Способ определения активности теломеразы методом двойной амплификации теломерных повторов в реальном времени

Изобретение относится к биохимии, биологии, медицине, онкологии, ветеринарии, и может быть использовано для определения активности теломеразы при диагностике злокачественных новообразований. Предложен способ выявления и количественного определения активности теломеразы в биологических образцах эукариотических организмов методом двойной амплификации теломерных повторов в реальном времени, основанном на измерении суммарного содержания теломерных повторов, новосинтезированных теломеразой в анализируемом образце. Изобретение позволяет обеспечить высокую чувствительность и специфичность метода, в том числе при проведении анализа в биологических образцах, характеризующихся низким содержанием теломеразопозитивных клеток и присутствием ингибиторов теломеразы. 3 н. и 13 з.п. ф-лы, 5 пр.

 

Изобретение относится к биологии, медицине, онкологии, ветеринарии, репродуктологии и может быть использовано, в частности, для определения активности теломеразы при диагностике злокачественных новообразований, на подготовительных этапах при применении вспомогательных репродуктивных технологий, научных исследованиях и др.

Уровень техники

Теломеры – это концевые участки хромосом, которые укорачиваются с каждым делением клетки. Теломераза – рибонуклеопротеидный комплекс, который достраивает теломеры, тем самым компенсируя их укорачивание. Высокая теломеразная активность характерна для эмбриональных, половых и стволовых клеток. В тканях здорового человека в норме, за исключением ряда органов, теломеразная активность полностью отсутствует и начинает проявляться в процессе онкогенеза. Теломеразная активность является универсальным маркером для 85% злокачественных опухолей. Это позволяет разрабатывать современные высокочувствительные и высокоспецифичные наборы для диагностики большинства злокачественных новообразований, в том числе на ранних стадиях заболевания.

Знание структурных и функциональных особенностей теломеразы открывает дорогу для поиска ингибиторов и активаторов теломеразы, а также новых подходов к диагностике злокачественных новообразований. Однако измерение активности теломеразы - это непростая задача, поскольку характерной особенностью является низкое число ее копий на клетку, а, следовательно, и низкая активность, даже в опухолевых клетках, где теломераза активирована. Тем не менее, использование определения активности теломеразы в диагностических тестах очень перспективно, так как позитивный результат может быть получен при наличии в образце всего лишь нескольких теломеразопозитивных опухолевых клеток. При этом важно, что для диагностики могут оказаться пригодными образцы, полученные неинвазивными и минимально инвазивными способами.

Определение активности теломеразы может быть использовано в области вспомогательных репродуктивных технологий, как в репродуктивной медицине, так и в сельском хозяйстве, для определения качества сперматозоидов, ооцитов и яйцеклеток позвоночных животных и человека. Определение активности теломеразы может быть проведено в фолликулярных клетках (клетки кумулюса и клетки гранулезы) для прогнозирования исходов программ вспомогательных репродуктивных технологий, а также для диагностики ряда заболеваний репродуктивной системы, например, синдрома недостаточности яичников. Кроме того, данный метод может быть использован для исследования воздействия лекарственных препаратов, влияющих на механизмы старения через стабилизацию/дестабилизацию длины теломер.

Для определения активности теломеразы, при наличии в образце ее ингибиторов, в первую очередь, необходим надежный метод. В ряде случаев из-за низкой концентрации теломеразы в клетке (100 молекул на 1 клетку) детекция компонентов теломеразы и ее активности становится сложным процессом. Первым для исследования теломеразы использовался прямой метод детекции теломеразной активности. Этот метод основан на удлинении праймера теломеразой в клеточном экстракте в присутствии радиоактивно меченого нуклеотида, который включается в теломерный повтор. Далее продукты удлинения анализируют электрофорезом. Этот метод очень надежный, показывает не только активность, но и количество добавленных теломерных повторов. Однако этот метод имеет ограниченную чувствительность, из-за чего необходимо значительное количество клеточного образца и радиоактивного материала, что часто ограничивает использование данного метода в обычных исследовательских и клинико-диагностических лабораториях.

Известен метод определения активности теломеразы методом TRAP (Telomeric Repeat Amplification Protocol) в реальном времени, в котором для визуализации продуктов реакции используется система TaqMan (John P. Jakupciak et al. Preparation and Characterization of Candidate Reference Materials for Telomerase Assays // Clinical Chemistry, Vol. 51, Issue 8, August 2005, p.1443–1450). Однако его чувствительность невысока при очень низком содержании клеток в образце и/или наличии в нем ингибиторов реакции.

В патенте US7390621 (Methods and compositions for detecting telomerase activity)Ошибка! Недопустимый объект гиперссылки. описан метод определения теломеразной активности с помощью удлинения праймера с последующим проведением ПЦР в реальном времени в одной пробирке. Особенностью данного метода является использование очень большого числа циклов ПЦР в течение одной стадии (40 циклов), что приводит к существенному изменению зависимости между скоростью синтеза ампликона и временем реакции, а также к возможному синтезу неспецифических продуктов. Данный метод имеет высокое значение порогового цикла, что также существенно отражается на качестве анализа.

Известен метод определения теломеразной активности с помощью удлинения праймера с последующим проведением количественной ПЦР в реальном времени в одной пробирке (Hou M, Xu D, Bjorkholm M, Gruber A. (2001) Real-Time Quantitative Telomeric Repeat Amplification Protocol Assay for the Detection of Telomerase Activity. Clin Chem;47:519–24. В отличие от приведённого выше метода (патент US7390621), в данной работе используется модифицированный СХ праймер – ACХ. В данной работе, тем не менее, также используется достаточно большое число циклов ПЦР в течение одной стадии (40 циклов), что приводит к существенному изменению зависимости между скоростью синтеза ампликона и временем реакции, а также к возможному синтезу неспецифических продуктов.

Известен метод, в котором для визуализации продуктов реакции при проведении ПЦР в «реальном времени» используется флуоресцентно меченый (по запатентованной технологии Amplifluor® primer) праймер RP (TRAPEZE® RT Telomerase Detection Kit). В данной работе используется очень большое число циклов ПЦР в течение одной стадии (45 циклов), что приводит к существенному изменению зависимости между скоростью синтеза ампликона и временем реакции, а также к возможному синтезу неспецифических продуктов.

Классический метод анализа теломеразной активности (TRAP – Telomeric Repeat Amplification Protocol – Протокол амплификации теломерных повторов) считается неэффективным, когда анализируется очень маленькое количество клеточного материала. Это делает невозможным проведение неинвазивного варианта диагностики ряда заболеваний, когда количество клеточного материала мало. В связи с этим, разработка более чувствительных вариантов TRAP анализа является весьма актуальной задачей биологии и медицины.

Раскрытие изобретения

Задачей изобретения является разработка способа количественного определения активности теломеразы, обеспечивающего его высокую чувствительность и специфичность при проведении анализа в биологических образцах, в том числе в образцах, содержащих низкое количество теломеразопозитивных клеток и/или ингибиторы теломеразы.

Для решения поставленной задачи был разработан способ определения активности теломеразы методом двойной амплификации теломерных повторов в реальном времени (RT-TRAP-2PCR), который может быть охарактеризован как

способ выявления и/или количественного определения активности теломеразы в биологическом образце эукариотического организма, включающий следующие этапы:

(1) инкубацию указанного биологического образца в среде, включающей по меньшей мере один теломеримитирующий олигонуклеотид и дезоксинуклеозидтрифосфаты (дНТФ) или их меченые производные, в условиях, подходящих для продуцирования теломеразой продуктов элонгации на основе теломеримитирующего олигонуклеотида в течение времени, достаточного для элонгации;

(2) выдерживание реакционной смеси, полученной на этапе (1), при температуре и в условиях, подходящих для инактивации теломеразы;

(3) проведение полимеразной цепной реакции (ПЦР №1) в реакционной смеси, полученной на этапе (2), с добавлением по меньшей мере одного праймера, комплементарного теломерным повторам в геноме исследуемого биологического объекта, и в условиях, подходящих для амплификации продуктов элонгации, полученных на этапе (1);

(4) проведение полимеразной цепной реакции в режиме реального времени (ПЦР №2) в реакционной смеси, полученной на этапе (3), с добавлением по меньшей мере одной пары праймеров, один из которых способен комплементарно взаимодействовать с цепью теломерных повторов, а другой – с комплементарной ей цепью, и в условиях, подходящих для амплификации продукта, полученного на этапе (3);

(5) анализ присутствия и/или активности теломеразы в анализируемом образце путем проведения, соответственно, качественного и/или количественного анализа продуктов реакции, полученных на этапе (4).

В некоторых вариантах изобретения биологический образец представляет собой биологический образец позвоночного животного или человека.

В некоторых вариантах изобретения позвоночное животное представляет собой млекопитающее.

В частных вариантах воплощения изобретения биологическим образцом является ткань, жидкость или отдельные клетки, выделенные из живого организма.

В некоторых вариантах изобретения теломеримитирующий олигонуклеотид имеет последовательность SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 или последовательность, гомологичную по меньшей мере на 80% одной из этих последовательностей, более предпочтительно, гомологичную по меньшей мере на 90%, еще более предпочтительно гомологичную по меньшей мере на 95%.

В некоторых вариантах изобретения на этапе (3) используют праймер вида

5’–V(CCCTTA)kW–3’ или 5’–V(CTАAСС)kW–3’,

где V – цепочка из 0-20 нуклеотидных остатков, независимо выбранных из А,С,T,G,

W выбран из С, СС, ССС, СССТ, СССТА, СССТАА,

k – целое число от 1 до 3.

В частных вариантах изобретения на этапе (3) используют праймер, имеющий последовательность SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 или праймер, имеющий последовательность, гомологичную по меньшей мере на 80% одной из этих последовательностей, более предпочтительно, гомологичную по меньшей мере на 90%, еще более предпочтительно гомологичную по меньшей мере на 95%.

В некоторых вариантах изобретения на этапе (4) используют пару праймеров, один из которых представляет собой праймер вида:

5’ –Х1Х2Х3Х4Х5Х6Х7Х8(TTTGGG)nY1Y2Y3Y4Y5Y6Y7Y8, – 3’,

а другой – праймер вида:

5’ – Х’1Х’2Х’3Х’4Х’5Х’6Х’7Х’8(CCCTTA)mY’1Y’2Y’3Y’4Y’5Y’6Y’7Y’8 – 3’

или 5’ – Х’1Х’2Х’3Х’4Х’5Х’6Х’7Х’8(CCCTAT)mY’1Y’2Y’3Y’4Y’5Y’6Y’7Y’8, – 3’,

где каждый из Х1 – Х8, Y1 – Y6, Х’1 – Х’8, Y’1 – Y’6 независимо выбраны из А,С,T,G или отсутствуют (=0),

Y7Y8 независимо выбраны из AG, GT, GG, ТA или TТ,

Y'7Y’8 независимо выбраны из AA, СС, ТС, СА, СТ или АТ,

а n, m – независимо выбраны из целых чисел от 1 до 8,

при этом длина праймера независимо составляет не менее 18, но не более 55 нуклеотидов.

В частных вариантах изобретения на этапе (4) используют пару праймеров, состоящую из

TelG-праймера, имеющего последовательность SEQ ID NO:8 или последовательность, по меньшей мере на 80% гомологичную ей; и TelC-праймера, имеющего последовательность SEQ ID NO:9 или последовательность, по меньшей мере на 80% гомологичную ей, и сконструированные по правилам, как это описано выше; или

Tel1-праймера, имеющего последовательность SEQ ID NO:10, или последовательность, по меньшей мере на 80% гомологичную ей; и Tel2-праймера, имеющего последовательность SEQ ID NO:11 или последовательность, по меньшей мере на 80% гомологичную ей и сконструированные по правилам, как это описано выше; или

Tel1-праймера, имеющего последовательность SEQ ID NO:10 или последовательность, по меньшей мере на 80% гомологичную ей; и Tel2b-праймера, имеющего последовательность SEQ ID NO:12 или последовательность, по меньшей мере на 80% гомологичную ей и сконструированные по правилам, как это описано выше.

В некоторых вариантах изобретения способ включает предварительную подготовку биологического образца.

В некоторых вариантах воплощения изобретения праймер на любом из этапов независимо представляет собой флуоресцентно-меченый праймер, люминесцентно-меченый праймер, праймер, меченый радиоактивным изотопом или биотинилированный праймер.

В некоторых вариантах воплощения изобретения меченые производные дезоксинуклеозидтрифосфатов представляют собой биотинилированные нуклеотиды или флуоресцентномеченые нуклеотиды, содержащие химические модификации (такие, как гасители (quenchers) и эммитеры флуоресценции).

Предлагаемое изобретение также относится к применению способа выявления и/или количественного определения активности теломеразы в биологическом образце для диагностики онкологических заболеваний у человека или позвоночных животных. В некоторых частных вариантах биологический образец содержит не более 10 клеток, более конкретно, не более 10 теломеразопозитивных клеток или потенциально теломеразопозитивных клеток (в случае анализа опухолевых тканей – не более 10 опухолевых клеток).

Предлагаемое изобретение также относится к применению способа выявления и/или количественного определения активности теломеразы в биологическом образце в области вспомогательных репродуктивных технологий для оценки качества сперматозоидов, яйцеклеток и ооцитов (по клеткам кумулюса, то есть клеткам гранулезы, окружающих сам ооцит) и др. позвоночных животных или человека.

Предлагаемое изобретение также относится к применению способа выявления и/или количественного определения активности теломеразы в биологическом образце для исследования действия препаратов, препятствующих старению и стабилизирующих длину теломер у позвоночных животных или человека.

Изобретение также относится к определению активности теломеразы в различных клетках для диагностики ряда заболеваний, например, в клетках гранулезы – для диагностики ряда заболеваний репродуктивной системы (таких как синдром недостаточности яичников).

Предлагаемое изобретение также относится к набору для выявления и/или количественного определения активности теломеразы способом по изобретению, включающему, по меньшей мере, теломеримитирующий олигонуклеотид, дезоксирибонуклеозидтрифосфаты дАТФ, дГТФ, дЦТФ, дТТФ или их меченые производные; праймер, комплементарный теломерным повторам в геноме исследуемого биологического объекта; а также пару праймеров, один из которых способен комплементарно взаимодействовать с цепью теломерных повторов, а другой – с комплементарной ей цепью, в количествах, достаточных для проведения анализа активности теломеразы. Все компоненты набора входят в набор и используются в количествах, по меньшей мере, необходимых для проведения анализа согласно изобретению. В частных случаях выполнения изобретения набор дополнительно содержит экстракт опухолевой клеточной линии или синтетическую двунитевую матрицу ds(GGGTTA/CCCAAT)n (n – целое число, отражающее количесто повторов; в предпочтительных вариантах n выбирают от 4 до 16, в наиболее предпочтительных – от 8 до 9), используемую в качестве положительного контроля.

В состав набора по изобретению также входят буферные растворы и компоненты, необходимые для создания условий для осуществления соответствующих этапов способа выявления и/или количественного определения активности теломеразы в биологическом образце. Каждый из компонентов набора используются в количестве, по меньшей мере, достаточном для проведения анализа.

В частных случаях выполнения изобретения теломеримитирующий олигонуклеотид, входящий в набор, имеет последовательность SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 или последовательность, гомологичную по меньшей мере на 80% одной из этих последовательностей, более предпочтительно, гомологичную по меньшей мере на 90%, еще более предпочтительно гомологичную по меньшей мере на 95%.

В некоторых вариантах изобретения в состав набора в качестве праймера, комплементарного теломерным повторам в геноме исследуемого биологического объекта, входит праймер вида

5’–V(CCCTTA)kW–3’ или 5’–V(CTАAСС)kW–3’,

где V – цепочка из 0-20 нуклеотидных остатков, независимо выбранных из А,С,T,G,

W выбирают из С, СС, ССС, СССТ, СССТА, СССТАА,

k – целое число от 1 до 3.

В частных вариантах изобретения в качестве праймера, комплементарного теломерным повторам в геноме исследуемого биологического объекта, в состав набора входит праймер, имеющий последовательность SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 или праймер, имеющий последовательность, гомологичную по меньшей мере на 80% одной из этих последовательностей.

В некоторых вариантах изобретения в качестве пары праймеров, один из которых способен комплементарно взаимодействовать с цепью теломерных повторов, а другой – с комплементарной ей цепью, входит пара праймеров, один из которых представляет собой праймер вида:

5’ –Х1Х2Х3Х4Х5Х6Х7Х8 (TTTGGG)nY1Y2Y3Y4Y5Y6Y7Y8, – 3’,

а другой – праймер вида:

5’ – Х’1Х’2Х’3Х’4Х’5Х’6Х’7Х’8(CCCTTA)mY’1Y’2Y’3Y’4Y’5Y’6Y’7Y’8 – 3’

или 5’ – Х’1Х’2Х’3Х’4Х’5Х’6Х’7Х’8(CCCTAT)mY’1Y’2Y’3Y’4Y’5Y’6Y’7Y’8, – 3’,

где каждый из Х1 – Х8, Y1 – Y6, Х’1 – Х’8, Y’1 – Y’6 независимо выбраны из А,С,T,G или отсутствуют (=0),

Y7Y8 независимо выбраны из AG, GT, GG, ТA или TТ,

Y'7Y’8 независимо выбраны из AA, СС, ТС, СА, СТ или АТ,

а n, m – независимо выбраны из целых чисел от 1 до 8,

при этом длина праймера независимо составляет не менее 18, но не более 55 нуклеотидов.

В частных вариантах изобретения в качестве такой пары праймеров используют пару праймеров, состоящую из

TelG-праймера, имеющего последовательность SEQ ID NO:8 или последовательность, по меньшей мере на 80% гомологичную ей; и TelC-праймера, имеющего последовательность SEQ ID NO:9 или последовательность, по меньшей мере на 80% гомологичную ей, и сконструированные по правилам, как это описано выше; или

Tel1-праймера, имеющего последовательность SEQ ID NO:10, или последовательность, по меньшей мере на 80% гомологичную ей; и Tel2-праймера, имеющего последовательность SEQ ID NO:11 или последовательность, по меньшей мере на 80% гомологичную ей и сконструированные по правилам, как это описано выше; или

Tel1-праймера, имеющего последовательность SEQ ID NO:10 или последовательность, по меньшей мере на 80% гомологичную ей; и Tel2b-праймера, имеющего последовательность SEQ ID NO:12 или последовательность, по меньшей мере на 80% гомологичную ей и сконструированные по правилам, как это описано выше.

В некоторых вариантах воплощения изобретения, по меньшей мере, один из праймеров, входящих в набор, независимо представляет собой флуоресцентно-меченый праймер, люминесцентно-меченый праймер, праймер, меченый радиоактивным изотопом или биотинилированный праймер.

В некоторых вариантах воплощения изобретения меченые производные дезоксинуклеозидтрифосфатов (дНТФ, dNTP) дАТФ, дГТФ, дЦТФ, дТТФ, входящие в набор, представляют собой биотинилированные нуклеотиды или флуоресцентномеченые нуклеотиды, содержащие химические модификации (представляющие собой гасители (quenchers) и эммитеры флуоресценции).

Например, в одном из частных случаев выполнения изобретения состав набора включает Трис-HCl, MgCl2, EGTA, PMSF, β-меркаптоэтанол, CHAPS, глицерин, Coomassie Brilliant Blue G-250, (NH4)2SO4, Tween-20, dNTPs, TS-праймер, CX-праймер, экстракт опухолевой клеточной линии, ДНК-полимеразу, SYBR Green I, ROX, betain, TelG-праймер, TelC-праймер, каждый из которых входит в набор в количестве, по меньшей мере, достаточном для проведения выявления и/или количественного определения активности теломеразы в биологическом образце позвоночных животных или человека методом двойной амплификации теломерных повторов в реальном времени (RT-TRAP-2PCR).

При осуществлении изобретения достигаются следующие технические результаты:

- разработан специфический и высокочувствительный метод анализа теломеразной активности, позволяющий проводить не только качественный, но и количественный анализ активности теломеразы в образце;

- достигнуто существенное снижение порогового цикла (Сt), что определяет значительное повышение чувствительности метода (для проведения анализа достаточно всего лишь 10 клеток);

- достигнуто снижение минимального количества циклов для каждой стадии ПЦР, достаточных для проведения анализа, т.е. для достижения порогового цикла (Сt);

- отсутствие необходимости использования радиоактивных изотопов;

- разработанный метод позволяет проводить анализ теломеразной активности в присутствии различных примесей нуклеиновых кислот, белков и других компонентов клеток и тканей, характерных для клинических образцов, при этом для диагностики могут оказаться пригодны образцы, полученные неинвазивными и малоинвазивными способами;

- разработанный метод позволяет эффективно проводить анализ в образцах с низким содержанием теломеразопозитивных клеток, а также в присутствии ингибиторов теломеразы, позволяя при этом избежать появления ложноотрицательных результатов;

- метод прост в подготовке и эксплуатации, имеет низкую стоимость.

Краткое описание рисунков

Рис. 1A. Анализ образцов лизатов клеточной линии К562 (хронический промиелолейкоз человека), содержащих различное количество клеток и эквивалентных различному уровню теломеразной активности (АТ) методом RT-TRAP-2PCR:

«100% АТ (К+)» – положительный контрольный образец (100 клеток – 100% АТ),

«80% АТ» - образец с высокой теломеразной активностью (80% АТ от К+),

«40% АТ» - образец со средней теломеразной активностью (40% АТ от К+);

«10% АТ» - образец с низкой теломеразной активностью (10% АТ от К+);

«0% АТ (К--)» – отрицательный контрольный образец (0% АТ).

Рис. 1В. Электрофорез продуктов TRAP-анализа активности теломеразы в экстрактах клеточной линии К562, содержащих различное количество клеток и эквивалентных различному уровню теломеразной активности (АТ) (10% электрофорез в полиакриламидном геле (ПААГ), окрашенный красителем SYBR Gold, фотография в УФ-свете).

Дорожка 1 –положительный контрольный образец (100 клеток – 100% АТ),

Дорожка 2 –образец с высокой теломеразной активностью (80% АТ от К+),

Дорожка 3 –образец со средней теломеразной активностью (40% АТ от К+),

Дорожка 4 –образец с низкой теломеразной активностью (10% АТ от К+),

Дорожка 5 –отрицательный контрольный образец (0% АТ).

Рис.1С. Линейная регрессия между активностью теломеразы (количеством клеток в лизате клеточной линии K562) и значением порогового цикла (Ct) при анализе теломеразной активности методом RT-TRAP-2PCR.

Рис.2А. Электрофорез продуктов TRAP-анализа активности теломеразы в клеточных экстрактах, полученных из клеточного осадка мочи и образца ткани после проведения биопсии у пациента с диагнозом рак мочевого пузыря (стадия T1N0M0G1) (10% электрофорез в полиакриламидном геле (ПААГ), окрашенный красителем SYBR Gold, фотография в УФ-свете). Анализ белковых экстрактов из образцов клеточного осадка мочи (дорожки 1-4) и ткани мочевого пузыря (МП, дорожки 5-8). Реакционные пробы содержали различное количество белка экстракта: 8 мкг (дорожки 1 и 5), 4 мкг (дорожки 2 и 6), 2 мкг (дорожки 3 и 7) и 0,7 мкг (дорожки 4 и 8). К-- – отрицательный контрольный образец (TRAP в отсутствии белкового экстракта), К+ – положительный контроль – внесено 0,04 мкг белка экстракта клеточной линии К562;

Рис. 2В. Анализ активности теломеразы методом RT-TRAP-2PCR в клиническом материале пациента с раком мочевого пузыря:

«К+» – положительный контрольный образец (100 клеток линии К562 – 100% АТ),

«К»– отрицательный контрольный образец (0% АТ),

Приведены кривые накопления продуктов амплификации теломерных повторов методом RT-TRAP-2PCR в образцах реакционных смесей лизатов клеточного осадка мочи (кривые № 1-4) и ткани (кривые №5-8) этого же пациента (рак мочевого пузыря, стадия T1N0M0G1) с различным содержанием белка в экстракте: 8 мкг (кривые № 1 и 5), 4 мкг (кривые № 2 и 6), 2 мкг (кривые № 3 и 7), 0,7 мкг (кривые № 4 и 8).

Рис. 3. Кривые накопления продуктов амплификации теломерных повторов методом RT-TRAP-2PCR в образцах реакционных смесей лизатов клинического материала от 5-ти разных пациентов с диагнозом рак поджелудочной железы (кривые 1-5). К+ – положительный контрольный образец (100 клеток линии К562 – 100% теломеразной активности), К-- – отрицательный контрольный образец (0% теломеразной активности). Выход флуоресценции в образце К-- является результатом неспецифической амплификации дуплекса праймеров TS и CX.

Рис. 4. Кривые накопления продуктов амплификации теломерных повторов методом RT-TRAP-2PCR в образцах реакционных смесей лизатов клинического материала от 3-х пациентов с диагнозом рак желудка (кривые 1-3). К+ – положительный контрольный образец (100 клеток линии К562 – 100% теломеразной активности), К-- – отрицательный контрольный образец (0% теломеразной активности). Выход флуоресценции в образце К-- является результатом неспецифической амплификации дуплекса праймеров TS и CX.

Рис.5. Сравнительный анализ чувствительности стандартного метода RT-TRAP (пунктирная линия) и метода TRAP c использованием магнитно-силовой микроскопии (сплошная линия). Использована синтетическая ds(GGGTTA/CCCAAT)9 матрица.

RTA (ед.) – Related Telomerase Activity (относительные единицы активности теломеразы), δT2 (мс) – magnetic field distortion (искажение изменения магнитного поля)

Рис. 6. Определение чувствительности метода RT-TRAP-2PCR с использованием синтетической ds(GGGTTA/CCCAAT)9 матрицы. «К+» – положительный контрольный образец (100 клеток линии К562 – 100% теломеразной активности), «К--» – отрицательный контрольный образец (0% теломеразной активности), «100 фмоль» (1 фмоль=10-15 моль), «10 фмоль», «1 фмоль», «100 амоль» (1 амоль=10-18 моль), «10 амоль» - исследованные образцы, содержащие соответствующее количество ds(GGGTTA/CCCAAT)9 матрицы.

Определения (термины)

RT-TRAP-2PCR - метод двойной амплификации теломерных повторов в реальном времени (Real-Time – Telomeric Repeat Amplification Protocol – 2 Polymerase Chain Reaction).

В данном документе под теломеразой (ферментом, добавляющим теломерные повторы (TTAGGG-повторы у человека и позвоночных) к 3'-концу цепи ДНК на участках теломер на концах хромосом) подразумевается теломераза любых эукариотических организмов. В частных вариантах воплощения изобретения подразумевается теломераза человека или позвоночных.

Под теломеримитирующим олигонуклеотидом подразумевается любой олигонуклеотид, последовательность которого не совпадает с теломерной последовательностью, но который пригоден в качестве субстрата для теломеразы. Примерами такого теломеримитирующего олигонуклеотида (но не ограничиваются ими) при определении активности теломеразы в биологических образцах позвоночных животных или человека, могут быть олигонуклеотиды, имеющие последовательность 5’–ATTCCGTCGAGCAGAGTT–3' (SEQ ID NO:1, известный как TS-праймер), 5’–AATCCGTCGAGCGAGGTT–3' (SEQ ID NO:2), 5’–AGAGTTCCCCAAGGGGAG–3’ (SEQ ID NO:3), 5’–GGGATTGGGATTGGGATTGGGTT–3’ (SEQ ID NO:4, известный как TSG4 праймер) или олигонуклеотиды, имеющие последовательность, гомологичную по меньшей мере на 80% одной из приведенных последовательностей, более предпочтительно, гомологичную по меньшей мере на 90%, еще более предпочтительно, гомологичную по меньшей мере на 95%. При этом здесь и далее в настоящем изобретении подразумеваются только такие олигонуклеотиды, которые не образуют комплементарные комплексы с нетаргетными участками ДНК, т.е. их использование не приводит к появлению неспецифических продуктов.

ПЦР №1 – полимеразная цепная реакция, в процессе которой происходит амплификация продуктов элонгации теломеримитирующих олигонуклеотидов, полученных в результате удлинения их теломеразой путем добавления теломерных повторов. При этом в первом цикле ПЦР №1 происходит образование комплементарных цепей к однонитевым ДНК, являющихся продуктами элонгации теломеримитирующих олигонуклеотидов. Во втором и последующих циклах происходит амплификация образовавшихся двунитевых ДНК. В качестве прямого праймера в ПЦР №1 выступает теломеримитирующий олигонуклеотид, выбранный в качестве субстрата теломеразы. В качестве обратного праймера используют праймер, комплементарный теломерным повторам в геноме исследуемого биологического объекта. Принципы конструирования праймеров для ПЦР хорошо известны специалистам в данной области техники. При конструировании необходимо, чтобы праймер имел структуру, комплементарную G-богатому теломерному повтору, но не образовывал дуплексов с праймером элонгации, а также имел комплементарную теломерному повтору область с 3’ конца. В частных случаях осуществления изобретения при определении активности теломеразы в биологических образцах позвоночных животных или человека качестве обратного праймера может быть использован праймер вида

5’–V(CCCTTA)kW–3’ или 5’–V(CTАAСС)kW–3’, где V – цепочка из 0-20 нуклеотидных остатков, независимо выбранных из А,С,T,G, W выбран из С, СС, ССС, СССТ, СССТА, СССТАА, а k – целое число от 1 до 3. В некоторых частных, но не ограничивающих, вариантах изобретения при проведении ПЦР №1 используют праймер, имеющий последовательность 5’–СССTTACCCTTACCCTTACCCTAA–3’ (SEQ ID NO:5, известный как СХ-праймер), 5’–GСGCGCCTTACCCTTACCCTTACCCTAACC–3’ (SEQ ID NO:6, известный как АСХ-праймер), 5’-TAGAGCACAGCCTGTCCGTG(CTAACC)3 (SEQ ID NO:7, известный как RPC3-праймер) или праймер, имеющий последовательность, гомологичную по меньшей мере на 80% одной из этих последовательностей, более предпочтительно, гомологичную по меньшей мере на 90%, еще более предпочтительно гомологичную по меньшей мере на 95%. При этом здесь и далее в настоящем изобретении подразумеваются только такие праймеры, которые не образуют комплементарные комплексы с нетаргетными участками ДНК, т.е. их использование не приводит к появлению неспецифических продуктов.

ПЦР №2 – полимеразная цепная реакция, в процессе которой происходит амплификация фрагментов цепей ДНК, полученных в результате проведения ПЦР №1. При проведении ПЦР №2 используют пару праймеров, один из которых способен комплементарно взаимодействовать с цепью теломерных повторов, а другой – с комплементарной ей цепью, при этом важно, чтобы праймеры не образовывали между собой димеры (дуплексы) (или количество образуемых димеров, по меньшей мере, не препятствовало проведению реакции ПЦР). В частных случаях осуществления изобретения при определении активности теломеразы в биологических образцах позвоночных животных или человека при проведении ПЦР №2 может быть использована пара праймеров

один из которых представляет собой праймер вида:

5’ –Х1Х2Х3Х4Х5Х6Х7Х8 (TTTGGG)nY1Y2Y3Y4Y5Y6Y7Y8, – 3’,

а другой – праймер вида:

5’ – Х’1Х’2Х’3Х’4Х’5Х’6Х’7Х’8(CCCTTA)mY’1Y’2Y’3Y’4Y’5Y’6Y’7Y’8 – 3’

или 5’ – Х’1Х’2Х’3Х’4Х’5Х’6Х’7Х’8(CCCTAT)mY’1Y’2Y’3Y’4Y’5Y’6Y’7Y’8, – 3’,

где каждый из Х1 – Х8, Y1 – Y6, Х’1 – Х’8, Y’1 – Y’6 независимо выбраны из А,С,T,G или отсутствуют (=0), Y7Y8 независимо выбраны из AG, GT, GG, ТA или TТ, Y'7Y’8 независимо выбраны из AA, СС, ТС, СА, СТ или АТ, а n, m – независимо выбраны из целых чисел от 1 до 8, при этом длина праймера независимо составляет не менее 18, но не более 55 нуклеотидов. В предпочтительных вариантах различие в длине праймеров не должно составлять более 20%.

В некоторых частных, но не ограничивающих, вариантах изобретения в качестве праймеров при проведении ПЦР №2 могут быть использованы пары праймеров, имеющие следующие последовательности:

5’–ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT–3’ (SEQ ID NO:8, известный как TelG-праймер) и

5’–TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA–3' (SEQ ID NO:9, известный как TelC-праймер) или

5’–CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT–3’ (SEQ ID NO:10, известный как Tel1-праймер) и

5’–GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT–3’ (SEQ ID NO:11, известный как Tel2-праймер) или

5’–CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT–3’ (SEQ ID NO:10, известный как Tel1-праймер) и

5’–GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT–3’ (SEQ ID NO:12, известный как Tel2b-праймер)

или праймеры, гомологичные им, по меньшей мере на 80%, более предпочтительно, - по меньшей мере на 90%, еще более предпочтительно - по меньшей мере на 95%.

В предпочтительных вариантах воплощения изобретения ПЦР №2 проводится в режиме реального времени (qRT-PCR), включая в себя одновременно детекцию и количественное определение суммарного содержания всех теломерных повторов ((TTAGGG)n для позвоночных, в том числе для человека), что обеспечивается за счет измерения количества амплифицированной ДНК в реальном времени после каждого цикла амплификации. Для обеспечения такого количественного определения согласно изобретению может быть использован любой из известных методов, например, использование флуоресцентных красителей (например, SYBR Green), интеркалирующих в двуцепочечные молекулы ДНК, или использование модифицированных олигонуклеотидов (ДНК-зондов), которые флуоресцируют после гибридизации с комплементарными участками ДНК.

В качестве ферментов при проведении ПЦР №1 и ПЦР №2 может быть использован любой термостабильный фермент ДНК-полимераза, известный для специалистов в данной области техники, в том числе, но не ограничиваясь, Taq ДНК-полимераза, Pfu ДНК-полимераза, Tth ДНК-полимераза. Реакционная смесь для проведения ПЦР также обычно включает магниевую соль (например, MgCl2), с целью обеспечения оптимальных условий для ПЦР-амплификации.

В описании данного изобретения термины «включает» и «включающий» интерпретируются как означающие «включает, помимо всего прочего». Указанные термины не предназначены для того, чтобы их истолковывали как «состоит только из».

Используемый здесь термин «процент гомологичности двух последовательностей» определяется числом положений идентичных нуклеотидов в этих двух последовательностях, при этом различия гомологичных последовательностей могут быть связаны с наличием делеции, инсерции по 3' и/или 5' - концу и/или нуклеотидных замен; т.е. имеется в виду структурная гомология при условии, однако, что гомологичная последовательность не утрачивает своей первоначальной функции.

Согласно изобретению, «биологический образец» включает в себя ткани, клетки и биологические жидкости, выделенные от субъекта, а также ткани, клетки и биологические жидкости, присутствующие в субъекте. Биологический образец также включает в себя первичные клетки, трансформированные клетки и любые другие культивируемые клетки. Предпочтительно, биологический образец представляет собой клеточный или тканевый экстракт, в частности экстракт из клеток или тканей человека. Экстракт может быть получен повторным оттаиванием / замораживанием клеток, гомогенизацией клеток или тканей, или лизированием клеток или тканей в буфере для лизиса, содержащем неионный и/или цвиттерионный детергент. Примеры неионного детергента включают, но не ограничиваются ими, Tween 20, Triton X-100, Triton X-114, полидоканол (Thesit), NP-40, n-октилглюкозид, n-додецилглюкозид, n-додецил-бета-D-мальтозид, октаноил-N-метилглюкамид (MEGA-8), деканоил-N-метилглюкамид (MEGA-10) и изотридецил-поли (этиленгликолевый эфир)n. Примеры цвиттерионных детергентов включают, но не ограничиваются ими, CHAPS (3-[(3-холамидопропил) диметиламмоний]-1-пропансульфонат), CHAPSO (3-[(3-холамидопропил)диметил-аммоний]-2-гидрокси-1-пропансульфонат), N-додецил-N,N-диметил-3-аммоний-1-пропансульфонат и дигитонин. Поскольку теломераза содержит как РНК, так и белковые компоненты, к экстракту могут быть добавлены ингибиторы протеазы и/или РНКазы, чтобы предотвратить разрушение теломеразы в экстракте другими клеточными протеазами. Примеры ингибиторов протеазы включают, но не ограничиваются ими, амастин, 4-амидинофенилметансульфонилфторид (AMPSF), антипаин, апротинин, бестатин, химостатин, цистатин, 3,4-дихлоризозумарин, эбелактон А и В, эластатин, этилендиаминтетрауксусную кислоту (ЭДТА), этиленгликольтетрауксусную кислоту (ЭГТА), леупептин, пепстатин A, фенилметилсульфонилфторид (PMSF), фосфорамидон, тозилсилсилокметилкетон (TLCK), тозилфенилаланилхлорметилкетон (TPCK) и ингибиторы трипсина. Примеры ингибиторов РНКазы включают, но не ограничиваются ими, ингибиторы РНКазы поджелудочного типа, ингибиторы РНКазы плаценты человека и диэтилпирокарбонат (DEPC).

Дезоксинуклеозидтрифосфаты (дНТФ) в реакционной смеси включают, но не ограничиваются ими, дезоксиаденозинтрифосфат (дАТФ), дезоксигуанозинтрифосфат (дГТФ), дезоксиуридинтрифосфат (дУТФ), дезокситимидинтрифосфат (дТТФ) и дезоксицитидинтрифосфат (дЦТФ). В некоторых вариантах осуществления реакционная смесь содержит дАТФ, дГТФ, дЦТФ и один из дУТФ и дТТФ в равном молярном отношении. В ряде вариантов изобретения могут быть использованы меченые производные дезоксинуклеозидтрифосфатов, например, биотинилированные нуклеотиды или флуоресцентномеченые нуклеотиды, содержащие химические модификации.

В дополнение к специфическим, перечисленным выше компонентам, реакционные смеси, применяемые на каждом из этапов анализа, могут также содержать буферную систему для поддержания оптимального рН для реакции удлинения праймера для теломеразы. Примеры буферных систем включают, но не ограничиваются ими, фосфатную буферную систему, цитратную буферную систему, боратную буферную систему, трис- (гидроксиметил) аминометан, 3-[(3-холамидопропил) диметиламмониол]-1-пропансульфонат (CHAPS), N-[2-гидроксиэтил] пиперазин-N'-2-[этансульфановую кислоту] (HEPES) и 3- [N-морфолино] пропансульфоновую кислоту (MOPS).

Условия, подходящие для теломеразы для получения продукта удлинения из теломеримитирующего олигонуклеотида, хорошо известны в данной области. Обычно реакцию удлинения теломер проводят при температуре около 20-30 °С в течение примерно 10-60 мин, предпочтительно при температуре около 25 °С или около 30 °С в течение примерно 15-30 мин. и наиболее предпочтительно примерно при 25 °С в течение примерно 20 мин.

Для визуализации продуктов реакции в настоящем изобретении могут быть использованы флуоресцентные красители, например, SYBR Green I или SYBR Gold, флуоресцентно-меченые праймеры, люминесцентно-меченые праймеры, праймеры, меченые радиоактивными изотопами, биотинилированные праймеры.

Все компоненты набора входят в набор и используются в количествах, необходимых для проведения анализа согласно изобретению.

Если не определено отдельно, технические и научные термины в данной заявке имеют стандартные значения, общепринятые в научной и технической литературе.

Возможность объективного проявления технического результата при использовании изобретения подтверждена достоверными данными, приведенными в примерах, содержащих сведения экспериментального характера, полученными в процессе проведения исследований по методикам, принятым в данной области. Сущность изобретения поясняется рисунками.

Подробное раскрытие изобретения

Предлагаемый метод основан на модификации классического метода определения активности теломеразы методом TRAP. Ключевой особенностью предлагаемого подхода является наличие второй последовательной реакции ПЦР в реальном времени (ПЦР №2) с другой парой праймеров. На второй стадии ПЦР измеряется суммарное содержание теломерных повторов, новосинтезированных в результате проведения первого этапа ПЦР (ПЦР №1) с праймерами, один из которых представляет собой теломеримитирующий олигонуклеотид, а другой - праймер, комплементарный теломерным повторам в геноме исследуемого биологического объекта (в частных примерах осуществления изобретения это, например, праймеры TS и CX) в исследуемом образце, то есть, по сути, проводится количественный анализ суммарного содержания всех теломерных повторов (TTAGGG)n для позвоночных и в том числе для человека. Этот шаг позволяет добиться значительного увеличения чувствительности и специфичности метода. Так, на примере клеточной линии K562 (хронический промиелолейкоз человека) предлагаемый метод позволяет достичь следующих значений пороговых циклов (Ct): лизат из 10 клеток – 12 циклов, из 100 клеток – 4 цикла. При стандартных методах анализа пороговый цикл (Ct) в предлагаемой тест-системе соответствует 4-му циклу при максимальных уровнях теломеразной активности. При минимальных уровнях теломеразной активности Ct соответствует 18-му циклу. Для количественной оценки активности теломеразы в образце может быть использована методика калибровочных кривых с использованием в качестве положительного контроля экстракта опухолевой клеточной линии (с известным содержанием количества молекул теломеразы на клетку) или двунитевой синтетической матрицы ds(GGGTTA/CCCAAT)n.

Таким образом, по чувствительности предлагаемый подход существенно превосходит существующие методы определения теломеразной активности с помощью ПЦР в реальном времени (RT-TRAP-PCR).

Как известно, большое число циклов ПЦР в течение одной стадии приводит к существенному изменению зависимости между скоростью синтеза ампликона и временем реакции, а также к возможности синтеза неспецифических продуктов. Достигаемое значительное снижение числа циклов ПЦР позволяет избежать этих проблем, что в конечном итоге положительно влияет на чувствительность и специфичность метода.

При условии учета нуклеотидной последовательности теломерного повтора (что будет определять структуры используемых праймеров), предлагаемый метод может быть применен для анализа активности теломеразы в биологическом образце любого эукариотического организма, начиная от одноклеточных (например, простейших, дрожжей), беспозвоночных, заканчивая высшими растениями и позвоночными, в частности млекопитающими и человеком, как при проведении научных исследований, так и в практических областях. Так, например, данный метод может быть использован в области онкологии и ветеринарии для диагностики злокачественных новообразований у позвоночных животных и человека. Кроме того, определение активности теломеразы предлагаемым методом может быть использовано в области вспомогательных репродуктивных технологий, как в репродуктивной медицине, так и в сельском хозяйстве, для определения качества сперматозоидов, ооцитов и яйцеклеток позвоночных животных и человека. Определение активности теломеразы может быть проведено в фолликулярных клетках (клетки кумулюса и клетки гранулезы) для прогнозирования исходов программ вспомогательных репродуктивных технологий, а также для диагностики ряда заболеваний репродуктивной системы, например, синдрома недостаточности яичников. Кроме того, данный метод может быть использован для исследования воздействия лекарственных препаратов, влияющих на механизмы старения через стабилизацию/дестабилизацию длины теломер.

Нижеследующие примеры приведены в целях иллюстрирования способа согласно настоящему изобретению и их не следует рассматривать как каким-либо образом ограничивающие объем изобретения.

Пример 1

В одном из возможных вариантов изобретения предлагаемый способ может быть осуществлен следующим образом.

Биологический образец промывают в стерильном растворе PBS (натрий-фосфатный буфер), или физ.растворе и далее сразу замораживают. Образцы можно хранить при -70ºС.

Перед приготовлением лизатов образцы размораживают на льду. Далее к ним добавляют холодный лизирующий CHAPS-буфер, содержащий 10 мМ Трис-HCl (рН 7,5), 1 мМ MgCl2, 1 мМ EGTA, 0,1 мМ PMSF, 5 мМ β-меркаптоэтанола, 0,5% (в/о) CHAPS и 10% (в/о) глицерина. CHAPS-буфер добавляют из расчета 1 мкл на 1000 клеток. Затем образец ресуспендируют в буфере и инкубируют на льду в течение 30 мин. В процессе инкубации образец интенсивно перемешивают через каждые 5 мин. на аппарате Vortex в течение нескольких секунд. Полученный клеточный экстракт центрифугируют при 12000 g в течение 30 мин. при +4ºС. Супернатант, не касаясь осадка, аккуратно переносят по 25 мкл в чистые микропробирки и быстро замораживают в жидком азоте. Готовые экстракты можно хранить при -70ºС. Концентрацию белка в экстрактах клеток и тканей определяют с помощью красителя Coomassie Brilliant Blue G-250 по методу Брэдфорда.

Элонгацию олигонуклеотидного субстрата и последующую амплификацию проводят в 50 мкл реакционной смеси, содержащей 67 мМ Трис-HCl (рН 8,8); 16,6 мМ (NH4)2SO4; 0,01% Tween-20; 1,5 мМ MgCl2; 1 мМ EGTA; по 50 мМ каждого из dNTP; 0,1 мкг TS-праймера. В качестве положительного контроля используют 1 мкл клеточного экстракта опухолевой клеточной линии К562 (хронический промиелоидный лейкоз), разбавленного лизирующим буфером CHAPS и эквивалентного 100 клеткам опухолевой линии, с концентрацией белка 0,04 мкг/мкл. Для анализа чувствительности метода экстракт, содержащий 100 клеток в 1 мкл, разводят лизирующим буфером CHAPS до конечных значений 10, 40, 80 клеток на 1 мкл. В качестве отрицательного контроля вместо экстракта используют 1 мкл буфера CHAPS. Опосредованное теломеразой удлинение TS праймера происходит при инкубации реакционной смеси при +37ºС в течение 25 мин. По окончании инкубации смесь выдерживают 5 мин. при +94 ºС для инактивации теломеразы.

Затем в каждую пробу добавляют по 0,1 мкг СХ-праймера и 2,5 ед. SmarTaq ДНК-полимеразы.

TRAP-PCR-реакция №1 (ПЦР №1). Реакционную смесь амплифицируют в течение 35 циклов ПЦР в следующем режиме: +94ºС – 60 сек, +50ºС – 60 сек, +72ºС – 90 сек.

TRAP-PCR-реакция №2 (ПЦР №2). Далее готовится инкубационная смесь объемом 25 мкл, содержащая 67 мМ Трис-HCl (рН 8,8); 16,6 мМ (NH4)2SO4; 0,01% Tween-20; 1,5 мМ MgCl2; по 50 мМ каждого из dNTP; по 0,9 мкМ TelG-праймера и TelC-праймера, а также 0,75 x SYBR Green I (краситель), 1 x ROX (референсный краситель), 1M бетаина, 1,25 ед. SmarTaq ДНК-полимеразы. В подготовленную смесь добавляют 1 мкл реакционной смеси после ПЦР реакции №1 и проводят 22 цикла ПЦР в реальном времени в следующем режиме: +95ºС – 15 мин; 2 цикла в режиме: +94ºС – 15 сек, +49ºС – 15 сек; 20 циклов в режиме: +94ºС – 15 сек, +62ºС – 10 сек, +72ºС – 30 сек. со снятием сигнала.

Для отделения ложноотрицательных результатов от истинно отрицательных результатов и выявления ингибиторов активности теломеразы белковый экстракт подвергается ингибиторному анализу. Для этого при постановке TRAP-анализа к теломеразопозитивному экстракту опухолевой клеточной линии K562 (который является положительным контролем реакции), содержащему 0,04 мкг белка, вносят по 1 мкл исследуемого экстракта на обоих этапах реакции – перед этапом элонгации олигонуклеотидного субстрата теломеразой (проверка на наличие ингибиторов теломеразы и SmarTaq-полимеразы) и перед этапом амплификации полученных TRAP-продуктов (проверка на наличие ингибиторов только SmarTaq-полимеразы). Образцы экстрактов, в которых было установлено наличие ингибиторов активности теломеразы, повторно анализируют методом TRAP-RT-2PCR. Для этого исходный экстракт разводят CHAPS-буфером в 2, 4, 8 и 16 раз, и 1 мкл каждого разведения исследуют методом TRAP-RT-2PCR с целью выявления активности теломеразы.

Результаты проведенного таким образом анализа на примере лизатов клеточной линии К562, содержащих различное количество клеток и эквивалентных различному уровню теломеразной активности (АТ), приведены на рис. 1А. На рис. 1В приведены результаты анализа этих же образцов, проведенные с использованием классического метода TRAP с использованием электрофоретического разделения продуктов ПЦР и фотографированием геля.

Как следует из рисунка 1А, значение порогового цикла (Ct) для положительного контрольного образца, содержащего 100 клеток (все 100% клеток имеют активированную теломеразу) составляет всего 4 (Ct=4). При разведении образца значение порогового цикла увеличивается, достигая в образце с низкой теломеразной активностью (10% АТ от К+) значения Ct=12 (наблюдаемый выход флуоресценции в отрицательном контрольном образце (К-- - образец, не содержащий клеток, т.е. имеющий 0 % теломеразной активности) является результатом неспецифической амплификации дуплекса праймеров TS и CX). Анализ кривых накопления продуктов амплификации теломерных повторов показывает, что значение порогового цикла Ct для пяти исследуемых образцов коррелирует с уровнем активности теломеразы каждого образца. Как видно из рисунка, значение Ct для К+ (100% АТ) составило 4, для высокой АТ (80% АТ от К+) – 6, для средней АТ (40% АТ от К+) – 11, для низкой АТ (10% АТ от К+) – 12 и для К- (0% АТ) – 19.

В то же время, как следует из рис.1В, при анализе активности теломеразы лизатов клеточной линии К562 классическим методом TRAP в образце с низкой теломеразной активностью (10% АТ от К+, дорожка 4), классические TRAP-продукты практически не наблюдались, что свидетельствует о недостаточной чувствительности этого метода анализа активности теломеразы.

Таким образом, предлагаемая модификация метода TRAP позволяет повысить чувствительность метода анализа активности теломеразы и дает возможность подойти к количественному анализу теломеразной активности.

На рис.1C приведена линейная регрессия между количеством клеток в лизате клеточной линии K562 и значением порогового цикла (Ct) при анализе теломеразной активности методом RT-TRAP-2PCR.

Представленные данные демонстрируют высокую чувствительность метода (величина порогового цикла составляет всего лишь от 4-х до 12 (при 10% АТ)), подтверждающую возможность эффективно проводить анализ в образцах с низким содержанием теломеразопозитивных клеток, а также в присутствии ингибиторов теломеразы, избегая при этом появления ложноотрицательных результатов.

Пример 2

В данном примере проводилась оценка активности теломеразы в клеточном осадке мочи и биопсийном образце ткани мочевого пузыря.

Все процедуры центрифугирования при получении клеточного осадка мочи проводили при комнатной температуре. Для промывки клеточных осадков применяли охлаждённый до +4ºС стерильный однократный раствор PBS (0,145 M NaCl, 0,76 M NaH2PO4, 2.24 M Na2HPO4). Для получения клеточных осадков предпочтительно использовали вторую утреннюю порцию мочи пациента. Каждую пробу в течение 30 мин. охлаждали при температуре +4оС. Далее 100 мл каждой пробы равномерно распределяли по культуральным пробиркам объемом 15 мл и центрифугировали при 2500 об/мин в течение 10 минут. Супернатант отбрасывали и осадки в каждой пробирке ресуспендировали в 1 мл однократного раствора PBS. Далее содержимое всех пробирок равномерно распределяли по двум культуральным пробиркам объемом 15 мл и центрифугировали в течение 10 мин. при 2500 об/мин, после чего повторяли процедуру промывки осадков в 1 мл однократного раствора PBS. После этого осадок в каждой пробирке ресуспендировали в 1 мл раствора PBS и переносили в две микропробирки на 1,5 мл, затем центрифугировали на микроцентрифуге 10 мин. при 2500 об/мин. Супернатант отбрасывали, а остаток капель жидкости в пробирке с осадком аккуратно удаляли полоской фильтровальной бумаги. Далее осадок клеток замораживали в жидком азоте и хранили при -70ºС.

Перед приготовлением лизатов образцы клеточных осадков размораживают на льду. Далее к ним добавляют холодный лизирующий CHAPS-буфер, содержащий 10 мМ Трис-HCl (рН 7,5), 1 мМ MgCl2, 1 мМ EGTA, 0,1 мМ PMSF, 5 мМ β-меркаптоэтанола, 0,5% (в/о) CHAPS и 10% (в/о) глицерина. CHAPS-буфер добавляли из расчета 1 мкл на 1000 клеток осадка. Затем клеточный осадок интенсивно ресуспендируют в буфере и инкубируют на льду в течение 30 мин. В процессе инкубации осадок интенсивно перемешивают через каждые 5 мин. на аппарате Vortex в течение нескольких секунд. Полученный клеточный экстракт центрифугируют при 12000 g в течение 30 мин при +4ºС. Супернатант, не касаясь осадка, аккуратно переносят по 25 мкл в чистые микропробирки и быстро замораживают в жидком азоте. Готовые экстракты можно хранить при -70ºС.

При использовании образцов тканей (операционный материал) непосредственно перед стадией лизирования проводят гомогенизацию образца. Для этого около 30 мг размороженного образца помещают в стеклянный мини-гомогенизатор и проводят первую гомогенизацию на льду в течение 1 мин в 300 мкл лизирующего CHAPS-буфера. CHAPS-буфер добавляют из расчета 10 мкл на 1 мг ткани. Затем каждые 5 мин. проводят ещё 6 стадий гомогенизации, не более одной минуты каждая. Далее, как и при обработке клеток, гомогенат центрифугируют, аккуратно отбирают супернатант, разделяют его на аликвоты по 20-50 мкл, которые замораживают и хранят при -70ºС.

Исследование теломеразной активности проводилось по методике, описанной в примере 1.

Результаты анализа приведены на рисунке 2.

Как видно из рис. 2А, во всех пробах, содержащих различное количество белка из экстракта образца ткани рака мочевого пузыря, стадия T1N0M0G1 (дорожки 5-8, «биопсийный образец МП») наблюдались характерные дискретные полосы TRAP-продуктов, что свидетельствует о наличии активности теломеразы в образцах. При этом активность теломеразы в экстрактах из клеточного осадка мочи этого пациента (дорожки 1-4) детектировалась только в двух пробах (дорожки 1 и 2), а в двух остальных пробах (дорожки 3 и 4) классические TRAP-продукты практически не наблюдались и не отличались от отрицательного контрольного образца. При анализе активности теломеразы в этих экстрактах методом RT-TRAP-2PCR (рис. 2В) видно, что как в случае анализа ткани (кривые 5-8), так и в случае анализа клеточного осадка мочи (кривые1-4) пациента с раком мочевого пузыря, кривые, характеризующие активность теломеразы, достоверно отличались от отрицательного контрольного образца. Эти результаты свидетельствуют в пользу более высокой чувствительности определения активности теломеразы методом RT-TRAP-2PCR по сравнению с неизотопным методом TRAP.

Пример 3

Согласно методике, описанной в примере 1, было проведено исследование теломеразной активности в клиническом материале, полученном от пациентов с диагнозом рак поджелудочной железы. На рис. 3 представлены результаты анализа теломеразной активности методом RT-TRAP-2PCR в биологическом материале 5-ти пациентов с диагнозом рак поджелудочной железы. Как видно из рисунка, в клинических образцах трех пациентов (кривые № 1, 2, 3) наблюдалась высокая теломеразная активность, еще двоих пациентов (кривые № 4, 5) – средняя теломеразная активность. При этом кривые, характеризующие активность теломеразы, достоверно отличаются от отрицательного контрольного образца.

Пример 4

Согласно методике, описанной в примере 1, было проведено исследование теломеразной активности в постоперационном клиническом материале желудка, полученном от пациентов с диагнозами умеренно дифференцированная аденокарцинома желудка (клинический образец №1), низко дифференцированная и умеренно дифференцированная аденокарцинома желудка (клинический образец №2) и лимфома желудка (клинический образец №3). Данные по измерению теломеразной активности методом RT-TRAP-2PCR представлены на рис. 4 (номера кривых соответствуют номерам образцов пациентов). Как видно из рисунка, в образце №1 наблюдалась высокая теломеразная активность, в образце №2 – средняя теломеразная активность и в образце №3 – низкая теломеразная активность, при этом все кривые, характеризующие активность теломеразы, достоверно отличаются от отрицательного контрольного образца, что свидетельствует о высокой чувствительности метода.

Пример 5

Сравнение чувствительности метода RT-TRAP-2PCR со стандартным методом TRAP и методом определения активности теломеразы с помощью магнито-силовой микроскопии на синтетической ds(GGGTTA/CCCAAT)n матрице

Для оценки чувствительности метода по изобретению было проведено исследование по сравнительному анализу чувствительности метода RT-TRAP-2PCR, RT-TRAP и метода TRAP, основанного на магнито-силовой микроскопии, на синтетической двунитевой (double-stranded) матрице ds(GGGTTA/CCCAAT)n (n – количесто повторов). Как видно из рис. 5, чувствительность метода определения активности теломеразы с помощью магнитно-силовой микроскопии (TRAP, основанного на магнитно-силовой микроскопии) и стандартного метода RT-TRAP – real-time TRAP (с использованием набора для определения активности теломеразы фирмы Roche), проведенная с использованием в качестве матрицы синтезированного 54-нуклеотидного теломерного повтора, составила 30 амоль ds(GGGTTA/CCCAAT)9, показав хорошую корреляцию в чувствительности двух методов (r2=0,99), в то время как чувствительность предлагаемого метода RT-TRAP-2PCR составляет 10 амоль для аналогичной матрицы ds(GGGTTA/CCCAAT)9 (рис. 6), что свидетельствует о значительно большей чувствительности предлагаемого по изобретению метода анализа активности теломеразы.

Несмотря на то, что изобретение описано со ссылкой на раскрываемые варианты воплощения, для специалистов в данной области должно быть очевидно, что конкретные подробно описанные эксперименты приведены лишь в целях иллюстрирования настоящего изобретения, и их не следует рассматривать как каким-либо образом ограничивающие объем изобретения. Должно быть понятно, что возможно осуществление различных модификаций без отступления от сути настоящего изобретения.

1. Способ выявления и количественного определения активности теломеразы в биологическом образце эукариотического организма, включающий следующие этапы:

(1) инкубацию указанного биологического образца в среде, включающей по меньшей мере один теломеримитирующий олигонуклеотид, имеющий последовательность SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 или SEQ ID NO:4, и дезоксинуклеозидтрифосфаты (дНТФ) и их меченые флуоресцентным красителем производные, в условиях, подходящих для продуцирования теломеразой продуктов элонгации с теломеримитирующего олигонуклеотида;

(2) выдерживание реакционной смеси, полученной на этапе (1), при температуре и в условиях, подходящих для инактивации теломеразы;

(3) проведение полимеразной цепной реакции не более 35 циклов в реакционной смеси, полученной на этапе (2), с добавлением по меньшей мере одного праймера, комплементарного теломерным повторам в геноме исследуемого биологического объекта и имеющего последовательность вида:

5' -V (CCCTTA)kW-3' или 5'-V (СТААСС)kW-3',

где V - цепочка из 0-20 нуклеотидных остатков, независимо выбранных из A, C, T, G,

W выбран из С, СС, ССС, СССТ, СССТА, СССТАА,

k - целое число от 1 до 3;

и в условиях, подходящих для амплификации продуктов элонгации, полученных на этапе (1);

(4) проведение полимеразной цепной реакции не более 25 циклов в режиме реального времени в реакционной смеси, полученной на этапе (3), с добавлением по меньшей мере одной пары праймеров, один из которых способен комплементарно взаимодействовать с целью теломерных повторов, а другой - с комплементарной ей цепью, а именно

один из которых представляет собой праймер вида:

5'-Х1Х2Х3Х4Х5Х6Х7Х8 (TTTGGG)nY1Y2Y3Y4Y5Y6Y7Y8-3',

а другой - праймер вида:

5'-Х'1X'2Х'3Х'4X'5Х'6Х'7Х'8(СССТТА)mY'1Y'2Y'3Y'4Y'5Y'6Y'7Y'8-3'

или

5' -X'1X'2X'3X'4X'5X'6X'7X'8 (CCCTAT)mY'1Y'2Y'3Y'4Y'5Y'6Y'7Y'8-3',

где

каждый из X18, Y1-Y6, X'1-Х'8, Y'1-Y'6 независимо выбраны из

A, C, T, G или отсутствуют (=0),

Y7Y8 независимо выбраны из AG, GT, GG, ТА или ТТ,

Y'7Y'8 независимо выбраны из АА, СС, ТС, СА, СТ или AT,

a n, m - независимо выбраны из целых чисел от 1 до 8,

при этом длина праймера независимо составляет не менее 18, но не более 55 нуклеотидов;

и в условиях, подходящих для амплификации продукта, полученного на этапе (3);

(5) Выявление и количественное определение активности теломеразы в анализируемом образце путем измерения количества амплифицированной ДНК в реальном времени после каждого цикла амплификации на этапе (4), посредством детекции флуоресценции флуоресцентных красителей.

2. Способ по п. 1, в котором биологический образец представляет собой биологический образец позвоночного животного или человека.

3. Способ по п. 1, в котором на этапе (3) используют праймер, имеющий последовательность SEQ ID NO:5, SEQ ID NO:6 или SEQ ID NO:7.

4. Способ по п. 1, в котором на этапе (4) используют следующие пары праймеров:

TelG-праймер, имеющий последовательность SEQ ID NO:8 и TelC-праймер, имеющий последовательность SEQ ID NO:9; или

Tel1-праймер, имеющий последовательность SEQ ID NO:10, и Tel2-праймер, имеющий последовательность SEQ ID NO:11; или

Tel1-праймер, имеющий последовательность SEQ ID NO:10 и Tel2b-праймер, имеющий последовательность SEQ ID NO:12.

5. Способ по любому из пп. 1-4, включающий предварительную подготовку биологического образца.

6. Способ по любому из пп. 1-4, в котором праймер на любом из этапов независимо представляет собой флуоресцентно-меченый праймер, люминесцентно-меченый праймер, праймер, меченый радиоактивным изотопом, или биотинилированный праймер.

7. Способ по любому из пп. 1-4, в котором меченые производные дезоксинуклеозидтрифосфатов представляют собой биотинилированные нуклеотиды или флуоресцентномеченые нуклеотиды, содержащие химические модификации.

8. Применение способа по любому из пп. 1-7 для выявления и количественного определения активности теломеразы в биологическом образце

- для диагностики онкологических заболеваний у человека или позвоночных животных, или

- в области вспомогательных репродуктивных технологий для оценки качества яйцеклеток, ооцитов и/или сперматозоидов позвоночных животных или человека, или

- для исследования действия препаратов, препятствующих старению и стабилизирующих длину теломер у позвоночных животных или человека.

9. Применение по п. 8, в котором биологическим образцом является ткань или жидкость, выделенная из живого организма.

10. Применение по п. 8, в котором биологический образец содержит не более 10 клеток.

11. Набор для выявления и количественного определения активности теломеразы способом по п. 1, включающий, по меньшей мере,

теломеримитирующий олигонуклеотид, имеющий последовательность SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, или SEQ ID NO:4,

дезоксинуклеозидтрифосфаты дАТФ, дГТФ, дЦТФ, дТТФ и их меченые флуоресцентным красителем производные;

праймер, комплементарный теломерным повторам в геноме исследуемого биологического объекта и имеющий последовательность вида:

5'-V(CCCTTA)kW-3' или 5'-V(СТААСС)kW-3',

где V - цепочка из 0-20 нуклеотидных остатков, независимо выбранных из A, C, T, G,

W выбран из С, СС, ССС, СССТ, СССТА, СССТАА,

k - целое число от 1 до 3; а также

пару праймеров, один из которых способен комплементарно взаимодействовать с цепью теломерных повторов, а другой - с комплементарной ей цепью, а именно

один из которых представляет собой праймер вида:

5'-Х1Х2Х3Х4Х5Х6Х7Х8 (TTTGGG)nY1Y2Y3Y4Y5Y6Y7Y8-3',

а другой - праймер вида:

5'-Х'1X'2Х'3Х'4Х'5Х'6Х'7Х'8(СССТТА)mY'1Y'2Y'3Y'4Y'5Y'6Y'7Y'8-3'

или

5'-X'1X'2X'3Х'4X'5X'6X'7X'8(CCCTAT)mY'1Y'2Y'3Y' 4Y' 5Y' 6Y' 7Y' 8-3',

где

каждый из X1-X8, Y1-Y6, X'1-X'8, Y'1-Y'6 независимо выбраны из

A, C, T, G или отсутствуют (=0),

Y7Y8 независимо выбраны из AG, GT, GG, ТА или ТТ,

Y'7Y'8 независимо выбраны из АА, СС, ТС, СА, СТ или AT,

a n, m - независимо выбраны из целых чисел от 1 до 8,

при этом длина праймера независимо составляет не менее 18, но не более 55 нуклеотидов;

в количествах, достаточных для проведения анализа активности теломеразы.

12. Набор по п. 11, включающий экстракт опухолевой клеточной линии или синтетическую матрицу ds (GGGTTA/CCCAAT) n в качестве положительного контроля, где n - количесто повторов, выбранное из целых чисел от 4 до 16.

13. Набор по п. 11, в котором праймер, комплементарный теломерным повторам в геноме исследуемого биологического объекта, имеет последовательность SEQ ID NO:5, SEQ ID NO:6 или SEQ ID NO:7.

14. Набор по п. 11, в который в качестве пары праймеров, один из которых способен комплементарно взаимодействовать с цепью теломерных позторов, а другой - с комплементарной ей цепью, входят

TelG-праймер, имеющий последовательность SEQ ID NO:8 и TelC-праймер, имеющий последовательность SEQ ID NO:9; или

Tel1-праймер, имеющий последовательность SEQ ID NO:10, и Tel2-праймер, имеющий последовательность SEQ ID NO:12; или

Tel1-праймер, имеющий последовательность SEQ ID NO: 10 и Tel2b-праймер, имеющий последовательность SEQ ID NO:12.

15. Набор по любому из пп. 11-14, в котором по меньшей мере один из праймеров представляет собой флуоресцентно-меченый праймер, люминесцентно-меченый праймер, праймер, меченый радиоактивным изотопом или биотинилированный праймер.

16. Набор по любому из пп. 11-14, в котором меченые производные дезоксинуклеоэидтрифосфатов представляют собой биотинилированные нуклеотиды или флуоресцентномеченые нуклеотиды, содержащие химические модификации.



 

Похожие патенты:

Изобретение относится к биотехнологии. Разработана кассета генов, несущая гены вируса гриппа субтипов А(Н1N1) и A(H3N2) и типа В - НА, M1 и NA, кодирующие белки вируса гриппа, предназначенная для последующего получения плазмидного вектора для трансдукции клеток млекопитающих, которые в дальнейшем использовались для создания клеток-продуцентов вирусоподобных частиц (ВПЧ) вируса гриппа.

Настоящее изобретение относится к области биотехнологии, конкретно к полинуклеотидам, которые кодируют CDR3 в генах TCR-[альфа] и TCR-[бета] цепей CD4+ хелперных Т-клеток, которые специфичны к хелперному пептиду WT1322, и может быть использовано в медицине для индукции иммунного ответа против WT1322-экспрессирующей злокачественной опухоли.

Настоящее изобретение относится к области биотехнологии, конкретно к полинуклеотидам, которые кодируют CDR3 в генах TCR-[альфа] и TCR-[бета] цепей CD4+ хелперных Т-клеток, которые специфичны к хелперному пептиду WT1322, и может быть использовано в медицине для индукции иммунного ответа против WT1322-экспрессирующей злокачественной опухоли.

Изобретение относится к биотехнологии. Разработаны лентивирусные векторы, несущие кассету генов белков вируса гриппа субтипов A(H1N1) и A(H3N2) и типа В, кодирующих последовательности белков вируса гриппа для трансдукции клеток млекопитающих.

Изобретение относится к биотехнологии. Заявлен способ определения вероятности того, что пациент имеет волчанку в доклинической стадии.

Изобретение относится к биотехнологии и представляет собой набор синтетических олигонуклеотидов для выявления маркерных участков генов бактерий и архей из микробиоты кишечника человека.

Изобретение относится к ветеринарной микробиологии, в частности к лабораторной диагностике возбудителей инфекционных заболеваний, а именно к средствам диагностики инфекции у животных.

Изобретение относится к области биологии и медицины и предназначено для экспресс-выделения ДНК из размороженной крови. Проводят забор 2 мл цельной венозной крови в пробирки, содержащие ЭДТА-К3.

Изобретение относится к биотехнологии. Предложены олигонуклеотидные ДНК-праймеры для выявления и филогенетического анализа провирусной ДНК вируса лейкоза кошек, а также для синтеза фрагмента гена поверхностного гликопротеина gp70, содержащего протективные антигенные эпитопы, отличающиеся тем, что две пары олигонуклеотидных ДНК-праймеров имеют следующие последовательности: внешние (1 fwd: 5'TCCAACGCACCCAAAACCCT3'; 1 rev: 5'GCTTTAGTCCCTGTTCCGAC3'), внутренние (2 fwd: 5'TCCTGCCTATCTACTCCGCA3'; 2 rev: 5'ATGCATGGGGTGAGTCCAGT3').

Изобретение относится к области медицины, а именно к офтальмологии, и предназначено для прогнозирования тяжелой степени сухого керататоконъюнктивита (СКК) при синдроме Шегрена, ассоциированном с ревматоидным артритом.

Настоящее изобретение относится к области биотехнологии, конкретно к полинуклеотидам, которые кодируют CDR3 в генах TCR-[альфа] и TCR-[бета] цепей CD4+ хелперных Т-клеток, которые специфичны к хелперному пептиду WT1322, и может быть использовано в медицине для индукции иммунного ответа против WT1322-экспрессирующей злокачественной опухоли.

Изобретение относится к биотехнологии. Заявлен способ определения вероятности того, что пациент имеет волчанку в доклинической стадии.

Изобретение относится к области биологии и медицины и предназначено для экспресс-выделения ДНК из размороженной крови. Проводят забор 2 мл цельной венозной крови в пробирки, содержащие ЭДТА-К3.

Изобретение относится к биотехнологии. Предложены олигонуклеотидные ДНК-праймеры для выявления и филогенетического анализа провирусной ДНК вируса лейкоза кошек, а также для синтеза фрагмента гена поверхностного гликопротеина gp70, содержащего протективные антигенные эпитопы, отличающиеся тем, что две пары олигонуклеотидных ДНК-праймеров имеют следующие последовательности: внешние (1 fwd: 5'TCCAACGCACCCAAAACCCT3'; 1 rev: 5'GCTTTAGTCCCTGTTCCGAC3'), внутренние (2 fwd: 5'TCCTGCCTATCTACTCCGCA3'; 2 rev: 5'ATGCATGGGGTGAGTCCAGT3').

Изобретение относится к области медицины, а именно к офтальмологии, и предназначено для прогнозирования тяжелой степени сухого керататоконъюнктивита (СКК) при синдроме Шегрена, ассоциированном с ревматоидным артритом.
Изобретение относится к области медицины, а именно к диагностике и гинекологии, и предназначено для выявления риска развития сочетания генитального эндометриоза и гиперпластических процессов эндометрия у женщин русской национальности, уроженок Центрального Черноземья.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития ишемического инсульта. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из венозной крови и проводят анализ полиморфизмов генов цитокинов rs1061624 TNFR2 и rs767455 TNFR1.

Группа изобретений относится к области биотехнологии. Предложен способ и устройство определения нуклеотидной последовательности молекулы нуклеиновой кислоты.

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития гипертонической болезни. У индивидуумов русской национальности, являющихся жителями Центрального Черноземья, выделяют ДНК из периферической венозной крови и проводят анализ полиморфизмов генов цитокинов rs1800469 TGFβ-1 и rs833061 VEGFА.

Группа изобретений относится к области биотехнологии. Предложены способ извлечения нуклеиновых кислот из являющегося пластичным в живом организме полимера, способ обнаружения микроорганизма, прикрепленного или закрепленного в пластичном в живом организме полимере, способ идентификации резистентных к адгезии микроорганизма пластичных полимеров в живом организме, способ создания микробного профиля полости рта субъекта–млекопитающего и in vitro способ диагностики инфекции в полости рта млекопитающего или определения восприимчивости млекопитающего к развитию инфекции в полости рта.

Изобретение относится к биотехнологии, а именно к средствам диагностики вируса парагриппа 3 типа у животных. Предлагается тест-система для обнаружения генома возбудителя коронавирусной инфекции у животных с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени. Тест-система включает буфер для проведения полимеразной цепной реакции, праймеры и флуоресцентные зонды, специфичные для коронавируса А и для внутреннего контрольного образца, смесь ферментов из ДНК полимеразы с антителами, ингибирующими активность фермента, TAQ POLYMERASE и обратной транскриптазы MMLV REVERSE TRANSCRIPTASE, буфер для разведения РНК в виде деионизованной воды, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, для внутреннего контрольного образца - суспензию бактериофага MS2, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома вируса BPI 3 и фрагмент генома бактериофага. Изобретение служит для расширения функциональных возможностей и получения достоверной диагностики. 5 табл., 1 пр.

Изобретение относится к биохимии, биологии, медицине, онкологии, ветеринарии, и может быть использовано для определения активности теломеразы при диагностике злокачественных новообразований. Предложен способ выявления и количественного определения активности теломеразы в биологических образцах эукариотических организмов методом двойной амплификации теломерных повторов в реальном времени, основанном на измерении суммарного содержания теломерных повторов, новосинтезированных теломеразой в анализируемом образце. Изобретение позволяет обеспечить высокую чувствительность и специфичность метода, в том числе при проведении анализа в биологических образцах, характеризующихся низким содержанием теломеразопозитивных клеток и присутствием ингибиторов теломеразы. 3 н. и 13 з.п. ф-лы, 5 пр.

Наверх