Тест-система для выявления днк возбудителя лептоспироза (leptospira spp.) у сельскохозяйственных животных

Авторы патента:


Тест-система для выявления днк возбудителя лептоспироза (leptospira spp.) у сельскохозяйственных животных
Тест-система для выявления днк возбудителя лептоспироза (leptospira spp.) у сельскохозяйственных животных
Тест-система для выявления днк возбудителя лептоспироза (leptospira spp.) у сельскохозяйственных животных
Тест-система для выявления днк возбудителя лептоспироза (leptospira spp.) у сельскохозяйственных животных
Тест-система для выявления днк возбудителя лептоспироза (leptospira spp.) у сельскохозяйственных животных
Тест-система для выявления днк возбудителя лептоспироза (leptospira spp.) у сельскохозяйственных животных

Владельцы патента RU 2680094:

Федеральное государственное бюджетное образовательное учреждение высшего образования "Кубанский государственный аграрный университет имени И.Т. Трубилина" (RU)

Изобретение относится к ветеринарной микробиологии, в частности к лабораторной диагностике возбудителей инфекционных заболеваний, а именно к средствам диагностики инфекции у животных. Описан тест-система для выявления ДНК возбудителя лептоспироза (Leptospira spp.) у сельскохозяйственных животных, включающий буфер для проведения полимеразной цепной реакции, смесь для ее проведения состоящая из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов специфичные для возбудителя лептоспироза Leptospira spp. и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец. Для внутреннего контрольного образца используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл. Для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома возбудителя лептоспироза (Leptospira spp. Lpts) и фрагмент генома бактериофага Т4, взятых в объемном соотношении 1:1. Технический результат - уменьшение трудозатрат, времени и расходного материала при проведении полимеразной цепной реакции. 2 ил., 4 табл., 1 пр.

 

Изобретение относится к ветеринарной микробиологии, в частности к лабораторной диагностике возбудителей инфекционных заболеваний, а именно к средствам диагностики инфекции у животных.

Также известно использование ПЦР для диагностики лептоспироза у сельскохозяйственных животных для этого проводили две амплификации: первая - с внешней парой праймеров (LepF и LepR), вторая - с внутренней (16LNF и 16LNR). Использовали универсальные праймеры, позволяющие определять участок генома, кодирующий 16S рРНК. Выявление продуктов реакции проводили методом горизонтального электрофореза в агарозном геле. Гели анализировали, используя ультрафиолетовый трансиллюминатор ( - 254 нм).

Исследуемые пробы считали отрицательными, если на электрофоре-граммах не было четких полос или полосы не соответствовали по размеру фрагменту в контрольной пробе (т.е. располагались на другом расстоянии от старта) (Викторова Е.В. Автореферат диссертации по ветеринарии на тему «Полимеразная цепная реакция при диагностике лептоспироза и изучение органотропности лептоспир у сельскохозяйственных животных», Москва, 2006 г.)

Недостатком известного технического решения является не достаточная чувствительность из-за проведения ПЦР в агарозном геле.

Наиболее близким аналогом является техническое решение (Инструкция по применению набора реагентов для выявления 16S РНК патогенных геновидов лептоспир в клиническом, аутопсийном и биологическом материале методом полимеразной цепной реакции (ПЦР) с гибридизационно-флуоресцентной детекцией «АмплиСенс Leptospira-FL», Москва, 2018 г. - прототип) в котором использовали буфер для проведения полимеразной цепной реакции, смесь для ее проведения состоящая из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов специфичные для возбудителя лептоспироза и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец,

Недостатком является увеличение трудозатрат, времени и использование дополнительных реагентов для процесса выделения РНК для получения кДНК.

Техническим результатом является уменьшение трудозатрат, времени и расходного материала при проведении ПЦР.

Технический результат достигается тем, что в тест-системе для выявления ДНК возбудителя лептоспироза (Leptospira spp.) у сельскохозяйственных животных, включающем буфер для проведения полимеразной цепной реакции, смесь для ее проведения состоящая из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов специфичные для возбудителя лептоспироза (Leptospira spp.) и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, согласно изобретению для внутреннего контрольного образца используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома возбудителя лептоспироза (Leptospira spp. Lpts) и фрагмент генома бактериофага Т4 взятых в соотношении 1:1 со следующими нуклеотидными последовательностями:

прямой праймер

обратный праймер

зонд

зонд.

Новизна заявляемого технического решения заключается в том, что для уменьшения трудозатрат, времени и расходного материала при проведении ПЦР выделяют ДНК из биологического материала от инфицированных животных и используют для внутреннего и положительного контрольных образцов различные формы материала бактериофага Т4: суспензия и фрагмент генома со специфическими к нему праймерами и зондом. Такая постановка ПЦР в реальном времени сокращает и упрощает процедуру анализа, снижает риск контаминации. Кроме того, флуоресцентная детекция продуктов амплификации осуществляется с использованием принципа выщепления флуоресцентной метки на 5' конце олигонуклеотидного зонда.

Признаки, отличающие заявляемое техническое решение от прототипа, направлены на достижение технического результата и не выявлены при изучении данной и смежной областей науки и техники и, следовательно, соответствуют критерию «изобретательский уровень».

Заявляемый способ рекомендовано использовать в ветеринарной вирусологии, так как относится к средствам выявления ДНК возбудителя лептоспироза (Leptospira spp.) у сельскохозяйственных животных, что соответствует критерию «промышленная применимость».

Сущность изобретения поясняется чертежами, где представлены скриншоты графиков, на фиг. 1 - представлен канал FAM/Green - для тестирования сигнала от внутреннего контрольного образца - ВКО; на фиг. 2 канал JOE(HEX)/Yellow накопление флуоресцентного сигнала для специфического сигнала тестирования наличия генома возбудителя лептоспироза (Leptospira spp. Lpts) Тест-система для выявления ДНК возбудителя лептоспироза (Leptospira spp.) у сельскохозяйственных животных используется следующим образом.

Выделяют ДНК из биологического материала от инфицированных животных. В качестве биологического материала используют по выбору: цельную кровь (от животных с острой формой инфекции), фрагменты тканей и органов от павших животных (мозг, легкие, почки) и мочу. Для внутреннего контрольного образца используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома возбудителя лептоспироза (Leptospira spp. Lpts) и фрагмент генома бактериофага Т4 взятых в соотношении 1:1, со следующими нуклеотидными последовательностями:

прямой праймер

обратный праймер

зонд

зонд.

Осуществляют постановку одноэтапной полимеразной цепной реакции - с одновременным проведением не более 40 циклов амплификации с флуоресцентной детекцией с использованием специфичных для участка генома ДНК возбудителя лептоспироза (Leptospira spp.) олигонуклеотидных праймеров, зондов, красителей и контрольных образцов в виде внутреннего и положительного, измеряют по каналу JOE(HEX)/Yellow (фиг. 2) накопление флуоресцентного сигнала для специфического сигнала тестирования наличия генома ДНК возбудителя лептоспироза (Leptospira spp.), а по каналу FAM/Green - накопление сигнала внутреннего контрольного образца (фиг. 1), проведят интерпретацию результатов на основании наличия/отсутствия пересечения кривой флуоресценции с пороговой линией, если кривые накопления флуоресцентного сигнала выходят до 35 цикла, то ДНК возбудителя лептоспироза (Leptospira spp.) присутствует и результат реакции считается положительным, а если кривые не пересекают пороговую линию или пересекают ее после 35 цикла, то ДНК возбудителя лептоспироза (Leptospira spp.) отсутствует и результат реакции - отрицательный.

Пример конкретного использования тест-системы для выявления ДНК возбудителя лептоспироза (Leptospira spp.) у сельскохозяйственных животных. Для тест системы используют набор «ПЦР-ЛЕПТОСПИРОЗ-ФАКТОР» в соответствии с инструкцией по применению набора реагентов «ПЦР-ЛЕПТОСПИРОЗ-ФАКТОР» для выявления ДНК возбудителя лептоспироза (Leptospira spp.) в биологическом материале методом полимеразной цепной реакции (ПЦР) с флуоресцентной детекцией в режиме реального времени ТУ 21.10.60-129-51062356-2017, для диагностики in vitro, (http://www. vetfaktor.ru/.).

Набор состоит из комплекта реагентов для проведения мультиплексной ПЦР (комплект №1) и комплекта контрольных образцов (комплект №2). Состав набора приведен в Таблицах 1 и 2.

Для исследования используют следующий биологический материал:

- Цельная кровь (от животных с острой формой инфекции). Кровь забирается в пробирку с 3-6% ЭДТА из расчета 50 мкл раствора ЭДТА на 1 мл крови, закрытую пробирку с кровью несколько раз переворачивают.

- Фрагменты тканей и органов от павших животных (мозг, легкие, почки) отбирают в стерильный контейнер.

- Мочу отбирают в количестве 15-25 мл в специальный сухой стерильный флакон или контейнер. Если нет возможности исследовать материал в течение суток вносят глицерин до 10% от объема, перемешивают и хранят при температуре не выше 16°С.

Подготовка исследуемого биологического материала:

Кровь. Пробирку с кровью аккуратно несколько раз переворачивают для равномерного перемешивания. Затем готовят плазму центрифугированием в течение 6-10 мин при 1000 g. Отбирают плазму в пробирки по 1 мл и центрифугируют на микроцентрифуге при 13 тыс об/мин в течение 10 мин для концентрирования бактериальных клеток. Удаляют 900 мкл надосадочной плазмы, оставшиеся 100 мкл надосадка используют для экстракции ДНК.

Исследуемые пробы фрагментов тканей и органов от павших животных гомогенизируют с использованием стерильных фарфоровых ступок и пестиков, добавляют десятикратный объем стерильного физиологического раствора или фосфатного буфера и тщательно перемешивают. Суспензию переносят в пробирку объемом 1,5 мл и центрифугируют при 600-1600 g (2000 об./мин на центрифуге «MiniSpin», Eppendorf, Германия) в течение 2-5 мин. Аликвоту надосадочной жидкости (0,1 мл) используют для экстракции ДНК.

Мочу после сбора отстаивают в течение 1 часа, затем осторожно сливают, оставляя придонную часть - около 10 мл. Центрифугируют остаток при 5000-6000 g 10 мин, удаляют надосадочную жидкость (не полностью), осадок с 100 мкл надосадочной жидкости переносят в пробирку объемом 1,5 мл и используют для экстракции ДНК.

Проведение анализа, который состоит из трех этапов:

- экстракция нуклеиновой кислоты (НК), на этом этапе дополнительно используют реактивы для экстракции, например набор «ДНК/РНК-С-ФАКТОР»);

- проведение ПЦР с флуоресцентной детекцией в режиме реального времени;

- учет результатов анализа.

Для экстракции (выделения) НК из биологического материала отбирают необходимое количество одноразовых пробирок объемом 1,5 мл, включая отрицательный контроль выделения. Вносят во все пробирки с исследуемыми образцами, включая пробирку для отрицательного контрольного образца (ОКО), по 10 мкл внутреннего контрольного образца (ВКО) LEPTO.

Вносят исследуемые пробы в объеме согласно инструкции к набору для выделения НК, в пробирку отрицательного контроля выделения вместо исследуемой пробы вносят ОКО (пробирку обозначить как ВК-).

Выделяют НК из анализируемых и контрольных образцов согласно протоколу инструкции производителя набора для выделения НК.

Выделенную ДНК можно хранить в течение одной недели при температуре от 2°С до 8°С или в течение года при температуре не выше минус 16°С.

Подготовку образцов к проведению ПЦР проводят с помощью комплектов входящих набор «ПЦР-ЛЕПТОСПИРОЗ-ФАКТОР». Общий объем реакционной смеси - 25 мкл, объем ДНК-пробы - 10 мкл.

Успешное прохождение реакции контролируют использованием положительный контрольный образец (ПКО) LEPTO, ВКО LEPTO и ДНК буфера, где для внутреннего контрольного образца (ВКО) используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца (ПКО) используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома возбудителя лептоспироза (Leptospira spp.) и фрагмент генома бактериофага T4 взятых в объемном соотношении 1:1.

В отдельной пробирке смешивают компоненты набора из расчета на каждую реакцию ПЦР:

5 мкл ПЦР СМЕСЬ LEPTO

10 мкл смеси ПЦР БУФЕР LEPTO

0,5 мкл TAQ POLYMERASE

Перемешивают смесь на вортексе и сбрасывают капли кратковременным центрифугированием.

Отбирают необходимое количество пробирок для амплификации ДНК исследуемых и контрольных проб. Вносят по 15 мкл приготовленной реакционной смеси.

Используя наконечники с фильтром в подготовленные пробирки вносят:

а) в пробирку отрицательного контроля ПЦР (К-) 10 мкл ДНК буфера;

б) в ряд пробирок для исследуемых проб - в каждую вносят по 10 мкл ДНК соответствующей пробы;

в) в пробирку положительный контроль ПЦР (К+) 10 мкл ПКО LEPTO ПЦР РВ с флуоресцентной детекцией проводят с помощью прибора «Rotor-Gene Q», подготовленные для проведения ПЦР пробирки помещают в его ячейки. Далее программируют прибор согласно инструкции производителя.

Интерпретацию результатов анализа проводят по полученным кривым накопления флуоресцентного сигнала, которые анализируются с помощью программного обеспечения используемого прибора для проведения ПЦР в режиме «реального времени» в соответствии с инструкцией производителя к прибору.

Учет результатов ПЦР-анализа проводится по наличию или отсутствию пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией (что соответствует наличию или отсутствию значения порогового цикла «Ct» для исследуемого образца).

Результат считается достоверным в случае корректного прохождения положительных и отрицательных контролей амплификации и экстракции ДНК в соответствии с таблицей 4.

Появление любого значения Ct в таблице результатов для отрицательного контроля этапа экстракции ВК- (на канале JOE(HEX)/Yellow) и для отрицательного контроля этапа ПЦР К- (на любом из каналов) свидетельствует о наличии контаминации реактивов или образцов. В этом случае результаты анализа для всех проб считаются недействительными. Требуется повторить анализ всех проб, а также предпринять меры по выявлению и ликвидации источника контаминации.

Образцы, для которых по каналу FAM/Green (фиг. 1) значение Ct отсутствует или превышает 35 цикл (и при этом по каналу JOE(HEX)/Yellow отсутствует значение Ct) требуют повторного проведения исследования с этапа ПЦР. Задержка в значениях пороговых циклов для исследуемых образцов на канале FAM/Green указывает на присутствие ингибиторов в пробе(ах) или на ошибки при экстракции ДНК или при постановке реакции. Требуется провести исследование, начиная с этапа экстракции ДНК.

Образец считается положительным (ДНК бактерий рода Leptospira присутствует) если наблюдается экспоненциальный рост сигнала на канале JOE(HEX)/Yellow (фиг 2), при этом значения Ct контрольных образцов находятся в пределах нормы (табл. 4). Если для исследуемого образца по каналу JOE(HEX)/Yellow значение Ct определяется позднее 35 цикла при корректном прохождении положительных и отрицательных контролей - он считается спорным и исследуется повторно с этапа выделения ДНК. Если при повторной постановке наблюдается схожий результат (Ct на канале JOE(HEX)/Yellow более 35), требуется повторное взятие материала от того же животного для проведения ПЦР-исследования и (или) использование альтернативных методов диагностики. В случае получения значения Ct на канале JOE(HEX)/Yellow менее 35 при исследовании повторно взятого от животного материала - образец считать положительным.

Эффективность заявляемого технического решения по сравнению с прототипом подтверждается сравнительным анализом по части расходного материала, трудозатрат и времени. В прототипе необходимо использовать набор реагентов в 4 формах комплектации, а в заявляемом же всего 2 формы комплектов. Что касается сокращения трудозатрат и времени, то исключение выделения РНК из биологического материал и проведения реакции обратной транскрипции, уже влечет за собой сокращение трудозатрат и времени.

1. Тест-система для выявления ДНК возбудителя лептоспироза Leptospira spp. у сельскохозяйственных животных, включающий буфер для проведения полимеразной цепной реакции, смесь для ее проведения, состоящую из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов, специфичных для возбудителя лептоспироза Leptospira spp. и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующими активность фермента, TAQ POLYMERASE, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, отличающийся тем, что для внутреннего контрольного образца используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома возбудителя лептоспироза Leptospira spp. Lpts и фрагмент генома бактериофага T4, взятых в объемном соотношении 1:1 со следующими нуклеотидными последовательностями:

Lpts F CCCGCGTCCGATTAG прямой праймер

Lpts R TCCATTGTGGCCGRACAC обратный праймер

Lpts Р [R6G]CTCACCAAGGCGACGATCGGTAGC[BHQ1]зонд

T4F TACATATAAATCACGCAAAGC

T4R TAGTATGGCTAATCTTATTGG

Т4Р FAM ACATTGGCACTGACCGAGTTC BHQ1зонд.



 

Похожие патенты:

Изобретение относится к биотехнологии. Предложен набор для обнаружения РНК вируса болезни Гамборо, где указанный набор включает олигонуклеотиды, имеющие следующие последовательности: SEQ ID NO:1, SEQ ID NO:2 и SEQ ID NO:3.

Изобретение относится к области биохимии, в частности к способу выбора реципиента при пересадке трупной почки, включающему выявление антигенов HLA-A, HLA-B и HLA-DR, сопоставление эпитопов антигенов HLA-A и HLA-B потенциального реципиента и донора, а также выбор реципиента по полученным данным.

Изобретение относится к области микробиологии и предназначено для идентификации дрожжей рода Pichia. Осуществляют предварительное обогащение дрожжей, осаждение их центрифугированием, выделение ДНК с проведением ПЦР в реальном времени.

Изобретение относится к области микробиологии и предназначено для идентификации дрожжей рода Pichia. Осуществляют предварительное обогащение дрожжей, осаждение их центрифугированием, выделение ДНК с проведением ПЦР в реальном времени.

Изобретение относится к области медицины, в частности стоматологии, медицинской микробиологии и эндокринологии, и может использоваться для прогноза развития сахарного диабета типа 2 у больных хроническим пародонтитом.

Изобретение относится к области медицины, в частности к гинекологии. Предложен способ центильной оценки микроценоза слизистой влагалища у девочек путем отбора биоматериала со слизистой боковой стенки влагалища за физиологическим отверстием девственной плевы соскобом одноразовым урогенитальным зондом.

Изобретение относится к области медицины, в частности к гинекологии. Предложен способ центильной оценки микроценоза слизистой влагалища у девочек путем отбора биоматериала со слизистой боковой стенки влагалища за физиологическим отверстием девственной плевы соскобом одноразовым урогенитальным зондом.

Изобретение относится к биотехнологии. В частности, настоящее изобретение относится к новым бактериофагам F1245/05, F168/08, F170/08, F770/05, F197/08, F86/06, F87s/06 и F91a/06, выделенным из них полипептидам, композициям, включающим один или несколько новых бактериофагов и/или выделенных полипептидов, способу лечения или профилактики бактериальных инфекций, относящихся к Acinetobacter baumannii.

Изобретение относится к биотехнологии. В частности, настоящее изобретение относится к новым бактериофагам F1245/05, F168/08, F170/08, F770/05, F197/08, F86/06, F87s/06 и F91a/06, выделенным из них полипептидам, композициям, включающим один или несколько новых бактериофагов и/или выделенных полипептидов, способу лечения или профилактики бактериальных инфекций, относящихся к Acinetobacter baumannii.
Изобретение относится к области лабораторной диагностики, молекулярной биологии и эпидемиологии. Предложен набор синтетических олигонуклеотидов для выявления ДНК возбудителя бактериального вагинита Lactobacillus spp.

Изобретение относится к области биологии и медицины и предназначено для экспресс-выделения ДНК из размороженной крови. Проводят забор 2 мл цельной венозной крови в пробирки, содержащие ЭДТА-К3.

Изобретение относится к биотехнологии. Предложены олигонуклеотидные ДНК-праймеры для выявления и филогенетического анализа провирусной ДНК вируса лейкоза кошек, а также для синтеза фрагмента гена поверхностного гликопротеина gp70, содержащего протективные антигенные эпитопы, отличающиеся тем, что две пары олигонуклеотидных ДНК-праймеров имеют следующие последовательности: внешние (1 fwd: 5'TCCAACGCACCCAAAACCCT3'; 1 rev: 5'GCTTTAGTCCCTGTTCCGAC3'), внутренние (2 fwd: 5'TCCTGCCTATCTACTCCGCA3'; 2 rev: 5'ATGCATGGGGTGAGTCCAGT3').

Изобретение относится к области медицины, а именно к офтальмологии, и предназначено для прогнозирования тяжелой степени сухого керататоконъюнктивита (СКК) при синдроме Шегрена, ассоциированном с ревматоидным артритом.

Изобретение относится к области медицины, а именно к офтальмологии, и предназначено для прогнозирования тяжелой степени сухого керататоконъюнктивита (СКК) при синдроме Шегрена, ассоциированном с ревматоидным артритом.

Группа изобретений относится к медицине, а именно к онкологии, и может быть использована для диагностики выявления Ph-негативных миелопролиферативных новообразований.
Изобретение относится к области медицины, а именно к диагностике и гинекологии, и предназначено для выявления риска развития сочетания генитального эндометриоза и гиперпластических процессов эндометрия у женщин русской национальности, уроженок Центрального Черноземья.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития ишемического инсульта. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из венозной крови и проводят анализ полиморфизмов генов цитокинов rs1061624 TNFR2 и rs767455 TNFR1.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития ишемического инсульта. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из венозной крови и проводят анализ полиморфизмов генов цитокинов rs1061624 TNFR2 и rs767455 TNFR1.

Группа изобретений относится к области биотехнологии. Предложен способ и устройство определения нуклеотидной последовательности молекулы нуклеиновой кислоты.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития гипертонической болезни. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из периферической венозной крови и проводят анализ полиморфизмов генов цитокинов rs1800469 TGFβ-1 и rs833061 VEGFА.

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления маркерных участков генов бактерий и архей из микробиоты кишечника человека. Был разработан и экспериментально протестирован новый способ профилирования микробиоты кишечника индивида. Способ основан на полуколичественном и качественном определении представителей прокариотических таксонов, которые имеют описанную ассоциацию с теми или иными патологиями человека и наиболее представлены в микробиоте кишечника человека. Набор включает олигонуклеотиды, специфичные к и способные гибридизоваться с фрагментами генов 16S рРНК указанных в описании бактериальных и архейных таксонов. Набор позволяет повысить точность и скорость определения микроорганизмов, потенциально ответственных за заболевания человека. 2 н. и 6 з.п. ф-лы, 48 ил., 6 табл., 2 пр.

Изобретение относится к ветеринарной микробиологии, в частности к лабораторной диагностике возбудителей инфекционных заболеваний, а именно к средствам диагностики инфекции у животных. Описан тест-система для выявления ДНК возбудителя лептоспироза у сельскохозяйственных животных, включающий буфер для проведения полимеразной цепной реакции, смесь для ее проведения состоящая из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов специфичные для возбудителя лептоспироза Leptospira spp. и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец. Для внутреннего контрольного образца используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл. Для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома возбудителя лептоспироза и фрагмент генома бактериофага Т4, взятых в объемном соотношении 1:1. Технический результат - уменьшение трудозатрат, времени и расходного материала при проведении полимеразной цепной реакции. 2 ил., 4 табл., 1 пр.

Наверх