Способ прогнозирования развития профессиональных гиперкератозов у работников производства стекловолокна

Изобретение относится к медицине, а именно к способу прогнозирования развития профессиональных гиперкератозов. Сущность способа состоит в том, что выделяют ДНК из лимфоцитов периферической венозной крови, проводят генотипирование полиморфизма rs1625895 гена ТР53 методом полимеразной цепной реакции с последующим рестрикционным анализом. При выявлении генотипа G/A и аллеля А прогнозируют риск развития профессиональных гиперкератозов. Использование изобретения дает возможность прогнозировать развитие профессиональных гиперкератозов при воздействии на организм вредных производственных факторов. 2 табл., 2 пр.


Изобретение относится к медицине, а именно к дерматологии, и может быть использовано для прогнозирования развития профессиональных гиперкератозов при воздействии на организм вредных производственных факторов.

Развитие всех областей промышленности, фармации и сельского хозяйства сопровождается все большим числом работников, контактирующих с неблагоприятными производственными факторами, вызывающими развитие профессиональных заболеваний кожи. Причиной возникновения большинства профессиональных дерматозов (более 90%) являются химические соединения и лишь немногим более 9% случаев приходится на долю физических и инфекционных факторов. Одну из групп в профдерматозах химической природы составляют ограниченные гиперкератозы. К профессиям с высоким риском развития профессиональных гиперкератозов относятся операторы получения непрерывного стекловолокна.

В условиях производства операторы подвергаются действию комплекса химических веществ, эффект которых усиливается микроклиматом и пылью стекловолокна. В связи с высокой долей ручного труда, кожные покровы работников имеют постоянный контакт с замасливателями и их компонентами. Замасливатели представляют собой многокомпонентную смесь сложных химических соединений, которые обладают аллергенным, раздражающим, общетоксическим действием и относятся к 2-3 классу опасности. Некоторые из них являются канцерогенами (формальдегид и эпихлоргидрин).

Развитию гиперкератоза предшествует хронический, развивающийся в период от нескольких месяцев до нескольких лет, трудно поддающийся излечению дерматит, возникающий на местах непосредственного контакта с производственными раздражителями. На коже пальцев кистей и предплечий работников появлялись начальные патологические изменения в виде гиперпигментации, которые обычно развивались через 2-3 года от начала работы с замасливателями. При дальнейшем производственном контакте с ними формировались очаги ограниченного гиперкератоза с бородавчатыми разрастаниями, не вызывающими субъективных ощущений. Но изменения на коже рук прогрессировали и приобретали более выраженный характер. При гистологическом исследовании ограниченных гиперкератозов изменения эпидермиса соответствовали псевдоэпителиоматозной гиперплазии.

Ежегодно у работников производства стекловолокна регистрируются 5-7 случаев гиперкератоза. Средний возраст работников на момент установления профессионального ограниченного гиперкератоза составил - 56,6 лет. Профессиональные заболевания кожи были выявлены у операторов наиболее часто при стаже работы 15-20 лет. Средние сроки появления ограниченного гиперкератоза после начала работы составляют 12,6 лет. У одного оператора начальные изменения на коже рук появились через 1 год от начала контакта с продуктами производства, у четверых - через 3-4 года.

Важную роль в патогенезе гиперкератоза, помимо средовых факторов, играет генетическая предрасположенность. Гиперкератоз характеризуется повышенным утолщением эпидермиса, к которому приводит усиленное деление рогового слоя в сочетании с нарушениями слущивания эпидермиса. Для поддержания тканевого гомеостаза необходимо равновесие между процессами деления клеток и их гибели. То есть для нормального развития и функционирования организма важна не только пролиферация, но и регуляция клеточной смерти. Одним из наиболее известных генов, инициирующих программируемую клеточную смерть, является ТР53, кодирующий белок р53. Активируясь в ответ на самые разные неблагоприятные воздействия, р53 индуцирует механизм, приводящий клетку к апоптозу.

Активность белка р53 в значительной степени модифицирована генетическим полиморфизмом. Одним из наиболее функционально значимых полиморфизмов гена ТР53 является - точечная замена гуанина на аденин в 6-м интроне (IVS6+62G>A, rs 1625895). Установлено, что данный полиморфизм может изменять экспрессию белка р53, тем самым приводить к снижению апоптического индекса и эффективности репарации ДНК [Barel D., Avigad S., Cohen I.J. et al. A novel germline р53 insertion/duplication mutation in intron 6 in a Li-Fraumeni Famaly // Cancer Res. - 1994. - V.54, №23. - P.1298-1304].

Известен способ прогнозирования риска развития профессиональных аллергических дерматозов, включающий забор венозной крови, выделение генетического материала, проведение полимеразной цепной реакции со специфическими праймерами, определение нуклеотидной последовательности и на основании этого определение полиморфного варианта A4889G цитохрома Р-450 1А1 [Лазарашвили Н.А. Роль системы «оксиданты-антиоксиданты» и генетического биохимического полиморфизма в патогенезе профессиональных аллергических дерматозов. Автореф. дис. канд. мед. наук. - Москва. - 2006].

В работе Хайрутдинова В.Р. (2005) изучалось распределение аллелей Arg/Pro полиморфизма гена р53 у больных псориазом [Хайрутдинов В.Р. Особенности распределения аллелей 72 кодона гена р53 у больных псориазом. Автореф. дис. канд. мед. наук. - Санкт-Петербург. - 2005]. Однако результаты исследования показали, что Arg/Pro полиморфизм гена р53 не оказывает влияния на формирование риска развития псориаза.

Известен способ прогнозирования трофических нарушений мягких тканей нижней конечности у больных сахарным диабетом, заключающийся в том, что проводят прицельное исследование участков критической функциональной нагрузки и компрессии опорных участков нижних конечностей путем термографического сканирования. Исследование проводят до и после ортостатической и/или маршевой нагрузки. Используют ортопедические приспособления и/или обувь. Определяют характер изменения термоактивности и время ее восстановления в данном участке до исходного уровня. По этим показателям оценивают состояние локальной микроциркуляции и прогнозируют характер трофических нарушений - в виде мацерации, гиперкератоза и изъязвлений или в виде некрозов [Патент RU №2128941, 1999 г.].

Известен способ прогнозирования развития профессиональных злокачественных новообразований кожи, включающий выделение ДНК, проведение анализа полиморфизма dup 16 bp d в 3 интроне и Arg72Pro полиморфизма 4 экзона гена ТР53. При выявлении сочетания генотипов *Arg/*Pro и *W/*dup16 прогнозируют риск развития злокачественных новообразований кожи [Патент RU №2454668, 2012 г.].

Но для развития кожного профессионального рака требуется длительное, измеряемое двумя-тремя десятками лет, раздражение кожи, и появлению рака предшествуют предраковые заболевания кожи (ксеродерма, кожный рог, гиперкератоз и др.). Термин «предраковые поражения кожи» впервые предложен W. Dubreulh еще в 1886 г. на III Международном конгрессе дерматологов в Лондоне. Он поставил вопрос о кератозах как предшественниках (предраках) злокачественных опухолей кожи.

Для ранней диагностики и прогнозирования течения профессионального гиперкератоза очень важно изучение генетических детерминант гиперкератоза как предракового заболевания. Это позволит разработать принципиально новые и эффективные подходы к профилактике развития данного профессионального заболевания.

В доступной научно-медицинской и патентной литературе сведений об известности способа прогнозирования риска раннего развития профессиональных гиперкератозов у работников производства стекловолокна не обнаружено.

Задачей настоящего изобретения является прогнозирование риска раннего развития профессиональных гиперкератозов у работающих во вредных и/или опасных условиях труда.

Техническим результатом изобретения является получение критериев прогноза развития профессиональных гиперкератозов у работников производства стекловолокна.

Указанный технический результат достигается тем, что из лимфоцитов периферической венозной крови выделяют ДНК, проводят генотипирование полиморфного локуса rs1625895 гена TP53 методом полимеразной цепной реакции с последующим рестрикционным анализом, и при выявлении генотипа G/A и аллеля А прогнозируют риск развития профессиональных гиперкератозов у обследуемых.

Предлагаемый способ осуществляется следующим образом. Венозную кровь в объеме 5 мл забирают в пробирки, содержащие ЭДТА в качестве антикоагулянта, и тщательно перемешивают. Для выделения ДНК используют метод выделения ДНК из крови фенольно-хлороформной экстракцией, описанный Мэтью [Mathew С.С.The isolation of high molecular weight eukaryotic DNA // Methods in Molecular Biology / Ed. Walker J.M., N.Y., L.: Human Press. - 1984. - V.2. - P. 31-34].

1. Кровь в пробирке с консервантом тщательно перемешивается и переливается в центрифужный стакан на 50 мл, туда же добавляют 30 мл охлажденного лизирующего буфера, содержащего 320 мМ сахарозы, 1% раствор тритона Х-100, 5 мМ MgCl2, 10 мМ трисНСl (pH 7,6).

2. Смесь центрифугируют 20 мин при 4000 об./мин, при 4°C.

3. Надосадочную жидкость сливают, добавляют 15 мл лизирующего буфера, перемешивают с осадком, центрифугируют 10 мин при 4000 об./мин, при 4°C.

4. Надосадочную жидкость сливают, к получившемуся осадку приливают 0,5 мл 25 мМ ЭДТА, рН 8,0, суспензируют.

5. К суспензии добавляют 40 мкл 10% SDS и протеиназу К (концентрация - 10 мг/мл). Смесь для лизиса оставляют на ночь в термостате при температуре 37°С.

Далее проводят фенол-хлороформную экстракцию ДНК с последующим осаждением 96% этанолом и центрифугированием в течение 10 мин при 10000 об./мин. Образовавшийся осадок ДНК растворяют в деионизированной воде, раствор хранят при -20°С.

Оценку полиморфизма гена ТР53 проводят с помощью ПЦР-ПДРФ анализа. ПЦР проводят в амлификаторе «Терцик» фирмы ДНК-Технология. При этом используют специфические праймеры и условия реакции. Последовательности специфических праймеров представлены в таблице 1. ПЦР проводят в объеме 25 мкл следующего состава: по 6 пмоль каждого праймера, четыре дезоксинуклеозидтрифосфата (каждый в концентрации 0,2 мМ), 1 мкл геномной ДИК, Taq-полимеразу («Sileks»), буфер для Taq-полимеразы и необходимое количество деионизированной воды до объема 25 мкл. Режим амплификации следующий: денатурация (94°С, 5 мин) - 1 цикл; денатурация (94°С, 30 с), отжиг (61°С, 40 с) и элонгация (72°С, 30 с) - 30 циклов; конечная элонгация (72°С, 5 мин) - 1 цикл.

Для рестрикционного анализа продукты ПЦР подвергают обработке рестриктазой MspI («Fermentas)» в течение 6 часов. На реакцию рестрикции берут 5 мкл ампликона, 0,5 рестриктазы (3-4 Ед.) и 1 мкл 10Х буфера для рестриктазы.

Результаты амплификации и рестрикции оценивают с помощью вертикального электрофореза в 6-8% полиакриламидном геле (исходное соотношение акриламида и метиленбисакриламида 29: 1) при напряжении 200-300 В (10 В/см). По окончании электрофореза гель окрашивают раствором бромистого этидия (0,1 мкг/мл) в течение 15 минут с последующей визуализацией в ультрафиолетовом свете на трансиллюминаторе. Размер фрагментов определяют с помощью стандарта массы 500 п.о. - Ladder фирмы «Fermentas». О наличии в образце определенных аллельных вариантов судят по появлению в геле фрагментов с размерами, указанными в таблице 1.

Нами были исследованы образцы ДНК у 51 больных с гиперкератозом, которые по профессии были операторами получения непрерывного стекловолокна. Группу сравнения составили 53 оператора с большим стажем работы, не имеющие установленной профессиональной патологии.

Ассоциацию генотипов с развитием заболевания выявляли, сравнивая выборки больных и здоровых индивидов по частоте одного признака с использованием критерия χ2 с поправкой Йетса на непрерывность. Если абсолютное число наблюдений хотя бы в одной ячейке таблицы было 5 и менее, то применялся точный критерий Фишера. Статистически значимыми считали различия при р<0.05.

Относительный риск заболевания по конкретному признаку вычисляли как соотношение шансов (OR - odds ratio). Для этого используют формулу, предложенную Бландом (Bland J.M., Altaian D.G. / The odds ratio // Br. Med. J. - 2000. - Vol.320. - P.1468]:


где a - частота генотипа в выборке больных, b - частота генотипа в контрольной выборке, с - сумма частот остальных генотипов в выборке больных, d - сумма частот остальных генотипов в контрольной выборке.

Значение OR=1 показывало отсутствие ассоциации, значение OR>1 рассматривали как положительную ассоциацию заболевания с признаком («фактор риска»), OR<1 - как отрицательную ассоциацию («фактор устойчивости»).

В ходе исследования нами проведен анализ полиморфного варианта гена ТР53 в выборке больных с профессиональным гиперкератозом, а также в группе сравнения для выяснения их взаимосвязи с риском развития данной патологии. По исследуемому локусу отклонения от равновесия Харди-Вайнберга в изученных группах обнаружено не было.

Сравнительный анализ распределения частот генотипов и аллелей полиморфного локуса rs1625895 гена ТР53 выявил достоверно значимые различия между изученными группами. Так, гомозиготный генотип G/G и аллель G преобладали в группе здоровых работников (χ2=8,03, р=0,006; χ2=9,16, р=0,003 соответственно). Тогда как в группе больных профессиональными заболеваниями достоверно чаще встречался гетерозиготный генотип G/A (χ2=5,87, р=0,016; OR=4,64, 95% CI 1,28-18,32), а также аллель А (χ2=9,16, р=0,003; OR=5,47, 95% CI 1,65-19,92) (таблица 2).

Таким образом, наличие в генотипе варианта G/A и аллеля А полиморфного локуса rs1625895 гена ТР53 является фактором предрасположенности. Высокий показатель отношения шансов позволяет рассматривать эти специфичности в качестве генетических маркеров, ассоциированных с повышенным риском развития профессионального гиперкератоза.

Пример 1.

Больной Р., 1960 г.р., работает оператором получения непрерывного стекловолокна на ОАО «Стеклонит» в течение 25 лет. Находился на стационарном лечении в клинике ФБУН «Уфимский НИИ медицины труда и экологии человека» с диагнозом гипертензивная болезнь сердца. Проведено исследование по предложенной методике. Установлено: является носителем гомозиготного генотипа G/G и аллеля G полиморфного локуса rs1625895 гена ТР53. В отношении развития профессионального гиперкератоза прогноз благоприятный. При осмотре кожных покровов патологии не выявлено.

Пример 2.

Больной Г., 1954 г.р., находился на диспансерном наблюдении в ФБУН «Уфимский НИИ медицины труда и экологии человека» с 2004 г. с диагнозом хронический дерматит рук. Работал оператором получения непрерывного стекловолокна на ОАО «Стеклонит» в течение 11 лет.

Проведено исследование по предлагаемой методике. Установлено: является носителем генотипа G/A и аллеля А полиморфного локуса rs1625895 гена ТР53. В отношении развития профессионального гиперкератоза прогноз неблагоприятный.

При осмотре при очередном освидетельствовании обнаружены очаги ограниченного гиперкератоза. Работник был переведен в другой цех.

Таблица 1
Тип полиморфизма, последовательности праймеров, ферменты рестрикции и номенклатура аллелей полиморфного ДНК-локуса гена ТР53
Полиморфный локус гена Праймеры (5′→3′) t° C отжига Длина продукта, пн Рестриктаза Аллели, пн Литературный источник
1 2 3 4 5 6 7
1 rs1625895 ТР53 intron 6 TGGCCATCTACAGGCACTCA TTGCACATCTCATGGGGTTA 61 404 MspI G 336 + 68 А 404 Wu X. et al., 2002
Таблица 2
Частоты аллелей и генотипов полиморфного локуса rs1625895 гена ТР53 у работников производства стекловолокна
Группа N Генотипы (%) Аллели (%)
Больные 51 35 (68,6) 14 (27,5) 2 (3,9) 84 (82,4) 18 (17,7)
Группа сравнения 53 49 (92,5) 4 (7,6) 0 102 (96,2) 4 (3,8)

Способ прогнозирования развития профессиональных гиперкератозов, характеризующийся тем, что проводят выделение ДНК из лимфоцитов периферической венозной крови, проводят генотипирование полиморфного локуса rs1625895 гена TP53 методом полимеразной цепной реакции с последующим рестрикционным анализом, при выявлении генотипа G/A и аллеля А прогнозируют риск развития профессиональных гиперкератозов у обследуемых.


Похожие патенты:

Изобретение относится к области медицины, а именно к способу диагностики гестационного сахарного диабета у беременных, включающий проведение исследования крови утром натощак с определением содержания глюкозы венозной плазмы.

Изобретение относится к области медицины, а именно к инфекционным болезням и гастроэнтерологии. Способ диагностики наличия и стадии фиброза печени при хроническом вирусном гепатите С заключается в том, что определяют концентрации ГГТ, ТФР-β1, ТИМП-1 и комплекс ММП-9/ТИМП-2 в сыворотке крови, на 1-м этапе рассчитывают вероятность наличия HCV-ассоциированного фиброза печени (РНФП) по формуле: РНФП=(ey/(1+ey))×100%, где y=-13,6+3,78·X1-0,1·X2 где X1 - сывороточное значение прогностического фактора ММП-9/ТИМП-2, X2 - сывороточное значение прогностического фактора ТИМП-1, ey - экспоненциальная функция.

Изобретение относится к области биотехнологии, конкретно к получению ингибиторов адгезии и/или агрегации тромбоцитов, и может быть использовано в медицине. Рекомбинантным путем с использованием матрицы кДНК слюнной железы Anopheles stephensi получают полипептид, который используют в составе фармацевтической композиции и в наборах для скрининга ингибиторов адгезии или агрегации тромбоцитов.
Изобретение относится к медицине, а именно к стоматологии, и может быть использовано для диагностики кариеса зубов методом инфракрасной спектроскопии. Для этого образец слюны пациента предварительно высушивают, сухой остаток измельчают и суспензируют в вазелиновом масле.
Изобретение описывает способ интраоперационной оценки состояния периферических нервов путем выявления положительной активности ацетилхолинэстеразы. Способ заключается в изготовлении криостатных срезов нерва, промывании их в двух порциях малеатного буфера, инкубации в инкубационной среде.
Изобретение относится к медицине, а именно к способу диагностики стафилококковой аллергии при аллергическом рините. Сущность способа состоит в том, что с помощью хемилюминесцентного анализа исследуют функциональную активность нейтрофильных гранулоцитов, рассчитывают индекс образования активных форм кислорода (ИОАФК), представляющий собой отношение площади под кривой люминолзависимой хемилюминесценции нейтрофильных гранулоцитов, индуцированной живой бактериальной суспензией золотистого стафилококка, ко времени выхода на максимум люминолзависимой хемилюминесценции нейтрофильных гранулоцитов, индуцированной живой бактериальной суспензией золотистого стафилококка.

Изобретение относится к кардиологии и представляет собой способ определения вероятности сохранения миокарда от инфарктного повреждения, для чего создается «база данных» на основе исследования на момент поступления 7 параметров периферической крови, 11 параметров биохимического анализа крови и 6 параметров стандартной 12-канальной электрокардиограммы у 200 больных с Q-инфарктом миокарда и 200 больных, у которых развитие инфаркта миокарда не происходило.

Группа изобретений относится к медицине, а именно к иммунологии, и может быть использована в лабораторной диагностике как тест-система и способ определения антивирусной активности интерферона альфа (ИФН-α) в сыворотке крови человека.
Изобретение относится к медицине и описывает способ диагностики инфицированного панкреонекроза с установлением показаний к оперативному вмешательству путем обследования больного, где газохроматографическим методом определяют в крови содержание уксусной, пропионовой, масляной и изовалериановой кислот и при концентрации уксусной кислоты больше 0,11 ммоль/л устанавливают наличие инфицированного панкреонекроза, а при концентрации любой из трех кислот: пропионовой больше 0,0095 ммоль/л, масляной больше 0,0035 ммоль/л, изовалериановой больше 0,0003 ммоль/л - устанавливают наличие инфицированного панкреонекроза с активным развитием анаэробной инфекции, требующего одного из вариантов оперативного вмешательства.

Изобретение относится к медицине, а именно к способу прогнозирования вероятности снижения скорости клубочковой фильтрации (СКФ) через 3 месяца наблюдения после аортокоронарного шунтирования без искусственного кровообращения (АКШ без ИК).

Предложенная группа изобретений относится к области медицины, молекулярной биологии и биотехнологии. Предложен способ определения чувствительности клеток рака легкого к цисплатину, включающий определение уровня экспрессии генов MLH1, ERCC1, DDB2, AKR1B1, FTL в зависимости от IC50 цисплатина для известных клеточных линий, построение градуировочной прямой зависимости IC50 цисплатина для этих клеточных линий от полученного уровня экспрессии указанных генов и гибридизацию на микрочипе.
Изобретение относится к области биохимии, в частности к способу идентификации изменений в экспрессии генов, характерных для старения, в выбранной ткани. Выбранная ткань представляет собой сердечную, мышечную, мозговую или жировую ткань.

Изобретение относится к области молекулярной биологии и может быть использовано в диагностике кардиомиопатий различной природы. Предложен набор синтетических олигонуклеотидов для выявления мутаций кодирующей части гена десмина (DES), ассоциированных с кардиомиопатиями.

Изобретение относится к области биотехнологии, конкретно к ингибиторам сигнального пути AXL, и может быть использовано в медицине. Получают растворимый вариант полипептида AXL без трансмембранного домена AXL, который содержит по меньшей мере одну модификацию аминокислоты в положении номер n, где n выбран из 32, 72, 87, 92 или 127 или их сочетание, где n+7 соответствует нумерации SEQ ID NO: 1 - последовательности AXL дикого типа, в котором указанная модификация повышает сродство связывания полипептида AXL со специфически задерживающим рост белком 6 (GAS6), которое, по меньшей мере, примерно в 2 раза сильнее, чем сродство полипептида AXL дикого типа.

Изобретение относится к области биохимии, в частности к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации Burkholderia pseudomallei и дифференциации от возбудителя сапа методом полимеразной цепной реакции с флуоресцентной детекцией.

Изобретение относится к области медицины, молекулярной биологии и биотехнологии. Предложен способ определения полиморфизма гена GP6 человека, кодирующего гликопротеин VI, по полиморфной позиции rs 1613662, основанный на снятии кривых плавления с флуоресцентно-мечеными аллель-специфичными олигонуклеотидными пробами.

Изобретение относится к области биотехнологии, конкретно к интернализации терапевтических молекул внутрь клетки, и может быть использовано в медицине. Получают композицию для доставки молекул нуклеиновых кислот в клетки, содержащую по меньшей мере один пептид с по меньшей мере 92% идентичностью к GAAEAAARVYDLGLRRLRQRRRLRRERVRA (SEQ ID NO: 2); IREIMEKFGKQPVSLPARRLKLRGRKRRQR (SEQ ID NO: 3); или YLKVVRKHHRVIAGQFFGHHHTDSFRMLYD (SEQ ID NO: 4), присоединенный к одной или нескольким молекулам нуклеиновых кислот.

Изобретение относится к биотехнологии, а именно к способу анализа пригодности РНК, экстрагированной из ткани или клетки (клеток), фиксированных с помощью фиксатора, для анализа экспрессии генов.

Группа изобретений относится к области лизиса клеток. Предложен способ избирательного лизиса животных клеток, а также прибор для обнаружения микроорганизмов.

Изобретения относятся к области медицинской микробиологии и касаются способа дифференциации токсигенных генетически измененных штаммов V.cholerae биовара Эль Тор и тест-системы.

Изобретение относится к области медицины и предназначено для определения риска развития рака тела матки у женщин с гиперпластическими процессами эндометрия. Осуществляют выделение ДНК из периферической венозной крови, проводят генотипирование гена APOE, выявляют полиморфные аллели APOE*2, APOE*3, APOE*4 и при наличии генотипов, содержащих аллели APOE*2 прогнозируют высокий риск рака эндометрия. Изобретение обеспечивает высокоспецифичный критерий для оценки прогноза риска развития гиперпролиферативных заболеваний эндометрия, в том числе эндометриоидной аденокарциномы у женщин с гиперпластическими процессами эндометрия. 2 ил., 10 табл., 4 пр.

Изобретение относится к медицине, а именно к способу прогнозирования развития профессиональных гиперкератозов. Сущность способа состоит в том, что выделяют ДНК из лимфоцитов периферической венозной крови, проводят генотипирование полиморфизма rs1625895 гена ТР53 методом полимеразной цепной реакции с последующим рестрикционным анализом. При выявлении генотипа GA и аллеля А прогнозируют риск развития профессиональных гиперкератозов. Использование изобретения дает возможность прогнозировать развитие профессиональных гиперкератозов при воздействии на организм вредных производственных факторов. 2 табл., 2 пр.
