGGCCCCTGGAC 133
MS52 GAAGACCGATGGGCCTTTGGTGCTAG 134
AM_DP88_H2_ba GACCCTGCCCTGGAACTTCTGTGCGTAGTTTGC GGTACCAAAGATAGGGATGATCCCTCCCATCC ACTCGAGCCCTTGTCCAG 135
RJH55 (DP88_Н2Н3_fo) TACGCACAGAAGTTCCAGGGCAGGGTCAC 136
Подчеркнуто: 60% исходных оснований и 40% рандомизированных по V Выделено жирным шрифтом: 60% исходных оснований и 40% рандомизированных по N

Пример 5

Селекция подвергшихся аффинному созреванию клонов к TNC A2

Селекцию проводили с использованием TNC A2 человека, экспрессированного в E. coli, который клонировали выше avi-tag и 6×his-tag (см. SEQ ID NO:97). Антиген биотинилировали in vivo сразу после экспрессии. Селекцию проводили в растворе согласно описанию первичной селекции TNC A2 с использованием понижающихся концентраций TNC A2 человека, изменяющихся в диапазоне от 100 до 2 нМ. После идентификации клонов с созревшей аффинностью при помощи иммуноферментного анализа проводили вторичный скрининг с применением биосенсора ProteOn XPR36 (Biorad) и на этом же инструменте определяли константы скорости реакции и аффинность Fab, очищенных с помощью аффинной хроматографии. KD определяли с помощью поверхностного плазменного резонанса с использованием аппарата ProteOn XPR36 (Biorad) при 25°С с иммобилизацией антигенов на сенсорном чипе NLC (Biorad). Вкратце, рекомбинантный антиген разводили до 10 мкг/мл в PBS/0,005% Tween-20, pH 7,4 и инжектировали на скорости 30 мкг/мин в течение 100-300 сек для достижения уровня связывания антигена приблизительно 200-800 единиц RU. Для анализа кинетики связывания по методу «one-shot» проводили инжектирование очищенных Fab в серии двукратных разведении (в диапазоне концентраций от ~0,01 нМ до 25 нМ) на скорости приблизительно 100 мкл/мин. Время ассоциации составляло 210 сек, а время диссоциации 600 сек. Для регенерации сенсорного чипа инжектировали 50 мМ NaOH в течение 18 сек при скорости потока 100 мкл/мин. Скорость ассоциации (kon) и скорость диссоциации (Код) рассчитывали с использованием простой модели связывания один-к-одному, предложенной Ленгмюром (в программное «ProteOn manager», версия 2.1) при одновременной аппроксимации сенсограмм ассоциации и диссоциации. Константу равновесной диссоциации (Ко) рассчитывали как отношение koff/kon.

Были идентифицированы следующие клоны с созревшей аффинностью:

2B10_01F7 (см. SEQ ID NOs:85 и 87), 2В10_6Н10 (см. SEQ ID NOs:89 и 91), 2В10_СЗА6 (см. SEQ ID NOs:69 и 71), 2B10_D1A2 (см. SEQ ID NOs:73 и 75), и 2B10_07D8 (см. SEQ ID NOs:81 и 83) (все они были получены из суб-библиотеки VJ, а также 2В10_С3В6 (см. SEQ ID NOs:61 и 63) и 2В10_6А12 (см. SEQ ID NOs:65 и 67) (эти два клона были получены из суб-библиотеки VH). Кроме этого, для клона 2B10_D1A2, был получен мутант V32D (см. SEQ ID NOs:77 и 79) (нумерация согласно Кабат).

На Фигуре 1 показаны сенсограммы поверхностного плазменного резонанса связывания отобранных Fab, подвергнутых аффинному созреванию, и иммобилизованного TNC A2, а в Таблице 7 приведены соответствующие значения аффинности. Отобранные Fab характеризуются высокой аффинностью в пикомолярном диапазоне концентраций

Таблица 7.
Итоговая информация о константах кинетического равновесия (Ко) антител с созревшей аффинностью к TNC A2 в виде Fab фрагментов (моновалентное связывание).
антитело аффинность (KD) к TNC A2 человека [пМ]
2В10_С3В6 191
2В10_6А12 290
2В10_С3А6 497
2В10_07D8 147
2В10_01F7 56
2В10_6Н10 810

Пример 6

Конверсия 2В10 Fab фрагментов, связывающих TNC A2, в IgG

Родительские Fab 2В10 и производные Fab 2В10 подвергнутые аффинному созреванию, конвертировали в формат IgG1 человека, в формат IgG2a мыши и формат IgG1 человека с пришиванием пептида Avi Tag к С-концу тяжелой цепи. Fab 2В10, подвергнутые аффинному созреванию, конвертировали в IgG мыши для возможности осуществлять иммуногистохимический анализ (см. Пример 8).

Последовательности ДНК тяжелой и легкой цепей полноразмерного антитела были получены либо при субклонировании вариабельных участков внутри рамки считывания с соответствующими константными участками тяжелой и легкой цепи, предварительно встроенными в различные экспрессионные векторы-реципиенты млекопитающих, либо были рекомбинированы путем пришивания короткого фрагмента последовательности, гомологичного сайту инсерции вектора-реципиента. Рекомбинацию осуществляли согласно инструкции "In-Fusion Cloning System" компании Invitrogen.

Во всех векторах экспрессия антитела находилась под контролем промотора MPSV, и все векторы имели синтетическую сигнальную последовательность поли-А на 3' конце CDS. Кроме этого, каждый вектор содержал последовательность EBV OriP.

Пример 7

Определение аффинности 2В10 Fab и IgG к TNC A2

Затем с помощью метода поверхностного плазменного резонанса с использованием прибора BIACORE®T100 (GE Healthcare) при 25°С определяли и проверяли аффинность к A2 домену TNC человека, мыши и яванского макака для Fab фрагмента 2В10 против TNC A2 и для конвертированного в формат человеческого IgG1 антитела 2В10 против TNC A2. Для этой цели биотинилированные антигены (экспрессированные в Е. coli антигены не претерпевали гликозилирования) иммобилизовали на стрептавидиновом чипе и использовали конструкции в качестве аналитов. Для иммобилизации антигены разводили в HBS-EP+(GE Healthcare, 10 мМ HEPES, 150 мМ NaCl, 3 мМ EDTA, 0,05% сурфактант Р20, рН 7,4) до 0,1 мкг/мл перед инжектированием со скоростью 10 мкл/мин для достижения уровня связывания белка приблизительно 80 единиц RU. Домен TNC A2 человека, мыши и яванского макака экспрессировали вместе с доменами А1 и A3. Конструкции антигенов, содержащие пятый фибронектиновый домен III типа (Fn5) TNC человека, А1 и A2 домены TNC человека, мыши или яванского макака и A3 домен TNC человека (TNC Fn5-A1-human/murine/cynoA2-A3), приведены в SEQ ID NOs 99-104.

Для измерения кинетики инжектировали серии двукратных разведении Fab фрагментов в (в диапазоне от 1,56 нМ до 100 нМ) или IgG (в диапазоне от 0,39 нМ до 25 нМ) в HBS-EP+при 25°С со скоростью 50 мкл/мин. Время ассоциации и диссоциации составляло 180 сек, а между циклами выполняли регенерацию с помощью 10 мМ глицина рН 1,5 в течение 60 сек. Скорости ассоциации (kon) и диссоциации (koff) рассчитывали с применением простой модели связывания в соотношении один-к-одному, предложенной Ленгмюром (в программе BIACORE® Т100 Evaluation, версия 1.1.1) при одновременной аппроксимации сенсограмм ассоциации и диссоциации. Константу равновесной диссоциации (KD) рассчитывали как отношение koff/kon. См., например, Chen et al., J Mol Biol 293, 865-881 (1999).

Домены TNC с 1 по 8, полученные в клетках НЕК, служили отрицательным контролем (см. SEQ ID 105 и 106).

Значения KD для связывания приведены в Таблице 8. На Фигуре 2 А-В показаны соответствующие результаты анализа кинетики с использованием SPR.

Таблица 8.
Итоговая информация о константах кинетического равновесия (KD) 2В10 антител к TNCA2 в виде Fab фрагментов и в виде IgG
Конструкция TNC человека TNC мыши TNC яванского макака
IgG 2B10 Иммоб Аг Е. coli Авидность: 0,29 нМ Авидность: 1,9 нМ Авидность: 0,21 нМ
Fab фрагмент 2B10 Иммоб Аг Е. coli Аффинность: 1,8 нМ Аффинность: 180нМ Аффинность: 17 нМ

Пример 8

Связывание антител к TNC A2 на срезах опухолевой ткани человека в сравнении с нормальной тканью

Для проверки специфичности отобранного Fab 2B10 к A2 домену тенасцина человека (TNC-A2) и оценки его способности селективно связываться с опухолевой тканью в сравнении с нормальной тканью проводили иммуногистохимические исследования. Вкратце, вариабельный участок 2B10 в составе Fab фрагмента гибридизовали с FLAG фрагментом (SHD2B10-FLAG). Для иммуногистохимического окрашивания подготавливали образцы здоровой и пораженной раком ткани матки человека. Затем образцы инкубировали с SHD2B10-FLAG Fab фрагментом. После этого образцы отмывали и инкубировали с флуоресцентным антителом, специфичным к FLAG эпитопу. Образцы опухолевой ткани имели повышенные уровни экспрессии TNC A2 по сравнению с образцами здоровой ткани (Фигура ЗА). Различные образцы тканей человека, полученные от здоровых индивидов и онкологических больных, инкубировали с SHD2B10-FLAG Fab фрагментом, согласно описанию. На Фигуре 3 В показан уровень экспрессии TNC A2 в различных образцах ткани человека, выраженный количественно в % от площади окрашиваемой поверхности. В другой серии экспериментов вариабельный участок 2B10 использовали в формате IgG мыши. Для иммуногистохимического окрашивания подготавливали образцы здоровых и пораженных раком тканей различных органов человека. Затем образцы инкубировали с мышиным IgG SHD2B10. После этого образцы отмывали и инкубировали с детектирующей системой на основе пероксидазы. На Фигуре 4 A-N показано, что образцы опухолевой ткани имели повышенные уровни экспрессии TNC A2 по сравнению с образцами здоровой ткани.

Пример 9

Связывание антител к TNC A2 с Тенасцином-С клеток глиобластомы U87MG

Fab 2B10 конвертировали в IgG1 антитело человека и исследовали связывание с TNC A2, экспрессируемым клетками глиобластомы U87MG при помощи FACS. Вкратце, 200000 клеток на лунку инкубировали с указанной концентрацией 2B10 антитела к TNC A2 в круглодонных 96-луночных планшетах, инкубировали в течение 30 мин при 4°С и отмывали однократно с PBS/0,1% BSA. Связанное антитело определяли при помощи FITC-конъюгированного F(ab')2 фрагмента антитела козы к IgG человека, специфичного к Fcγ (Jackson Immuno Research Lab #109-096-098, рабочий раствор: разведение 1:20 в PBS/0,1% BSA, свежеприготовленный) после инкубации в течение 30 мин при 4°С, на приборе FACS Cantoll (в программе FACS Diva). На Фигуре 5 показана средняя интенсивность флуоресценции для дозозависимого связывания в сравнении с необработанными клетками и клетками, окрашенными только вторичным антителом.

С использованием аналогичной методики исследовали связывание модифицированного с использованием гликоинженерии человеческого IgG антитела 2В10 с TNC A2 на клетках U87MG, в сравнении человеческим с IgG антителом 2В10 дикого типа. На Фигуре 8 показано, что оба антитела 2В10, как дикого типа, так и модифицированное с использованием гликоинженерии, связываются с TNC A2 на клетках U87MG.

Пример 10

Связывание антител с созревшей аффинностью к TNC A2 с Тенасцином-С опухолевых клеток

Связывание IgG1 антител человека, полученных на основе Fab 2В10, подвергнутых аффинному созреванию, и TNC A2 человека клеток глиобластомы U87MG или клеток меланомы SK-Mel5 исследовали с помощью FACS. Вкратце, 200000 клеток на лунку инкубировали с указанными концентрациями антител к TNC A2, полученных на основе 2В10, в круглодонном 96-луночном планшете, инкубировали в течение 30 мин при 4°С и отмывали однократно PBS/0,1% BSA. Связанное антитело определяли при помощи FITC-конъюгированного F(ab')2 фрагмента антитела козы к IgG человека, специфичного к Fey (Jackson Immuno Research Lab #109-096-098, рабочий раствор: разведение 1:20 в PBS/0,1% BSA, свежеприготовленный) после инкубации в течение 30 мин при 4°С, на приборе FACS Cantoll (в программе FACS Diva).

Пример 11

Антитело-зависимая клеточная цитотоксичность, опосредованная модифицированными с использованием гликоинженерии lgG1 антителами к TNCA2

IgG1 антитела человека к TNC A2, полученные на основе 2В10, были модифицированы с использованием гликоинженерии посредством ко-трансфекции плазмидами, кодирующими GnTIII и ManII, согласно описанию в Примере 1. Затем модифицированное с использованием гликоинженерии родительское антитело 2В10 и человеческое IgG1 антитело с созревшей аффинностью, полученное на основе 2В10, сравнивали при исследовании ADCC по их способности опосредовать большую антитело-зависимую клеточную цитотоксичность в сравнении с их версиями дикого типа, не модифицированными с использованием гликоинженерии. Вкратце, клетки глиобластомы U87MG или клетки меланомы SK-MeI5, использованные в качестве клеток-мишеней, собирали, отмывали и ресуспендировали в культуральной среде и окрашивали свежеприготовленным Calcein AM (Molecular Probes) при 37°С в течение 30 мин, 3-кратно отмывали, подсчитывали и разводили до концентрации 300000 клеток/мл. Эту суспензию переносили в круглодонные 96-луночные планшеты (30000 клеток/лунку), добавляли соответствующее разведение антитела и инкубировали в течение 10 мин для связывания тестируемого антитела с клетками перед контактом с эффекторными клетками. Соотношение эффекторных клеток и клеток-мишеней составляло 30 к 1 для РВМС; альтернативно, можно использовать клетки NK92. Совместную инкубацию проводили в течение 4 часов. В качестве показателя использовали высвобождение лактат дегидрогеназы (LDH) в супернатант после разрушения атакованных клеток. LDH в собранном культуральном супернатанте анализировали при помощи набора для определения LDH (Roche Applied Science). Превращение субстрата под воздействием фермента LDH измеряли при помощи ИФА-фотометра (программа SoftMaxPro, длины волн: 490 нм и 650 нм).

Несмотря на то, что настоящее изобретение было описано в некоторых деталях посредством иллюстраций и примеров в целях исключения двусмысленного толкования, описания и примеры не должны рассматриваться как исчерпывающие. Описания всех патентов и научных публикаций, процитированные здесь, явным образом полностью включены в данный документ путем ссылок.

1. Антитело, специфически связывающее А2 домен тенасцина С (TNC А2) человека или яванского макака, отличающееся тем, что указанное антитело содержит
(i) вариабельный участок тяжелой цепи, содержащий аминокислотную последовательность SEQ ID NO: 63 или SEQ ID NO: 67, и вариабельный участок легкой цепи, содержащий аминокислотную последовательность SEQ ID NO: 57; или
(ii) вариабельный участок тяжелой цепи, содержащий аминокислотную последовательность SEQ ID NO: 59, и вариабельный участок легкой цепи, содержащий аминокислотную последовательность, выбранную из группы SEQ ID NO: 69, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 81, SEQ ID NO: 85 и SEQ ID NO: 89.

2. Антитело по п.1, отличающееся тем, что указанное антитело содержит Fc фрагмент или участок, эквивалентный Fc фрагменту иммуноглобулина.

3. Антитело, специфически связывающее А2 домен тенасцина С (TNC А2) человека или яванского макака, отличающееся тем, что указанное антитело содержит вариабельный участок тяжелой цепи, содержащий аминокислотную последовательность SEQ ID NO: 59, и вариабельный участок легкой цепи, содержащий аминокислотную последовательность SEQ ID NO: 55 или SEQ ID NO: 57, где указанное антитело содержит Fc фрагмент или участок, эквивалентный Fc фрагменту иммуноглобулина.

4. Антитело по п.2 или 3, отличающееся тем, что указанный Fc фрагмент представляет собой Fc фрагмент IgG.

5. Антитело по п.1 или 2, отличающееся тем, что указанное антитело представляет собой полноразмерное антитело класса IgG.

6. Антитело по п.1 или 2, отличающееся тем, что указанное антитело содержит человеческий константный участок.

7. Антитело по п.1 или 2, отличающееся тем, что указанное антитело представляет собой человеческое антитело.

8. Антитело по п.1 или 2, отличающееся тем, что указанное антитело содержит Fc фрагмент, модифицированный с использованием гликоинженерии.

9. Антитело по п.8, отличающееся тем, что указанное антитело имеет повышенное содержание нефукозилированных олигосахаридов в указанном Fc фрагменте по сравнению с антителом, не модифицированным с использованием гликоинженерии.

10. Антитело по п.8, отличающееся тем, что по меньшей мере приблизительно от 20% до приблизительно 100% N-связанных олигосахаридов в указанном Fc фрагменте являются нефукозилированными.

11. Антитело по п.8, отличающееся тем, что указанное антитело имеет повышенное содержание разветвленных олигосахаридов в указанном Fc фрагменте по сравнению с антителом, не модифицированным с использованием гликоинженерии.

12. Антитело по п.8, отличающееся тем, что по меньшей мере приблизительно от 20% до приблизительно 100% N-связанных олигосахаридов в указанном Fc фрагменте являются разветвленными.

13. Антитело по п.8, отличающееся тем, что по меньшей мере приблизительно от 20% до приблизительно 50% N-связанных олигосахаридов в указанном Fc фрагменте являются разветвленными и нефукозилированными.

14. Антитело по п.1 или 2, отличающееся тем, что указанное антитело имеет повышенную эффекторную функцию и/или повышенную аффинность связывания Fc рецепторов.

15. Антитело по п.14, отличающееся тем, что указанная повышенная эффекторная функция представляет собой повышенную ADCC.

16. Антитело по п.1 или 2, отличающееся тем, что указанное антитело представляет собой антитело, подвергнутое аффинному созреванию.

17. Антитело по п.1 или 2, отличающееся тем, что указанное антитело связывает TNC А2 человека с KD менее приблизительно 1 мкМ.

18. Антитело по п.1 или 2, отличающееся тем, что указанное антитело связывает TNC А2 в тканях человека.

19. Выделенный полинуклеотид, кодирующий антитело по любому из пп.1-18.

20. Вектор экспрессии, содержащий полинуклеотид по п.19.

21. Клетка-хозяин для получения антитела, которое специфически связывает А2 домен тенасцина С человека или яванского макака, содержащая полинуклеотид по п.19 или вектор по п.20.

22. Клетка-хозяин по п.21, отличающаяся тем, что указанная клетка-хозяин модифицирована с целью экспрессировать повышенные уровни одного или нескольких полипептидов, обладающих активностью GnTIII.

23. Клетка-хозяин по п.22, отличающаяся тем, что указанный полипептид, имеющий активность GnTIII, представляет собой гибридный полипептид, содержащий каталитический домен GnTIII и отвечающий за локализацию в комплексе Гольджи домен ManII.

24. Клетка-хозяин по п.22 или 23, отличающаяся тем, что указанная клетка-хозяин также модифицирована с целью экспрессировать повышенный уровни одного или нескольких полипептидов, обладающих активностью ManII.

25. Способ получения антитела по любому из пп.1-18, отличающийся тем, что указанный способ включает
а) культивирование клетки-хозяина по п.21 в среде при условиях, обеспечивающих экспрессию антитела и
б) выделение антитела.

26. Способ получения антитела по любому из пп.1-18, отличающийся тем, что указанный способ включает
а) культивирование клетки-хозяина по любому из пп.22-24 в среде при условиях, обеспечивающих экспрессию антитела и модификацию олигосахаридов, содержащихся в Fc фрагменте указанного антитела с использованием указанного полипептида, обладающего активностью GnTIII и
б) выделение антитела.

27. Фармацевтическая композиция, обладающая связыванием с TNC А2, содержащая эффективное количество антитела по любому из пп.1-24 и фармацевтически приемлемый носитель.

28. Фармацевтическая композиция по п.27, также содержащая дополнительный терапевтический агент.

29. Антитело по п.1 или 2 для применения в качестве лекарственного средства.

30. Антитело по п.1 или 2 для лечения заболевания, характеризующегося экспрессией TNC А2.

31. Антитело по п.30, отличающееся тем, что указанное заболевание представляет собой рак.

32. Антитело по п.1 или 2 для применения при индукции цитолиза опухолевой клетки или стромальной опухолевой клетки.

33. Применение антитела по любому из пп.1-18 для изготовления лекарственного средства.

34. Применение антитела по любому из пп.1-18 для производства лекарственного средства для лечения заболевания, характеризующегося экспрессией TNC А2.

35. Применение по п.34, отличающееся тем, что указанное заболевание представляет собой рак.

36. Применение антитела по любому из пп.1-18 для производства лекарственного средства для индукции цитолиза опухолевой клетки или стромальной опухолевой клетки.



 

Похожие патенты:

Настоящее изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5, охарактеризованное последовательностями HVR.

Изобретение относится к области биотехнологии, конкретно к иммуногенным эпитопам MELK, и может быть использовано в медицине для лечения пациента, страдающего раком или эндометриозом.

Изобретение относится к области биотехнологии и вирусологии. Описан новый штамм вируса ветряной оспы (VZV).

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению модифицированного vWF, и может быть использовано в медицине для лечения гемофилии.

Изобретение относится к области биотехнологии и иммунологии. Предложены новые противораковые антитела, которые связываются с рецептором “frizzled” человека.

Изобретение относится к композиции для поддержания функции тромбоцитов, где композиция в качестве активного ингредиента содержит соединение, представленное общей формулой (I), или его фармацевтически приемлемую соль: где соединение, представленное общей формулой (I), представляет собой любое из N-[2-(4-бут-2-инилоксибензолсульфонил)-1-(4-диэтиламинометилфенил)этил]-N-гидроксиформамида и N-{4-[2-(4-бут-2-инилоксибензолсульфонил)-1-(формилгидроксиамино)этил]бензил}метансульфонамида.

Данное изобретение относится к области иммунологии. Предложено выделенное антитело или его фрагмент, которые связываются с Axl человека и охарактеризованные последовательностями гипервариабельных участков (CDR).

Изобретения касаются системы стабильной экспрессии лентивирусных структурных и регуляторных белков, полустабильной линии пакующих клеток и способа получения лентивирусных векторов (LV) с использованием такой линии пакующих клеток.

Изобретения касаются способов получения стабильной линии пакующих лентивирусы клеток (варианты), стабильной линии пакующих лентивирусы клеток, способа получения лентивирусных векторов, линии клеток-продуцентов и способа производства лентивирусных векторов.

Настоящее изобретение относится к области иммунологии. Предложено моноклональное антитело и его антигенсвязывающий фрагмент, обладающие способностью специфически связываться с IL-17А человека и охарактеризованные последовательностями CDR.

Настоящее изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5, охарактеризованное последовательностями HVR.

Изобретение относится к биотехнологии, а именно к полинуклеотиду, который кодирует полипептидный клостридиальный нейротоксин, а также к векторам и клеткам-хозяевам, содержащим указанный полинуклеотид.

Изобретение относится к области биохимии, в частности к антителу или его функциональному фрагменту, которые способны связывается с cMet. Также раскрыты мышиная гибридома, способная секретировать указное антитело, нуклеиновая кислота, которая экспрессирует указанное антитело и набор для прогнозирования эффективности лечения онкогенного расстройства, включающий указанное антитело.

Группа изобретений относится к области биотехнологии. Представлена рекомбинантная плазмида pCpG-CytDA/upp с нуклеотидной последовательностью SEQ ID NO: 1, обеспечивающая экспрессию гибридного белка цитозиндезаминаза E.coli-урацилфосфорибозил трансфераза.

Изобретение относится к области биотехнологии и вирусологии. Описан новый штамм вируса ветряной оспы (VZV).

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению модифицированного vWF, и может быть использовано в медицине для лечения гемофилии.

Изобретение относится к области биотехнологии и иммунологии. Предложены новые противораковые антитела, которые связываются с рецептором “frizzled” человека.

Данное изобретение относится к области иммунологии. Предложено выделенное антитело или его фрагмент, которые связываются с Axl человека и охарактеризованные последовательностями гипервариабельных участков (CDR).

Настоящее изобретение относится к области иммунологии. Предложено моноклональное антитело и его антигенсвязывающий фрагмент, обладающие способностью специфически связываться с IL-17А человека и охарактеризованные последовательностями CDR.

Изобретение касается способа получения рекомбинантного белка SAV-RGD, где SAV - мономер стрептавидина, RGD - меланома-адресующий олигопептид, имеющий аминокислотную последовательность Ser-Arg-Ala-Gly-Ala-Asp-Gly-Phe-Pro-Gly-Cys-Arg-Gly-Asp-Cys-Ser-Gln-Glu.

Настоящее изобретение относится к области иммунологии. Предложено выделенное моноклональное антитело к FcRH5, охарактеризованное последовательностями HVR.
Наверх