Способ определения генотипа человека по полиморфной позиции rs1613662 в гене gp6, кодирующем гликопротеин vi

Изобретение относится к области медицины, молекулярной биологии и биотехнологии. Предложен способ определения полиморфизма гена GP6 человека, кодирующего гликопротеин VI, по полиморфной позиции rs 1613662, основанный на снятии кривых плавления с флуоресцентно-мечеными аллель-специфичными олигонуклеотидными пробами. Благодаря увеличению надежности определения вариабельных позиций и возможности проводить определение в одной пробирке на стандартном оборудовании способ может быть эффективно использован для диагностики наследственных предрасположенностей человека с регистрацией результатов ПЦР в реальном времени. 1 ил.

 

1. Область техники.

Предложенный способ относится к области медицины, биологии и биотехнологии и может быть использован при диагностике заболеваний с генетической составляющей (генетической предрасположенностью), прогнозирования тяжести и скорости прогрессии заболевания и алгоритма лечения заболевания в зависимости от индивидуального генетического профиля пациента.

Известно, что развитие и течение множества заболеваний человека в значительной степени определяется его генотипом. За последние 10-15 лет получены первые результаты по идентификации широкого спектра генетических маркеров различных заболеваний и предрасположенности к ним.

Гликопротеины - это сложные белки, в которых белковая (пептидная) часть молекулы ковалентно соединена с одной или несколькими группами гетероолигосахаридов. Гликопротеины являются важным структурным компонентом клеточных мембран. Гликопротеины мембран эритроцитов, специфически гликозилированные теми или иными углеводными остатками, но имеющие гомологичную белковую часть, предопределяют группу крови у человека. Также гликопротеинами являются все антитела, интерфероны, компоненты комплемента, белки плазмы крови, молока, рецепторные белки и др. Важная роль гликопротеинов в организме определяет развитие ряда ассоциированных с ними заболеваний человека.

Для полиморфизма в позиции rs1613662 в гене GP6, кодирующем гликопротеин VI, показана взаимосвязь с развитием венозного тромбоза [1].

2. Уровень техники.

Широко распространен способ определения типа нуклеотида, находящегося в определенном месте ДНК, основанный на использовании аллель-специфичных праймеров с регистрацией результатов ПЦР по окончании реакции с помощью электрофореза. При использовании ПЦР с регистрацией результатов в ходе реакции известны различные способы определения генотипа исследуемого образца.

Существуют различные способы, позволяющие определить тип нуклеотида, находящегося в определенном месте ДНК, основанные на использовании аллель-специфичных праймеров с регистрацией результатов ПЦР непосредственно в ходе реакции с помощью использования флуоресцентно-меченых проб (олигонуклеотидов) (Andreas R. Tobler at all, "THE SNPlex Genotiping System: A Flexible and Scalable Platform for SNP Genotyping", Journal of Biomolecular Techniques, V.16, issue 4, Desember 2005).

Например, в наборах производства Applied Biosystems используют одну пару праймеров для каждого аллеля и два зонда с различными флуорецентными метками, в зависимости от генотипа аллеля фиксируют разгорание различных меток ("TaqMan SNP Genotyping Assays", Applied Biosistems, Prodakt Bulletin, USA, 06/2006). Недостатком способа, используемого в данных наборах, является сравнительно невысокая достоверность результатов исследования из-за небольшой разницы между получаемыми кривыми флуоресценции для разных аллелей.

Предлагаемым подходом к детекции генетического полиморфизма является использование двух аллель-специфичных и меченых разными флуоресцентными метками олигонуклеотидов, а также олигонуклеотида, несущего гаситель флуоресценции и гибридизирующегося на матрицу рядом с аллель-специфичным олигонуклеотидом. Гибридизация аллель-специфичного олигонуклеотида на матрицу ведет к переносу энергии с находящегося на нем флуорофора-донора на гаситель флуоресценции расположенного рядом «гасящего» олигонуклеотида. Регистрацию результатов амплификации ведут по окончании ПЦР путем снятия спектра флуоресценции при изменении температуры реакционной смеси в диапазоне от 25 до 80 градусов по Цельсию (так называемые «кривые плавления»). При получении графиков флуоресценции возможен как нагрев, так и охлаждение реакционной смеси в указанном интервале температур.

Предлагаемое изобретение делает определение вариабельных позиций в ДНК более надежным и удешевляет подобные исследования благодаря использованию стандартного оборудования.

3. Раскрытие изобретения.

Техническим результатом, на достижение которого направлено предлагаемое изобретение, является повышение доступности подобных исследований, поскольку способ может быть осуществлен на стандартном известном оборудовании. Также он обеспечивает возможность проводить исследование в одной пробирке, что снижает затраты на исследование.

Использованный нами способ генотипирования является вариантом классического метода «примыкающих проб». При определении замен одиночных нуклеотидов вначале проводили ПЦР с праймерами, общими для обоих вариантов последовательности, затем температуру реакционной смеси снижали для гибридизации полученной матрицы с олигонуклеотидными пробами. Для определения варианта последовательности использовали два типа олигонуклеотидов, гибридизирующихся на матрицу рядом. Один из олигонуклеотидов метили флуорофором, другой - гасителем флуоресценции.

В реакции использовали один общий олигоиуклеотид с гасителем флуоресценции и пару аллель-специфичных (сиквенс-специфичных) олигонуклеотидов, несущих флуорофор. Олигонуклеотидные пробы, соответствующие тому или иному варианту последовательности, метили различными флуорофорами, что позволило определять оба варианта в одной пробирке. Определение генотипа проводили после ПЦР и гибридизации путем измерения уровня флуоресценции в ходе температурной денатурации дуплексов олигонуклеотидов и полученных матриц (или наоборот - гибридизации). Данное измерение проводили в режиме реального времени, его результатом являлись кривые плавления.

Условия реакции подбирали так, чтобы максимизировать разницу в температурах плавления совершенного и несовершенного дуплексов. Таким образом, если анализируемый образец содержал только один вариант последовательности, т.е. был гомозиготен по данному полиморфизму, температура плавления для пробы, образующей совершенный дуплекс, была существенно выше, нежели для пробы, образующей несовершенный дуплекс. Если же анализировали гетерозиготный образец, температуры плавления были практически одинаковы.

Указанный результат достигается путем использования при постановке ПЦР флуоресцентно-меченых аллель-специфичных олигонуклеотидных проб и праймеров:

GP6_3s GGGGTCCGTGTACCTCATACGC
GP6_3a GAGGAAACTCAGTCACGGAGATGT
GP6_3p1 GCTACCGGGGAAGGTG-FAM
GP6_3p2 GCTACCGAGGAAGGTG-HEX
GP6_3pq BHQ1-GTTCTGTTGGTAACCGGCT-3'-(P)

FAM означает флуоресцентный краситель FAM, HEX означает флуоресцентный краситель HEX, BHQ1 означает присоединенный к 5' - концевому нуклеотиду темновой гаситель флуоресценции.

Состав амплификационной смеси (на одну реакцию)

Компонент Концентрация Объем
ПЦР - буфер* 1,25-кратный 18 мкл
смесь dNTP 0,25 мМ (каждого) 0,24 мкл
Праймеры 100 пМ/мкл по 0,14 мкл
Олигонуклеотиды, меченные флуорофорами 100 пМ/мкл по 0,07 мкл
Олигонуклеотид, меченный гасителем флуоресценции 100 пМ/мкл 0,14 мкл
Taq-полимераза 10 ед. активности/мкл 0,5 мкл
H2O (деионизированная) - до 30 мкл
Геномная ДНК - 5 мкл
*Состав буфера для проведения ПЦР
84 мМ Трис-HCl pH 8,6
21 мМ (NH4)2SO4
3,1 мМ MgCl2
0,003% Tween-20
0,003% NP-40
6,25% глицерин

4. Осуществление изобретения.

В качестве материала для исследования рекомендуется использовать кровь, соскобы буккального эпителия, биоптаты мягких тканей человека или иной стандартный биологический материал. Выделение ДНК из биоматериала производится с использованием комплекта реагентов для выделения ДНК (не является предметом данного патента).

Полимеразную цепную реакцию и определение температуры плавления олигонуклеотидных проб проводили с помощью детектирующего амплификатора «ДТпрайм» (ООО «НПО ДНК-Технология», Россия). Использовали следующий температурный режим амплификации: 94°C - 10 с, 64°C - 30 с в течение 50 циклов. По завершении реакции амплификации реакционную смесь остужали до 25°C со скоростью 2°C/сек. Кривые плавления получали следующим образом: температуру реакционной смеси повышали с 25°C до 75°C с шагом 1°C, измеряя уровень флуоресценции на каждом шаге.

Результаты, т.е. отнесение образца к гомозиготе или гетерозиготе по данному аллелю, оцениваются по форме кривых плавления ДНК (рис. 1).

Источник информации

1. Bezemer ID, Bare LA, Arellano AR, Reitsma PH, Rosendaal FR. Updated analysis of gene variants associated with deep vein thrombosis. JAMA. 2010 Feb 3; 303 (5): 421-2. doi: 10.1001/jama.2010.57.

Способ определения полиморфизма гена GP6 человека, кодирующего гликопротеин VI, по полиморфной позиции rs 1613662, основанный на снятии кривых плавления с флуоресцентно-мечеными аллель-специфичными олигонуклеотидными пробами, отличающийся тем, что используют общую для всех аллелей пару праймеров, отличающиеся для каждого аллеля флуоресцентно-меченые аллель-специфичные олигонуклеотидные пробы и универсальный олигонуклеотид, меченный гасителем флуоресценции, при этом вышеперечисленные праймеры, пробы и универсальный олигонуклеотид имеют следующий состав:

где FAM означает флуоресцентный краситель FAM, HEX означает флуоресцентный краситель HEX, BHQ1 означает присоединенный к 5′-концевому нуклеотиду темновой гаситель флуоресценции, а отнесение образца к гомозиготе или гетерозиготе по данному аллелю проводят по форме кривых плавления ДНК (по максимуму первой производной графиков флуоресценции), при этом наличие одного пика на графике свидетельствует о гомозиготности образца по аллелю, соответствующему более тугоплавкой флуоресцентно-меченой аллель-специфичной олигонуклеотидной пробе, а наличие двух пиков на графике свидетельствует о гетерозиготности образца.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к интернализации терапевтических молекул внутрь клетки, и может быть использовано в медицине. Получают композицию для доставки молекул нуклеиновых кислот в клетки, содержащую по меньшей мере один пептид с по меньшей мере 92% идентичностью к GAAEAAARVYDLGLRRLRQRRRLRRERVRA (SEQ ID NO: 2); IREIMEKFGKQPVSLPARRLKLRGRKRRQR (SEQ ID NO: 3); или YLKVVRKHHRVIAGQFFGHHHTDSFRMLYD (SEQ ID NO: 4), присоединенный к одной или нескольким молекулам нуклеиновых кислот.

Изобретение относится к биотехнологии, а именно к способу анализа пригодности РНК, экстрагированной из ткани или клетки (клеток), фиксированных с помощью фиксатора, для анализа экспрессии генов.

Группа изобретений относится к области лизиса клеток. Предложен способ избирательного лизиса животных клеток, а также прибор для обнаружения микроорганизмов.

Изобретения относятся к области медицинской микробиологии и касаются способа дифференциации токсигенных генетически измененных штаммов V.cholerae биовара Эль Тор и тест-системы.

Изобретение относится к области биохимии, в частности к способу выявления мутаций в гене MYO7A, сопровождающихся развитием несиндромальной аутосомно-рецессивной глухоты или синдрома Ушера.
Изобретение относится к области биотехнологии и касается специфических олигонуклеотидных праймеров. Представленные праймеры включают сайты эндонуклеазного расщепления, фланкирующие участки генома, кодирующие гликопротеины Gn и Gc, а также нуклеопротеин N, для получения библиотеки генов, кодирующих гликопротеины Gn и Gc и нуклеопротеин N вируса лихорадки долины Рифт.

Изобретения относятся к области биотехнологии и касаются олигонуклеотидных праймеров и способа выявления ДНК Mycobacterium avium с их использованием. Охарактеризованные олигонуклеотидные праймеры комплементарны специфичной области mig-гена Mycobacterium avium и имеют следующий нуклеотидный состав: 5'-CGT CAA AAG CGA ACT GCA-3' и 5'-ТАА ТТС GTT GCC CGA СТС-3'. Способ выявления ДНК Mycobacterium avium выключает выделение ДНК, проведение амплификации ДНК с использованием олигонуклеотидных праймеров, перенос продукта амплификации на гель с последующим детектированием результатов анализа на трансиллюминаторе.

Изобретение относится к области кардиологии и касается набора синтетических олигонуклотидов. Представленный набор используется для выявления мутаций кодирующей части генов NKX2.5, CFC1, GATA4, ассоциированных с орфанной моногенной патологией, лежащей в основе семейных форм врожденных пороков сердца.

Изобретение относится к области биотехнологии, а именно к паре синтетических олигонуклеотидных праймеров, применяемых для выделения ДНК провируса и РНК вируса иммунодефицита кошек, и к способу диагностики вирусного иммунодефицита кошек с использованием данных праймеров.

Изобретение относится к области биохимии, в частности к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации вируса лихорадки долины Рифт методом обратно транскриптазной полимеразной цепной реакции в реальном времени.

Изобретение относится к области биохимии, в частности к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации Burkholderia pseudomallei и дифференциации от возбудителя сапа методом полимеразной цепной реакции с флуоресцентной детекцией. Заявленное изобретение позволяет в короткий срок с высокой чувствительностью и специфичностью детектировать возбудителя мелиоидоза и дифференцировать его от возбудителя сапа в пробах чистых культур и биологическом материале. 1 ил., 1 табл., 3 пр.

Изобретение относится к области биотехнологии, конкретно к ингибиторам сигнального пути AXL, и может быть использовано в медицине. Получают растворимый вариант полипептида AXL без трансмембранного домена AXL, который содержит по меньшей мере одну модификацию аминокислоты в положении номер n, где n выбран из 32, 72, 87, 92 или 127 или их сочетание, где n+7 соответствует нумерации SEQ ID NO: 1 - последовательности AXL дикого типа, в котором указанная модификация повышает сродство связывания полипептида AXL со специфически задерживающим рост белком 6 (GAS6), которое, по меньшей мере, примерно в 2 раза сильнее, чем сродство полипептида AXL дикого типа. Полипептид может быть слит с Fc фрагментом и использован в способе лечения, снижения или предотвращения метастазирования или инвазии опухоли у пациента-млекопитающего. Изобретение позволяет эффективно ингибировать сигнальные пути AXL/GAS6. 6 н. и 2 з.п. ф-лы, 15 ил., 6 табл., 3 пр.

Изобретение относится к области молекулярной биологии и может быть использовано в диагностике кардиомиопатий различной природы. Предложен набор синтетических олигонуклеотидов для выявления мутаций кодирующей части гена десмина (DES), ассоциированных с кардиомиопатиями. Мутации выявляют путем определения полной нуклеотидной последовательности кодирующей части гена DES. Осуществляют амплификацию кодирующей части гена DES с помощью 7 пар синтетических олигонуклеотидов при одной температуре и времени отжига, с последующим секвенированием полученных продуктов амплификации с помощью одной пары универсальных праймеров. Предложенное изобретение позволяет чувствительно и специфично определять мутации гена DES, при этом сокращаются время реакции амплификации, количество манипуляций, время внесения реактивов для реакции секвенирования и снижается вероятность ошибки при постановке реакции. 2 з.п. ф-лы, 1 ил.
Изобретение относится к области биохимии, в частности к способу идентификации изменений в экспрессии генов, характерных для старения, в выбранной ткани. Выбранная ткань представляет собой сердечную, мышечную, мозговую или жировую ткань. Способ включает отбор одного или нескольких генов, дифференциально экспрессируемых в ткани старых субъектов по сравнению с молодыми субъектами, с применением двух критериев. Указанными критериями являются изменение экспрессии по меньшей мере в 50% линий, пород или этнических групп тестируемых видов на заранее определенном уровне значимости в р<0.10, а также по меньшей мере частичное обращение изменений в экспрессии генов путем ограничения в калорийности. Изобретение обеспечивает получение надежных тканеспецифических биомаркеров старения. 2 н. и 5 з.п. ф-лы, 11 табл., 5 пр.

Предложенная группа изобретений относится к области медицины, молекулярной биологии и биотехнологии. Предложен способ определения чувствительности клеток рака легкого к цисплатину, включающий определение уровня экспрессии генов MLH1, ERCC1, DDB2, AKR1B1, FTL в зависимости от IC50 цисплатина для известных клеточных линий, построение градуировочной прямой зависимости IC50 цисплатина для этих клеточных линий от полученного уровня экспрессии указанных генов и гибридизацию на микрочипе. Предложен также набор олигонуклеотидных зондов, представленных SEQ ID NO: 9-13. Предложенная группа изобретений обеспечивает эффективные средства и методы для определения чувствительности клеток рака легкого к цисплатину. 2 н.п. ф-лы, 1 ил., 2 табл., 3 пр.
Изобретение относится к медицине, а именно к способу прогнозирования развития профессиональных гиперкератозов. Сущность способа состоит в том, что выделяют ДНК из лимфоцитов периферической венозной крови, проводят генотипирование полиморфизма rs1625895 гена ТР53 методом полимеразной цепной реакции с последующим рестрикционным анализом. При выявлении генотипа G/A и аллеля А прогнозируют риск развития профессиональных гиперкератозов. Использование изобретения дает возможность прогнозировать развитие профессиональных гиперкератозов при воздействии на организм вредных производственных факторов. 2 табл., 2 пр.

Изобретение относится к области медицины и предназначено для определения риска развития рака тела матки у женщин с гиперпластическими процессами эндометрия. Осуществляют выделение ДНК из периферической венозной крови, проводят генотипирование гена APOE, выявляют полиморфные аллели APOE*2, APOE*3, APOE*4 и при наличии генотипов, содержащих аллели APOE*2 прогнозируют высокий риск рака эндометрия. Изобретение обеспечивает высокоспецифичный критерий для оценки прогноза риска развития гиперпролиферативных заболеваний эндометрия, в том числе эндометриоидной аденокарциномы у женщин с гиперпластическими процессами эндометрия. 2 ил., 10 табл., 4 пр.

Изобретения относятся к области ДНК-генеалогии и касаются способа определения гаплогрупп Y-хромосомы человека, тест-системы и олигонулкотидных праймеров. Охарактеризованный способ осуществляют в два этапа. На первом этапе производят генотипирование по основным гаплогруппам R,N,J,I,Q,C,E,D,G,O Y-хромосомного древа путем мультиплексной ПЦР с использованием специфичных олигонуклеотидных праймеров первого и второго наборов тест-системы. На втором этапе, если мутация выявлена, проводят дополнительную мультиплексную ПЦР для типирования по субгаплогруппам. Если на первом этапе мутация не выявлена, проводят мультиплексную ПЦР для типирования по редким гаплогруппам A,C3,F,H,K,L,O3 и Т. Последовательностям из первого набора тест-системы соответствует область отжига праймеров вне зон мутаций в пределах видовой специфичности. Последовательностям из второго набора тест-системы соответствует область отжига олигонуклеотидных праймеров, непосредственно примыкающая к зоне мутации в пределах видовой специфичности. Изобретения могут быть использованы для установления гаплогрупп Y-хромосомы человека. 3 н.п.ф-лы, 2 ил.,7 табл., 2 пр.

Изобретение относится к биохимии. Описан способ обнаружения присутствия или отсутствия нескольких серотипов вируса папилломы человека (ВПЧ) в биологическом образце с помощью многоканальной системы анализа, где указанная система анализа обнаруживает большее количество серотипов, чем существует каналов обнаружения. Особенностью способа является то, что используются первый и второй наборы праймеров и зондов, являющихся вырожденными по отношению друг к другу. А также то, что каждый вырожденный зонд имеет сигнальную группировку, каждая из которых излучает сигнал, обнаружимый на одном и том же канале. При этом третий набор праймеров и зондов не является вырожденным по отношению к двум другим наборам праймеров и зондов и является отличительным для третьего серотипа, не относящегося к серотипам, к которым преимущественно происходит отжиг вырожденных наборов праймеров и зондов и где третий набор праймеров и зондов имеет сигнальную группировку, которая излучает сигнал при длине волны, которая является такой же или отличается от длины волны, излучаемой сигнальной группировкой вырожденных зондов. Представлены соответствующие праймеры и зонды. Изобретение позволяет обнаруживать большее количество типов ВПЧ, чем существует каналов детекции в системе анализа. 3 н. и 8 з.п. ф-лы, 3 ил., 6 табл.

Представленное изобретение относится к области биотехнологии и касается способа обнаружения провируса лейкоза крупного рогатого скота. Охарактеризованный способ включает выявление фрагмента LTR (Long Terminal Repeat) - последовательности провируса лейкоза. Определение размера амплифицированного фрагмента нуклеотидной последовательности путем электрофоретического разделения в агарозном геле. В качестве праймеров используются олигонуклеотиды: BL1.F 5-GAGTTAGCGGCACCAGAAGC-3 и BL1.R 5-ATAGAGCTCGCGGTGGTCTC-3. Продукт синтеза составляет 175 пар нуклеотидов. Геномную ДНК выделяют сорбентным методом с последующим элюированием в буфере ТЕ, а амплификацию проводят в режиме: 95°С - 3 минуты 1 раз, 94°С - 20 секунд денатурация, 66°С - 20 секунд - отжиг праймеров, 74°С - 25 секунд элонгация, 45 раз, 74°С - 3 минуты - достраивание цепей. В качестве положительного контроля прохождения реакции используют препарат положительного контроля антигена ВЛКРС. Изобретение может быть использовано в молекулярно-генетической диагностике болезней животных и научных исследованиях в ветеринарии. 2 ил., 1 табл.

Изобретение относится к области медицины, молекулярной биологии и биотехнологии. Предложен способ определения полиморфизма гена GP6 человека, кодирующего гликопротеин VI, по полиморфной позиции rs 1613662, основанный на снятии кривых плавления с флуоресцентно-мечеными аллель-специфичными олигонуклеотидными пробами. Благодаря увеличению надежности определения вариабельных позиций и возможности проводить определение в одной пробирке на стандартном оборудовании способ может быть эффективно использован для диагностики наследственных предрасположенностей человека с регистрацией результатов ПЦР в реальном времени. 1 ил.

Наверх