Система детекции наиболее значимых прокариотических представителей микробиоты кишечника человека на основе пцр панели

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления маркерных участков генов бактерий и архей из микробиоты кишечника человека. Был разработан и экспериментально протестирован новый способ профилирования микробиоты кишечника индивида. Способ основан на полуколичественном и качественном определении представителей прокариотических таксонов, которые имеют описанную ассоциацию с теми или иными патологиями человека и наиболее представлены в микробиоте кишечника человека. Набор включает олигонуклеотиды, специфичные к и способные гибридизоваться с фрагментами генов 16S рРНК указанных в описании бактериальных и архейных таксонов. Набор позволяет повысить точность и скорость определения микроорганизмов, потенциально ответственных за заболевания человека. 2 н. и 6 з.п. ф-лы, 48 ил., 6 табл., 2 пр.

 

Область техники

Данное изобретение относится к биотехнологии, медицине и диетологии. Изобретение описывает способ характеризации микробиоты кишечника человека на основе набора синтетических олигонуклеотидов и может применяться для прогностических и диагностических целей.

Уровень техники

Микробиота (а также микробном или микрофлора) кишечника человека - это совокупность всех микроорганизмов, обитающих в толстом и тонком отделах кишечника. Совокупный качественный или количественный состав микробиоты называется ее профилем, а процесс его определения - профилированием микробиоты. Существуют разные подходы к изучению микробиоты, у каждого из них есть свои ограничения. Бактериальный посев позволяет выявить только культивируемые микроорганизмы, и по нему невозможно определить относительную представленность микроорганизмов. Метагеномное секвенирование - один из самых точных методов для определения качественного и полуколичественного состава микробиоты, но требует значительной технологической базы и достаточно дорог, поэтому используется не очень широко. Альтернативой секвенированию является анализ микробиоты при помощи методов полимеразной цепной реакции (далее ПЦР) с использованием олигонуклеотидных последовательностей, гибридизующихся с участками генома определенных микроорганизмов и их групп (для этой цели обычно используется последовательность гена 16S рРНК).

В норме в микробиоте кишечника человека преобладают бактерии из отделов Bacteroidetes и Firmicutes, среди прочих встречаются представители Actinobacteria и Proteobacteria. Бактерии взаимодействуют с организмом хозяина, влияя на его метаболизм и иммунитет. В частности, бактерии из клостридиальных кластеров XIVa и IV, относящиеся к отделу Firmicutes, являются эффективными производителями короткоцепочечной жирной кислоты бутирата, также известной как масляная кислота. Это вещество является активным противовоспалительным агентом, положительно влияя на состояние кишечного эпителия. Превалирование в микробиоте бактерий, способных синтезировать бутират, ассоциировано со здоровьем кишечника и организма в целом.

Из ряда работ (Forslund, K., et al., Nature, 2015, 528.7581:262-266; Le Chatelier Е, et al. Richness of human gut microbiome correlates with metabolic markers. Nature. 2013 Aug 29; 500(7464):541-6; Karlsson FH, et al. Symptomatic atherosclerosis is associated with an altered gut metagenome. Nature Communications. 2012;3:1245-50) известно, что микробиота претерпевает изменения при определенных патологических состояниях организма. В частности, ряд исследований показали, что при метаболических расстройствах, таких как ожирение или диабет второго типа, понижена представленность бутират-производящих бактерий из клостридиальных кластеров XIVa и IV, лактобактерий Lactobacillus, Bifidobacterium, археи Methanobrevibacter smithii, членов бактериального семейства Christensenellaceae, и в то же время повышена представленность представителей семейства Enterobacteriaceae, Peptostreptococcaceae, куда входят патогенные и оппортунистически патогенные клостридии, бактерии Ruminococcus из семейства Lachnospiraceae. Бактериальный род Akkermansia, основным представителем которого в кишечнике является вид Akkermansia muciniphila, ассоциирован с нормальным обменом веществ и может способствовать защите от избыточного веса.

Также выявлена связь между развитием других заболеваний человека и составом микробиоты. Профиль микробиоты при воспалительных заболеваниях кишечника человека, в том числе болезни Крона и неспецифическом язвенном колите, в первую очередь характеризуется сниженной относительной представленностью бутират-производящих бактерий и аномально высокой долей представителей семейства Enterobacteriaceae, в частности, Escherichia coli (Imhann F, et al, Gut, 2016, doi: 10.1136/gutjnl-2016-312135). У пациентов с атеросклерозом в кишечной микробиоте обнаружено снижение уровня Akkermansia muciniphila, а также бактерий родов Roseburia, Eubacterium и Dorea, входящих в клостридиальный кластер XIVa. Ряд бактерий, в том числе члены родов Proteus, Lachnoclostridium и другие, трансформируют фосфатидилхолин, содержащийся в красном мясе, яйцах и субпродуктах, в триметиламин (ТМА). Полученное соединение легко усваивается в клетках печени и окисляется в триметиламин-N-оксид (ТМАО), который обладает атерогенной активностью. Также бактерии способны производить ТМА из L-карнитина, содержащегося в диетической рыбе и красном мясе (Gregory JC, Buffa JA, Org E, et al. Transmission of Atherosclerosis Susceptibility with Gut Microbial Transplantation. The Journal of Biological Chemistry. 2015; 290(9):5647-5660).

Посредством анализа профиля микробиоты кишечника человека по образцам кала можно получать информацию, которая позволит оценить уровень разнообразия микробиоты, предсказывать предрасположенность к определенным заболеваниям, разрабатывать диетологические рекомендации. Поскольку в кишечнике человека может быть обнаружено порядка 1000 видов бактерий ( М, de Vos WM. FEMS Microbiol Rev, 2014, Sep; 38(5):996-1047), определить количество каждого из этих видов по отдельности в исследуемом образце достаточно сложно и дорого. В литературе описаны методы предсказания некоторых заболеваний на основе детекции присутствия определенных бактерий в желудочно-кишечном тракте (ЖКТ) человека (например, US 20170159108 А1 (опубликовано 6 апреля 2017), US 20170096709 А1 (опубликовано 7 июня 2017), WO 2012080753 (опубликовано 21 июня 2012), РФ 2601132 (опубликовано 27 октября 2016), РФ 2362808 (опубликовано 27 июля 2009)), однако они опираются на ограниченный, искусственно выбранный набор микроорганизмов, и не учитывают состояние микробиоты в целом. Для оптимизации методики профилирования микробиоты кишечника необходимо создание набора для теста на наличие и представленность определенных прокариотических таксонов (таксономических единиц, которые могут включать в себя виды, рода, семейства и тд, а также их группы), который бы наиболее полно характеризовал состояние всей микробиоты человека, при этом позволяя определять степень сходства с микробиотой пациентов с различными заболеваниями (нарушения метаболизма, воспалительные заболевания кишечника и другие), а также оценивать динамику кишечного сообщества под воздействием внешних факторов, таких, как диетическое вмешательство или прием лекарственных препаратов. Одновременно с этим набор должен быть прост в использовании, доступен большинству медицинских лабораторий, при этом позволяя производить большое количество анализов за короткий промежуток времени на стандартном оборудовании. Данное изобретение решает задачу создания подобного набора и применимо для создания недорогого и информативного экспресс-теста для профилирования микробиоты человека, в том числе с целью оценки вероятности развития заболеваний на основании ассоциативных связей между патологиями и микробными маркерами, выработки персонализированных рекомендаций по употреблению определенных продуктов питания, в том числе, а также оценке влияния лекарственных препаратов (а также пребиотиков и пробиотиков) на организм человека.

Сущность изобретения

Задачей настоящего изобретения является создание набора или комплекта олигонуклеотидных зондов и праймеров для качественной и полуколичественной оценки представленности определенного набора бактериальных и архейных таксонов при помощи метода полимеразной цепной реакции (ПЦР) в реальном времени, который бы позволял эффективно и полно охарактеризовать изменения состава микробиоты человека при возникновении определенных заболеваний, приеме лекарственных препаратов или изменении диеты.

Указанная задача решается путем создания нового набора биомаркеров, где в качестве биомаркера выступают прокариотические (бактериальные или архейные) таксоны. Принципы отбора биомаркеров по настоящему изобретению заключались в том, что представители этих таксонов должны: (а) быть наиболее представленными в микробиоте кишечника человека, (б) иметь описанное положительное или отрицательное влияние на здоровье человека и/или (в) быть прямо или обратно ассоциированными с теми или иными патологиями.

На основании этих принципов, а также исходя из данных, полученных путем метагеномного анализа 655 образцов микробиоты кишечника человека от населения Российской Федерации, при помощи рационального дизайна были разработаны и экспериментально протестированы 14 прокариотических таксонов, удовлетворяющих вышеперечисленным условиям. В совокупности, указанные таксоны составляют 56±11% (среднее значение ± стандартное отклонение) от общей микробной представленности в микробиоте кишечника в проанализированных образцах. Особенностью данного изобретения является то, что разработанный набор таксонов-биомаркеров способен указать на предрасположенность или наличие определенных заболеваний у человека и при этом охватить большую часть фактического состава микробиоты кишечника человека.

Некоторые варианты изобретения включают набор для определения уровня представленности микроорганизмов в образце, взятом из желудочно-кишечного тракта (ЖКТ) субъекта, путем амплификации определенных участков генома этих микроорганизмов в условиях количественного ПЦР и нормирования на общее количество прокариотической ДНК в указанном образце, включающий комплект олигонуклеотидных зондов, имеющих олигонуклеотидные последовательности, каждая из которых способна специфически гибридизоваться с участком генома микроорганизмов, имеющим последовательность, уникальную для только одного таксона, а микроорганизмы выбраны из следующей группы из 14 бактериальных и архейных таксонов: Lactobacillus spp.; Bifidobacterium spp.; Bacteroides spp.; Prevotella spp.; Enterobacteriaceae; Akkermansia spp.; Clostridium cluster XIVa, состоящий из родов Roseburia spp., Dorea spp., Eubacterium spp., Eubacterium spp., Clostridium spp., Anaerostipes spp., Butyrivibrio spp., Coprococcus spp., Lachnospira spp., Ruminococcus spp., Collinsella; Clostridium cluster IV, состоящий из родов Subdoligranulum spp., Faecalibacterium spp., Anaerotruncus spp.; Christensenellaceae; Enterococcus spp.; Streptococcus spp.; Methanobrevibacter spp.; Ruminococcus spp., относящиеся к семейству Lachnospiraceae; Blautia spp., и комплект олигонуклеотидных зондов, имеющих олигонуклеотидные последовательности, каждая из которых способна специфически гибридизоваться с участком генома, имеющим последовательность, общую для всех прокариотических микроорганизмов, присутствующих в ЖКТ субъекта.

Предпочтительные варианты изобретения включают вышеупомянутый набор для определения уровня микроорганизмов, в котором участки генома, которые участвуют в гибридизации с указанными зондами, кодируют ген 16S рРНК. Другие предпочтительные варианты изобретения отличаются тем, что указанный комплект олигонуклеотидных зондов содержит по меньшей мере одну последовательность, выбранную из SEQ ID NO: 1-30 или SEQ ID NO: 91-96, или из группы идентичных одной из этих последовательностей по меньшей мере на 95%. Зонды из этого комплекта могут содержать флуорофор, выбранный из списка FAM, R6G и ROX, прикрепленный на 5'-конце или 3'-конце последовательности зонда при помощи ковалентной связи, и содержат нефлуоресцентный тушитель, выбранный из списка DABCYL, BHQ и Eclipse, прикрепленный на противоположном от указанного флуорофора конце последовательности указанного зонда при помощи ковалентной связи. При этом, олигонуклеотидные зонды в комплекте могут содержать как одинаковые, так и разные пары флуорофор-тушитель, а для одного и того же флуорофора возможно использование различных тушителей.

Предпочтительные варианты изобретения также включают вышеупомянутый набор, дополнительно содержащий комплект праймеров, пригодных для использования при амплификации участков генома этих микроорганизмов в условиях количественного ПЦР, при этом для каждого используемого зонда в комплект праймеров включается специфичная пара праймеров, способная гибридизоваться с той же последовательностью ДНК микроорганизмов, что и указанный зонд, или последовательностью, комплементарной указанной последовательности ДНК, при этом указанные праймеры содержат по меньшей мере одну последовательность, выбранную из SEQ ID NO: 31-90 или SEQ ID NO: 97-108, или из группы идентичных одной из этих последовательностей по меньшей мере на 95%.

Вышеупомянутый набор может также дополнительно содержать, по меньшей мере, одно из следующего: (а) средства для проведения амплификации и/или реакции удлинения праимера для одного или нескольких олигонуклеотидов из комплекта зондов; (б) средства для получения и/или хранения образца кала; (в) средства для выделения нуклеиновой кислоты из образца кала.

Другие варианты изобретения включают способ определения уровня представленности микроорганизмов в образце, взятом из ЖКТ субъекта, включающий следующие стадии: (i) выделение геномной ДНК микроорганизмов из указанного образца; (ii) проведение амплификации определенных участков генома микроорганизмов в условиях количественной ПЦР с применением выделенной геномной ДНК из (i) и

олигонуклеотидных зондов, имеющих олигонуклеотидные последовательности, каждая из которых способна специфически гибридизоваться с участком генома микроорганизмов, имеющим последовательность, уникальную для только одного таксона, а микроорганизмы выбраны из следующей группы из 14 бактериальных и архейных таксонов: Lactobacillus spp.; Bifidobacterium spp.; Bacteroides spp.; Prevotella spp.; Enterobacteriaceae; Akkermansia spp.; Clostridium cluster XIVa, состоящий из родов Roseburia spp., Dorea spp., Eubacterium spp., Eubacterium spp., Clostridium spp., Anaerostipes spp., Butyrivibrio spp., Coprococcus spp., Lachnospira spp., Ruminococcus spp., Collinsella; Clostridium cluster IV, состоящий из родов Subdoligranulum spp., Faecalibacterium spp., Anaerotruncus spp.; Christensenellaceae; Enterococcus spp.; Streptococcus spp.; Methanobrevibacter spp.; Ruminococcus spp., относящиеся к семейству Lachnospiraceae; Blautia spp., и олигонуклеотидных зондов, имеющих олигонуклеотидные последовательности, каждая из которых способна специфически гибридизоваться с участком генома, имеющим последовательность, общую для всех прокариотических микроорганизмов, присутствующих в ЖКТ субъекта; (iii) определение уровня представленности микроорганизмов из указанных таксонов при помощи нормирования на общее количество прокариотической ДНК в указанном образце.

Предпочтительные варианты изобретения также включают вышеупомянутый способ, отличающийся тем, что участки генома, которые участвуют в гибридизации с указанными зондами, кодируют ген 16S рРНК. Другие предпочтительные варианты изобретения также включают вышеупомянутый способ, в котором для амплификации участков генома указанных микроорганизмов используются следующие олигонуклеотидные зонды: (a) SEQ ID NO: 1 и SEQ ID NO: 2 для детекции Bacteroides spp.; (6) SEQ ID NO: 3 и SEQ ID NO: 4 для детекции Prevotella spp.; (в) SEQ ID NO: 5 и SEQ ID NO: 6 для детекции Bifidobacterium spp.; (г) SEQ ID NO: 7 и SEQ ID NO: 8 для детекции Enterobacteriaceae; (д) SEQ ID NO: 9 и SEQ ID NO: 10 для детекции Akkermansia spp.; (e) SEQ ID NO: 11 и SEQ ID NO: 12 для детекции Methanobrevibacter spp.; (ж) SEQ ID NO: 13 и SEQ ID NO: 14 для детекции Streptococcus spp.; (з) SEQ ID NO: 15 и SEQ ID NO: 16 для детекции Enterococcus spp.; (и) SEQ ID NO: 17 и SEQ ID NO: 18 для детекции Christensenellaceae; (к) SEQ ID NO: 19 и SEQ ID NO: 20 для детекции Lactobacillus spp.; (л) SEQ ID NO: 21 и SEQ ID NO: 22 для детекции Ruminococcus spp. [Lachnospiraceae family]; (м) SEQ ID NO: 23 и SEQ ID NO: 24 для детекции Blautia spp; (н) SEQ ID NO: 25 и SEQ ID NO: 26 для детекции Clostridium cluster IV; (o) SEQ ID NO: 27 и SEQ ID NO: 28 для детекции Clostridium cluster XIVa; (n) SEQ ID NO: 29 и SEQ ID NO: 30 для детекции общей прокариотической ДНК.

Другие предпочтительные варианты изобретения также включают вышеупомянутый способ, в котором для амплификации участков генома указанных микроорганизмов используются следующие пары праймеров, специфичные для каждого используемого зонда: (a) SEQ ID NO: 31-32 вместе с SEQ ID NO: 1 и SEQ ID NO: 33-34 вместе с SEQ ID NO: 2 для детекции Bacteroides spp.; (б) SEQ ID NO: 35-36 вместе с SEQ ID NO: 3 и SEQ ID NO: 37-38 вместе с SEQ ID NO: 4 для детекции Prevotella spp.; (в) SEQ ID NO: 39-40 вместе с SEQ ID NO: 5 и SEQ ID NO: 41-42 вместе с SEQ ID NO: 6 для детекции Bifidobacterium spp.; (r) SEQ ID NO: 43-44 вместе с SEQ ID NO: 7 и SEQ ID NO: 45-46 вместе с SEQ ID NO: 8 для детекции Enterobacteriaceae; (д) SEQ ID NO: 47-48 вместе с SEQ ID NO: 9 и SEQ ID NO: 49-50 вместе с SEQ ID NO: 10 для детекции Akkermansia spp.; (e) SEQ ID NO: 51-52 вместе с SEQ ID NO: 11 и SEQ ID NO: 53-54 вместе с SEQ ID NO: 12 для детекции Methanobrevibacter spp.; (ж) SEQ ID NO: 55-56 вместе с SEQ ID NO: 13 и SEQ ID NO: 57-58 вместе с SEQ ID NO: 14 для детекции Streptococcus spp.; (з) SEQ ID NO: 59-60 вместе с SEQ ID NO: 15 и SEQ ID NO: 61-62 вместе с SEQ ID NO: 16 для детекции Enterococcus spp.; (и) SEQ ID NO: 63-64 вместе с SEQ ID NO: 17 и SEQ ID NO: 65-66 вместе с SEQ ID NO: 18 для детекции Christensenellaceae; (к) SEQ ID NO: 67-68 вместе с SEQ ID NO: 19 и SEQ ID NO: 69-70 вместе с SEQ ID NO: 20 для детекции Lactobacillus spp.; (л) SEQ ID NO:71-72 вместе с SEQ ID NO: 21 и SEQ ID NO:73-74 вместе с SEQ ID NO: 22 для детекции Ruminococcus spp. [Lachnospiraceae family]; (м) SEQ ID NO:75-76 вместе с SEQ ID NO: 23 и SEQ ID NO: 77-78 вместе с SEQ ID NO: 24 для детекции Blautia spp; (н) SEQ ID NO: 79-80 вместе с SEQ ID NO: 25 и SEQ ID NO: 81-82 вместе с SEQ ID NO: 26 для детекции Clostridium cluster IV; (o) SEQ ID NO: 83-84 вместе с SEQ ID NO: 27 и SEQ ID NO: 85-86 вместе с SEQ ID NO: 28 для детекции Clostridium cluster XIVa; (п) SEQ ID NO: 87-88 вместе с SEQ ID NO: 29 и SEQ ID NO: 89-90 вместе с SEQ ID NO: 30 для детекции общей прокариотической ДНК. В предпочтительных вариантах изобретения указанный образец является образцом кала человека.

При осуществлении изобретения достигаются следующие технические результаты: разработан новый способ профилирования микробиоты кишечника индивида, который основан на полуколичественном и качественном определении представителей прокариотических таксонов, которые имеют описанную ассоциацию с теми или иными патологиями человека и наиболее представлены в микробиоте кишечника человека;

- путем рационального дизайна разработан ограниченный комплект олигонуклеотидных зондов и праймеров, позволяющий определять представителей прокариотических таксонов, которые имеют описанную ассоциацию с теми или иными патологиями человека и наиболее представлены в микробиоте кишечника человека; такой комплект позволяет повысить точность и скорость определения микроорганизмов, потенциально ответственных за заболевания человека. Краткое описание рисунков

Фиг. 1. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 2. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 3. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 4. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 5. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 6. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 7. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг.8. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 9. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 10. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 11. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 12. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 13. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 14. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 15. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 16. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 17. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 18. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 19. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 20. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 21. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 22. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 23. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 24. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 25. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг.26. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 27. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 28. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 29. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 30. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 31. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 32. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 33. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 34. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг.35. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 36. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 37. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 38. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 39. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 40. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 41. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 42. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 43. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 44. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 45. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 46. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 47. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Фиг. 48. - График величины порогового цикла (Cq) и результатов амплификации при проведении ПЦР (значение относительных флуоресцентных единиц (RFU) при различном числе циклов амплификации) с олигонуклеотидными последовательностями, согласно Таблице 6.

Определения и термины

В описании данного изобретения термины «включает» и «включающий» интерпретируются как означающие «включает, помимо всего прочего». Указанные термины не предназначены для того, чтобы их истолковывали как «состоит только из».

Под «субъектом» и «индивидом» следует понимать млекопитающее, преимущественно человека.

Под «таксоном» следует понимать группу организмов, связанных той или иной степенью родства и достаточно обособленную, чтобы ей можно было присвоить определенную таксономическую категорию того или иного ранга - вид, род, семейство и т.д. Таксоны по настоящему изобретению включают могут включать в себя рода, семейства, или их группы.

Метод полимеразной цепной реакции (ПЦР) основан на многократном избирательном копировании (амплификации) определенного участка нуклеиновой кислоты ДНК при помощи фермента ДНК полимеразы в определенных условиях с использованием двух праймеров, комплементарных противоположным концам разных цепей требуемого участка ДНК. Метод ПЦР включает в себя три этапа: выделение ДНК из образца; амплификацию последовательности ДНК; анализ полученных результатов. Эффективность ПЦР определяется количеством амплифицированного продукта после определенного количества проведенных циклов амплификации.

Количественная ПЦР (qPCR), или ПЦР в реальном времени, используется для одновременной амплификации и измерения количества конкретного ПЦР продукта в каждом цикле реакции. В этом методе используют ДНК-зонды для точного измерения количества продукта реакции по мере его накопления, или используется флуоресцентный интеркалирующий краситель Sybr Green I.

Под зондом, или олигонуклеотидным зондом, понимается олигонуклеотидная последовательность, способная гибридизоваться с последовательностью участка гена 16S рРНК в промежутке между теми участками, что гибиридизуются с праймерами.

Под "гибридизацией" понимается соединение in vitro комплементарных одноцепочечных нуклеиновых кислот, которое приводит к образованию двухцепочечной последовательности.

Под уровнем, или уровнем представленности, определенного микроорганизма в образце следует понимать долю генетического материала этого микроорганизма от общего количества бактериального генетического материала (общей прокариотической ДНК), определенного в этом образце.

Используемый здесь термин «процент идентичности двух последовательностей» определяется числом положений идентичных нуклеотидов в этих двух последовательностях с учетом числа пробелов и длины каждого пробела, которые необходимо ввести для оптимального сопоставления двух последовательностей путем выравнивания. Процент идентичности равен числу идентичных нуклеотидов в данных положениях с учетом выравнивания последовательностей, разделенному на общее число положений и умноженному на 100. Процент идентичности двух нуклеотидных последовательностей может быть определен с помощью бесплатной программы NCBI Nucleotide BLAST (https://blast.ncbi.nlm.nih.gov/).

Если не определено отдельно, технические и научные термины в данной заявке имеют стандартные значения, общепринятые в научной и технической литературе.

Подробное раскрытие изобретения

Настоящее изобретение относится к комплекту олигонуклеотидных зондов и праймеров и их применению для профилирования микробиоты кишечника субъекта. В состав микробиоты кишечника входят микробные таксоны, представляющие собой потенциальные биомаркеры ряда заболеваний. Путем соотнесения показателей относительной представленности таксонов в микробиоте индивида с таковой у здоровых индивидов, а также у пациентов с различными заболеваниями, возможно на основе ассоциативных связей оценить сбалансированность состава кишечного сообщества этого индивида. Предложенный набор позволяет определить эти показатели.

Наиболее практичным и в то же время достаточно информативным способом определения состава микробиоты кишечника человека является анализ образца кала. В кале содержится слепок всей микробиоты кишечника, но большую часть ее составляют бактерии толстого кишечника, как наиболее близкого к анальному отверстию отдела и наиболее заселенного бактериями. Возможно также использовать образцы биопсии, а также содержимого различных отделов кишечника - в таких случаях результат анализа будет более прицельно характеризовать микробное сообщество в соответствующем отделе. Предлагаемый набор предназначен для использования на образцах кала, а также может быть использован для профилирования образцов микробиоты кишечника, полученных другими методами.

Методами секвенирования нового поколения (Next-generation sequencing) авторами были проанализированы 655 образцов микробиоты кишечника человека, полученных в результате проведенного краудфандингового проекта "OhMyGut", а также собранных от пользователей продукта "Генетика микробиоты" компании "Атлас". При помощи проведенного анализа, а также на основании опубликованных литературных данных, устанавливающих ассоциацию определенных прокариотических таксонов с заболеваниями человека, авторами были отобраны 14 прокариотических таксонов, составляющих 56±11% (среднее значение ± стандартное отклонение) от общей микробной представленности в микробиоте кишечника в проанализированных образцах, и при этом имеющих опубликованную ассоциацию с заболеванием человека (см. Таблица 1). Указанное количество детектируемых таксонов позволяет сбалансировать полноту характеристики состава микробиоты по экономическим и техническим соображениям.

При осуществлении изобретения определение уровня представленности микроорганизмов в образце, взятом из желудочно-кишечного тракта (ЖКТ) субъекта, происходит путем амплификации определенных участков генома этих микроорганизмов в условиях количественного ПЦР и нормирования на общее количество прокариотической ДНК в указанном образце. В предпочтительных вариантах изобретения эти участки генома кодируют ген 16S рРНК. Ген 16S рРНК присутствует у всех прокариот и содержит как консервативные участки, одинаковые для всех прокариотических организмов, так и вариабельные участки, отличающиеся между разными прокариотическими таксонами, но при этом имеющие одинаковую последовательность внутри одного таксона. Поэтому последовательность гена 16S рРНК удобно использовать для идентификации специфических прокариотических таксонов. Тем не менее, использование этого изобретения не ограничивается исключительно последовательностью гена 16S рРНК, и другие последовательности, позволяющие идентифицировать специфические прокариотические таксоны, также могут быть использованы.

Проведенный метагеномный анализ последовательностей 16s рРНК микроорганизмов позволил разработать и экспериментально протестировать специфические олигонуклеотидные зонды, которые могут быть использованы для специфической детекции и определения относительной представленности вышеуказанных микроорганизмов (см. Таблица 2). Данный комплект зондов может служить основой для создания экспресс-теста для диагностики состояния микробиоты человека путем анализа наиболее информативных прокариотических таксонов, имеющих ассоциацию с заболеваниями человека. Путем анализа данных о профиле микробиоты можно делать выводы о текущем состоянии микробиоты и возможных рисках перехода состава микроорганизмов в конфигурации, ассоциированные с заболеваниями. Набор для профилирования микробиоты может также включать, но необязательно, дополнительный комплект зондов из таблицы 4, а также праймеры, пригодные для проведения реакции количественного ПЦР, указанные в таблицах 3 и 5.

Предлагаемая экспресс-тест система в оптимальном варианте будет содержать по 2 различных комплекта "пара праймеров + олигонуклеотидный зонд" на каждый таксон, а также дополнительную пару праймеров с олигонуклеотидным зондом для оценки общей прокариотической ДНК. Также, предлагаемая экспресс-тест система может дополнительно содержать пару праймеров для оценки представленности ДНК человека. В качестве праймеров для оценки представленности ДНК человека могут быть использованы любые существующие праймеры на ДНК человека, например, описанные в коммерческом наборе Quantifiler Human DNA Quantification Kit). Также в оптимальном варианте экспресс-тест система будет включать буфер для полимеразной цепной реакции, ДНК полимеразу (Taq), положительный и отрицательный контроли, и внешний контрольный образец.

Суммарно, тест-система для одного образца микробиоты кишечника человека в оптимальном варианте будет занимать 16 лунок из 96 на стандартном 96-луночном планшете для проведения ПЦР в режиме реального времени, таким образом, позволяя единовременно проанализировать 6 образцов микробиоты. Альтернативно, можно использовать планшеты на 384 лунки, и тогда единовременно указанным способом можно анализировать до 24 образцов.

Олигонуклеотидные зонды из комплекта зондов по изобретению способны к гибридизации с последовательностями в ДНК, кодирующими бактериальную 16S рРНК и которые специфичны для определенных бактерий или групп бактерий. SEQ ID NO: 1-2 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Bacteroides spp; SEQ ID NO: 3-4 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Prevotella spp.; SEQ ID NO: 5-6 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Bifidobacterium spp.; SEQ ID NO: 7-8 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Enterobacteriaceae; SEQ ID NO: 9-10 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Akkermansia spp.; SEQ ID NO: 11-12 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Methanobrevibacter spp.; SEQ ID NO: 13-14 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Streptococcus spp.; SEQ ID NO: 15-16 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Enterococcus spp.; SEQ ID NO: 17-18 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Christensenellaceae; SEQ ID NO: 19-20 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Lactobacillus spp.; SEQ ID NO: 21-22 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Ruminococcus spp., относящиеся к семейству Lachnospiraceae (Ruminococcus spp. [Lachnospiraceae family]); SEQ ID NO: 23-24 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Blautia spp; SEQ ID NO: 25-26 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Clostridial Cluster IV; SEQ ID NO: 27-28 предназначены для взаимодействия с последовательностями ДНК, кодирующими бактериальную 16S рРНК Clostridial Cluster XIVa; SEQ ID NO: 29-30 предназначены для взаимодействия с последовательностями ДНК, кодирующими общую бактериальную 16S рРНК (используется для нормирования на общую прокариотическую ДНК). Если не указано иначе, все нуклеотидные последовательности приведены в настоящем документе от 5'-конца к 3'-концу в соответствии с традиционными обозначениями в данной области техники.

Организмы, содержащие последовательности-мишени для SEQ ID NO: 1-30, приведены в Таблице 1. Эти бактерии обычно присутствуют в ЖКТ человека в значительном количестве, и согласно литературным данным, относительное количество некоторых из них в ЖКТ изменяется в ту или иную сторону при определенных заболеваниях человека (Таблица 1). Таким образом, с помощью комплекта олигонуклеотидных зондов по изобретению, можно в одном тесте получить информацию о количестве индикаторных микроорганизмов в ЖКТ человека. При использовании специально подобранных зондов и праймеров, указанных в таблицах 2-5, описываемый набор для профилирования микробиоты представляет собой эффективное средство диагностики с высокой чувствительностью и точностью.

Совокупность геномов организмов, присутствующих в кишечнике человека, содержит в себе важную информацию о представленности метаболических путей и функциональном потенциале. Выбранные биомаркеры на основе бактериальных и архейных таксонов позволяют получать следующую информацию о метаболических путях для данного субъекта:

1) Оценка достаточной представленности путей витаминогенеза. Известно, что ряд бактерий способны производить витамины группы В. Эти витамины преимущественно используются самой микробиотой кишечника, однако могут всасываться и через эпителий толстого кишечника человека, влияя на организм хозяина.

2) Оценка достаточной представленности путей синтеза короткоцепочечных жирных кислот (КЖК). КЖК являются основными элементами, получаемыми от микробиоты кишечника.

3) Оценка представленности биомаркеров ряда болезней, а именно, диабета второго типа, воспалительных заболеваний кишечника, атеросклероза, ожирения.

4) Диетологические рекомендации с целью добавления в рацион продуктов, содержащих пищевые волокна, питающие недопредставленные таксоны.

Для профилирования микробиоты определение уровня микроорганизмов, перечисленных в Таблице 1, производится с помощью проведения количественной ПЦР с использованием специфического зонда и пары праймеров. Предпочтительные варианты зондов перечислены в Таблице 2, а предпочтительные варианты праймеров перечислены в Таблице 3, при этом для каждого используемого зонда должна быть использована специфичная пара праймеров, способная гибридизоваться с той же последовательностью ДНК микроорганизмов, что и указанный зонд, или последовательностью, комплементарной указанной последовательности ДНК. В предпочтительном варианте изобретения для амплификации участков генома указанных микроорганизмов используются следующие пары праймеров, специфичные для каждого используемого зонда: (a) SEQ ID NO: 31-32 вместе с SEQ ID NO: 1 и SEQ ID NO: 33-34 вместе с SEQ ID NO: 2 для детекции Bacteroides spp.; (б) SEQ ID NO: 35-36 вместе с SEQ ID NO: 3 и SEQ ID NO: 37-38 вместе с SEQ ID NO: 4 для детекции Prevotella spp.; (в) SEQ ID NO: 39-40 вместе с SEQ ID NO: 5 и SEQ ID NO: 41-42 вместе с SEQ ID NO: 6 для детекции Bifidobacterium spp.; (г) SEQ ID NO: 43-44 вместе с SEQ ID NO: 7 и SEQ ID NO: 45-46 вместе с SEQ ID NO: 8 для детекции Enterobacteriaceae; (д) SEQ ID NO: 47-48 вместе с SEQ ID NO: 9 и SEQ ID NO: 49-50 вместе с SEQ ID NO: 10 для детекции Akkermansia spp.; (e) SEQ ID NO: 51-52 вместе с SEQ ID NO: 11 и SEQ ID NO: 53-54 вместе с SEQ ID NO: 12 для детекции Methanobrevibacter spp.; (ж) SEQ ID NO: 55-56 вместе с SEQ ID NO: 13 и SEQ ID NO: 57-58 вместе с SEQ ID NO: 14 для детекции Streptococcus spp.; (з) SEQ ID NO: 59-60 вместе с SEQ ID NO: 15 и SEQ ID NO: 61-62 вместе с SEQ ID NO: 16 для детекции Enterococcus spp.; (и) SEQ ID NO: 63-64 вместе с SEQ ID NO: 17 и SEQ ID NO: 65-66 вместе с SEQ ID NO: 18 для детекции Christensenellaceae; (к) SEQ ID NO: 67-68 вместе с SEQ ID NO: 19 и SEQ ID NO: 69-70 вместе с SEQ ID NO: 20 для детекции Lactobacillus spp.; (л) SEQ ID NO: 71-72 вместе с SEQ ID NO: 21 и SEQ ID NO: 73-74 вместе с SEQ ID NO: 22 для детекции Ruminococcus spp. [Lachnospiraceae family]; (м) SEQ ID NO: 75-76 вместе с SEQ ID NO: 23 и SEQ ID NO: 77-78 вместе с SEQ ID NO: 24 для детекции Blautia spp; (н) SEQ ID NO: 79-80 вместе с SEQ ID NO: 25 и SEQ ID NO: 81-82 вместе с SEQ ID NO: 26 для детекции Clostridium cluster IV; (o) SEQ ID NO: 83-84 вместе с SEQ ID NO: 27 и SEQ ID NO: 85-86 вместе с SEQ ID NO: 28 для детекции Clostridium cluster XIVa; (п) SEQ ID NO: 87-88 вместе с SEQ ID NO: 29 и SEQ ID NO: 89-90 вместе с SEQ ID NO: 30 для детекции общей (тотальной) прокариотической ДНК.

Нормирование на общую прокариотическую ДНК может быть произведено по различным алгоритмам. В предпочтительном варианте изобретения нормирование на общую прокариотическую ДНК производилось согласно формуле: Х=100%*(2-c/2-m),

где X - относительная представленность биомаркера,

с - количество циклов амплификации ДНК данного биомаркера в процессе ПЦР в реальном времени,

m - количество циклов амплификации ДНК тотальной прокариотической ДНК в процессе ПЦР в реальном времени.

Также изобретение предоставляет и раскрывает любые комбинации различных индивидуальных вариации для каждого компонента из набора для профилирования микробиоты. Подобные вариации, например, включают олигонуклеотиды, способные гибридизоваться с последовательностями из таблицы 2, а также олигонуклеотиды из таблицы 2, или способные с ними гибридизоваться, содержащие одну или две нуклеотидные замены, не ухудшающие их функциональность. Также, олигонуклеотиды из таблицы 2, или способные с ними гибридизоваться, могут дополнительно содержать один или несколько дополнительных нуклеотидов на 5'-конце, если такая добавка не ухудшает их функциональность. Для среднего специалиста понятно, что подобные вариации компонента также могут быть использованы в описываемом наборе для профилирования микробиоты.

Комплект зондов может включать более одной копии каждого типа выбранного олигонуклеотидного зонда.

Предпочтительно дополнительные олигонуклеотидные зонды позволяют получать информацию о составе микробиоты кишечника, которую предоставляет комплект зондов.

Это могут быть дополнительные зонды, которые предоставляют достоверные сведения о микробиоте кишечника или предоставляют информацию, которая может использоваться в качестве контроля для одного или нескольких других зондов в комплекте зондов, или предоставляют стандартную информацию, которая может позволять количественно оценивать данные, полученные от одного или нескольких других зондов в комплекте зондов. Дополнительные зонды могут быть подобраны на те же самые или другие бактерии, что и один или несколько зондов из комплекта зондов, описанных выше.

Изобретение также относится к олигонуклеотидному зонду, содержащему нуклеотидную последовательность, выбранную из Таблицы 2. Применение таких зондов в композициях по изобретению и их получение, и применение таких зондов в способах по изобретению представляют собой дополнительные аспекты изобретения. Изобретение также относится к праймеру, содержащему нуклеотидную последовательность, выбранную из Таблицы 3. Применение таких зондов в композициях по изобретению и их получение, и применение таких зондов в способах по изобретению представляют собой дополнительные аспекты изобретения.

Данное изобретение позволяет восстановить профиль микробиоты кишечника человека по наиболее представленным бактериальным и архейным таксонам, а также по таксонам, для которых известны ассоциации с заболеваниями человека, в том числе (но не будучи ограниченными перечисленными): диабет второго типа, ожирение, атеросклероз, воспалительные заболевания кишечника (в том числе болезнь Крона и неспецифический язвенный колит).

Таким образом, в другом своем аспекте данное изобретение относится к профилированию микробиоты. Для этого используется ПЦР в режиме реального времени с использованием следующих олигонуклеотидных зондов, предпочтительно, из числа указанных в таблице 2, и, возможно, из числа указанных в таблице 4. Для проведения ПЦР в режиме реального времени предпочтительно использовать праймеры, указанные в таблице 3, и, возможно, указанные в таблице 5.

Данный тест профилирования микробиоты может быть проведен на образцах кала человека, с использованием метода ПЦР в реальном времени. Метод ПЦР включает в себя три этапа: выделение ДНК из образца; амплификацию последовательности ДНК; анализ полученных результатов.

Накопление продуктов амплификации ДНК детектируют в режиме реального времени при помощи олигонуклеотидной пробы типа TaqMan, комплементарной центральной части амплифицируемого фрагмента транскрипта. В одном из вариантов осуществления изобретения используется зонд длиной 20-30 нуклеотидов, который несет на 5'-конце флуорофор (FAM, R6G или ROX) и на 3'-конце нефлуоресцентный тушитель (DABCYL, BHQ, FTQ или другие). При этом, олигонуклеотидные зонды в комплекте могут содержать как одинаковые, так и разные пары флуорофор-тушитель, а для одного и того же флуорофора возможно использование различных тушителей. На каждом цикле амплификации гибридизованная проба гидролизуется со стороны 5'-конца, при этом флуорофор пространственно разобщается с тушителем и, как следствие, увеличивается флуоресценция реакционной смеси. Определение количества кДНК выполняют при помощи уравнения калибровочной кривой с учетом эффективности каждой реакции амплификации. Для построения калибровочной кривой одновременно с анализируемыми образцами амплифицируют стандартные образцы ДНК с известной последовательностью, уменьшающейся в три раза концентрацией ДНК. Калибровочную кривую строят в зависимости от значений Ct и Log количества ДНК в стандартном образце. В соответствии с полученным графиком калибровочной кривой при помощи регрессионного анализа определяют коэффициенты линейного уравнения калибровочной кривой. ПЦР в реальном времени проводят на специализированных планшетах с лунками. В оптимальном варианте описываемой системы детекции в каждой лунке содержится по два олигонуклеотидных зонда из Таблицы 2, и по две пары праймеров, выбранных из Таблицы 3, для идентификации соответствующего биомаркера, перечисленного в Таблице 1. Также 2 лунки используются для контрольных измерений: определения тотальной прокариотической ДНК по концентрации кДНК гена 16S рРНК и определения количества ДНК человека. Таким образом, для анализа одного образца необходимо 16 лунок из 96. Одним экспресс-тестом из предлагаемого изобретения можно проанализировать до 6 образцов микробиоты кишечника человека.

Предлагаемый набор также может содержать инструкцию по применению этого набора, описание всех его составных частей, руководство по интерпретации результатов.

Для выявления оптимальных последовательностей зондов и праймеров, способных эффективно и специфично детектировать определенные роды микроорганизмов, авторами был разработан следующий алгоритм:

1) Из базы данных HITdb v1.00, содержащей репрезентативную выборку из 2473 последовательностей 16S рРНК представителей микробиоты кишечника человека, извлекались последовательности, принадлежащие определенному таксону. Далее проводилось множественное выравнивание отобранных последовательностей с помощью онлайн-сервиса Aligner из набора программ, предоставляемого RDP (http://rdp.cme.msu.edu/). Алгоритм выравнивания, использующийся в Aligner, учитывает особенности вторичной структуры 16S рРНК бактерий.

2) Полученное выравнивание использовали для поиска таксон-специфичных мотивов. Для этого, на первом шаге, выравнивание разбивалось на мотивы длиной 20 п. н., из них отбирались такие мотивы, которые обладали высокой консервативностью среди данного таксона (с коэффициентом соответствия каждой позиции в мотиве консенсусной последовательности не менее 90% и с максимальным допустимым числом вырожденных позиций - 2). На втором шаге, отобранные мотивы проверялись на таксон-специфичность путем их выравнивания с помощью BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cqi) против базы данных HITdb v1.00, из которой были исключены последовательности, соответствующие проверяемому таксону.

Таксон-специфичными мотивами считали такие мотивы, которые выравнивались со 100% идентичностью и покрытием не более, чем на 1% последовательностей из базы данных. Если таких мотивов не удавалось обнаружить, тогда мотивы, отстоящие друг от друга на расстоянии от 50 до 300 п.н., объединялись попарно и отбирались такие пары мотивов, которые одновременно выравнивались не более чем на 1-2% одних и тех же последовательностей из базы данных.

3) Далее таксон-специфичные мотивы анализировались в программе Vector NTI (Life Technologies) на соответствие параметрам, требуемых для праймирования данных участков: температура плавления (Тm) праймера - 58-62°С и ДНК-зонда - 65-75°С, GC-состав - 40-65%, отсутствие шпилек со значениями ΔG ниже - 3 kcal/mol и выше 2 kcal/mol и димеров со значениями ΔG ниже - 5 kcal/mol.

Все этапы анализа, кроме выравнивания с помощью Aligner и анализа в Vector NTI, были автоматизированы с помощью скриптов, написанных на языке программирования Python.

Полученные с помощью этого алгоритма зонды и праймеры представлены в Таблицах 2-5.

Нижеследующие примеры приведены в целях раскрытия характеристик настоящего изобретения и их не следует рассматривать как каким-либо образом ограничивающие объем изобретения.

Пример 1. Выделение ДНК из замороженного образца кала.

Для осуществления изобретения выделение ДНК из образцов кала может быть произведено с помощью стандартных методов, стандартных методов, например таких, как описанный ниже. Данный метод относится к средствам для выделения нуклеиновой кислоты из образца кала.

Вкратце, 150-200 мг замороженного кала помещают в пробирку с завинчивающейся крышкой, добавляют смесь микрошариков и 1 мл нагретого до 60°С лизисного буфера (500 мМ NaCl, 50 мМ Tris-HCl, рН 8.0, 50 мМ EDTA, 4% SDS). Образец гомогенизируют с помощью устройства MiniLys (Bertin corp.) на максимальной скорости в течение 3 мин. Затем полученный лизат инкубируют 15 мин при 70°С, центрифугируют 20 мин при 14000 об/мин, аккуратно отбирают 1 мл супернатанта в стерильную пробирку, не захватывая осадок, и ставят в лед. К осадку повторно добавляют 1 мл лизисного буфера и процедуру повторяют 2-6 раз. Полученные супернатанты объединяют и переносят в 15 мл пробирки для осаждения, содержащие 4 мл 96% этанола и 200 мкл 3М ацетата натрия. Для эффективного осаждения ДНК пробирки инкубируют при -20°С по меньшей мере 1 час. Тотальную ДНК осаждают при помощи центрифугирования при 14000 g в течение 15 мин при +4°С, осадок промывают 80% EtOH и опять осаждают центрифугированием, процедуру повторяют 2 раза. После этого осадок высушивают при комнатной температуре примерно 30-60 мин. Далее осадок растворяют в 200 мкл стерильной milliQ воды; раствор центрифугируют и переносят в новую стерильную пробирку. Далее проводят дополнительную очистку хлороформом путем смешивания и центрифугирования, отбирают водную фазу, содержащую ДНК, и обрабатывают ее раствором РНКазы А (5 мг/мл) в течение 1 часа при 37°С. Полученная таким способом ДНК является достаточно чистой для проведения последующих реакций ПЦР.

Для выделения ДНК из кала человека можно также использовать коммерческие наборы реагентов для получения препаратов очищенной ДНК, основанные на ее селективной сорбции на поверхности силикогеля из растворов с хаотропными агентами (например, «QIAamp DNA stool kit» (QIAgen), «ДНК-сорб-В», «ПРОБА-ГС-ГЕНЕТИКА» и другие).

Пример 2. Скрининг специфичности и эффективности олигонуклеотидных последовательностей в реакциях количественной ПЦР qPCR.

В некоторых вариантах осуществления изобретения первичный скрининг специфичности и эффективности выбранных последовательностей олигонуклеотидных праймеров для qPCR оценивали в амплификации с использованием интеркалирующего красителя SYBR Green I с последующим анализом полученных кривых плавления и электрофорезом в акриламидном геле для подтверждения специфичности.

Эффективность полимеразной цепной реакции (ПЦР) были определена при помощи калибровочных кривых, полученных путем амплификации последовательных разбавлений ДНК-матрицы в 10 раз. В качестве матрицы служили ДНК, выделенные из человеческих фекалий, либо ДНК, выделенные из клеточных культур. Эффективность оценивалась как для амплификации с использованием интеркалирующего красителя SYBR Green I (система без флуоресцентно-меченого зонда), так и для амплификации с гидролизующимся флюоресцентно меченным зондом.

В первом случае условия ПЦР были следующими:

ПЦР проводили в конечном объеме 20 мкл, содержащем 65 мМ Трис-HCl (рН 8.9), 16 мМ (NH4)2SO4, 3.0 мМ MgCl2, 0.05% Tween20, 0.2 мМ раствор дезоксинуклеозидтрифосфатов, 0.3 мкМ растворы олигонуклеотидных праймеров, SYBR Green I (разведение 1:25000), 1 ед. акт.Hot-start Taq-ДНК-полимеразы. ПЦР проводили на ДНК-амплификаторе CFX96 (BioRad, США).

Протокол ПЦР для ДНК-амплификатора CFX96:

1 96.0 С for 15:00

2 96.0 С for 0:05

3 60.0 С for 0:05

4 72.0 С for 0:05

5 75.0 С for 0:10

+Plate Read

6 GOTO 2, 45 more times

7 Melt Curve 70.0 to 95.0 C, increment 0.5 C,

0:10 + Plate Read

Данный метод относится к средствам для проведения амплификации и/или реакции удлинения праимера для одного или нескольких олигонуклеотидов из комплекта зондов.

8 случае построения калибровочных кривых с использованием зонда условия были такими:

ПЦР проводили в конечном объеме 20 мкл, содержащем 65 мМ Трис-HCl (рН 8.9), 24 мМ (NH4)2SO4, 3.0 мМ MgCl2, 0.05% Tween20, 0.2 мМ раствор дезоксинуклеозидтрифосфатов, 0.3 мкМ растворы олигонуклеотидных праймеров, 0.1 мкМ растворы зондов, 1 ед. акт. Hot-start Taq-ДНК-полимеразы. ПЦР проводили на ДНК-амплификаторе CFX96 (BioRad, США). Протокол ПЦР для ДНК-амплификатора CFX96:

1 96.0 С for 15:00

2 96.0 С for 0:08

3 60.0 С for 0:40

+Plate Read

4 GOTO 2, 45 more times

Эффективность реакции определяли для диапазона концентраций, в котором было возможно получить калибровочные кривые с ожидаемым шагом и хорошим коэффициентом корреляции между повторами.

Далее приведены репрезентативные примеры, демонстрирующие осуществление некоторых вариантов изобретения, а именно результаты амплификации ПЦР с использованием разработанных праймеров и зондов, в двух вариантах: с использованием красителя SybrGreen (без зонда) и с парой флурофор-тушитель (HEX и BHQ соответственно) на зонде. В качестве результата представлены графики качества ПЦР и степени амплификации за цикл (см. Фиг. 1-48). В Таблице 6 показаны номера Фигур и используемые зонды и праймеры для детекции определенных биомаркеров. На Фиг. 1-48 изображены по два графика: сверху изображена зависимость достижения порогового значения числа циклов при проведении ПЦР для нескольких разбавлений одного образца и совпадение этих величин с предсказанными, снизу - график зависимости значений относительных флуоресцентных единиц (сила сигнала ПЦР) от числа пройденных циклов ПЦР, для этих же самых разбавлений. Данный вид валидации был призван доказать сохранение линейности результата при исследовании разработанными ПЦР системами различных разбавлений, что было успешно подтверждено. Перечисленные в Таблице 6 зонды и праймеры для детекции общей прокариотической ДНК связываются с большинством прокариотических микроорганизмов, присутствующих в ЖКТ субъекта.

Таким образом, по результатам валидации, для всех выбранных мишеней удалось разработать и экспериментально протестировать пару праймеров и флуоресцентно меченный гибридизационный зонд, с помощью которых можно осуществлять qPCR с приемлемой эффективностью (80-105%). Разработанные qPCR системы обладают динамическим диапазоном измерений не менее 4 порядков, который может быть увеличен при дальнейшей оптимизации и валидации.

Построенные калибровочные кривые имеют коэффициент детерминации r2 не хуже 0.98, что говорит об их высоком потенциале для проведения с их помощью количественных измерений.

Несмотря на то, что изобретение описано со ссылкой на раскрываемые варианты воплощения, для специалистов в данной области должно быть очевидно, что конкретные подробно описанные эксперименты приведены лишь в целях иллюстрирования настоящего изобретения, и их не следует рассматривать как каким-либо образом ограничивающие объем изобретения. Должно быть понятно, что возможно осуществление различных модификаций без отступления от сути настоящего изобретения.

1. Набор для определения уровня представленности микроорганизмов в образце, взятом из желудочно-кишечного тракта (ЖКТ) субъекта, включающий

комплект олигонуклеотидных зондов, имеющих:

а) олигонуклеотидные последовательности, каждая из которых способна специфически гибридизоваться с участком генома микроорганизмов, имеющим последовательность, уникальную для только одного таксона, а микроорганизмы выбраны из следующей группы из 14 бактериальных и архейных таксонов: Lactobacillus spp.; Bifidobacterium spp.; Bacteroides spp.; Prevotella spp.; Enterobacteriaceae; Akkermansia spp.; Clostridium cluster XIVa, состоящий из родов Roseburia spp., Dorea spp., Eubacterium spp., Clostridium spp., Anaerostipes spp., Butyrivibrio spp., Coprococcus spp., Lachnospira spp., Ruminococcus spp., Collinsella; Clostridium cluster IV, состоящий из родов Subdoligranulum spp., Faecalibacterium spp., Anaerotruncus spp.; Christensenellaceae; Enterococcus spp.; Streptococcus spp.; Methanobrevibacter spp.; Ruminococcus spp., относящиеся к семейству Lachnospiraceae; Blautia spp., и

б) олигонуклеотидные последовательности, каждая из которых способна специфически гибридизоваться с участком генома, имеющим последовательность, общую для всех прокариотических микроорганизмов, присутствующих в ЖКТ субъекта,

при этом указанный комплект олигонуклеотидных зондов содержит по меньшей мере одну последовательность, выбранную из SEQ ID NO: 1-30 или SEQ ID NO: 91-96, или из группы идентичных одной из этих последовательностей по меньшей мере на 95%;

и

комплект праймеров, пригодных для использования при амплификации участков генома этих микроорганизмов в условиях количественного ПЦР, при этом для каждого используемого зонда в комплект праймеров включается специфичная пара праймеров, способная гибридизоваться с той же последовательностью ДНК микроорганизмов, что и указанный зонд, или последовательностью, комплементарной указанной последовательности ДНК, при этом указанные праймеры содержат по меньшей мере одну последовательность, выбранную из SEQ ID NO: 31-90 или SEQ ID NO: 97-108, или из группы идентичных одной из этих последовательностей по меньшей мере на 95%.

2. Набор по п. 1, в котором участки генома, которые участвуют в гибридизации с указанными зондами, кодируют ген 16S рРНК.

3. Набор по п. 1, в котором указанные олигонуклеотидные зонды содержат флуорофор, выбранный из списка FAM, R6G и ROX, прикрепленный на 5'-конце или 3'-конце последовательности зонда при помощи ковалентной связи, и содержат нефлуоресцентный тушитель, выбранный из списка DABCYL, BHQ и Eclipse, прикрепленный на противоположном от указанного флуорофора конце последовательности указанного зонда при помощи ковалентной связи.

4. Набор по любому из пп. 1-3, отличающийся тем, что дополнительно содержит, по меньшей мере, одно из следующего:

(а) средства для проведения амплификации и/или реакции удлинения праймера для одного или нескольких олигонуклеотидных зондов;

(б) средства для выделения нуклеиновой кислоты из образца кала.

5. Способ определения уровня представленности микроорганизмов в образце, взятом из ЖКТ субъекта, с использованием набора по п. 1, включающий следующие стадии:

(i) выделение геномной ДНК микроорганизмов из указанного образца;

(ii) проведение амплификации определенных участков генома микроорганизмов в условиях количественной ПЦР с применением выделенной геномной ДНК из (i), комплекта олигонуклеотидных зондов, имеющих:

а) олигонуклеотидные последовательности, каждая из которых способна специфически гибридизоваться с участком генома микроорганизмов, имеющим последовательность, уникальную для только одного таксона, а микроорганизмы выбраны из следующей группы из 14 бактериальных и архейных таксонов: Lactobacillus spp.; Bifidobacterium spp.; Bacteroides spp.; Prevotella spp.; Enterobacteriaceae; Akkermansia spp.; Clostridium cluster XIVa, состоящий из родов Roseburia spp., Dorea spp., Eubacterium spp., Clostridium spp., Anaerostipes spp., Butyrivibrio spp., Coprococcus spp., Lachnospira spp., Ruminococcus spp., Collinsella; Clostridium cluster IV, состоящий из родов Subdoligranulum spp., Faecalibacterium spp., Anaerotruncus spp.; Christensenellaceae; Enterococcus spp.; Streptococcus spp.; Methanobrevibacter spp.; Ruminococcus spp., относящиеся к семейству Lachnospiraceae; Blautia spp., и

б) олигонуклеотидные последовательности, каждая из которых способна специфически гибридизоваться с участком генома, имеющим последовательность, общую для всех прокариотических микроорганизмов, присутствующих в ЖКТ субъекта,

при этом указанный комплект олигонуклеотидных зондов содержит по меньшей мере одну последовательность, выбранную из SEQ ID NO: 1-30 или SEQ ID NO: 91-96, или из группы идентичных одной из этих последовательностей по меньшей мере на 95%;

и

комплекта праймеров, пригодных для использования при амплификации участков генома этих микроорганизмов в условиях количественного ПЦР, при этом для каждого используемого зонда в комплект праймеров включается специфичная пара праймеров, способная гибридизоваться с той же последовательностью ДНК микроорганизмов, что и указанный зонд, или последовательностью, комплементарной указанной последовательности ДНК, при этом указанные праймеры содержат по меньшей мере одну последовательность, выбранную из SEQ ID NO: 31-90 или SEQ ID NO: 97-108, или из группы идентичных одной из этих последовательностей по меньшей мере на 95%;

(iii) определение уровня представленности микроорганизмов из указанных таксонов при помощи нормирования на общее количество прокариотической ДНК в указанном образце.

6. Способ по п. 5, в котором участки генома, которые участвуют в гибридизации с указанными зондами, кодируют ген 16S рРНК.

7. Способ по п. 5, в котором для амплификации участков генома указанных микроорганизмов используются следующие олигонуклеотидные зонды:

(a) SEQ ID NO: 1 и SEQ ID NO: 2 для детекции Bacteroides spp.; (б) SEQ ID NO: 3 и SEQ ID NO: 4 для детекции Prevotella spp.; (в) SEQ ID NO: 5 и SEQ ID NO: 6 для детекции Bifidobacterium spp.; (г) SEQ ID NO: 7 и SEQ ID NO: 8 для детекции Enterobacteriaceae; (д) SEQ ID NO: 9 и SEQ ID NO: 10 для детекции Akkermansia spp.; (e) SEQ ID NO: 11 и SEQ ID NO: 12 для детекции Methanobrevibacter spp.; (ж) SEQ ID NO: 13 и SEQ ID NO: 14 для детекции Streptococcus spp.; (з) SEQ ID NO: 15 и SEQ ID NO: 16 для детекции Enterococcus spp.; (и) SEQ ID NO: 17 и SEQ ID NO: 18 для детекции Christensenellaceae; (к) SEQ ID NO: 19 и SEQ ID NO: 20 для детекции Lactobacillus spp.; (л) SEQ ID NO: 21 и SEQ ID NO: 22 для детекции Ruminococcus spp.[Lachnospiraceae family]; (м) SEQ ID NO: 23 и SEQ ID NO: 24 для детекции Blautia spp; (н) SEQ ID NO: 25 и SEQ ID NO: 26 для детекции Clostridium cluster IV; (o) SEQ ID NO: 27 и SEQ ID NO: 28 для детекции Clostridium cluster XIVa; (п) SEQ ID NO: 29 и SEQ ID NO: 30 для детекции общей прокариотической ДНК.

8. Способ по п. 7, в котором для амплификации участков генома указанных микроорганизмов используются следующие пары праймеров, специфичные для каждого используемого зонда:

(a) SEQ ID NO: 31-32 вместе с SEQ ID NO: 1 и SEQ ID NO: 33-34 вместе с SEQ ID NO: 2 для детекции Bacteroides spp.; (6) SEQ ID NO: 35-36 вместе с SEQ ID NO: 3 и SEQ ID NO: 37-38 вместе с SEQ ID NO: 4 для детекции Prevotella spp.; (в) SEQ ID NO: 39-40 вместе с SEQ ID NO: 5 и SEQ ID NO: 41-42 вместе с SEQ ID NO: 6 для детекции Bifidobacterium spp.; (г) SEQ ID NO: 43-44 вместе с SEQ ID NO: 7 и SEQ ID NO: 45-46 вместе с SEQ ID NO: 8 для детекции Enterobacteriaceae; (д) SEQ ID NO: 47-48 вместе с SEQ ID NO: 9 и SEQ ID NO: 49-50 вместе с SEQ ID NO: 10 для детекции Akkermansia spp.; (e) SEQ ID NO: 51-52 вместе с SEQ ID NO: 11 и SEQ ID NO: 53-54 вместе с SEQ ID NO: 12 для детекции Methanobrevibacter spp.; (ж) SEQ ID NO: 55-56 вместе с SEQ ID NO: 13 и SEQ ID NO: 57-58 вместе с SEQ ID NO: 14 для детекции Streptococcus spp.; (з) SEQ ID NO: 59-60 вместе с SEQ ID NO: 15 и SEQ ID NO: 61-62 вместе с SEQ ID NO: 16 для детекции Enterococcus spp.; (и) SEQ ID NO: 63-64 вместе с SEQ ID NO: 17 и SEQ ID NO: 65-66 вместе с SEQ ID NO: 18 для детекции Christensenellaceae; (к) SEQ ID NO: 67-68 вместе с SEQ ID NO: 19 и SEQ ID NO: 69-70 вместе с SEQ ID NO: 20 для детекции Lactobacillus spp.; (л) SEQ ID NO: 71-72 вместе с SEQ ID NO: 21 и SEQ ID NO: 73-74 вместе с SEQ ID NO: 22 для детекции Ruminococcus spp.[Lachnospiraceae family]; (м) SEQ ID NO: 75-76 вместе с SEQ ID NO: 23 и SEQ ID NO: 77-78 вместе с SEQ ID NO: 24 для детекции Blautia spp; (н) SEQ ID NO: 79-80 вместе с SEQ ID NO: 25 и SEQ ID NO: 81-82 вместе с SEQ ID NO: 26 для детекции Clostridium cluster IV; (o) SEQ ID NO: 83-84 вместе с SEQ ID NO: 27 и SEQ ID NO: 85-86 вместе с SEQ ID NO: 28 для детекции Clostridium cluster XIVa; (п) SEQ ID NO: 87-88 вместе с SEQ ID NO: 29 и SEQ ID NO: 89-90 вместе с SEQ ID NO: 30 для детекции общей прокариотической ДНК.



 

Похожие патенты:

Изобретение относится к ветеринарной микробиологии, в частности к лабораторной диагностике возбудителей инфекционных заболеваний, а именно к средствам диагностики инфекции у животных.

Изобретение относится к области биологии и медицины и предназначено для экспресс-выделения ДНК из размороженной крови. Проводят забор 2 мл цельной венозной крови в пробирки, содержащие ЭДТА-К3.

Изобретение относится к биотехнологии. Предложены олигонуклеотидные ДНК-праймеры для выявления и филогенетического анализа провирусной ДНК вируса лейкоза кошек, а также для синтеза фрагмента гена поверхностного гликопротеина gp70, содержащего протективные антигенные эпитопы, отличающиеся тем, что две пары олигонуклеотидных ДНК-праймеров имеют следующие последовательности: внешние (1 fwd: 5'TCCAACGCACCCAAAACCCT3'; 1 rev: 5'GCTTTAGTCCCTGTTCCGAC3'), внутренние (2 fwd: 5'TCCTGCCTATCTACTCCGCA3'; 2 rev: 5'ATGCATGGGGTGAGTCCAGT3').

Изобретение относится к области медицины, а именно к офтальмологии, и предназначено для прогнозирования тяжелой степени сухого керататоконъюнктивита (СКК) при синдроме Шегрена, ассоциированном с ревматоидным артритом.

Изобретение относится к области медицины, а именно к офтальмологии, и предназначено для прогнозирования тяжелой степени сухого керататоконъюнктивита (СКК) при синдроме Шегрена, ассоциированном с ревматоидным артритом.

Группа изобретений относится к медицине, а именно к онкологии, и может быть использована для диагностики выявления Ph-негативных миелопролиферативных новообразований.
Изобретение относится к области медицины, а именно к диагностике и гинекологии, и предназначено для выявления риска развития сочетания генитального эндометриоза и гиперпластических процессов эндометрия у женщин русской национальности, уроженок Центрального Черноземья.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития ишемического инсульта. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из венозной крови и проводят анализ полиморфизмов генов цитокинов rs1061624 TNFR2 и rs767455 TNFR1.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития ишемического инсульта. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из венозной крови и проводят анализ полиморфизмов генов цитокинов rs1061624 TNFR2 и rs767455 TNFR1.

Группа изобретений относится к области биотехнологии. Предложен способ и устройство определения нуклеотидной последовательности молекулы нуклеиновой кислоты.

Изобретение относится к биотехнологии. Заявлен способ определения вероятности того, что пациент имеет волчанку в доклинической стадии. Способ включает взятие образца крови у пациента, измерение уровней для группы клеточно-связанных продуктов активации комплемента (CB-CAP) в указанном образце крови, где указанная группа CB-CAP включает по меньшей мере восемь из следующих: E-C4d, E-C3d, R-C4d, R-C3d, T-C4d, T-C3d, B-C4d, B-C3d, М-C4d, М-C3d, G-C4d, G-C3d, P-C4d и E-CR1, сравнение уровней CB-CAP пациента с контрольными уровнями, вычисление процента CB-CAP, для которых уровни у пациента являются аномальными по сравнению с контрольными уровнями, и принятие вычисленного процента за вероятность того, что пациент имеет волчанку в доклинической стадии. Клеточно-связанные продукты активации комплемента (CB-CAP) служат в качестве диагностических биомаркеров волчанки в доклинической стадии у пациентов, которые не соответствуют по меньшей мере четырем критериям Американской коллегии ревматологов (или подобным, например SLICC) установленного диагноза волчанки. 6 з.п. ф-лы, 4 ил., 7 табл., 1 пр.

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления маркерных участков генов бактерий и архей из микробиоты кишечника человека. Был разработан и экспериментально протестирован новый способ профилирования микробиоты кишечника индивида. Способ основан на полуколичественном и качественном определении представителей прокариотических таксонов, которые имеют описанную ассоциацию с теми или иными патологиями человека и наиболее представлены в микробиоте кишечника человека. Набор включает олигонуклеотиды, специфичные к и способные гибридизоваться с фрагментами генов 16S рРНК указанных в описании бактериальных и архейных таксонов. Набор позволяет повысить точность и скорость определения микроорганизмов, потенциально ответственных за заболевания человека. 2 н. и 6 з.п. ф-лы, 48 ил., 6 табл., 2 пр.

Наверх