Композиции и способы модуляции smn2 сплайсинга у субъекта

Предложенная группа изобретений относится к области медицины. Предложен способ облегчения по меньшей мере одного симптома спинальной мышечной атрофии у субъекта, включающий введение субъекту антисмыслового соединения, содержащего антисмысловой олигонуклеотид, комплементарный интрону 7 пре-мРНК, кодирующей человеческий SMN2. Предложено применение такого антисмыслового соединения в производстве лекарственного средства для облегчения или лечения по меньшей мере одного симптома спинальной мышечной атрофии у субъекта. Предложенная группа изобретений обеспечивает эффективные средства и методы облегчения спинальной мышечной атрофии у субъекта. 2 н. и 11 з.п. ф-лы, 13 ил., 14 табл., 14 пр.

 

УРОВЕНЬ ТЕХНИКИ

Ново синтезированные молекулы мРНК эукариот, известные также как первичные транскрипты или пре-мРНК, перед трансляцией претерпевают ряд изменений в ходе процессинга. Процессинг пре-мРНК включает в себя добавление 5'-метилированного кэпа и примерно 200-250 оснований поли (А) хвоста на 3' конце транскрипта. Процессинг мРНК из пре-мРНК также часто включает в себя сплайсинг пре-мРНК, который происходит при образовании 90-95% мРНК млекопитающих. Интроны (или промежуточные последовательности) представляют собой области пре-мРНК (или кодирующей ее ДНК), которые не включены в кодирующую последовательность зрелой мРНК. Экзоны представляют собой области первичного транскрипта, которые сохраняются в зрелой мРНК. Экзоны соединяются друг с другом при формировании зрелой последовательности мРНК. Сплайсинговое соединение также называют сайтами сплайсинга: соединение с 5' конца часто называют "5' сайтом сплайсинга" или "донорным сайтом сплайсинга", а с 3' конца - "3' сайтом сплайсинга" или "акцепторным сайтом сплайсинга". Во время сплайсинга 3' конец экзона слева соединяется с 5'-конца экзона справа. Таким образом, не прошедшая сплайсинг пре-мРНК содержит экзон/интронное соединения с 5' конца интрона и интрон/экзонное соединение с 3' конца интрона. После удаления интронов экзоны соединяются между собой, при этом такое соединение иногда называют экзон/экзонным соединением или границами экзона в зрелой мРНК. Скрытые сайты сплайсинга представляют собой сайты, которые применяются менее часто, но могут быть использованы в случае, когда обычный сайт сплайсинга заблокирован или недоступен. Альтернативный сплайсинг, определяемый как сплайсинг различных комбинаций экзонов, часто приводит к множеству транскриптов мРНК от одного гена.

До 50% генетических заболеваний человека, обусловленных наличием точечных мутаций, характеризуются аберрантным процессингом пре-мРНК. Такие точечные мутации могут либо нарушить текущий сайт, либо создать новый сайт сплайсинга, в результате чего транскрипты мРНК включают различные комбинации экзонов или содержат делеции в экзонах. Точечные мутации также могут привести к активации скрытых сайтов сплайсинга или нарушить регуляторные цис-элементы (энхансеры или сайленсеры) (Cartegni et al, Nat. Rev. Genet., 2002, 3, 285-298; Drawczak et al, Hum. Genet, 1992, 90, 41-54). Антисмысловые олигонуклеотиды были использованы для целевых мутаций, которые приводят к аберрантному сплайсингу при некоторых генетических заболеваниях для того, чтобы перенаправить сплайсинг, обеспечивая получение желаемого сплайсингового продукта (Kole, Acta Biochimica Polonica, 1997, 44, 231-238).

Антисмысловые соединения были также использованы для изменения соотношения природных вариантов альтернативного сплайсинга, таких как длинные и короткие формы Bcl-x пре-мРНК (патент США 6,172,216, патент США 6,214,986; Taylor et al, Nat. Biotechnol. 1999, 17, 1097-1100), или для усиления включения специфических экзонов, содержащих незрелые терминаторные кодоны (Wilton et al, Neuromuscul. Disord., 1999, 9, 330-338). Патент США 5,627,274 и WO 94/26887 раскрывают композиции и способы борьбы с аберрантными формами сплайсинга в мутантных пре-мРНК молекулах, используя антисмысловые олигонуклеотиды, которые не активируют РНКазу Н.

Проксимальная спинальная мышечная атрофия (СМА) является генетическим нейродегенеративным расстройством, характеризующимся потерей спинальных моторных нейронов. СМА представляет собой аутосомно-рецессивное заболевание раннего проявления и в настоящее время является основной причиной смерти среди младенцев. Тяжесть СМА варьирует среди пациентов и, таким образом, СМА была классифицирована на три типа. Тип I СМА является наиболее тяжелой формой, проявляется при рождении или в течение 6 месяцев с момента рождения и обычно приводит к смерти в течение 2 лет. Дети, страдающие СМА типа I, не способны сидеть или ходить. Тип II СМА является средней формой, при которой пациенты способны сидеть, но не могут стоять или ходить. У пациентов с III типом СМА, хронической формой заболевания, СМА обычно развивается после 18-месячного возраста (Lefebvre et al, Hum. Mol. Genet., 1998, 7, 1531-1536).

Молекулярная основа СМА заключается в потере обеих копий гена выживаемости мотонейронов 1 (SMN1), известного также как теломерный SMN, который кодирует белок, входящий в состав мультибелкового комплекса, вовлеченного в биогенез и метаболизм мяРНП. Практически идентичный ему ген, SMN2, которые также известен как центромерный SMN, расположен в двойном локусе 5q13 и модулирует тяжесть заболевания. Экспрессия нормального гена SMN1 приводит исключительно к экспрессии белка фактора выживаемости мотонейронов (SMN). Хотя SMN1 и SMN2 кодируют сходные белки, SMN2 содержит трансляционно молчащую мутацию в позиции +6 экзона 7, которая приводит к неэффективному включению экзона 7 в транскрипты SMN2. Таким образом, преобладающей формой SMN2 является усеченная версия, не содержащая экзон 7, которая является нестабильной и неактивной (Cartegni and Krainer, Nat. Genet., 2002, 30, 377-384). Экспрессия гена SMN2 обеспечивает примерно 10-20% белка SMN и 80-90% неустойчивого/ нефункционального белка SMNdelta7. Хорошо известно, SMN белок играет роль в сборке сплайсосомы, а также может участвовать в транспорте мРНК аксонов и нервных окончаний нейронов.

Антисмысловая технология является эффективным средством для модуляции экспрессии одного или нескольких специфических генных продуктов, в том числе продуктов альтернативного сплайсинга, и, несомненно, может использоваться в терапевтических, диагностических и исследовательских целях. Принцип антисмысловой технологии заключается в том, что антисмысловое соединение, которое гибридизуется с целевой нуклеиновой кислотой, модулирует процессы, отвечающие за экспрессию генов, такие как транскрипция, сплайсинг или трансляция, через один из антисмысловых механизмов. Специфичность последовательности антисмысловых соединений делает их чрезвычайно полезными как инструмент для таргетной проверки и функционализации генов, а также терапии для селективного модулирования экспрессии генов, вовлеченных в болезнь.

Некоторые антисмысловые соединения, комплементарные SMN2, известны из уровня техники. См. например, WO 2007/002390; US 61/168,885; Hua et al, American J. of Human Genetics (April 2008) 82, 1-15; Singh et al, RNA Bio. 6:3, 1-10 (2009). Некоторые антисмысловые соединения и способы, описанные здесь, обладают желательными характеристиками по сравнению с такими соединениями и способами, известными из уровня техники. Химерные молекулы пептидов и нуклеиновых кислот, предназначенные для модуляции сплайсинга SMN2, были описаны в уровне техники (WO 02/38738; Cartegni and Krainer, Nat. Struct. Biol., 2003, 10, 120-125).

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

В некоторых вариантах воплощения настоящее изобретение обеспечивает способы, включающие введение субъекту антисмыслового соединения, содержащего антисмысловой олигонуклеотид, комплементарный интрону 7 нуклеиновой кислоты пре-мРНК, кодирующей человеческий SMN2, где антисмысловое соединение вводят в спинномозговую жидкость. В некоторых вариантах введение осуществляется в интратекальное пространство. В некоторых вариантах введение осуществляется в спинномозговую жидкость в головном мозге. В некоторых вариантах введение заключается в болюсном введении. В некоторых вариантах введение заключается во введении нагнетающим насосом.

В некоторых вариантах воплощения антисмысловое соединение вводят в дозе от 0,01 до 10 миллиграмм антисмыслового соединения на килограмм веса тела субъекта. В некоторых вариантах доза составляет от 0,01 до 10 миллиграмм антисмыслового соединения на килограмм веса тела субъекта. В некоторых вариантах доза составляет от 0,01 до 5 миллиграмм антисмыслового соединения на килограмм веса тела субъекта. В некоторых вариантах доза составляет от 0,05 до 1 мг антисмыслового соединения на килограмм веса тела субъекта. В некоторых вариантах доза составляет от 0,01 до 0,5 миллиграмма антисмыслового соединения на килограмм веса тела субъекта. В некоторых вариантах доза составляет от 0,05 до 0,5 миллиграмма антисмыслового соединения на килограмм веса тела субъекта.

В некоторых вариантах воплощения дозу вводят ежедневно. В некоторых вариантах дозу вводят еженедельно. В некоторых вариантах антисмысловое соединение вводят непрерывно, а доза представляет собой количество, вводимое в день. В некоторых вариантах способ включает введение, по меньшей мере, одной индукционной дозы в течение индукционной фазы и введение, по меньшей мере, одной поддерживающей дозы в течение поддерживающей фазы. В некоторых вариантах индукционная доза составляет от 0,05 до 5,0 миллиграмм антисмыслового соединения на килограмм веса тела субъекта. В некоторых вариантах поддерживающая доза составляет от 0,01 до 1,0 миллиграмма антисмыслового соединения на килограмм веса тела субъекта. В некоторых вариантах продолжительность индукционной фазы составляет, по меньшей мере, 1 неделю. В некоторых вариантах продолжительность поддерживающей фазы составляет, по меньшей мере, 1 неделю. В некоторых вариантах каждая индукционная доза и каждая поддерживающая доза составляет одну инъекцию. В некоторых вариантах каждая индукционная доза и каждая поддерживающая доза независимо состоят из двух или более инъекций. В некоторых вариантах антисмысловое соединение вводится, по меньшей мере, 2 раза в течение периода лечения, составляющего, по меньшей мере, 1 неделю. В некоторых вариантах период лечения составляет, по меньшей мере, один месяц. В некоторых вариантах период лечения составляет, по меньшей мере, 2 месяца. В некоторых вариантах период лечения составляет, по меньшей мере, 4 месяца. В некоторых вариантах индукционная доза вводится посредством одной или более болюсной инъекции, а поддерживающая доза вводится посредством инфузионного насоса.

В некоторых вариантах воплощения способ включает в себя оценку переносимости и/или эффективности антисмыслового соединения. В некоторых вариантах величина дозы или частота введения антисмыслового соединения уменьшается при обнаружении того, что введение антисмыслового соединения не переносится организмом. В некоторых вариантах величина дозы или частота введения антисмыслового соединения сохраняется или уменьшается при обнаружении того, что введение антисмыслового соединения является эффективным. В некоторых вариантах доза антисмыслового соединения увеличивается при обнаружении того, что введение антисмыслового соединения не является эффективным. В некоторых вариантах частота введения антисмыслового соединения уменьшается при обнаружении того, что введение антисмыслового соединения является эффективным. В некоторых вариантах частота введения антисмыслового соединения увеличивается при обнаружении того, что введение антисмыслового соединения не является эффективным.

В некоторых вариантах воплощения способы по настоящему изобретению включают совместное применение антисмыслового соединения и, по меньшей мере, одного другого вида терапии. В некоторых вариантах антисмысловое соединение и, по меньшей мере, один другой вид терапии применяются совместно в одно и то же время. В некоторых вариантах антисмысловое соединение вводят до применения, по меньшей мере, одного другого вида терапии. В некоторых вариантах антисмысловое соединение вводят после применения, по меньшей мере, одного другого вида терапии. В некоторых вариантах, по меньшей мере, один другой вид терапии включает введение одного или нескольких препаратов, выбранных из вальпроевой кислоты, рилузола, гидроксимочевины и бутирата. В некоторых вариантах, по меньшей мере, один другой вид терапии включает введение трихостатина А. В некоторых вариантах, по меньшей мере, один другой вид терапии включает введение стволовых клеток. В некоторых вариантах, по меньшей мере, один другой вид терапии представляет собой генную терапию. В некоторых вариантах генная терапия применяется к спинномозговой жидкости, а антисмысловое соединение вводят системно. В некоторых вариантах генная терапия применяется к спинномозговой жидкости, а антисмысловое соединение вводят системно и в спинномозговую жидкость. В некоторых вариантах настоящее изобретение обеспечивает схемы лечения, где на начальном этапе вводят антисмысловое соединение в спинномозговую жидкость и системно, а затем применяют генную терапию к спинномозговой жидкости и системное введение антисмыслового соединения. В некоторых таких вариантах субъект представляет собой младенца во время первичного лечения. В некоторых таких вариантах субъекту менее 2 лет. В некоторых вариантах антисмысловое соединение вводят в ЦНС субъекта, когда возраст субъекта допускает применение генной терапии. В некоторых таких вариантах антисмысловое соединение вводят системно на протяжении всего времени лечения.

В некоторых вариантах антисмысловое соединение вводят в концентрации примерно 0,01 мг/мл, примерно 0,05 мг/мл, примерно 0,1 мг/мл, примерно 0,5 мг/мл, примерно 1 мг/мл, примерно 5 мг/мл, примерно 10 мг/мл, примерно 50 мг/мл или примерно 100 мг/мл.

В некоторых вариантах воплощения включение экзона 7 SMN2 мРНК в мотонейронах субъекта усиливается. В некоторых вариантах усиливается включение аминокислотной последовательности экзона 7 в полипептид SMN2 в мотонейронах субъекта.

В некоторых вариантах настоящее изобретение обеспечивает способы усиления включения экзона 7 SMN2 мРНК в мотонейронах субъекта, включающие введение субъекту антисмыслового соединения, содержащего антисмысловой олигонуклеотид, комплементарный интрону 7 нуклеиновой кислоты, кодирующей человеческий SMN2, и тем самым усиление включения экзона 7 SMN2 мРНК в мотонейронах субъекта.

В некоторых вариантах изобретение обеспечивает способы усиления включения аминокислотной последовательности экзона 7 в полипептид SMN2 в мотонейронах субъекта, включающие введение субъекту антисмыслового соединения, содержащего антисмысловой олигонуклеотид, комплементарный интрону 7 нуклеиновой кислоты, кодирующей человеческий SMN2, и тем самым более эффективное включение аминокислотной последовательности экзона 7 в полипептид SMN2 в мотонейронах субъекта.

В некоторых вариантах воплощения субъект страдает спинальной мышечной атрофией (СМА). В некоторых вариантах субъект имеет тип I CMA. В некоторых вариантах субъект имеет тип II СМА. В некоторых вариантах субъект имеет тип III СМА.

В некоторых вариантах воплощения первую дозу вводят в период внутриутробного развития. В некоторых вариантах первая доза вводится до полного формирования гематоэнцефалического барьера. В некоторых вариантах первая доза вводится в течение 1 недели со дня рождения субъекта. В некоторых вариантах первая доза вводится в течение 1 месяца с момента рождения субъекта. В некоторых вариантах первая доза вводится в течение 3 месяцев со дня рождения субъекта. В некоторых вариантах первая доза вводится в течение 6 месяцев со дня рождения субъекта. В некоторых вариантах первая доза вводится субъекту в возрасте от 1 до 2 лет. В некоторых вариантах первая доза вводится субъекту в возрасте от 1 до 15 лет. В некоторых вариантах первая доза вводится субъекту в возрасте старше 15 лет.

В некоторых вариантах воплощения субъект является млекопитающим. В некоторых вариантах субъект является человеком.

В некоторых вариантах способы по настоящему изобретению включают определение субъекта, страдающего СМА. В некоторых вариантах субъект определяется путем измерения электрической активности одной или нескольких мышц субъекта. В некоторых вариантах субъект определяется с помощью генетического теста, показывающего, имеет ли субъект мутацию гена SMN1. В некоторых вариантах субъект идентифицируется с помощью мышечной биопсии.

В некоторых вариантах воплощения введение антисмыслового соединения приводит к увеличению количества SMN2 мРНК, содержащих экзон 7, по меньшей мере, на 10%. В некоторых вариантах увеличение количества SMN2 мРНК, содержащих экзон 7, составляет, по меньшей мере, 20%. В некоторых вариантах увеличение количества SMN2 мРНК, содержащих экзон 7, составляет, по меньшей мере, 50%. В некоторых вариантах количество SMN2 мРНК, содержащих экзон 7, составляет, по меньшей мере, 70%.

В некоторых вариантах воплощения введение антисмыслового соединения приводит к увеличению количества SMN2 полипептидов, содержащих аминокислотную последовательность экзона 7, по меньшей мере, на 10%. В некоторых вариантах увеличение количества SMN2 полипептидов, содержащих аминокислотную последовательность экзона 7, составляет, по меньшей мере, 20%. В некоторых вариантах увеличение количества SMN2 полипептидов, содержащих аминокислотную последовательность экзона 7, составляет, по меньшей мере, 50%. В некоторых вариантах увеличение количества SMN2 полипептидов содержащих аминокислотную последовательность экзона 7, составляет, по меньшей мере, 70%.

В некоторых вариантах воплощения введение антисмыслового соединения улучшает,

по меньшей мере, один из симптомов СМА у субъекта. В некоторых вариантах введение антисмыслового соединения приводит к улучшению двигательных функций у субъекта. В некоторых вариантах введение антисмыслового соединения приводит к задержке или снижению потери двигательной функции у субъекта. В некоторых вариантах введение антисмыслового соединения приводит к улучшению дыхательных функций. В некоторых вариантах введение антисмыслового соединения приводит к улучшению выживаемости.

В некоторых вариантах воплощения, по меньшей мере, один нуклеозид антисмыслового олигонуклеотида содержит модифицированный остаток сахара. В некоторых вариантах, по меньшей мере, один модифицированный остаток сахара содержит 2'-метоксиэтил остаток сахара. В некоторых вариантах практически каждый нуклеозид антисмыслового олигонуклеотида содержит модифицированный остаток сахара. В некоторых вариантах нуклеозиды, содержащие модифицированные остатки сахара, имеют одинаковые модификации сахарных групп. В некоторых вариантах каждый модифицированный остаток сахара содержит 2'-метоксиэтил остаток сахара. В некоторых вариантах каждый нуклеозид антисмыслового олигонуклеотида содержит модифицированный остаток сахара. В некоторых вариантах нуклеозиды имеют одинаковые модификации сахаров. В некоторых вариантах каждый модифицированный остаток сахара содержат 2'-метоксиэтил остаток сахара. В некоторых вариантах, по меньшей мере, одна межнуклеозидная связь является фосфоротиоатной межнуклеозидной связью. В некоторых вариантах каждая межнуклеозидная связь является фосфоротиоатной межнуклеозидной связью.

В некоторых вариантах воплощения антисмысловой олигонуклеотид состоит из от 10 до 25 связанных нуклеозидов. В некоторых вариантах антисмысловой олигонуклеотид состоит из от 12 до 22 связанных нуклеозидов. В некоторых вариантах антисмысловой олигонуклеотид состоит из от 15 до 20 связанных нуклеозидов. В некоторых вариантах антисмысловой олигонуклеотид состоит из 18 связанных нуклеозидов.

В некоторых вариантах воплощения антисмысловой олигонуклеотид комплементарен, по меньшей мере, на 90% нуклеиновой кислоте, кодирующей человеческий SMN2. В некоторых вариантах антисмысловой олигонуклеотид полностью комплементарен нуклеиновой кислоте, кодирующей человеческий SMN2. В некоторых вариантах олигонуклеотид имеет последовательность азотистых оснований, содержащую, по меньшей мере, 10 смежных азотистых оснований последовательности SEQ ID NO:1. В некоторых вариантах олигонуклеотид имеет последовательность азотистых оснований, содержащую, по меньшей мере, 15 смежных азотистых оснований последовательности SEQ ID NO:1. В некоторых вариантах олигонуклеотид имеет последовательность, включающую последовательность азотистых оснований SEQ ID NO:1. В некоторых вариантах олигонуклеотид имеет последовательность азотистых оснований, состоящую из последовательности азотистых оснований SEQ ID NO:1.

В некоторых вариантах антисмысловое соединение содержит конъюгированную или терминальную группу.

В некоторых вариантах антисмысловое соединение состоит из антисмыслового олигонуклеотида.

В некоторых вариантах воплощения антисмысловое соединение также вводится системно. В некоторых вариантах системное введение осуществляется посредством внутривенного или внутрибрюшинного введения. В некоторых вариантах системное введение и введение в центральную нервную систему осуществляются одновременно. В некоторых вариантах системное введение и введение в центральную нервную систему осуществляются в разное время.

В некоторых вариантах воплощения настоящее изобретение обеспечивает системное введение антисмысловых соединений, либо самостоятельно, либо в комбинации с введением в спинномозговую жидкость. В некоторых вариантах фармацевтические композиции вводят системно. В некоторых вариантах фармацевтические композиции вводят подкожно. В некоторых вариантах фармацевтические композиции вводят внутривенно. В некоторых вариантах фармацевтические композиции вводят внутримышечно.

В некоторых вариантах воплощения фармацевтические композиции вводят непосредственно в спинномозговую жидкость (например, путем интратекальной и/или интрасеребровентрикулярной инъекции и/или инфузии) и системно.

В некоторых вариантах воплощения настоящее изобретение обеспечивает способы введения субъекту, имеющему, по меньшей мере, один симптом, ассоциированный со СМА, по меньшей мере, одной дозы антисмыслового соединения, содержащего олигонуклеотид, состоящий из от 15 до 20 связанных нуклеозидов и имеющий последовательность азотистых оснований, которая комплементарна на 100% последовательности SEQ ID NO:7, где каждый нуклеозид представляет собой 2'-O-(2-метокси)этил нуклеозид, и где, по меньшей мере, одна доза составляет от 0,1 мг/кг до 5 мг/кг и вводится в спинномозговую жидкость. В некоторых таких вариантах доза составляет от 0,5 мг/кг до 2 мг/кг. В некоторых вариантах, по меньшей мере, одна доза вводится посредством болюсного инъекции. В некоторых таких вариантах дозу вводят путем болюсной интратекальной инъекций. В некоторых вариантах вводится, по меньшей мере, одна повторная доза. В некоторых таких вариантах вторая доза вводится, по меньшей мере, через 2 недели после введения первой дозы. В некоторых вариантах вторая доза вводится, по меньшей мере, через 4 недели после введения первой дозы. В некоторых вариантах вторая доза вводится, по меньшей мере, через 8 недель после введения первой дозы. В некоторых вариантах вторая доза вводится, по меньшей мере, через 12 недель после введения первой дозы. В некоторых вариантах вторая доза вводится, по меньшей мере, через 16 недель после введения первой дозы. В некоторых вариантах вторая доза вводится, по меньшей мере, через 20 недель после введения первой дозы. В некоторых вариантах субъект младше 2 лет на момент введения первой дозы. В некоторых вариантах субъекту от 2 до 15 лет. В некоторых вариантах субъекту от 15 до 30 лет. В некоторых вариантах субъект старше 30 лет. В некоторых вариантах прогрессирование, по меньшей мере, одного симптома, ассоциированного со СМА, замедляется. В некоторых вариантах олигонуклеотид представляет собой ISIS396443.

В некоторых вариантах воплощения настоящее изобретение обеспечивает способы введения субъекту, имеющему, по меньшей мере, один симптом, ассоциированный со СМА, по меньшей мере, одной дозы антисмыслового соединения, включающего олигонуклеотид, состоящий из от 15 до 20 связанных нуклеозидов и имеющий последовательность азотистых оснований, которая на 100% комплементарна последовательности SEQ ID NO:7, и где каждый нуклеозид представляет собой 2'-O-(2-метокси)этил нуклеозид, и где, по меньшей мере, одну дозу вводят системно. В некоторых таких вариантах, по меньшей мере, одну дозу вводят посредством болюсной инъекции. В некоторых таких вариантах дозу вводят с помощью болюсной подкожной инъекции. В некоторых вариантах доза составляет от 0,5 мг/кг до 50 мг/кг. В некоторых вариантах доза составляет от 1 мг/кг до 10 мг/кг. В некоторых вариантах доза составляет от 1 мг/кг и 5 мг/кг. В некоторых вариантах доза составляет от 0,5 мг/кг до 1 мг/кг. В некоторых вариантах вводят, по меньшей мере, одну повторную дозу. В некоторых таких вариантах вторая доза вводится, по меньшей мере, через 2 недели после введения первой дозы. В некоторых вариантах вторая доза вводится, по меньшей мере, через 4 недели после введения первой дозы. В некоторых вариантах вторая доза вводится, по меньшей мере, через 8 недель после введения первой дозы. В некоторых вариантах вторая доза вводится, по меньшей мере, через 12 недель после введения первой дозы. В некоторых вариантах вторая доза вводится, по меньшей мере, через 16 недель после введения первой дозы. В некоторых вариантах вторая доза вводится, по меньшей мере, через 20 недель после введения первой дозы. В некоторых вариантах субъект младше 2 лет на момент введения первой дозы. В некоторых вариантах субъекту от 2 до 15 лет. В некоторых вариантах субъекту от 15 до 30 лет. В некоторых вариантах субъект старше 30 лет. В некоторых вариантах прогрессирование, по меньшей мере, одного симптома, ассоциированного со СМА, замедляется. В некоторых вариантах олигонуклеотид представляет собой ISIS396443.

В некоторых вариантах воплощения настоящее изобретение обеспечивает способы введение субъекту, имеющему, по меньшей мере, один симптом, ассоциированный со СМА, по меньшей мере, одной дозы в спинномозговую жидкость и, по меньшей мере, одной системной дозы антисмыслового соединения, содержащего олигонуклеотид, состоящий из от 15 до 20 связанных нуклеозидов и имеющий последовательность азотистых оснований, которая на 100% комплементарна последовательности SEQ ID NO:7, и где каждый нуклеозид представляет собой 2'-O-(2-метокси)этил нуклеозид. В некоторых таких вариантах доза, вводимая в спинномозговую жидкость, составляет от 0,1 мг/кг до 5 мг/кг. В некоторых вариантах системная доза составляет от 0,5 мг/кг до 50 мг/кг. В некоторых вариантах, по меньшей мере, одна доза, вводимая в спинномозговую жидкость, вводится посредством болюсной инъекции. В некоторых таких вариантах, по меньшей мере, одна доза, вводимая в спинномозговую жидкость, вводится посредством болюсной интратекальной инъекции. В некоторых вариантах, по меньшей мере, одна системная доза вводится посредством болюсной инъекции. В некоторых таких вариантах, по меньшей мере, одна системная доза вводится посредством подкожной инъекции. В некоторых вариантах доза, вводимая в спинномозговую жидкость, и системная доза вводятся одновременно. В некоторых вариантах доза, вводимая в спинномозговую жидкость, и системная доза вводятся в разное время. В некоторых вариантах субъект младше 2 лет на момент введения первой дозы. В некоторых вариантах субъекту от 2 до 15 лет. В некоторых вариантах субъекту от 15 до 30 лет. В некоторых вариантах субъект старше 30 лет. В некоторых вариантах прогрессирование, по меньшей мере, одного симптома, ассоциированного со СМА, замедляется. В некоторых вариантах олигонуклеотид представляет собой ISIS396443.

В некоторых вариантах воплощения настоящее изобретение обеспечивает способы введения субъекту, имеющему, по меньшей мере, один симптом, ассоциированный со СМА, по меньшей мере, одной системной дозы антисмыслового соединения, содержащего олигонуклеотид, состоящий из от 15 до 20 связанных нуклеозидов и имеющий последовательность азотистых оснований, которая на 100% комплементарна последовательности SEQ ID NO:7, и где каждый нуклеозид представляет собой 2'-O-(2-метокси)этил нуклеозид, и, по меньшей мере, одной дозы геннотерапевтического агента. В некоторых вариантах системная доза составляет от 0,5 мг/кг до 50 мг/кг. В некоторых вариантах, по меньшей мере, одна системная доза вводится посредством болюсной инъекции. В некоторых таких вариантах, по меньшей мере, одна системная доза вводится посредством подкожной инъекции. В некоторых вариантах системная доза и геннотерапевтический агент вводятся одновременно. В некоторых вариантах системная доза и геннотерапевтический агент вводятся в разное время. В некоторых вариантах геннотерапевтический агент вводят в спинномозговую жидкость. В некоторых таких вариантах геннотерапевтический агент вводят посредством интратекальной инъекции и/или инфузии. В некоторых таких вариантах геннотерапевтический агент вводят посредством интрасеребровентрикулярной инъекции и/или инфузии. В некоторых вариантах субъект младше 2 лет на момент введения первой дозы. В некоторых вариантах субъекту от 2 до 15 лет. В некоторых вариантах субъекту от 15 до 30 лет. В некоторых вариантах субъект старше 30 лет. В некоторых вариантах прогрессирование, по меньшей мере, одного симптома, ассоциированного со СМА, замедляется. В некоторых вариантах олигонуклеотид представляет собой ISIS396443.

В некоторых вариантах воплощения настоящее изобретение обеспечивает способы выбора субъекта, имеющего, по меньшей мере, один симптом, ассоциированный со СМА, и введения антисмыслового соединения, согласно любому из способов, описанных выше. В некоторых таких вариантах, по меньшей мере, один из симптомов СМА оценивается после введения. В некоторых таких вариантах, по меньшей мере, один из симптомов СМА улучшается. В некоторых таких вариантах, по меньшей мере, один из симптомов СМА не прогрессирует или прогрессирует более медленно по сравнению с симптомами субъекта, которому не вводили антисмысловое соединение.

В некоторых вариантах воплощения настоящее изобретение обеспечивает антисмысловое соединение, содержащее антисмысловой олигонуклеотид, комплементарный интрону 7 нуклеиновой кислоты, кодирующей человеческий SMN2, для использования в любом из вышеперечисленных способов. В некоторых вариантах изобретение обеспечивает такое соединение для использования в лечении болезни или состояния, ассоциированного с фактором выживаемости мотонейронов 1 (SMN1).

В некоторых вариантах воплощения настоящее изобретение обеспечивает использование антисмыслового соединения, содержащего антисмысловой олигонуклеотид, комплементарный интрону 7 нуклеиновой кислоты, кодирующей человеческий SMN2, в производстве лекарственного средства для использования в любом из вышеупомянутых способов. В некоторых вариантах лекарственное средство предназначено для лечения заболевания или состояния, ассоциированного с фактором выживаемости мотонейронов 1 (SMN1).

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На фигуре 1 показаны результаты продолжительности действия, описанные в Примере 4, где процентное содержание SMN2, содержащего экзон 7 (ось ординат), оценивалось в 0, 2, 4, 6 и 8 недель после окончания 7 дней лечения (ось абсцисс). Образец недели "0" был взят в один день после прекращения лечения. Значения CON относятся к мышам, получавшим физиологический раствор. Различий в % включения от контрольных значений мышей, получавшим физиологический раствор, между значениями, полученными в различные моменты времени от 0 до 6 месяцев, не зафиксировано.

На фигуре 2 представлены результаты продолжительности действия, описанные в Примере 4, где процентное количество SMN2, содержащего экзон 7, оценивалось в 0, 0,5, 1, 2, 5 и 6 месяцев после окончания 7 дней лечения. Образец месяца "0" был взят в один день после прекращения лечения. Значения CON относятся к мышам, получавших физиологический раствор. Различий в % включения от контрольных значений мышей, получавшим физиологический раствор, между значениями, полученными в различные моменты времени от 0 до 6 месяцев, не зафиксировано.

На фигуре 3 показаны результаты экспериментов, описанных в Примере 6, по измерению эффекта эмбрионального введения ISIS396443 на длину хвоста Тайваньской линии СМА мышей. На фиг.ЗА показан первый такой эксперимент, а на фигуре 3В - повторный эксперимент при различных концентрациях антисмысловых соединений, включающие также значения нормальных мышей для сравнения.

На фигуре 4 показаны результаты вестерн-блоттинга, описанные в Примере 7. Ось Y представляет процент SMN, включающих экзон 7, в различных образцах.

На рисунках 5 и 6 показаны результаты экспериментов, описанных в Примере 7. Ряд значений для СМА мышей (Тайваньской линии) определены после лечения антисмысловыми соединениями или контрольным олигонуклеотидом.

На фигуре 7 показана кривая выживаемости, полученная в эксперименте, описанном в Примере 7.

На фигуре 8 показаны результаты оценки количества моторных нейронов в различных участках спинного мозга после лечения антисмысловыми соединениями или контрольным олигонуклеотидом, как описано в Примере 7.

На фигуре 9 показаны результаты оценки полных SMN РНК (включающих экзон 7) у животных, получавших лечение антисмысловыми соединениями, как описано в Примере 7.

На фигуре 10 показаны кривые выживаемости, полученные в эксперименте, описанном в Примере 7, в которых животные (1) не получали лечения, (2) получали одну дозу антисмыслового соединения при рождении (День Р0), или (3) получали первую дозу в Р0 и вторую дозу в 21 день (Р21).

На фигуре 11 показаны кривые выживаемости, полученные в эксперименте, описанном в Примере 7, сравнивая животных, которые получили вторую дозу, с животными, которые получили только первую дозу.

На фигуре 12 показаны результаты эксперимента, описанного в Примере 9, в котором антисмысловые соединения вводили обезьянам с помощью интратекальной инфузии, а концентрация соединения оценивалась в различных тканях 96 часов спустя.

На фигуре 13 показаны кривые выживаемости, полученные в эксперименте, описанном в Примере 12, в котором различные дозы антисмыслового соединения вводились мышам с тяжелой формой СМА путем подкожной инъекции.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Следует понимать, что вышерассмотренное общее описание и последующее подробное описание приведены в качестве примеров и лишь поясняют, но не ограничивают изобретение в том виде, как оно заявлено. При этом использование единственного числа включает в себя множественное, если специально не оговорено иное. Использование здесь союза "или" означает "и/или", если не указано иное. Кроме того, использование термина "включая", а также других форм, таких как "включает" и "включено", является неограничивающим. Также такие термины, как "элемент" или "компонент", охватывают элементы и компоненты, содержащие одну единицу, и элементы и компоненты, которые составляют более одной субъединицы, если специально не оговорено иное.

Заголовки разделов используются здесь для организационных целей и не должны рассматриваться как ограничивающие суть изобретения. Все документы или части документов, цитированные в данной заявке, включающие, но, не ограничиваясь этим, патенты, заявки на патенты, статьи, книги и монографии, включены в настоящий документ посредством ссылки в полном объеме для любых целей.

I. Определения

Если не указаны конкретные определения, номенклатура, использованная здесь, а также процедуры и методы аналитической химии, синтетической органической химии, а также медицинской и фармацевтической химии, описанные здесь, широко используются и хорошо известны из уровня техники. Стандартные методы могут быть использованы для химического синтеза и химического анализа. Некоторые такие методы и процедуры могут быть найдены, например, в "Carbohydrate Modifications in Antisense Research" под ред. Sangvi и Cook, American Chemical Society, Washington D.C., 1994; "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., 18th edition, 1990; и "Antisense Drug Technology, Principles, Strategies, and Applications" под ред. Stanley Т. Crooke, CRC Press, Boca Raton, Florida; и Sambrook et al, "Molecular Cloning, A laboratory Manual," 2nd Edition, Cold Spring Harbor Laboratory Press, 1989, которые включены в настоящее описание посредством ссылки для любых целей. В случаях, где это допустимо, все патенты, заявки, опубликованные заявки и другие публикации, а также другие сведения, упомянутые в настоящем документе, включены посредством ссылки в полном объеме.

Если не указано иное, следующие термины имеют следующие значения:

"Нуклеозид" означает вещество, содержащее остаток гетероциклического основания и остаток сахара. Нуклеозиды включают, но не ограничиваются этим, природные нуклеозиды, модифицированные нуклеозиды и нуклеозиды, имеющие миметические основания и/или сахарные группы. Нуклеозиды могут быть модифицированы с помощью любого из множества заместителя.

"Остаток сахара" означает природный или модифицированный сахар или заменитель сахара.

"Природный сахар" означает остаток рибофуранозы ДНК (2'-Н) или РНК (2'-ОН).

"Модифицированный сахар" означает остаток рибофуранозы, содержащий, по меньшей мере, один заместитель, отличающий его от природного сахара.

"Заменитель сахара" означает структуру, отличающуюся от кольца рибофуранозы, которая способна заменять сахар нуклеозида. Примеры заменителей Сахаров включают, но не ограничиваются этим, системы открытых колец, 6-членные кольца, сахара, в которых кислород замещен, например, на серу или азот. Например, заменители Сахаров включают, но не ограничиваются этим, морфолины и 4'-тио-содержащие сахара.

"Азотистое основание" означает остаток гетероциклического основания нуклеозида. Азотистые основания могут быть природными или модифицированными. В некоторых вариантах азотистое основание может включать любой атом или группу атомов, способных образовывать водородные связи с азотистым основанием другой нуклеиновой кислоты.

"Нуклеотид" означает нуклеозид, включающий фосфатную группу. При использовании здесь нуклеозиды включают нуклеотиды.

"Модифицированный нуклеозид" означает нуклеозид, содержащий, по меньшей мере, одну модификацию по сравнению с природными РНК или ДНК нуклеозидами. Такая модификация может приходиться на остаток сахара и/или азотистое основание.

"Бициклический нуклеозид" или "БНК" означает нуклеозид, в котором остаток сахара нуклеозида содержит мостик, соединяющий два атома углерода сахарного кольца, образуя тем самым бициклический остаток сахара.

"4'-2' бициклический нуклеозид" означает бициклический нуклеозид, включающий фуранозное кольцо, содержащее мостик, соединяющий два атома углерода фуранозного кольца, соединяющего 2' атом углерода и 4' атом углерода сахарного кольца.

"2'-модифицированный" или "2'-замещенный" означает нуклеозид, включающий сахар, содержащий заместитель в положении 2', отличающийся от Н или ОН.

"2'-ОМе" или "2'-OCH3" или "2'-O-метил" каждый означает нуклеозид, включающий сахар, содержащий -OCH3 группу в 2' положении кольца сахара.

"МОЭ", или "2'-МОЭ", или "2'-OCH2CH2OCH3", или "2'-O-метоксиэтил", означает нуклеозид, включающий сахар, содержащий -OCH2CH2OCH3 группу в положении 2' кольца сахара.

"Олигонуклеотид" означает соединение, содержащее множество связанных нуклеозидов. В некоторых вариантах один или несколько из множества нуклеозидов модифицированы. В некоторых вариантах олигонуклеотид содержит один или более рибонуклеозидов (РНК) и/или дезоксирибонуклеозидов (ДНК).

"Олигонуклеозид" означает олигонуклеотид, в котором ни одна из межнуклеозидных связей не содержит атом фосфора. При использовании здесь олигонуклеотиды включают олигонуклеозиды.

"Модифицированный олигонуклеотид" означает олигонуклеотид, содержащий, по меньшей мере, один модифицированный нуклеозид и/или, по меньшей мере, одну модифицированную межнуклеозидную связь.

"Межнуклеозидная связь" означает ковалентную связь между соседними нуклеозидами олигонуклеотида.

"Природная межнуклеозидная связь" означает 3'-5' фосфодиэфирную связь.

"Модифицированная межнуклеозидная связь" означает любую межнуклеозидную связь, отличную от природной межнуклеозидной связи.

"Олигомерное соединение" означает соединение, содержащее олигонуклеотид. В некоторых вариантах олигомерное соединение состоит из олигонуклеотида. В некоторых вариантах олигомерное соединение дополнительно содержит один или несколько конъюгированных и/или терминальных групп.

"Антисмысловое соединение" означает олигомерное соединение, которое, по меньшей мере, частично комплементарно целевой нуклеиновой кислоте и гибридизуется с ней, где такая гибридизация является следствием, по меньшей мере, одной антисмысловой активности.

"Антисмысловой олигонуклеотид" означает антисмысловое соединение, где олигомерное соединение представляет собой олигонуклеотид.

"Антисмысловая активность" относится к любому детектируемому и/или измеряемому эффекту, свойственному гибридизации антисмыслового соединения с целевой нуклеиновой кислотой. В некоторых вариантах такая антисмысловая активность представляет собой увеличение или уменьшение количества нуклеиновой кислоты или белка. В некоторых вариантах такая антисмысловая активность представляет собой изменение соотношения сплайсинговых вариантов нуклеиновой кислоты или белка. В некоторых вариантах такая антисмысловая активность представляет собой фенотипическое изменение клеток и/или субъекта.

"Детектируемая" или "измеряемая" антисмысловая активность может быть прямой или косвенной. Например, в некоторых вариантах антисмысловая активность оценивается путем детектирования и/или измерения количества целевой нуклеиновой кислоты или белка либо относительного количества сплайсинговых вариантов целевой нуклеиновой кислоты или белка. В некоторых вариантах антисмысловая активность детектируется путем оценки фенотипических изменений клетки или животного. В связи с какой-либо активностью, ответом или эффектом, термины "детектируемый" и "измеряемый" показывают, что осуществлялся тест для детекции или измерения. Такое детектирование и/или измерение может включать нулевые значения. Так, если тест для детекции или измерения показывает отсутствие активности (нулевая активность), этап детектирования или измерения активности при этом, все равно, осуществлялся.

"Целевая нуклеиновая кислота" относится к любой молекуле нуклеиновой кислоты, экспрессия, количество или активность которой способна модулироваться антисмысловым соединением.

"Целевая мРНК" означает предварительно выбранную молекулу РНК, которая кодирует белок.

"Целевая пре-мРНК" означает предварительно выбранный РНК транскрипт, который не полностью процессирован в мРНК, а именно пре-мРНК включает в себя один или более интронов.

"Целевой белок" означает белок, кодируемый целевой нуклеиновой кислотой.

"Модуляция" означает изменение функции или активности. В некоторых вариантах модуляция означает увеличение экспрессии генов. В некоторых вариантах модуляция означает уменьшение экспрессии генов.

"Экспрессия" означает любые функции и этапы, посредством которых информация, кодируемая геном, преобразуется в структуры, присутствующие и используемые в клетке.

"Последовательность азотистых оснований" означает порядок последовательных азотистых оснований в направлении от 5' конца к 3' концу, независимо от сахаров, связей и/или модификаций азотистых оснований.

"Смежные азотистые основания " означают азотистые основания, прилегающие в нуклеиновой кислоте друг к другу.

"Комплементарность азотистых оснований" означает способность двух азотистых оснований нековалентно спариваться за счет образования водородных связей.

"Комплементарный" означает, что первая нуклеиновая кислота способна гибридизоваться со второй нуклеиновой кислотой в строгих условиях гибридизации. Например, антисмысловое соединение является комплементарным к целевой нуклеиновой кислоте, если оно способно гибридизоваться с целевой нуклеиновой кислотой в строгих условиях гибридизации.

"Полностью комплементарный" означает, что каждое азотистое основание первой нуклеиновой кислоты способно спариваться с соответствующим азотистым основанием второй нуклеиновой кислоты.

"Процентная комплементарность" антисмыслового соединения означает процентное соотношение азотистых оснований антисмыслового соединения, которое комплементарно части целевой нуклеиновой кислоты эквивалентной длины. Процентная комплементарность рассчитывается путем деления числа азотистых оснований антисмыслового олигонуклеотида, которые комплементарны азотистым основаниям в соответствующих смежных позициях целевой нуклеиновой кислоте, к общей длине антисмыслового соединения.

"Процентная идентичность" означает число азотистых оснований в первой нуклеиновой кислоте, которые идентичны азотистым основаниям в соответствующих позициях во второй нуклеиновой кислоте, деленное на общее число азотистых оснований первой нуклеиновой кислоте.

"Гибридизировать" означает отжиг комплементарных нуклеиновых кислот, который происходит за счет комплементарности азотистых оснований.

"Ошибочно спаренный" означает азотистое основание из первой нуклеиновой кислоты, которое не способно спариваться с азотистым основанием в соответствующей позиции второго нуклеиновой кислоты.

"Идентичная последовательность азотистых оснований" означает наличие аналогичной последовательности азотистых оснований, свободной от каких-либо химических модификаций нуклеозидов.

"Различные модификации" или "различно модифицированный" относятся к нуклеозидам или межнуклеозидным связям, которые имеют различные модификации нуклеозидов или межнуклеозидных связей, отличающиеся друг от друга, в том числе отсутствие модификаций. Так, например, МОЭ нуклеозид и немодифицированный ДНК нуклеозид являются "различно модифицированными", несмотря на то, что ДНК нуклеозид является немодифицированным. Более того, ДНК и РНК "различно модифицированны", хотя оба являются природными немодифицированными нуклеозидами. Сходные нуклеозиды, содержащие различные азотистые основания, не являются различно модифицированными, если не указано иное. Например, нуклеозид, содержащий 2'-ОМе сахар и азотистое основание аденин, и нуклеозид, содержащий 2'-ОМе сахар и азотистое основание тимин, не являются различно модифицированными.

"Одинаковые модификации" относятся к одинаковым нуклеозидам и межнуклеозидным связям (в том числе немодифицированным нуклеозидам и межнуклеозидным связям). Так, например, два немодифицированных нуклеозида ДНК имеют одинаковые модификации, хотя ДНК нуклеозиды являются немодифицированными.

"Тип модификации" или нуклеозид "типа" означает модификацию нуклеозида и включает в себя модифицированные и немодифицированные нуклеозиды. Соответственно, если не указано иное, "нуклеозид с модификацией первого типа" может быть немодифицированным нуклеозидом.

"Отдельные регионы" олигонуклеотида означает часть олигонуклеотида, в которой все нуклеозиды и межнуклеозидные связи внутри региона содержат одинаковые модификации, а нуклеозиды и/или межнуклеозидные связи соседних частей включают, по меньшей мере, одну различную модификацию.

"Мотив" означает характерную последовательность модифицированных и/или немодифицированных азотистых оснований, Сахаров и/или межнуклеозидных связей в олигонуклеотиде.

"Полностью модифицированный олигонуклеотид" означает, что каждое азотистое основание, каждый сахар и/или каждая межнуклеозидная связь модифицирована.

"Равномерно модифицированный олигонуклеотид" означает, что каждое азотистое основание, каждый сахар и/или каждая межнуклеозидная связь имеет одинаковую модификацию по всему модифицированному олигонуклеотиду.

"Переменный мотив" означает олигонуклеотид или его часть, имеющую, по меньшей мере, четыре отдельных региона модифицированных нуклеозидов в последовательности (AB)nAm, где А представляет регион нуклеозидов, имеющих первый тип модификаций; В представляет собой регион нуклеозидов, имеющих другой тип модификаций; n представляет собой число от 2 до 15; а m - 0 или 1. Таким образом, в некоторых вариантах, переменные мотивы включают 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 или более чередующихся регионов. В некоторых вариантах, каждый А регион и каждый В регион независимо включают от 1 до 4 нуклеозидов.

"Субъект" означает человека или животное, отличное от человека, выбранное для лечения или терапии.

"Субъект, нуждающихся в этом" означает субъекта, идентифицированного как нуждающийся в терапии или лечении. В таких вариантах субъект имеет один или более признаков наличия или развития СМА.

"Введение" означает предоставление лекарственного средства или композиции субъекту и включает, но не ограничиваясь этим, введение с помощью профессиональной медицинской помощи и самостоятельно.

"Парентеральное введение" означает введение посредством инъекции или инфузии. Парентеральное введение включает, но не ограничиваясь этим, подкожное введение, внутривенное введение или внутримышечное введение.

"Системное введение" означает введение в область, отличную от предполагаемой области активности. Примерами системного введения являются подкожное введение, внутривенное введение и внутрибрюшинное введение.

"Подкожное введение" означает введение непосредственно под кожу.

"Внутривенное введение" означает введения в вену.

"Спинномозговая жидкость" или "СМЖ" означает жидкость, заполняющую полости головного и спинного мозга.

"Введение в спинномозговую жидкость" означает любое введение, обеспечивающее доставку вещества непосредственно в спинномозговую жидкость.

"Интрацеребровентрикулярное" или "ИСВ" означает введение в систему желудочков головного мозга.

"Интратекальное" или "ИТ" означает введения в спинномозговую жидкость под паутинной мембраной, которая покрывает головной и спинной мозг. ИТ-инъекция производится через оболочки спинного мозга в субарахноидальное пространство, где фармацевтические агент вводится в оболочки, окружающие спинной мозг.

"Индукционная фаза" означает начальную фазу лечения, в течение которой равновесные концентрации активного фармацевтического агента достигают ткани-мишени. Например, индукционная фаза является фазой лечения, в течение которой равновесная концентрация антисмысловых олигонуклеотидов достигает печени.

"Поддерживающая фаза" означает последующую фазу лечения, когда равновесные концентрации препарата достигли ткани-мишени.

"Продолжительность" означает период времени, в течение которого активность или событие продолжается. Например, продолжительность индукционной фазы представляет собой период времени, в течение которого вводятся индукционные дозы.

"Поддерживающая доза" означает дозу для однократного введения в течение поддерживающей фазы. При использовании здесь "индукционная доза" означает дозу для однократного введения в течение индукционной фазы.

"Совместное введение" означает введение двух или более фармацевтических агентов субъекту. Два или более фармацевтических агента могут быть в одной фармацевтической композиции или в отдельных фармацевтических композициях. Каждый из двух или более фармацевтических агентов могут быть введены одним и тем же или различными способами. Совместное введение выполняется параллельно или последовательно.

"Терапия" означает способ лечения болезни. В некоторых вариантах терапия включает, но не ограничиваясь этим, хирургическую терапию, химическую терапию и физическое вмешательство, такие как вспомогательная искусственная вентиляция легких, питательные трубки и силовая физическая терапия.

"Лечение" означает применение одного или нескольких конкретных процедур, используемых для лечения или улучшение состояния болезни. В некоторых вариантах конкретные процедуры представляют собой введение одного или нескольких фармацевтических агентов.

"Улучшение" означает уменьшение тяжести, по меньшей мере, одного из показателей состояния или болезни. В некоторых вариантах улучшение включает задержку или замедление прогрессирования одного или нескольких показателей состояния или болезни. Показатели тяжести могут быть определены с помощью субъективных или объективных показателей, которые известны специалистам в данной области техники.

"Предупреждение наступления" означает предупреждение развития состояния или заболевания у субъекта, который имеет риск развития заболевания или состояния. В некоторых вариантах субъект, имеющий риск развития заболевания или состояния, получает лечение, похожее на лечение, которое получает субъект, имеющий заболевание или состояние.

"Задержка наступления" означает задержку развития состояния или заболевания у субъекта, который имеет риск развития заболевания или состояния.

"Замедление прогрессирования" означает, что степень тяжести, по меньшей мере, одного симптома, ассоциированного с болезнью или состоянием, ухудшается менее быстро.

"Аминокислотная последовательность экзона 7" означает часть SMN белка, которая соответствует экзону 7 из РНК SMN. Аминокислотная последовательность экзона 7 присутствуют в белке SMN, экспрессированного из РНК SMN, где экзон 7 не исключен во время сплайсинга.

"Белок SMN" означает нормальный белок фактора выживаемости мотонейронов полной длины. SMN может быть экспрессирован из SMN1 гена или SMN2 гена при условии, что экзон 7 присутствует в зрелой мРНК, а аминокислотная последовательность экзона 7 присутствует в SMN белке.

"Доза" означает определенное количество фармацевтического агента, вводимое однократно или в течение определенного отрезка времени. В некоторых вариантах доза может быть представлена в двух или более болюсах, таблетках или инъекциях. Например, в некоторых вариантах, когда предпочтительно подкожное, интертекальное или интрасеребровентрикулярное введение, однократное введение требуемого объема дозы затруднено. В таких вариантах две или более инъекций могут быть использованы для достижения требуемой дозы. В условиях непрерывной инфузии доза может быть выражена как количество лекарственного средства, доставляемого в единицу времени.

"Единица дозировки " означает форму, в которой предоставляется фармацевтический агент. В некоторых вариантах единица дозировки представляет собой флакон, содержащий лиофилизированный олигонуклеотид. В некоторых вариантах единица дозировки представляет собой флакон, содержащий восстановленный олигонуклеотид.

"Терапевтически эффективное количество" означает количество лекарственного средства, которое обеспечивает терапевтический эффект на животных.

"Фармацевтическая композиция" означает смесь веществ, пригодных для введения индивидууму, которая включает фармацевтическое средство. Например, фармацевтическая композиция может включать в себя модифицированный олигонуклеотид и стерильный водный раствор.

"Приемлемый профиль безопасности" означает совокупность побочных эффектов, которые находятся в клинически приемлемых пределах.

"Побочное действие" означает физиологическую реакцию, свойственное лечению, за исключением желаемого эффекта.

1. Некоторые варианты модифицированных олигонуклеотидов

В некоторых вариантах воплощения настоящее изобретение обеспечивает способы и композиции, включающие антисмысловые олигонуклеотиды, содержащие одну или более модификаций по сравнению с олигонуклеотидами природных олигомеров, таких как ДНК или РНК. Такие модифицированные антисмысловые олигонуклеотиды, могут обладать одним или более желаемым свойством. Некоторые такие модификации увеличивают антисмысловую активность антисмыслового олигонуклеотида, например, путем увеличения аффинности антисмыслового олигонуклеотида к целевой нуклеиновой кислоте, увеличения устойчивости к действию одной или более нуклеаз и/или в увеличении фармакокинетики или распределения олигонуклеотида в ткани. В некоторых вариантах воплощения такие модифицированные антисмысловые олигонуклеотиды содержат один или более модифицированных нуклеозидов и/или одну или более модифицированных нуклеозидных связей и/или одну или более присоединенных групп.

а. Некоторые варианты модифицированных нуклеозидов

В некоторых воплощениях антисмысловые олигонуклеотиды содержат один или более модифицированных нуклеозидов. Такие модифицированные нуклеозиды могут включать модифицированный остаток сахара и/или модифицированное азотистое основание. В некоторых воплощениях введение таких модифицированных нуклеозидов в олигонуклеотид приводит к увеличению аффинности связывания с целевой нуклеиновой кислотой и/или увеличению стабильности, включая, но не ограничиваясь этим, увеличение устойчивости к деградации нуклеазами, улучшенные показатели токсичности и/или улучшенное поглощение клетками модифицированного олигонуклеотида.

i. Некоторые варианты азотистых оснований

Природные основания нуклеозидов представляют собой гетероциклические основания, как правило, пуриновые и пиримидиновые. В дополнение к "немодифицированным" и "природным" азотистым основаниям, таким как пуриновые азотистые основания аденин (А) и гуанин (G) и пиримидиновые азотистые основания тимин (Т), цитозин (С) и урацил (U), многие модифицированные азотистые основания или миметики азотистых оснований, известные из уровня техники, подходят для введения в соединения, описанные здесь. В некоторых воплощениях модифицированное азотистое основание представляет собой азотистое основание, которое приближено по структуре к исходному азотистому основанию, такое как, например, 7-диазапурин, 5-метилцитозин или G-кламп. В некоторых воплощениях миметики азотистых оснований включают более сложные структуры, такие как, например, миметик азотистого основания трициклический феноксазин. Способы получения описанных выше азотистых оснований известны из уровня техники.

ii. Некоторые варианты модифицированных сахаров и заменителей сахаров

Антисмысловые олигонуклеотиды по настоящему изобретению могут содержать один или более нуклеозидов, в которых остаток сахара модифицирован относительно природного сахарного остатка. Олигонуклеотиды, содержащие такие модифицированные по сахарному остатку нуклеозиды, могут иметь улучшенную нуклеазную стабильность, увеличенную аффинность связывания или некоторые другие полезные биологические свойства. Такие модификации включают, но не ограничиваются этим, добавление групп заместителей, формирование связей в незародышевом атомном кольце, обеспечивая получение бициклической нуклеиновой кислоты (БНК), замещение атома кислорода рибозильного кольца на S, N(R) или C(R1)(R)2 (R=Н, C1-C12 алкил или протекторная группа) и комбинации модификаций, таких как, например, 2'-F-5'-метил замещенный нуклеозид (см. Международную заявку РСТ WO 2008/101157, опубликованную 21.08.2008, которая раскрывает другие 5',2'-бис замещенные нуклеозиды) или замещение атома кислорода рибозильного кольца на S с дальнейшим замещением в 2'-положении (см. заявку США US2005-0130923, опубликованную 16 июля 2005) или альтернативно в 5'-положении БНК (см. Международную заявку РСТ WO 2007/134181, опубликованную 22.11.2007, где ЛНК содержит модификации с помощью замещения, например, на 5'-метил или 5'-винил группы).

Примеры нуклеозидов, имеющих модифицированный остаток сахара, включают, но без ограничений, нуклеозиды, содержащие 5'-винил, 5'-метил (R или S), 4'-S, 2'-F, 2'-ОСН3 и 2'-O(СН2)2OCH3 замещающие группы. Заместители по 2'-положению также могут быть выбраны из аллил-, амино-, азидо-, тио-, O-C110 алкил-, OCF3-, O(СН2)2SCH3-, O(СН2)2-O-N(Rm)(Rn)- и O-CH2-C(=O)-N(Rm)(Rn)- групп, где каждый Rm и Rn представляют собой независимо Н или замещенный или незамещенный C110 алкил.

Примеры бициклических нуклеиновых кислот (БНК) включают, но без ограничений, нуклеозиды, содержащие мостик между 4' и 2' атомами рибозильного кольца. В некоторых воплощениях антисмысловые соединения по настоящему изобретению включают один или более нуклеозидов БНК, где мостик представлен одной из формул: 4'-β-D-(CH2)-O-2' (β-D-LNA); 4'-(CH2)-S-2'; 4'-α-L-(CH2)-O-2' (α-L-LNA); 4'-(CH2)2-O-2' (ENA); 4'-С(СН3)2-O-2' (см. PCT/US2008/068922); 4'-СН(СН3)-O-2' и 4'-СН(CH2OCH3)-O-2' (см. Патент США US 7,399,845, выданный 15 июля 2008); 4'-СН2-N(ОСН3)-2' (см. PCT/US2008/ 064591); 4'-СН2-O-N(CH3)-2' (см. заявку США US2004-0171570, опубликованную 2 сентября 2004); 4'-СН2-N(R)-O-2' (см. Патент США US 7,427,672, выданный 23 сентября 2008); 4'-СН2-С(СН3)-2' и 4'-СН2-С(=СН2)-2' (см. PCT/US2008/ 066154), где R независимо представляет собой Н, C1-C12 алкил или протекторную группу.

В некоторых воплощениях настоящее изобретение обеспечивает модифицированные нуклеозиды, содержащие модифицированные остатки сахара, которые не являются бициклическими остатками сахара. Некоторые такие модифицированные нуклеозиды известны. В некоторых воплощениях сахарное кольцо нуклеозида может быть модифицировано по любому положению. Примеры модификации сахара, использованные в настоящем изобретении, включают, но не ограничиваются этим, соединения, содержащие сахар-замещающие группы, выбранные из: ОН, F, O-алкил, S-алкил, N-алкил или О-алкил-O-алкил, где алкил, алкенил и алкинил могут быть замещенными или незамещенными C110 алкил или C2-C10 алкенил и алкинил. В некоторых таких воплощениях такие заместители могут приходиться на 2'положение сахара.

В некоторых воплощениях модифицированные нуклеозиды содержат заместитель во 2' положении сахара. В некоторых воплощениях такие заместители выбраны из числа: галогенидов (включая, но не ограничиваясь, F), аллил-, амино-, азидо-, тио-, O-аллил-, О-С110 алкил-, -OCF3, O-(СН2)2-O-СН3-, 2'-O(СН2)2SCH3-, O-(CH2)2-O-N(Rm)(Rn)- или O-СН2-C(=O)-N(Rm)(Rn)- групп, где каждый Rm и Rn независимо представляют собой Н или замещенный или незамещенный C110 алкил.

В некоторых вариантах воплощения модифицированные нуклеозиды, пригодные для использования в настоящем изобретении, представляют собой: 2-метоксиэтокси, 2'-O-метил (2'-O-СН3), 2'-флуоро (2'-F).

В некоторых вариантах воплощения модифицированные нуклеозиды, содержащие замещающие группы во 2'-положении, выбраны из: O[(СН2)nO]mCH3, O(CH2)nNH2, O(СН2)nCH3, O(CH2)nONH2, OCH2C(=O)N(H)CH3 и O(СН2)nON[(СН2)nCH3]2, где n и m представляют собой от 1 до примерно 10. Другие 2'-замещающие группы сахара включают: C1-C10 алкил, замещенный алкил, алкенил, алкинил, алкарил, аралкил, O-алкарил или O-аралкил, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, гетероциклоалкил, гетероциклоалкарил, аминоалкиламино-, полиалкиламино, замещенный силил, РНК-отщепленная группа, репортерная группа, интеркалятор, группу для улучшения фармакинетических свойств или группу для улучшения для фармодинамических свойств олигомерного соединения и другие заместители, имеющие подобные свойства.

В некоторых воплощениях модифицированные нуклеозиды включают 2'-МОЭ боковую цепь (Baker et al, J. Biol. Chem., 1997, 272, 11944-12000). Такие 2'-МОЭ замены были описаны как улучшающие аффинность связывания по сравнению с немодифицированными нуклеозидами и другими модифицированными нуклеозидами, такими как 2'-O-метил, O-пропил и O-аминопропил нуклеозиды. Олигонуклеотиды, имеющие 2'-МОЭ заместитель, также были показаны как антисмысловые ингибиторы экспрессии генов с возможностью использования in vivo (Martin, P., Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al, Chimia, 1996, 50, 168-176; Altmann et al, Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al, Nucleosides Nucleotides, 1997, 16, 917-926).

В некоторых вариантах 2'-заместитель сахара находится либо в арабино (верхнем) положении, либо в рибо (нижнем) положении. В некоторых таких вариантах 2'-арабино модификация представляет собой 2'-F арабино (ФАНК). Подобные модификации могут быть произведены в других положениях сахара, в частности, 3'-положении сахара нуклеозида на 3' конце или в 2'-5'связанных олигонуклеотидов и в 5'-положении нуклеотида на 5' конце.

В некоторых вариантах, нуклеозиды, подходящие для использования в настоящем изобретении, имеют заменители Сахаров, такие как циклобутил вместо рибофуранозил сахара. В качестве примеров патенты США, которые раскрывают приготовление таких модифицированных структур Сахаров, включают, но не ограничиваются этим: US 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747 и 5,700,920, каждый из которых включен в настоящую заявку посредством ссылки в полном объеме.

В некоторых вариантах настоящее изобретение обеспечивает нуклеозиды, включающие модификацию в 2'-положении сахара. В некоторых вариантах изобретение обеспечивает нуклеозиды, включающие модификацию в 5'-положении сахара. В некоторых вариантах изобретение обеспечивает нуклеозиды, включающие модификации в 2'-положении и 5'-положении сахара. В некоторых вариантах модифицированные нуклеозиды могут быть использованы для включения в олигонуклеотиды. В некоторых вариантах модифицированные нуклеозиды включены в олигонуклеозиды с 5'-конца олигонуклеотида.

б. Некоторые варианты межнуклеозидных связей

Антисмысловые олигонуклеотиды по настоящему изобретению могут дополнительно содержать один или несколько модифицированных межнуклеозидных связей. Два основных класса линкерных групп определяются наличием или отсутствием атома фосфора. Примеры фосфорсодержащих связей включают, но не ограничиваясь этим, фофодиэфирную (Р=О), фосфотриэфирную, метилфосфанатную, фосфорамидатную и фосфоротиоатную (Р=S) связи. Примеры нефосфорсодержащих линкерных групп включают, но не ограничиваясь этим, метиленеметилимино (-СН2-N(СН3)-O-CH2-), тиодиэфир (-ОС(O)-S-), тионокарбамат (-ОС(О)(NH)-S-); силоксан (-O-Si(H)2-O-) и N,N-диметилгидразин (-СН2-N(СН3)-N(СН3)-). Олигонуклеотиды, имеющие нефосфорсодержащие линкерные группы называются олигонуклеозидами. Модифицированные относительно природных фосфодиэфирных связи могут быть использованы для изменения, как правило, увеличения, нуклеазной усточивости олигонуклеотидов. В некоторых вариантах связи, содержащие хиральный атом, могут быть приготовлены как рацемические смеси или как отдельные энантиомеры. Примеры хиральных связей включают, но не ограничиваясь этим, алкилфосфонаты и фосфоротиоаты. Способы получения фосфорсодержащих и нефосфорсодержащих связей, хорошо известны специалистам в данной области.

Антисмысловые олигонуклеотиды, описанные здесь, содержат один или несколько асимметричных центров и, тем самым, обеспечивают энантиомеры, диастереомеры и другие стереоизомерные конфигурации, которые могут быть определены в терминах абсолютной стереохимии как (R) или (S), например, сахарные аномеры, или (D) или (L), например, аминокислоты и др. Антисмысловые соединения по настоящему изобретению включают любые возможные изомеры, а также их рацемические и оптически чистые формы.

В некоторых вариантах антисмысловые олигонуклеотиды содержат, по меньшей мере, одну модифицированную межнуклеозидную связь. В некоторых вариантах антисмысловые олигонуклеотиды содержат, по меньшей мере, две модифицированные межнуклеозидные связи. В некоторых вариантах антисмысловые олигонуклеотиды содержат, по меньшей мере, три модифицированные межнуклеозидные связи. В некоторых вариантах антисмысловые олигонуклеотиды содержат, по меньшей мере, 10 модифицированных межнуклеозидных связей. В некоторых вариантах каждая межнуклеозидная связь антисмыслового олигонуклеотида является модифицированной межнуклеозидной связью. В некоторых вариантах такие модифицированные межнуклеозидные связи представляют собой фосфоротиоатные связи.

в. Варианты длины

В некоторых вариантах воплощения настоящее изобретение обеспечивает антисмысловые олигонуклеотиды любой из возможных длины. В некоторых вариантах воплощения настоящее изобретение обеспечивает антисмысловые соединения или антисмысловые олигонуклеотиды, включающие или состоящие из X-Y связанных нуклеозидов, где Х и Y каждый независимо выбран из 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 и 50; при этом X<Y. Например, в некоторых вариантах воплощения настоящее изобретение обеспечивает антисмысловые соединения или антисмысловые олигонуклеотиды, включающие или состоящие из: 8-9, 8-10, 8-11, 8-12, 8-13, 8-14, 8-15, 8-16, 8-17, 8-18, 8-19, 8-20, 8-21, 8-22, 8-23, 8-24, 8-25, 8-26, 8-27, 8-28, 8-29, 8-30, 9-10, 9-11, 9-12, 9-13, 9-14, 9-15, 9-16, 9-17, 9-18, 9-19, 9-20, 9-21, 9-22, 9-23, 9-24, 9-25, 9-26, 9-27, 9-28, 9-29, 9-30, 10-11, 10-12, 10-13, 10-14, 10-15, 10-16, 10-17, 10-18, 10-19, 10-20, 10-21, 10-22, 10-23, 10-24, 10-25, 10-26, 10-27, 10-28, 10-29, 10-30, 11-12, 11-13, 11-14, 11-15, 11-16, 11-17, 11-18, 11-19, 11-20, 11-21, 11-22, 11-23, 11-24, 11-25, 11-26, 11-27, 11-28, 11-29, 11-30, 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 16-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18-27, 18-28, 18-29, 18-30, 19-20, 19-21, 19-22, 19-23, 19-24, 19-25, 19-26, 19-29, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22-28, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30 или 29-30 связанных нуклеозидов.

В некоторых вариантах антисмысловые соединения или антисмысловые олигонуклеотиды по настоящему изобретению имеют длину 15 нуклеозидов. В некоторых вариантах воплощения антисмысловые соединения или антисмысловые олигонуклеотиды по настоящему изобретению имеют длину 16 нуклеозидов. В некоторых вариантах воплощения антисмысловые соединения или антисмысловые олигонуклеотиды по настоящему изобретению имеют длину 17 нуклеозидов. В некоторых вариантах воплощения антисмысловые соединения или антисмысловые олигонуклеотиды по настоящему изобретению имеют длину 18 нуклеозидов. В некоторых вариантах воплощения антисмысловые соединения или антисмысловые олигонуклеотиды по настоящему изобретению имеют длину 19 нуклеозидов. В некоторых вариантах воплощения антисмысловые соединения или антисмысловые олигонуклеотиды по настоящему изобретению имеют длину 20 нуклеозидов.

г. Некоторые варианты олигонуклеотидных мотивов

В некоторых вариантах воплощения антисмысловые олигонуклеотиды имеют химически модифицированные субъединицы, расположенных в определенных участках вдоль длины олигонуклеотида. В некоторых вариантах антисмысловые олигонуклеотиды по настоящему изобретению полностью модифицированы. В некоторых вариантах антисмысловые олигонуклеотиды изобретение равномерно модифицированы. В некоторых вариантах антисмысловые олигонуклеотиды по настоящему изобретению равномерно модифицированы и каждый нуклеозид содержит 2'-МОЭ группу сахара. В некоторых вариантах антисмысловые олигонуклеотиды по настоящему изобретению равномерно модифицированы и каждый нуклеозид содержит 2'-ОМе группу сахара. В некоторых вариантах антисмысловые олигонуклеотиды по настоящему изобретению равномерно модифицированы и каждый нуклеозид содержит морфолино сахарный остаток.

В некоторых вариантах олигонуклеотиды по настоящему изобретению содержат повторяющийся мотив. В таких вариантах типы повторяющихся модификаций выбраны из 2'-МОЭ, 2'-F, бициклический сахар-модифицированный нуклеозид и ДНК (немодифицированный 2'-дезокси). В некоторых таких вариантах воплощения каждый повторяющийся регион включает один нуклеозид.

В некоторых вариантах воплощения олигонуклеотиды по настоящему изобретению содержат один или более блоков нуклеозидов первого типа и один или более блоков нуклеозидов второго типа.

В некоторых вариантах воплощения один или более повторяющихся регионов в повторяющемся мотиве включают более одного нуклеозида одного типа. Например, олигомерные соединения по настоящему изобретению могут включать один или более регионов любого из следующих нуклеозидных мотивов:

Ну1 Ну1 Ну2 Ну2 Ну1 Ну1;

Ну1 Ну2 Ну2 Ну1 Ну2 Ну2;

Ну1 Ну1 Ну2 Ну1 Ну1 Ну2;

Ну1 Ну2 Ну2 Ну1 Ну2 Ну1 Ну1 Ну2 Ну2;

Ну1 Ну2 Ну1 Ну2 Ну1 Ну1;

Ну1 Ну1 Ну2 Ну1 Ну2 Ну1 Ну2;

Ну1 Ну2 Ну1 Ну2 Ну1 Ну1;

Ну1 Ну2 Ну2 Ну1 Ну1 Ну2 Ну2 Ну1 Ну2 Ну1 Ну2 Ну1 Ну1;

Ну2 Ну1 Ну2 Ну2 Ну1 Ну1 Ну2 Ну2 Ну1 Ну2 Ну1 Ну2 Ну1 Ну1 или

Ну1 Ну2 Ну1 Ну2 Ну2 Ну1 Ну1 Ну2 Ну2 Ну1 Ну2 Ну1 Ну2 Ну1 Ну1;

где Ну1 представляет собой нуклеозид первого типа, а Ну2 - второго типа. В некоторых вариантах один из Ну1 и Ну2 представляет собой 2'-МОЭ нуклеозид, при этом другой из Ну1 и Ну2 выбран из 2'-ОМе модифицированного нуклеозида, БНК и немодифицированного ДНК или РНК нуклеозида.

2. Олигомерные соединения

В некоторых вариантах воплощения настоящее изобретение обеспечивает олигомерные соединения. В некоторых вариантах воплощения олигомерные соединения включают в себя только олигонуклеотид. В некоторых вариантах воплощения олигомерные соединения включают в себя олигонуклеотид и одну или более конъюгированных и/или терминальных групп. Такие конъюгированные и/или терминальные группы могут быть присоединены к олигонуклеотидам, имеющим какой-либо из химических мотивов, описанных ниже. Так, например, олигомерное соединение, содержащее олигонуклеотид, имеющий регион повторяющихся нуклеозидов, может содержать терминальную группу.

а. Некоторые варианты конъюгированных групп

В некоторых вариантах воплощения олигонуклеотиды по настоящему изобретению модифицированы путем присоединения одной или нескольких конъюгированных групп. В основном сопряженные группы модифицируют одно или несколько свойств олигомерного соединения, включая, но не ограничиваясь этим, фармакодинамику, фармакокинетику, стабильность, связывание, абсорбцию, распределения в клетке, поглощение клеткой, заряд и клиренс. Конъюгированные группы обычно используются в химической технологии и связаны напрямую или через факультативные линкерные компоненты или группы с исходным соединением, таким как олигомерное соединение, в частности, олигонуклеотидом. Конъюгированные группы включают, но без ограничений, интеркаляторы, молекулы-репортеры, полиамины, полиамиды, полиэтилен гликоль, тиоэфиры, полиэфиры, холестеролы, тиохолестеролы, фрагменты желчные кислот, фолиевую кислоту, липиды, фосфолипиды, биотин, феназин, фенантридин, антрахинон, адамантан, акридин, флюоресцеины, родамины, кумарины и красители. Некоторые из конъюгированных групп были описаны ранее, например: фрагменты холестерола (Letsinger и др., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), желчные кислоты (Manoharan et al, Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), тиоэфир, например, гексил-3-тритилтиол (Manoharan et al, Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al, Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), тиохолестерол (Oberhauser et al, Nucl. Acids Res., 1992, 20, 533-538), алифатическая цепь, например, додекандиол или ундецид остаток (Saison-Behmoaras et al, EMBO J., 1991, 10, 1111-1118; Kabanov et al, FEBS Lett., 1990, 259, 327-330; Svinarchuk et al, Biochimie, 1993, 75, 49-54), фосфолипиды, например, ди-гексадецил-рац-глицерин или триэтиламмоний 1,2-ди-О-гексадецил-рац-глицеро-3-Н-фосфоната (Manoharan et al, Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al, Nucl. Acids Res., 1990, 18, 3777-3783), полиамины или цепь полиэтиленгликоля (Manoharan et al, Tetrahedron Lett., 1995, 36, 3651-3654) или адамантан уксусной кислоты (Manoharan et al. Tetrahedron Lett., 1995, 36, 3651-3654), пальмитил фрагмент (Mishra et al, Biochim. Biophys. Acta, 1995, 1264, 229-237) или октадециламин или гексиламно-карбонил-оксихолистерол фрагмент (Crooke et al, J. Pharmacol. Exp. Ther., 1996, 277, 923-937).

В некоторых вариантах конъюгированная группа содержит активное лекарственное вещество, например, аспирин, варфарин, фенилбутазон, ибупрофен, супрафен, фенбуфен, кетопрофен, (5)-(+)- пранопрофен, сарпрофен, дансилсаркозин, 2,3,5-трийодобензойную кислоту, флуфенамовую кислоту, фолиевую кислоту, бензотиадиазид, хлоротиазид, диазепинового, индометицин, барбитурат, цефалоспорин, серосодержащий препарат, антидиабетический, антибактериальный препарат или антибиотик. Конъюгаты олигонуклеотидов с лекарственными препаратами и их получение описаны в заявке на патент США 09/334,130.

Примеры патентов США, которые раскрывают получение конъюгатов олигонуклеотидов, включают, но не ограничиваясь этим: US 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 и 5,688,941.

Конъюгированные группы могут быть присоединены к одному или обоим концам олигонуклеотида (концевые конъюгированные группы) и/или в любом положении внутри олигонуклеотида.

б. Терминальные группы

В некоторых вариантах олигомерные соединения содержат терминальные группы на одном или обоих концах. В некоторых вариантах терминальная группа может включать какую-либо конъюгированную группу, описанную выше. В некоторых вариантах терминальные группы могут содержать дополнительные нуклеозиды и/или инвертированные базовые нуклеозиды. В некоторых вариантах терминальная группа является стабилизирующей группой.

В некоторых вариантах олигомерные соединения включают одну или несколько терминальных стабилизирующих групп, которые улучшают свойства, такие как, например, устойчивость к действию нуклеаз. Стабилизирующие группы могут включать кэп-структуры. Термины «кэп-структура» или «терминальная кэп-структура», используемые здесь, относятся к химическим модификациям, которые могут быть присоединены к одному или к обоим концам олигомерного соединения. Некоторые такие модификации терминальных групп защищают олигомерные соединения, имеющие терминальные остатки нуклеиновых кислот от экзонуклеазной деградации, а также кэп может помочь в доставке и/или локализации в клетке. Кэп может присутствовать на 5'-конце (5'-кэп), на 3'-конце (3-кэп) или на обоих концах (подробнее см. Wincott et al, Международная публикация РСТ WO 97/26270; Beaucage, Tyer, 1993, Tetrahedron 49, 1925; заявка на патент США US 2005/0020525; а также WO 03/004602).

В некоторых вариантах с одного или обоих концов терминального олигонуклеотида олигомерного соединения присоединен один или несколько дополнительных нуклеозидов. Такие дополнительные терминальные нуклеозиды называются здесь терминальной группой нуклеозидов. В двухцепочечном соединении такая терминальная группа нуклеозидов служит для формирования тупых концов (3' и/или 5'). При формировании двухцепочечных антисмысловых соединений такие терминальные группы нуклеозидов могут быть или не быть комплементарны целевой нуклеиновой кислоте. В некоторых вариантах терминальные группы являются ненуклеозидными терминальными группами. Такие ненуклеозидные терминальные группы могут представлять собой любую терминальную группу, отличную от нуклеозида.

в. Мотивы олигомерных соединений

В некоторых вариантах олигомерные соединения настоящего изобретения включают мотив:

Т1-(Ну1)n1-(Ну2)n2-(Ну1)n3-(Ну2)n4-(Ну1)n52, где:

Ну1 является нуклеозидом первого типа;

Ну2 является нуклеозидом второго типа;

каждый из n1 и n5 независимо представляют собой число от 0 до 3;

сумма n2 и n4 составляет от 10 до 25;

n3 представляет собой число от 0 до 5,

а также каждый из T1 и Т2 независимо представляет собой Н, гидроксил протекторную группу, факультативно линкерную конъюгированную группу или кэп-группу.

В некоторых таких вариантах сумма n2 и n4 составляет 13 или 14; n1 равно 2; n3 равно 2 или 3, а n5 равно 2. В некоторых таких вариантах олигомерные соединения по настоящему изобретению включают мотив, выбранный из таблицы А.

Таблица А
n1 n2 n3 n4 n5
2 16 0 0 2
2 2 3 11 2
2 5 3 8 2
2 8 3 5 2
2 11 3 2 2
2 9 3 4 2
2 10 3 3 2
2 3 3 10 2
2 4 3 9 2
2 6 3 7 2
2 7 3 6 2
2 8 6 2 2
2 2 2 12 2
2 3 2 11 2
2 4 2 10 2
2 5 2 9 2
2 6 2 8 2
2 7 2 7 2
2 8 2 6 2
2 9 2 5 2
2 10 2 4 2
2 11 2 3 2
2 12 2 2 2

Таблица А предназначена для иллюстрации и не должна ограничивать настоящее изобретение. Олигомерные соединения, описанные в Таблице А, содержат по 20 нуклеозидов. Олигомерные соединения, содержащие больше или меньше нуклеозидов, могут легко быть получены путем выбора различных чисел нуклеозидов для одного или более n1-n5. В некоторых вариантах изобретения Ну1 и Ну2 выбраны из 2'-МОЭ, 2'-ОМе, ДНК и бициклических нуклеозидов.

3. Антисмысловые соединения

В некоторых вариантах воплощения олигомерные соединения по настоящему изобретению являются антисмысловыми соединениями. Таким образом, в таких вариантах воплощения олигомерные соединения гибридизуются с целевой нуклеиновой кислотой, проявляя антисмысловую активность.

а. Гибридизация

В некоторых вариантах воплощения настоящее изобретение обеспечивает антисмысловые олигонуклеотиды, которые специфично гибридизуются с целевой нуклеиновой кислотой, когда существует достаточная степень комплементарности, обеспечивающая отсутствие неспецифического связывания антисмыслового соединения с нецелевой нуклеиновой кислотой, в условиях, при которых желательно специфическое связывание, например, в физиологических условиях при анализе in vivo или при терапевтическом лечении, и в условиях анализа in vitro.

Таким образом, "жесткие условия гибридизации" или "жесткие условия" означают условия, при которых антисмысловое соединение гибридизуется с целевой последовательностью, но с минимальным количеством других последовательностей. Жесткие условия зависят от последовательности и различаются в различных средах, а также "жесткие условия", при которых антисмысловые олигонуклеотиды гибридизуются с целевой последовательностью, определяются природой и составом антисмысловых олигонуклеотидов, а также условиями анализа, при которых они используются.

Из уровня техники известно, что введение модификаций нуклеотидов для изменения аффиности может обеспечить большее количество неспаренных олигонуклеотидов по сравнению с немодифицированным соединением. Аналогичным образом, некоторые последовательности азотистых оснований могут быть более устойчивыми к появлению неспаренных оснований, чем другие последовательности азотистых оснований. Любой специалист в данной области способен определить необходимое количество неспаренных нуклеотидов между олигонуклеотиды или между антисмысловым олигонуклеотидом и целевой нуклеиновой кислотой, например, путем определения температуры плавления (Тпл). Тпл или ΔТпл можно рассчитать с помощью методов, известных специалисту в данной области техники. В частности, методы, описанные Freier et al (Nucleic Acids Research, 1997, 25, 22:4429-4443), позволяют специалистам в данной области оценить нуклеотидные модификации на стабильность по увеличению температуры плавления РНК:ДНК-дуплекса.

б. Процессинг пре-мРНК

В некоторых вариантах воплощения антисмысловые соединения по настоящему изобретению являются комплементарными к пре-мРНК. В некоторых вариантах воплощения такие антисмысловые соединения изменяют сплайсинг пре-мРНК. В некоторых таких вариантах воплощения изменяется отношение одного варианта зрелой мРНК, отвечающей целевой пре-мРНК, к другому варианту зрелой мРНК. В некоторых таких вариантах изменяется отношение варианта белка, экспрессированного от целевой пре-мРНК, к другому варианту белка. Некоторые олигомерные соединения и последовательности азотистых оснований, которые могут быть использованы для изменения сплайсинга пре-мРНК, могут быть найдены, например, в публикациях US 6,210,892; US 5,627,274; US 5,665,593; 5,916,808; US 5,976,879; US2006/0172962; US2007/002390; US2005/0074801; US2007/0105807; US2005/0054836; WO 2007/090073; WO2007/047913, Hua и др., PLoS Biol 5(4):e73; Vickers et al, J. Immunol. 2006 Mar 15; 176(6):3652-61 и Hua et al, American J. of Human Genetics (April 2008) 82, 1-15, каждая из которых включена в настоящий документ путем ссылки в полном объеме для любых целей. В некоторых вариантах воплощения антисмысловые последовательности, которые изменяют сплайсинг, модифицированы в соответствии с мотивами по настоящему изобретению.

Антисмысловые соединения являются эффективными средствами для модуляции экспрессии одного или более специфических генетических продуктов и применяются в терапевтических, диагностических и исследовательских приложениях. Описанные здесь антисмысловые соединения могут использоваться для модуляции экспрессии генов посредством антисмысловых механизмов действия, включая антисмысловые механизмы целевого связывания. В одном аспекте антисмысловые соединения, предусмотренные настоящим изобретением, модулируют сплайсинг целевого гена. Такие модуляции включают стимулирование или ингибирование включения экзона. Дополнительно настоящим изобретением предусмотрены антисмысловые соединения, нацеленные на cis регуляторные элементы сплайсинга, существующие в пре-мРНК молекулах, включая экзонные сплайсинговые энхансеры, экзонные сплайсинговые сайленсеры, интронные сплайсинговые энхансеры и интронные сплайсинговые сайленсеры. Распределение cis регуляторных элементов сплайсинга изменяет выбор сплайсингового сайта, что может вызвать изменения композиции сплайсинговых продуктов.

Процессинг эукариотических пре-мРНК представляет собой комплекс процессов, для которых необходимо множество сигналов и белковых факторов с целью обеспечения соответствующего сплайсинга мРНК. Определение экзона с помощью сплайсосомы требует не только канонических сигналов сплайсинга, которые определяют интрон-экзонные границы. Один такой дополнительный сигнал обеспечивают cis-действующие регуляторные энхансерные и сайленсерные последовательности. Экзонные сплайсинговые энхансеры (ЭСЭ), экзонные сплайсинговые сайленсеры (ЭСС), интронные сплайсинговые энхансеры (ИСЭ) и интронные сплайсинговые сайленсеры (ИСС) были идентифицированы как подавляющие и облегчающие использование сплайсинговых донорных сайтов или сплайсинговых акцепторных сайтов, зависящих от этих сайтов и режима действия. (Yeo et al 2004, Proc. Natl. Acad. Sci. U.S.A. 101(44):15700-15705). Связывание специфических белков (trans-факторов) для регуляторных последовательностей направлено на процесс сплайсинга для стимулирования или ингибирования отдельных сплайсинговых сайтов, модулируя соотношение сплайсинговых продуктов (Scamborova et al 2004, Mol. Cell. Biol. 24(5):1855-1869; Hovhannisyan и Carstens, 2005, Mol. Cell. Biol. 25(1):250-263; Minovitsky et al 2005, Nucleic Acids Res. 33(2):714-724).

4. Фармацевтические композиции

В некоторых вариантах воплощения настоящее изобретение обеспечивает фармацевтические композиции, содержащие одно или более антисмысловых соединений. В некоторых вариантах воплощения такая фармацевтическая композиция содержит стерильный физиологический раствор и одно или более антисмысловых соединений. В некоторых вариантах воплощения такая фармацевтическая композиция состоит из стерильного физиологического раствора и одного или более антисмысловых соединений.

В некоторых вариантах воплощения антисмысловые соединения могут быть смешены с фармацевтически приемлемыми активными и/или инертными веществами для приготовления фармацевтических композиций или рецептур. Композиции и способы для приготовления фармацевтических композиций зависят от множества критериев, включая, но не ограничиваясь этим, способы введения, степень заболевания или дозы введения.

В некоторых вариантах антисмысловые соединения могут быть использованы в фармацевтических композициях путем комбинирования таких олигомерных соединений с подходящим фармацевтически приемлемым разбавителем или носителем. Фармацевтически приемлемый разбавитель включает натрий-фосфатный буфер (PBS). PBS является подходящим разбавителем для использования в композициях для приема парентерально. Таким образом, в некоторых вариантах воплощения в способах по настоящему изобретению используются фармацевтические композиции, содержащие антисмысловые соединения и фармацевтически приемлемый разбавитель. В некоторых вариантах воплощения фармацевтически приемлемый разбавитель представляет собой PBS.

Фармацевтические композиции, содержащие антисмысловые соединения, могут включать какие-либо фармацевтически приемлемые соли, эфиры или соли таких эфиров. В некоторых вариантах воплощения фармацевтические композиции, содержащие антисмысловые соединения, содержат один или более олигонуклеотидов, которые при введении животному, включая человека, способны обеспечивать (напрямую или косвенно) биологически активный метаболит или его фрагмент. Таким образом, настоящий документ, в частности, также описывает фармацевтически приемлемые соли антисмысловых соединений, пролекарства, фармацевтически приемлемые соли таких пролекарств и других биологические эквиваленты. Подходящие фармацевтически приемлемые соли включают, но не ограничиваются этим, соли натрия и калия.

Пролекарство может включать в себя введение дополнительных нуклеозидов на одном или обоих концах олигомерного соединения, которые отщепляются эндогенными нуклеазами в организме, для формирования активного олигомерного антисмыслового соединения.

Векторы на основе липидов были использованы в различных методах терапии, основанных на применении нуклеиновых кислот. Например, в одном из способов нуклеиновые кислоты вводят в предварительно созданные липосомы или липоплексы, приготовленные из смеси катионных и нейтральных липидов. В другом способе комплексы ДНК с моно- или поликатионными липидами образуются без нейтральных липидов.

Некоторые способы приготовления описаны в Akinc и др., Nature Biotechnology 26, 561-569 (01 мая 2008 г.), который включен в настоящее описание посредством ссылки в полном объеме.

5. Введение субъекту

В некоторых вариантах воплощения фармацевтические композиции, содержащие один или несколько антисмысловых соединений, вводят субъекту. В некоторых вариантах такие фармацевтические композиции вводят посредством инъекции. В некоторых вариантах такие фармацевтические композиции вводят путем инфузии.

В некоторых вариантах воплощения фармацевтические композиции вводят с помощью инъекции или инфузии в спинномозговую жидкость. В некоторых таких вариантах фармацевтические композиции вводятся с помощью прямой инъекции или инфузии в позвоночник. В некоторых вариантах фармацевтические композиции вводят в виде инъекции или инфузии в головной мозг. В некоторых вариантах фармацевтические композиции введение путем интратекальной инъекции или инфузии более предпочтительно, чем введение непосредственно в ткань спинного мозга. Не ограничиваясь как теория, в некоторых вариантах антисмысловые соединения вводятся в окружающую спинномозговую жидкость и способны проникать в паренхиму спинного мозга. Дополнительным преимуществом интратекального введения является то, что интратекальный способ имитирует введение с помощью люмбальной пункции (например, спинномозговой пункции), которая широко применяется в терапии людей.

В некоторых вариантах воплощения фармацевтические композиции вводятся путем интрасеребровентрикулярной (ИСВ) инъекции или инфузии. Интрацеребровентрикулярное, или интравентрикулярное, введение фармацевтической композиции, содержащей одно или несколько антисмысловых соединений, может быть выполнена в любой один или несколько желудочков мозга, которые заполнены спинномозговой жидкостью (ликвором, СМЖ). СМЖ представляет собой прозрачную жидкость, которая заполняет желудочки, присутствует в субарахноидальном пространстве и окружает головной и спинной мозг. СМЖ производится сосудистым сплетением и путем просачивания или трансмиссии тканевой жидкости головного мозга, поступая в желудочки. Сосудистое сплетение представляет собой структуру, покрывающую стенки боковых желудочков и крышу третьего и четвертого желудочков. Некоторые исследования показали, что эти структуры способны производить 400-600 см3 жидкости в сутки в соответствии с количеством, необходимым для того, чтобы заполнять пространство центральной нервной системы четыре раза за день. У взрослых людей объем этой жидкости составляет от 125 до 150 мл (4-5 унций). СМЖ находится в непрерывном образовании, распространении и поглощении. Некоторые исследования показали, что примерно 430 до 450 мл (около 2 стаканов) СМФ может производиться ежедневно. Некоторые расчеты показывают, что продукция составляет около 0,35 мл в минуту у взрослых и 0,15 мл в минуту у детей. Сосудистое сплетение боковых желудочков производят основную часть всей СМЖ. Вначале СМЖ проходит через отверстия Монро в третий желудочек, который также дополнительно вносит СМЖ, далее она проходит вниз через Сильвиев водопровод до четвертого желудочка. Четвертый желудочек дополнительно привносит часть СМЖ, которая затем идет субарахноидальное пространство через отверстия Мажанди и Лужки. Затем она циркулирует в основании мозга, идет вниз к спинному мозгу и вверх к полушариям головного мозга. СМЖ попадает в кровь через ворсинки паутинной оболочки и внутричерепных сосудистых пазух.

В некоторых вариантах такие фармацевтические композиции вводят системно. В некоторых вариантах фармацевтические композиции вводят подкожно. В некоторых вариантах фармацевтические композиции вводят внутривенно. В некоторых вариантах фармацевтические композиции вводят внутримышечно.

В некоторых вариантах, фармацевтические композиции вводят как непосредственно СМЖ (например, ИТ и/или ИСВ инъекции и/или инфузии), так и системно.

В некоторых вариантах антисмысловые соединения, которые вводят системно, поступают к нейронам. В некоторых вариантах антисмысловые соединения, которые вводят системно, могут проникать через гематоэнцефалический барьер, особенно у молодых субъектов, у которых гематоэнцефалический барьер не сформирован полностью (например, у субъектов в период внутриутробного развития и/или у новорожденных). В некоторых вариантах некоторое количество антисмыслового соединения, которое вводится системно, может быть поглощено нервными клетками, в том числе у субъектов, гематоэнцефалический барьер которых сформирован полностью. Например, антисмысловые соединения могут поступать к нейронам в или около нервно-мышечного соединения (ретроградное поглощение). В некоторых вариантах такое ретроградное поглощение обеспечивает антисмысловую активность внутри нейрона, включая, но не ограничиваясь этим, внутри двигательного нейрона, а также обеспечивает терапевтический эффект за счет антисмысловой активности внутри нейрона.

В некоторых вариантах системное введение обеспечивает терапевтический эффект за счет антисмысловой активности, происходящей в клетках и/или тканях, за исключением нейронов. Несмотря на то, что показана необходимость функциональных SMN внутри нейронов для нормального функционирования нейронов, последствия уменьшения функционального SMN в других клетках и тканях не достаточно хорошо описаны. В некоторых вариантах антисмысловая активность в клетках, отличных от нервных, приводит к восстановлению функции SMN в этих клетках, что в свою очередь обеспечивает терапевтический эффект.

В некоторых вариантах улучшенное функционирование SMN в клетках, отличных от нервных, обеспечивает улучшение работы нервных клеток, независимо от того, улучшено или нет функционирование SMN внутри нейронов. Например, в некоторых вариантах системное введение фармацевтической композиции настоящего изобретения обеспечивает антисмысловую активность в мышечных клетках. Такая антисмысловая активность в мышечных клетках может благоприятно отразиться на моторных нейронах, связанных с этими мышечными клетками, или на нейронах в целом. В таких вариантах мышечная клетка, имеющая восстановленную функцию SMN, может обеспечить фактор, повышающий жизнеспособность нейронов и/или их функционирование. В некоторых вариантах такая антисмысловая активность не зависит от антисмысловой активности, обеспечиваемой антисмысловыми соединениями внутри нейронов. В некоторых вариантах системное введение фармацевтической композиции по настоящему изобретению обеспечивает антисмысловую активность в других клетках, отличных от нейронных, включая клетки, которые не контактируют непосредственно с нейронами. Такая антисмысловая активность в клетках, отличных от нервных, может улучшить функционирование нейронов. Например, антисмысловая активность в клетках, отличных от нервных, (например, клетках печени) может обеспечить образование этой клеткой фактора, улучшающего функционирование нейронов. Примечание: поскольку термин "антисмысловая активность" включает в себя как прямую, так и косвенную активность, нейронные клетки испытывают "антисмысловая активность" даже в том случае, когда антисмысловое соединение не вводится в сам нейрон.

В некоторых вариантах системное введение фармацевтической композиции приводит в результате к терапевтическому эффекту независимо от прямой или косвенной антисмысловой активности в нейронах. Как правило, при СМА функционирование нейронов ухудшается, что приводит к ярко выраженным симптомам. Дополнительные симптомы могут возникнуть в результате уменьшения активности SMN в других клетках. Некоторые такие симптомы могут быть незаметны на фоне проявления других более серьезных симптомов уменьшения функционирования нейронов. В некоторых вариантах системное введение приводит к восстановлению или улучшению функционирования SMN в клетках, отличных от нервных,. В некоторых таких вариантах такое восстановленное или улучшенное функционирование SMN в клетках, отличных от нервных, имеет терапевтический эффект. Например, в некоторых случаях рост субъектов, страдающих СМА, замедлялся. Такое снижение темпов роста не может быть вызвано ухудшением функционирования нервных клеток. На самом деле, снижение темпов роста может быть связано с нарушением функционирования клеток других органов, например, гипофиза, и/или может быть результатом нехватки SMN всех клеток организма. В таких вариантах системное введение может привести к повышению активности SMN в гипофизарных клетках и/или других клетках, что приводит к улучшению роста. В некоторых случаях введение в спинномозговую жидкость восстанавливает функционирование нейронов, в результате чего продолжительность жизни субъекта увеличивается. Однако в этом случае могут проявляться другие симптомы, которые не были известны ранее, поскольку пациенты, как правило, умирали до начала проявления таких симптомов. Некоторые из таких возникающих симптомов могут быть летальными. В некоторых вариантах такие возникающие симптомы лечатся при помощи системного введения. Независимо от механизма в некоторых вариантах различные симптомы СМА, включая, но не ограничиваясь этим, симптомы, ранее замаскированные более тяжелыми симптомами, связанные с нарушениями функционирования нейронов, могут излечимы посредством системного введения.

В некоторых вариантах системное введение фармацевтической композиции по настоящему изобретению приводит к увеличению активности SMN в мышечных клетках. В некоторых вариантах такое улучшение SMN активности в мышечных клетках обеспечивает терапевтический эффект. Улучшенная SMN активность только в мышцах, как известно, недостаточна для обеспечения терапевтического эффекта (например, Gravrilina et al, Hum Mol Genet 2008 17(8):1063-1075). В некоторых вариантах настоящее изобретение обеспечивает способы улучшения функционирования SMN в мышцах, которые обеспечивают терапевтический эффект. В некоторых случаях терапевтический эффект может быть связан с улучшением функционирования SMN в других клетках (отдельно или вместе с мышечными клетками). В некоторых вариантах улучшенное функционирование SMN в мышцах само по себе может принести пользу.

В некоторых вариантах системное введение приводит к улучшению выживаемости.

6. Спинальная мышечная атрофия (СМА)

СМА является генетическим заболеванием, характеризующимся дегенерацией спинальных мотонейронов. СМА вызвана гомозиготной потерей обеих копий SMN1 гена. В тоже время, ген SMN2 способен кодировать того же белок, что и SMN1, и таким образом может применяться для лечения генетического дефекта СМА пациентов. SMN2 трансляционно содержит сайлент мутацию (С→Т) в позиции + 6 экзона 7, которая приводит к неэффективному включению экзона 7 в SMN2 транскрипт. В этой связи преобладающая форма SMN2, которая лишена экзона 7, является неустойчивой и неактивной. Таким образом, терапевтические соединения, способные модулировать SMN2 сплайсинг так, что процент SMN2 транскриптов, содержащих экзон 7, увеличивается, могут найти применение в лечении СМА.

В некоторых вариантах настоящее изобретение обеспечивает антисмысловые соединения, комплементарные пре-мРНК, кодирующие SMN2. В некоторых таких вариантах антисмысловые соединения изменяют сплайсинг SMN2. Некоторые последовательности и регионы, используемые для изменения сплайсинга SMN2, могут быть найдены в PCT/US06/024469, который включен в настоящее описание посредством ссылки в полном объеме для любых целей. В некоторых вариантах олигомерные соединения, обладающие каким-либо мотивом, описанным выше, имеют последовательность азотистых оснований, комплементарную интрону 7 SMN2. Некоторые такие последовательности азотистых оснований в качестве неограничивающих примеров приведены в таблице ниже.

Последовательность Длина SEQID
TGCTGGCAGACTTAC 15 3
CATAATGCTGGCAGA 15 4
TCATAATGCTGGCAG 15 5
TTCATAATGCTGGCA 15 6
TTTCATAATGCTGGC 15 2
ATTCACTTTCATAATGCTGG 20 7
TCACTTTCATAATGCTGG 18 1
CTTTCATAATGCTGG 15 8
TCATAATGCTGG 12 9
ACTTTCATAATGCTG 15 10
TTCATAATGCTG 12 11
CACTTTCATAATGCT 15 12
TTTCATAATGCT 12 13
TCACTTTCATAATGC 15 14
CTTTCATAATGC 12 15
TTCACTTTCATAATG 15 16
ACTTTCATAATG 12 17
ATTCACTTTCATAAT 15 18
CACTTTCATAAT 12 19
GATTCACTTTCATAA 15 20
TCACTTTCATAA 12 21
TTCACTTTCATA 12 22
ATTCACTTTCAT 12 23
AGTAAGATTCACTTT 15 24

Антисмысловые соединения настоящего изобретения могут быть использованы для модуляции экспрессии SMN2 у субъекта, например, у человека. В некоторых вариантах субъект страдает спинальной мышечной атрофией. У некоторых таких субъектов ген SMN1 отсутствует или каким-либо иным образом не в состоянии обеспечить достаточное количество функционального белка SMN. В некоторых вариантах антисмысловые соединения по настоящему изобретению эффективно модулируют сплайсинг SMN2, что приводит к улучшению включения экзона 7 в SMN2 мРНК и в конечном счете в SMN2 белок, который включает в себя аминокислотную последовательность соответствующего экзона 7. Такой альтернативный белок SMN2 похож на белок SMN дикого типа. Антисмысловые соединения по настоящему изобретению, которые эффективно модулируют экспрессию мРНК SMN2, или белковые продукты экспрессии считаются активными антисмысловыми соединениями.

Модуляция экспрессии SMN2 может быть измерена в биологической жидкости, которая может содержать или не содержать клетки, а также в тканях или органах животного. Способы получения образцов для анализа, таких как жидкости организма (например, мокроты, сыворотки, спинномозговая жидкость), ткани (например, биопсия) или органы, а также способы подготовки образцов для анализа хорошо известны специалистам в данной области техники. Способы анализа РНК и белков были описаны выше и хорошо известны специалистам в данной области техники. Эффекты лечения можно оценить с помощью измерения биомаркеров, связанных с экспрессией гена-мишени в вышеупомянутых жидкостях, тканях или органах, полученных от животных, получавших одно или несколько соединений по настоящему изобретению, с помощью обычных клинических методов, известных из уровня техники.

Способы, согласно которым биологические жидкости, органы или ткани контактируют с эффективным количеством одного или нескольких антисмысловых соединений или композициями по настоящему изобретению, также рассмотрены. Жидкости, органы и ткани могут контактировать с одним или более из соединений по настоящему изобретению, обеспечивая модуляцию SMN2 экспрессии в клетках биологических жидкостей, органов или тканей. Эффективное количество можно определить путем мониторинга модулирующего эффекта антисмыслового соединения или соединений или композиций на целевые нуклеиновые кислоты или их продукты методами, известными из уровня техники.

Настоящее изобретение также обеспечивает антисмысловые соединения, описанные здесь, для применения в любой из способов, описанных здесь. Например, настоящее изобретение обеспечивает антисмысловое соединение, включающее антисмысловой олигонуклеотид, комплементарный нуклеиновой кислоте, кодирующей человеческий SMN2, для применения в лечении болезни или состояния, ассоциированного с белком выживаемости двигательных нейронов (SMN), например, спинальной мышечной атрофии (СМА). Как дополнительный пример, настоящее изобретение обеспечивает антисмысловое соединение, включающее антисмысловой олигонуклеотид, комплементарный нуклеиновой кислоте кодирующей человеческий SMN2, для применения в лечении болезни или состояния, ассоциированного с белком выживаемости двигательных нейронов (SMN), путем введения антисмыслового соединения непосредственно в центральную нервную систему (ЦНС) или СМЖ.

Настоящее изобретение также обеспечивает применение антисмыслового соединения, как описано здесь, в производстве лекарственного средства для применения в любом из способов, описанных здесь. Например, настоящее изобретение обеспечивает применение антисмыслового соединения, включающего антисмысловой олигонуклеотид, комплементарный нуклеиновой кислоте, кодирующей человеческий SMN2, в производстве лекарственного средства для лечения заболевания или состояния, ассоциированного с белком выживаемости двигательных нейронов (SMN), например, спинальной мышечной атрофией (СМА). Как еще один пример, настоящее изобретение обеспечивает применение антисмыслового соединения, включающего антисмысловой олигонуклеотид, комплементарный нуклеиновой кислоте, кодирующей человеческий SMN2, в производстве лекарственного средства для лечения заболевания или состояния, ассоциированного с белком выживаемости двигательных нейронов (SMN) путем введения лекарственного средства непосредственно в центральную нервную систему (ЦНС) и СМЖ.

В некоторых вариантах воплощения олигомерные соединения, содержащие какой-либо мотив, описанный выше, имеют последовательность азотистых оснований, комплементарную экзону 7 SMN2.

В некоторых вариантах воплощения олигомерные соединения, содержащие какой-либо мотив, описанный выше, имеют последовательность азотистых оснований, комплементарную интрону 6 SMN2.

В некоторых вариантах воплощения антисмысловое соединение содержит антисмысловой олигонуклеотид, имеющий последовательность азотистых оснований, содержащую не менее 10 азотистых оснований последовательности: TCACTTTCATAATGCTGG (SEQ ID NO:1). В некоторых вариантах антисмысловой олигонуклеотид имеет последовательность азотистых оснований, включающую, по меньшей мере, 11 азотистых оснований указанной последовательности. В некоторых вариантах антисмысловой олигонуклеотид имеет последовательность азотистых оснований, содержащую, по меньшей мере, 12 азотистых оснований указанной последовательности. В некоторых вариантах антисмысловой олигонуклеотид имеет последовательность азотистых оснований, содержащую, по меньшей мере, 13 азотистых оснований указанной последовательности. В некоторых вариантах антисмысловой олигонуклеотид имеет последовательность азотистых оснований, содержащую, по меньшей мере, 14 азотистых оснований указанной последовательности. В некоторых вариантах антисмысловой олигонуклеотид имеет последовательность азотистых оснований, содержащую, по меньшей мере, 15 азотистых оснований указанной последовательности. В некоторых вариантах антисмысловой олигонуклеотид имеет последовательность азотистых оснований, содержащую, по меньшей мере, 16 азотистых оснований указанной последовательности. В некоторых вариантах антисмысловой олигонуклеотид имеет последовательность азотистых оснований, содержащую, по меньшей мере, 17 азотистых оснований указанной последовательности. В некоторых вариантах антисмысловой олигонуклеотид имеет последовательность азотистых оснований, содержащую указанную последовательность. В некоторых вариантах антисмысловой олигонуклеотид имеет последовательность азотистых оснований, состоящую из указанной последовательности. В некоторых вариантах антисмысловой олигонуклеотид состоит из 10-18 связанных нуклеозидов и имеет последовательность азотистых оснований, идентичную на 100% фрагменту равной длины последовательности: TCACTTTCATAATGCTGG (SEQ ID NO:1).

7. Субъекты

В некоторых вариантах воплощения субъект имеет один или несколько индикаторов СМА. В некоторых вариантах субъект имеет уменьшенную электрическую активность одной или нескольких мышц. В некоторых вариантах субъект имеет мутантный ген SMN1. В некоторых вариантах ген SMN1 субъекта отсутствует или не может производить функциональный белок SMN. В некоторых вариантах субъект выявляется с помощью генетического теста. В некоторых вариантах субъект идентифицируется с помощью мышечной биопсии. В некоторых вариантах субъект не способен сидеть прямо. В некоторых вариантах субъект не способен стоять или ходить. В некоторых вариантах субъект нуждается в помощи дыхания и/или питания. В некоторых вариантах субъект определяется с помощью электрофизиологических измерений мышц и/или мышечной биопсии.

В некоторых вариантах субъект имеет тип I СМА. В некоторых вариантах субъект имеет тип II СМА. В некоторых вариантах субъект имеет тип III CMA. В некоторых вариантах субъект определен как имеющий СМА в период внутриутробного развития. В некоторых вариантах субъект определен как имеющий СМА в течение одной недели после рождения. В некоторых вариантах субъект определен как имеющий СМА в течение одного месяца после рождения. В некоторых вариантах субъект определен как имеющий СМА в 3-месячном возрасте. В некоторых вариантах субъект определен как имеющий СМА в 6-месячном возрасте. В некоторых вариантах субъект определен как имеющий СМА в возрасте 1 год. В некоторых вариантах субъект определен как имеющий СМА в возрасте от 1 до 2 лет. В некоторых вариантах субъект определен как имеющий СМА в возрасте от 1 до 15 лет. В некоторых вариантах субъект определен как имеющий СМА в возрасте старше 15 лет.

В некоторых вариантах воплощения первую дозу фармацевтической композиции по настоящему изобретению вводят в период внутриутробного развития. В некоторых таких вариантах первая доза вводится до окончания полного формирования гематоэнцефалического барьера. В некоторых вариантах первую дозу вводят субъекту в период внутриутробного развития системно. В некоторых вариантах первую дозу вводят в период внутриутробного развития после формирования гематоэнцефалического барьера. В некоторых вариантах первую дозу вводят в СМЖ.

В некоторых вариантах воплощения первую дозу фармацевтической композиции по настоящему изобретению вводят субъекту в возрасте менее 1 недели. В некоторых вариантах первая доза фармацевтической композиции по настоящему изобретению вводят субъекту в возрасте менее одного месяца. В некоторых вариантах первая доза фармацевтической композиции по настоящему изобретению вводят субъекту в возрасте менее 3 месяцев. В некоторых вариантах первая доза фармацевтической композиции по настоящему изобретению вводят субъекту в возрасте менее 6 месяцев. В некоторых вариантах первая доза фармацевтической композиции по настоящему изобретению вводят субъекту в возрасте менее одного года. В некоторых вариантах первая доза фармацевтической композиции по настоящему изобретению вводят субъекту в возрасте менее 2 лет. В некоторых вариантах первая доза фармацевтической композиции по настоящему изобретению вводят субъекту в возрасте менее 15 лет. В некоторых вариантах первая доза фармацевтической композиции по настоящему изобретению вводят субъекту в возрасте старше 15 лет.

8. Некоторые варианты дозы

В некоторых вариантах воплощения настоящее изобретение обеспечивает величину дозы и частоту ее введения. В некоторых вариантах фармацевтические композиции вводят в виде болюсной инъекции. В некоторых таких вариантах доза болюсного введения составляет от 0,01 до 25 мг антисмыслового соединения на килограмм веса тела субъекта. В некоторых таких вариантах доза болюсного введения составляет от 0,01 до 10 миллиграмм антисмыслового соединения на килограмм веса тела субъекта. В некоторых вариантах доза составляет от 0,05 до 5 миллиграмм антисмыслового соединения на килограмм веса тела субъекта. В некоторых вариантах доза составляет от 0,1 до 2 миллиграмм антисмыслового соединения на килограмм веса тела субъекта. В некоторых вариантах доза составляет от 0,5 до 1 миллиграмма антисмыслового соединения на килограмм веса тела субъекта. В некоторых вариантах указанные дозы вводятся два раза в месяц. В некоторых вариантах указанные дозы вводятся каждый месяц. В некоторых вариантах указанные дозы вводятся каждые 2 месяца. В некоторых вариантах указанные дозы вводятся каждые 6 месяцев. В некоторых вариантах указанные дозы вводятся путем болюсной инъекции в спинномозговую жидкость. В некоторых вариантах указанные дозы вводятся путем интратекальной болюсной инъекции. В некоторых вариантах указанные дозы вводятся путем системных болюсных инъекций (например, подкожных, внутримышечных или внутривенных инъекций). В некоторых вариантах субъекты получают болюсные инъекции в спинномозговую жидкость и системные болюсные инъекции. В таких вариантах дозы СМЖ болюсных и системных болюсных инъекций могут быть одинаковыми или различными друг от друга. В некоторых вариантах СМЖ и системные дозы вводят с разной частотой. В некоторых вариантах воплощения настоящее изобретение обеспечивает режим дозирования, включающие, по меньшей мере, одну болюсную интратекальную инъекцию и, по меньшей мере, одну болюсную подкожную инъекцию.

В некоторых вариантах воплощения фармацевтические композиции вводят путем непрерывной инфузии. Такая непрерывная инфузия может быть осуществлена путем введения фармацевтической композиции в СМЖ с помощью инфузионного насоса. В некоторых вариантах такие инфузионные насосы вводят фармацевтическую композицию ИТ или ИСВ. В некоторых таких вариантах доза составляет от 0,05 до 25 мг антисмыслового соединения на килограмм веса тела субъекта в день. В некоторых вариантах доза составляет от 0,1 до 10 миллиграмм антисмыслового соединения на килограмм веса тела субъекта в день. В некоторых вариантах доза составляет от 0,5 до 10 миллиграммов антисмыслового соединения на килограмм веса тела субъекта в день. В некоторых вариантах доза составляет от 0,5 до 5 миллиграмм антисмыслового соединения на килограмм веса тела субъекта в день. В некоторых вариантах доза составляет от 1 до 5 мг антисмыслового соединения на килограмм веса тела субъекта в день. В некоторых вариантах изобретения обеспечивает режим дозирования, включающий инфузию в центральную нервную систему и, по меньшей мере, одну болюсную системную инъекцию. В некоторых вариантах изобретение обеспечивает режим дозирования, включающий инфузию в центральную нервную систему и, по меньшей мере, одну болюсную подкожную инъекцию. В некоторых вариантах болюсная или инфузионная доза регулируется для достижения или поддержания концентрации антисмысловые соединения от 0,1 до 100 мкг на грамм ткани ЦНС. В некоторых вариантах болюсная или инфузионная доза регулируется для достижения или поддержания концентрации антисмыслового соединения от 1 до 10 мкг на грамм ткани ЦНС. В некоторых вариантах болюсная или инфузионная доза регулируется для достижения или поддержания концентрации антисмыслового соединения от 0,1 до 1 мкг на грамм ткани ЦНС.

В некоторых вариантах дозирование разделено на индукционную фазу и поддерживающую фазу. В некоторых таких вариантах доза во время индукционной фазы больше дозы во время поддерживающей фазы. В некоторых вариантах доза во время индукционной фазы меньше дозы во время поддерживающей фазы. В некоторых вариантах во время индукционной фазы осуществляется болюсное введение, а во время поддерживающей фазы - непрерывная инфузия.

В некоторых вариантах настоящее изобретение обеспечивает системное введение антисмысловых соединений, либо самостоятельно, либо в комбинации с введением в спинномозговую жидкость. В некоторых вариантах доза для системного введения составляет от 0,1 мг/кг до 200 мг/кг. В некоторых вариантах доза для системного введения составляет от 0,1 мг/кг до 100 мг/кг. В некоторых вариантах доза для системного введения составляет от 0,5 мг/кг до 100 мг/кг. В некоторых вариантах доза для системного введения составляет от 1 мг/кг до 100 мг/кг. В некоторых вариантах доза для системного введения составляет от 1 мг/кг до 50 мг/кг. В некоторых вариантах доза для системного введения составляет от 1 мг/кг до 25 мг/кг. В некоторых вариантах доза для системного введения составляет от 0,1 мг/кг до 25 мг/кг. В некоторых вариантах доза для системного введения составляет от 0,1 мг/кг до 10 мг/кг. В некоторых вариантах доза для системного введения составляет от 1 мг/кг до 10 мг/кг. В некоторых вариантах доза для системного введения составляет от 1 мг/кг до 5 мг/кг. В некоторых вариантах, включающих как системное, так и СМЖ введение, дозы для этих способов введения определяются независимо.

а. Расчет приемлемых для человека доз

В некоторых вариантах воплощения субъект представляет собой человека. В некоторых воплощениях доза для человека рассчитывается или оценивается по данным экспериментов на животных, таких как описанные здесь. В некоторых воплощениях доза для человека рассчитывается или оценивается по данным экспериментов на обезьянах и/или мышах, например, описанным здесь. В некоторых воплощениях доза для человека рассчитывается или оценивается по данным экспериментов на мышах, например, описанным в настоящем документе. В некоторых вариантах, приемлемые для человека дозы могут быть рассчитаны с использованием фармакокинетических данных для мыши, а также сведений о весе мозга и/или значений текучести спинномозговой жидкости (ликвора). Например, вес мозга мыши равен примерно 0,4 г, что составляет около 2% от массы тела мыши. У людей средний вес мозга равен 1,5 кг, что составляет примерно 2,5% массы тела. В некоторых вариантах введение в СМЖ приводит к элиминированию части соединения путем поглощения в тканях мозга и последующего метаболизма. Используя отношение веса мозга человека к весу мозга мыши как коэффициент масштабирования, можно оценить элиминирование и клиренс тканью мозга. Кроме того, скорость обновления СМЖ может быть использована для оценки элиминирования соединения из спинномозговой жидкости в кровь. Скорость обновления СМЖ мыши составляет примерно 10-12 раз в день (0,04 мл производится со скоростью 0,325 мкл/мин). Скорость обновления СМЖ человека составляет примерно 4 раза в день (100-160 мл производятся со скоростью 350-400 мкл/мин). Клиренс, а, следовательно, и условия дозирования, могут быть основаны на масштабировании веса мозга и/или масштабировании скорости обновления СМЖ. Экстраполированный клиренс СМЖ человека может быть использован для оценки эквивалентной дозы для людей на основе аппроксимированных доз для мышей. Таким образом, дозы для человека могут быть оценены, учитывая различия тканевого метаболизма в зависимости от веса мозга и скорости обновления СМЖ. Такие методы расчета и оценки известны специалистам в данной области техники.

В качестве неограничивающего примера, в некоторых вариантах эквивалентная доза для человека может быть оценена по желаемой дозе для мыши путем умножения мг/кг мышиной дозы на коэффициент, равный от 0,25 до примерно 1,25 в зависимости от определенного клиренса и элиминирования конкретного соединения. Так, например, в некоторых воплощениях доза для человека, эквивалентная дозе 0,01 мг для мыши весом 20 г, будет находиться в диапазоне от 8,75 мг до 43,75 мг общей дозы для человека весом 70 кг. Аналогично, в некоторых воплощениях доза для человека, эквивалентная дозе 0,01 мг для новорожденной мыши весом 4 г, будет находиться в диапазоне от 1,9 мг до 9,4 мг общей дозы для новорожденного человека весом 3 кг. Эти примеры доз приведены только для иллюстрации, как один из способов оценки приемлемой дозы для человека и не предназначены для ограничения настоящего изобретения.

В некоторых воплощениях человеческая доза для системного введения (для введения самостоятельно или в комбинации с введением в СМЖ) вычисляется или оценивается по данным экспериментов на животных, таких как описанные здесь. Как правило, приемлемые дозы для человека (в мг/кг) для системного введения составляют от 0,1 до 10 эффективных доз у животных. Таким образом, исключительно для примера, доза для подкожного введения 50 мкг новорожденной мыши весом 2 г равна 25 мг/кг. Соответствующая доза для человека будет составлять от 2,5 мг/кг до 250 мг/кг. Для младенца весом 3 килограмма соответствующая доза составит от 7,5 мг до 750 мг. Для ребенка весом 25 кг соответствующая доза составит с 62,5 мг до 6250 мг.

9. Режимы лечения

В некоторых вариантах воплощения описанные выше значения дозы, частота введения, способы введения, индукционная и поддерживающая фазы и сроки введения первой дозы скомбинированы так, чтобы обеспечить режимы дозирования для пациентов со СМА. Такие режимы дозирования могут быть выбраны и скорректированы для обеспечения улучшения одного или нескольких симптомов СМА и/или уменьшения или устранения токсичности или побочных эффектов, связанных с введением фармацевтической композиции. В некоторых вариантах субъекты являются субъектами в период внутриутробного развития или новорожденными. В таких вариантах введение фармацевтических композиций, в частности, путем непрерывной инфузии, представляет частный вариант воплощения. Соответственно, в некоторых вариантах настоящее изобретение обеспечивает введение фармацевтической композиции с помощью болюсной инъекции, когда субъект представляет собой субъект в период внутриутробного развития или очень молод, с последующей непрерывной инфузией с помощью имплантированного инфузионного насоса, когда субъект становится старше и установка такого насоса является наиболее практичной. Кроме того, в некоторых вариантах, по мере взросления субъекта увеличивается абсолютное значение дозы для сохранения соотношения доза: масса тела. Следующая таблица предназначена для иллюстрации схемы лечения и не должна ограничивать возможные комбинации лечения, которые могут быть легко осуществлены специалистами в данной области.

Период дозирования Первый Второй Третий Четвертый Пятый
Режим 1
Возраст субъекта Внутриутробное развитие, до образования гематоэнцефалического барьера Внутриутробное развитие, после образования гематоэнцефалического барьера >1 недели 6 месяцев 1,5 года
Величина дозы 50 мкг 50 мкг 100 мкг 10 мкг/день 50 мкг/день
Частота Однократное введение Однократное введение Ежемесячно Непрерывно Непрерывно
Способ введения Системная инъекция ИТ инъекция ИТ инъекции ИТ инфузия ИТ инфузия
Длительность - - 6 месяцев 1 год неограниченно
Режим 2
Возраст субъекта Внутриутробное развитие, после образования гематоэнцефалического барьера >1 недели 6 месяцев 1,5 года -
Величина дозы 50 мкг 100 мкг 5 мг/день 10 мг/день -
Частота Однократное введение Ежемесячно Непрерывно Непрерывно -
Способ введения ИСВ инъекция ИСВ инъекция ИСВ инфузия ИСВ инфузия -
Длительность - 6 месяцев 1 год неограниченно -
Режим 3
Возраст >1 недели 6 месяцев 1,5 года 2,5 года*
субъекта
Величина дозы 100 мкг 500 мкг/день 20 мг/день 20 мг/день 100 мг
Частота 2 раза в месяц Непрерывно Непрерывно Непрерывно 2 раза в месяц
Способ введения ИСВ инъекция ИСВ инфузия ИСВ инфузия ИСВ инфузия Периодические инъекции
Длительность 6 месяцев 1 год 1 год неограниченно неограниченно
* Примечание: 4-й период дозирования в режиме 3 иллюстрирует непрерывную СМЖ инфузию в сочетании с периодическим системным введением. Рассмотренные схемы лечения приведены для примера и не должны ограничивать настоящее изобретение.

В некоторых вариантах режим дозирования включает системное введение, самостоятельно или в сочетании с введением в спинномозговую жидкость (например, режим 3, см. выше). Таблица, приведенная ниже, иллюстрирует такие схемы.

Системное введение СМЖ введение
Доза Способ введения Частота введения Доза Способ введения Частота введения
1-5 мг/кг подкожно еженедельно 5-10 мг/кг ИТ болюс ежемесячно
1-5 мг/кг подкожно ежемесячно 1-5 мг/кг ИСВ болюс 2 месяца
10-50 мг/кг подкожно ежемесячно 0,5-1 мг/кг ИТ болюс 6 месяцев
0,5-25 мг/кг подкожно ежемесячно 10 мг/кг/день ИТ инфузия в течение 7 дней каждые 6 месяцев
0,1-10 мг/кг подкожно ежемесячно -
- 0,5-1 мг/кг ИТ болюс 6 месяцев

Рассмотренные схемы лечения предназначены для примера и не должны ограничивать настоящее изобретение. Специалист в данной области техники способен выбрать приемлемую комбинацию доз и способов введения с учетом настоящего раскрытия и на основе ряда факторов, таких как тяжесть состояния, общее состояние здоровья и возраста субъекта.

10. Совместное применение

В некоторых вариантах воплощения фармацевтические композиции по настоящему изобретению вводятся совместно с введением, по меньшей мере, одной другой фармацевтической композиции для лечения СМА и/или для лечения одного или нескольких симптомов, ассоциированных со СМА. В некоторых вариантах такая другая фармацевтическая композиция выбрана из трихостатина А, вальпроевой кислоты, рилузола, гидроксимочевины и бутират или его производных. В некоторых вариантах фармацевтические композиции по настоящему изобретению вводят вместе с трихостатином А. В некоторых вариантах фармацевтические композиции по настоящему изобретению вводят вместе с производным хиназолина, например, как описано в публикации Thurmond et al, J. Med Chem. 2008, 51, 449-469. В некоторых вариантах фармацевтическая композиция по настоящему изобретению и, по меньшей мере, одна другая фармацевтическая композиция вводятся одновременно. В некоторых вариантах фармацевтическая композиция по настоящему изобретению и, по меньшей мере, одна другая фармацевтическая композиция вводятся в разное время.

В некоторых вариантах фармацевтические композиции по настоящему изобретению вводятся совместно с применением геннотерапевтического агента. В некоторых таких вариантах геннотерапевтический агент вводят в СМЖ, а фармацевтическая композиция по настоящему изобретению вводится системно. В некоторых таких вариантах геннотерапевтический агент вводят в СМЖ, а фармацевтическая композиция по настоящему изобретению вводится в СМЖ и системно. В некоторых вариантах фармацевтическая композиция по настоящему изобретению и геннотерапевтический агент вводятся одновременно. В некоторых вариантах фармацевтическая композиция по настоящему изобретению и геннотерапевтический агент вводятся в разное время. Некоторые подходы генной терапии для лечения СМА были описаны в уровне техники (например, Coady et al, PLoS ONE 2008 3(10): e3468; Passini et al, J Clin Invest 2010 Apr 1, 120(4):1253-64).

В некоторых вариантах фармацевтические композиции по настоящему изобретению вводятся совместно с применением, по меньшей мере, одного другого вида терапии СМА. В некоторых вариантах таким другим видом терапии СМА является операция. В некоторых вариантах таким другим видом терапии СМА является физиотерапия, включая, но не ограничиваясь этим, упражнения, направленные на укрепление дыхательных мышц, таких как терапия кашля. В некоторых вариантах, другой вид терапии представляет собой физическое вмешательство, такое как питательная трубка для зондового питания или устройство для вспомогательного дыхания.

В некоторых вариантах фармацевтические композиции по настоящему изобретению вводятся совместно с введением одной или более фармацевтических композиций, которые снижают нежелательные побочные эффекты фармацевтических композиций по настоящему изобретению.

11. Фенотипические эффекты

В некоторых вариантах введение, по меньшей мере, одной фармацевтической композиции по настоящему изобретению обеспечивает фенотипические изменения субъекта. В некоторых вариантах такие фенотипические изменения включают, но не ограничиваясь этим: увеличение абсолютного количества мРНК SMN, которая включает экзон 7; увеличение соотношения мРНК SMN, которая включает экзон 7, к мРНК SMN, лишенной экзона 7; увеличение абсолютного количества белка SMN, который включает в себя аминокислотную последовательность, соответствующей экзону 7, увеличение соотношения белка SMN, которое включает аминокислотную последовательность, соответствующей экзону 7, к белку SMN, лишенного аминокислотной последовательности, соответствующей экзону 7, улучшение мышечной силы, повышение электрической активности, по меньшей мере, одной мышцы, улучшение дыхания, увеличение веса и выживаемости. В некоторых вариантах, по меньшей мере, одно фенотипическое изменение происходит в мотонейронах субъекта. В некоторых вариантах, введение, по меньшей мере, одной фармацевтической композиции по настоящему изобретению обеспечивает возможность субъекта сидеть прямо, стоять и/или ходить. В некоторых вариантах введение, по меньшей мере, одной фармацевтической композиции по настоящему изобретению обеспечивает возможность субъекта есть, пить и/или дышать без посторонней помощи. В некоторых вариантах эффективность лечения оценивается по электрофизиологической оценке мышцы. В некоторых вариантах введение фармацевтической композиции по настоящему изобретению улучшает, по меньшей мере, один из симптомов СМА и имеет небольшой или не имеет воспалительного эффекта. В некоторых таких воплощениях отсутствие воспалительного эффекта определяется по отсутствию значительного увеличения уровней Aif1 во время лечения.

В некоторых вариантах введение, по меньшей мере, одной фармацевтической композиции по настоящему изобретению задерживает наступление хотя бы одного симптома СМА. В некоторых вариантах введение, по меньшей мере, одной фармацевтической композиции по настоящему изобретению замедляет прогрессирование, по меньшей мере, одного из симптомов СМА. В некоторых вариантах введение, по меньшей мере, одной фармацевтической композиции по настоящему изобретению уменьшает тяжесть, по меньшей мере, одного из симптомов СМА.

В некоторых вариантах введение, по меньшей мере, одной фармацевтической композиции по настоящему изобретению приводит к нежелательным побочным эффектам. В некоторых вариантах схема лечения выбрана так, что приводит к желаемому облегчению симптомов, избегая при этом нежелательных побочных эффектов.

12. Единицы дозировки

В некоторых вариантах фармацевтические композиции по настоящему изобретению готовят в виде дозированных единиц для введения. Некоторые такие единицы дозировки составляют концентрации от 0,01 мг до 100 мг. В некоторых таких вариантах фармацевтическая композиция по настоящему изобретению содержит дозу антисмыслового соединения, выбранную из 0,01 мг, 0,1 мг, 0,5 мг, 1 мг, 5 мг, 10 мг, 20 мг, 25 мг, 50 мг, 75 мг, 100 мг, 150 мг и 200 мг. В некоторых вариантах фармацевтическая композиция включает в себя дозы олигонуклеотида, выбранные из 0,1 мг, 0,5 мг, 1 мг, 5 мг, 10 мг, 25 мг и 50 мг.

13. Наборы

В некоторых вариантах настоящее изобретение обеспечивает наборы, содержащие, по меньшей мере, одну фармацевтическую композицию. В некоторых вариантах такие наборы дополнительно содержат средства для введения, например, шприц или инфузионный насос.

Неограничивающее раскрытие и включение путем ссылки

Наряду с тем, что некоторые соединения, композиции и способы, рассмотренные выше, были описаны в соответствии с некоторыми конкретными вариантами воплощения, следующие примеры служат лишь для иллюстрации описанных соединений и не предназначены для ограничения настоящего изобретения. Каждая ссылка, номер GenBank и т.п. включены в настоящее описание путем ссылки в полном объеме.

Несмотря на то, что перечень последовательностей, сопровождающий настоящую заявку, идентифицирует каждую последовательность либо как «РНК», либо как «ДНК», в действительности, эти последовательности могут быть изменены посредством любой комбинации химических модификаций. Специалист в данной области без труда поймет, что такое обозначение как «РНК» или «ДНК» для описания модифицированных олигонуклеотидов в некоторых случаях произвольно. Например, олигонуклеотид, включающий нуклеозид, содержащий 2'-ОН остаток сахара и азотистое основание тимин, может быть описана как ДНК, имеющая модифицированный сахар (2'-ОН для природных 2'-Н ДНК) или в виде РНК, имеющих модифицированное основание (тимин (метилированный урацил) на природный урацил РНК).

Таким образом, последовательности нуклеиновых кислот, предусмотренные настоящим документом, включая, но не ограничиваясь этим, указанные в перечне последовательностей, предназначены для того, чтобы охватить нуклеиновые кислоты, содержащие любое сочетание природных или модифицированных РНК и/или ДНК, включая, но не ограничиваясь этим, такие нуклеиновые кислоты, имеющие модифицированные азотистые основания. В качестве дополнительного и неограничивающего примера, олигомерное соединение, имеющее последовательность азотистых оснований "ATCGATCG", включает в себя любое олигомерное соединение, обладающих такой последовательностью азотистых оснований, как модифицированных, так и немодифицированных, включая, но не ограничиваясь этим, например соединения, содержащие РНК основания, такие как те, которые имеют последовательность "AUCGAUCG", и те, которые имеют частично основания ДНК и частично основания РНК, такие как "AUCGATCG", и олигомерные соединения, имеющие другие модифицированные основания, такие как " ATmeCGAUCG ", где meC представляет собой азотистое основание цитозин, содержащий метальную группу в 5-позиции.

Пример 1 - Антисмысловые соединения, комплементарные SMN2

Следующие олигонуклеотиды были синтезированы, используя стандартные методы, описанные ранее.

Пример 2 -Smn-/-SMN трансгенные мыши

Терапевтическая эффективность и безопасность использования антисмысловых соединений, как описано выше, может быть протестирована в адекватной модели на животных. Например, модели на животных, которые проявляют наиболее схожий с человеческим тип заболеваний, включают виды животных, которые либо спонтанно развивают высокую частоту конкретного заболевания, либо те, заболевания которых индуцированы специально.

В частности, известны модели на животных для СМА. Как было описано выше, молекулярной основой СМА, аутосомно-рецессивного нервно-мышечного расстройства, является гомозиготная потеря гена выживаемости мотонейронов 1 (SMN1). Практически идентичная копия SMN1 гена, называемая SMN2, находится в организме человека и модулирует тяжесть заболевания. В отличие от людей, мыши имеют только один ген (Smn), эквивалентный гену SMN1. Гомозиготная потеря этого гена детальна для эмбрионов и приводит к массовой гибели клеток, что указывает на то, что экспрессия гена Smn необходима для выживания и функционирования клеток. Введение двух копий SMN2 мышам, лишенных SMN гена, спасает их от эмбриональной смертности, в результате чего мыши проявляют СМА фенотип (Monani et al, Hum. Mol. Genet. (2000) 9:333-339). Увеличенное количество копий SMN2 спасает мышей, поскольку мотонейроны продуцируют достаточное количество белка SMN. См. также публикацию Ce-Li et al, Nat. Genet. (2000) 24:66-70, описывающую получение трансгенных линий мышей, которые экспрессируют человеческий SMN2. В частности, трансгенные мыши, которые получали SMN2 при Smn-/-генотипе, показали патологические изменения спинного мозга и скелетных мышц, аналогично СМА пациентам. Тяжесть патологических изменений у этих мышейкоррелировала с количеством белка SMN, который содержал область, кодируемую экзоном 7. Гетерозиготные мыши, лишенные одной копии Smn, обозначены как Smn -/+ и представляют собой модель для менее тяжелой формы СМА, тип III.

Тяжесть СМА фенотипа является функцией от числа копий человеческого SMN2 у мыши. Так называемая Тайваньская линия имеет 4 копии человеческого SMN2, в результате мыши имеют фенотип СМА от умеренного до тяжелого, схожий с типом I или типом II.

Дельта-7 мыши (Smn-/-, hSMN2+/+, SMNΔ7+/+) также лишены мышиного гена Smn и экспрессируют человеческий SMN2. Дельта 7 мыши имеют более тяжелый фенотип и умирают вскоре после рождения, обычно примерно на 15-20 день после рождения.

Пример 3 - Системное введение антисмысловых соединений in vivo Smn -/- SMN2 мышам (Тайваньская линия)

Тайваньские мыши получали внутрибрюшинные инъекции физиологического раствора или дозу 35 мг/кг ISIS396443 или ISIS396443 или неправильно спаренного (мисматч) контрольного антисмыслового олигонуклеотида один раз в день на протяжении 5 дней и были умерщвлены через два дня, на седьмой день. РНК была выделена из печени и почек, использую стандартные методы. SMN2, содержащие и не содержащие экзон 7, были исследованы с помощью ОТ-ПЦР. Введение ISIS396443 привело к значительному увеличению включения экзона 7 в SMN2 из почек и печени по сравнению контрольными значениями.

Пример 4 - Интрасеребровентрикулярное (ИСВ) введение антисмысловых соединений in vivo Smn -/- SMN2 мышам (Тайваньская линия)

Тайваньским мышам внутрь желудочков мозга вводили физиологический раствор или 150 мкг ISIS396443 каждый день в течение 7 дней. Мышей умерщвляли на 8 день и выделяли РНК из головного и спинного мозга. Используя ОТ-ПЦР, было показано существенное увеличение включения экзона 7 в SMN2 в образцах головного и спинного мозга, полученных из животных, получавших ISIS396443. Эти результаты показывают, что применение интрасеребровентрикулярного введения антисмысловых олигонуклеотидов, нацеленных на SMN, может облегчить СМА состояние, поскольку СМА фенотип ассоциирован с исключением экзона 7.

Зависимость «доза-ответ»

Тайваньским мышам внутрь желудочков мозга вводили физиологический раствор или 10, 50, 100 или 150 мкг ISIS396443 каждый день в течение 7 дней (5 мышей в каждой группе), которые были умерщвлены на 8 день. РНК выделяли и анализированы с помощью ОТ-ПЦР. Группа, получавшая 10 мкг активного вещества, показала умеренное включение экзона 7. Группы, получавшие 50 мкг, 100 мкг и 150 мкг, показали существенное улучшение включения экзона 7.

Продолжительность ответа

Для определения продолжительности эффекта 24 мышам инъецировали внутрь желудочков мозга 50 мкг ISIS396443 каждый день в течение 7 дней. Четыре мыши были умерщвлены после получения последней дозы (время 0) и четыре мыши были умерщвлены через 1, 2, 4 и 8 недель, соответственно, после получения последней дозы. Все мыши, получавшие лечение, показали значительное улучшение включения экзона 7, при этом эффект на 8 неделю не отличался в различных группах, как показано на фиг.1.

Эти результаты показывают, что введение внутрь желудочков мозга 50 мкг в день ISIS396443 в течение 7 дней является более эффективным для 8 недель последующего лечения.

Эксперимент был проведен повторно для более длительного отрезка времени. Мыши, имеющие тип III CMA, получали ISIS396443 посредством интрасеребровентрикулярной инфузии в количестве 50 мкг/день в течение 7 дней. Мыши были умерщвлены через 0, 0,5, 1, 2, 4 и 6 месяцев после окончания 7-ми дневного периода инфузии. Из спинного мозга была выделена РНК и проанализирована с помощью нозерн-блоттинга. Как показано на фиг.2, эффект инфузии ISIS396443 продолжался в течение 6 месяцев после инфузии. Такой продолжительный эффект имеет множество возможных объяснений. Он может отражать стабильность ISIS396443, стабильность исправленного белка SMN и/или то, что доза была достаточно высокой для того, чтобы даже после распада соединения эффект его действия сохранился. Таким образом, эти данные могут поддержать введение более низких доз, а также редких доз.

Пример 5 - Введение антисмысловых соединений путем продолжительной интрасеребровентрикулярной (ИСВ) инфузии

Используя микроосмотический насос (Azlet Osmotic Pumps, Cupertino, штат Калифорния, США), ISIS396443 был введен в спинномозговую жидкость (ликвор) через правый боковой желудочек взрослым мышам СМА типа-III Smn+/- или Smn-/-, имеющих человеческий ген SMN2 (Тайваньская линия). Зависимость «доза-ответ» показала, что интрасеребровентрикулярная (ИСВ) инфузия ISIS396443 увеличивала включение экзона 7 SMN2 в спинном мозге до ~90% по сравнению с ~10% у мышей, получавших физиологический раствор. Вестерн-блоттинг и иммуногистохимический анализ показали сильное увеличение уровня человеческого трансгенного SMN белка в спинно-мозговых мотонейронах. Эти результаты показывают, что ЦНС инфузия антисмыслового олигонуклеотида ISIS396443 может облегчить СМА состояние, поскольку исключения экзона 7 ассоциировано со СМА фенотипом.

Пример 6 - Эмбриональное введение

Единичную ИСВ инъекцию 20 мкг или 10 мкг ISIS396443 вводили эмбрионам Тайваньских мышей на 15-й день беременности (Е15). Животные были умерщвлены на 7 день после рождения (Р7). РНК выделяли из спинного мозга поясничного отдела и анализированы с помощью ОТ-ПЦР. Единичное эмбриональное введение ISIS396443 привело к значительному улучшению включения экзона 7. Эти результаты показывают, что лечение с помощью антисмысловых олигонуклеотидов ISIS396443 внутриутробно может облегчить СМА состояние, поскольку исключение экзона 7 ассоциировано со СМА фенотипом.

Эксперимент, описанный выше, был проведен повторно, а животные умерщвлены на 11 неделе. Тайваньские мыши, не получавшие лечение, развивали пораженные некрозом хвосты, которые укорачивались со временем. Единичная эмбриональная инъекция 20 мкг ISIS396443 значительно отсрочила начало деградации хвоста, как показано на фиг.3А. Эти результаты показывают, что эмбриональное лечение антисмысловыми олигонуклеотидами, нацеленными на SMN, задерживает начало развития СМА.

Эти результаты были подтверждены в другом исследовании с использованием тех же условий, за исключением дозировок, которые составили 20 мкг и 10 мкг ISIS396443, при этом для сравнения в исследование были вовлечены нормальные мыши. Результаты этого эксперимента представлены на рис 3В.

Пример 7 - Введение in vivo на модели дельта-7 мыши

Гетерозиготные (SMN+/-, hSMN+/+, SMNΔ+/+) родительские пары были скрещены, и в день рождения (Р0) новорожденным детенышам вводили ISIS396443 (18-мер, SEQ ID NO:1), ISIS396449 (15-мер, SEQ ID NO:2), ISIS387954 (20-мер, SEQ ID NO:7) или контрольный аллель-специфичный скрамблед-олигонуклеотид (ISIS439273; 18-мер). Мышам вводили билатерально в боковые желудочки мозга по 8 мкг (4 мкг в каждый боковой желудочек). Все инъекции производились с помощью острой стеклянной микропипетки-иглы, как описано Passini и др., J. Virol. (2001), 75:12382-12392. После инъекции детеныши были помечены путем отрезания пальцев и генотипированы (Le et al, Hum. Mol. Genet. (2005) 14:845-857) с целью идентификации СМА (SMN-/-, hSMN2+/+, SMNΔ7+/+), гетерозиготных мышей и мышей дикого типа (SMN+/+, hSMN2+/+, SMNΔ7+/+). Из пометов были выбраны 7 детенышей для контроля численности на выживаемости. Некоторые пометы не получали инъекции в целях обеспечения контрольных групп, не подвергавшихся лечению.

Широкое распространение 18-мерного олигонуклеотида было зафиксировано в спинном мозге через 14 дней после инъекции у СМА мышей, в том числе в грудном, поясничном и шейном отделах спинного мозга. Кроме того, исследования совместной с ChAT локализацией подтвердили, что подавляющее большинство клеток, являющихся мишенями для ISIS396443 в спинном мозге, представляли собой мотонейроны. У контрольных мышей, не получавших лечение, ответ не был обнаружен.

Анализ вестерн-блот на 14 день показал, что количество SMN в головном и спинном мозге составило 40-60% от уровня дикого типа, по сравнению с 10% у СМА контролей, не получавших лечения. У контрольных мышей, получавших скрамблед-версию АСО, ответ не был обнаружен по сравнению с фоновыми значениями. Результаты вестерн-блоттинга представлены на фигуре 4.

СМА мыши, получавшие СМА АСО, также показали значительное увеличение веса, амбулаторной функции (восстановление рефлексов и силы захвата) и координации (сгибание задних конечностей), независимо от длины АСО по сравнению со СМА мышами, не получавшими лечение, или СМА мышами, получавшими скрамблед-АСО. Значительного увеличения массы тела, амбулаторной функции (восстановление рефлексов и силы захвата) или координация не наблюдалось у СМА мышей, получавших скрамблед-АСО по сравнению со СМА мышами, не получавшими лечения. Результаты приведены на фиг.5 и 6.

Следует отметить, что СМА мыши, получавших АСО лечение, независимо от длины АСО показали значительное увеличение средней продолжительности жизни, как показано на фиг.7. Продолжительность жизни с момента рождения составила 31,5 (15-мер), 27,0 (18-мер) и 28,0 (20-мер) дней, по сравнению с 16,0 днями для контрольных СМА мышей, не получавших лечение. В отличие от этого, продолжительность жизни СМА мышей, получавших 18-мерный скрамблед-контроль, не улучшилась. Эти результаты показывают, что лечение антисмысловыми олигонуклеотидами, нацеленными на SMN, увеличивает продолжительность жизни субъектов, страдающих СМА.

СМА аллель-специфичные олигонуклеотиды также увеличивали количество мотонейронов в спинном мозге, как показано на фигуре 8.

РНК SMN измерялась с помощью ОТ-ПЦР. Животные, получавшие СМА АСО, имели повышенные уровни РНК SMN по сравнению со СМА мышами, не получавшими лечение. Результаты мышей, получавших 20-мерные АСО, по сравнению со СМА мышами, не получавшими лечения, показаны на фиг.9.

Для определения того, может ли быть увеличена продолжительность жизни путем введения второй дозы, эксперимент, описанный выше, был повторен с дополнительной дозой 20 мкг на 21 день. Результаты показаны на фиг.10. Верхняя кривая показывает эффект первой дозы 8 мкг в день 0. В день Р21 половина мышей получила повторное лечение.

Эффект повторного введения по сравнению с мышами, которые получили только первое введение, показан на фигуре 11. Этот результат показывает, что второе ИСВ введение антисмысловых олигонуклеотидов увеличивает продолжительность жизни.

Пример 8 - Активность у мышей со СМА типа III

Два антисмысловых соединения и одно контрольное были протестированы в модели СМА на мышах. Соединения описаны в таблице, приведенной ниже.

Соединения, протестированные на СМА мышах Тайваньской линии

ISIS# Последовательность Описание SEQ ID
396443 TCACTTTCATAATGCTGG равномерно 2'-МОЭ, полностью PS; 18-мерный, комплементарен интрону 7 человеческого SMN2 1
449220 ATTCACTTTCATAATGCTGG равномерно 2-ОМе; полностью PS; 20-мерный, комплементарен интрону 7 человеческого SMN2 3
439272 TTAGTTTAATCACGCTCG равномерно 2'-МОЭ; полностью PS; 18-мерный; контрольная последовательность 4

Мыши Тайваньской линии с типом III CMA были предоставлены Jackson Laboratory (Бар Харбор, Мэн). Эти мыши лишены мышиного гена SMN и являются гомозиготными по человеческому гену SMN2 (mSMN-/-; hSMN2+/+). Они были описаны в публикации Hsieh-Li HM et al, Nature Genet. 24, 66-70 2000.

Мыши получали 3, 10, 30 или 100 мкг ISIS396443 или ISIS449220 в день либо 30 или 100 мкг контрольного соединения ISIS439272 в день в натрий-фосфатном буфере (PBS). Контрольные мыши получали только PBS (доза 0). Все препараты вводились с помощью интрасеребровентрикулярной (ИСВ) инфузии, используя осмотический насос Azlet 1007D. Для каждой дозы было выбрано пять животных, однако, две мыши, получавшие максимальную дозу ISIS449220, погибли до окончания исследования. Животные были умерщвлены на 9 день (через 2 дня после получения последней дозы), из каждого животного были выделены головной мозг и люмбальный отдел спинного мозга. Каждый образец был исследован с помощью ПНР в реальном времени для определения количества человеческих SMN2, включающих экзон 7 ((+)экзон 7), и количество человеческих SMN2, лишенных экзона 7((-)экзон 7). ПЦР в реальном времени также был использован для определения уровней экспрессии фактора воспаления аллотрансплантата (AIF1) и глицеральдегид-3-фосфат дегидрогеназы (GADPH).

Уровни экспрессии (+)экзон 7 и (-)экзон 7 форм были нормированы к GADPH уровню. Такие нормированные уровни экспрессии были затем разделены на GADPH-нормированные уровни контрольных мышей, получавших PBS. Полученные значения, кратные контрольным, представлены ниже в Таблице 17. Данные представляют среднее значение от контрольного для всех пяти мышей в каждой группе, за исключением максимальной дозы ISIS449220, которые получены от трех выживших мышей.

Введение ISIS396443 привело к резкому увеличению включения экзона 7. Введение 10 мкг/день ISIS396443 привело к увеличению почти вдвое (в 1,8 раз) количества SMN2, содержащих экзон 7, в головном мозге, а в люмбальном отделе спинного мозга к увеличению более чем в два раза по сравнению с контрольными мышами, не получавшими лечения.

Способность антисмысловых соединений изменять сплайсинг у СМА мышей

Соединение Доза (мкг/день) Головной мозг Люмбальный отдел спинного мозга
(+)экзон 7 (-)экзон 7 (+)экзон 7 (-)экзон 7
396443 (2'-МОЭ) 0 1,0 1,0 1,0 1,0
3 1,3 1,0 1,4 1,0
10 1,8 0,7 2,1 0,6
30 2,4 0,6 3,4 0,3
100 3,0 0,3 3,8 0,1
449220 (2'-ОМе) 0 1,0 1,0 1,0 1,0
3 0,9 1,1 1,0 1,1
10 1,0 1,1 1,0 1,2
30 1,0 1,2 1,1 1,2
100* 1,0 1,0 1,2 1,1
439272 Контроль 0 1,0 1,0 1,0 1,0
30 1,0 1,1 0,9 1,1
100 1,0 1,0 1,0 1,0
* данные от 3 мышей, получавших указанную дозу

Экспрессия фактора воспаления аллотрансплантата (AIF1) была исследована путем оценки воспаления. После нормирования всех образцов к значениям для GADPH, отношение AIF1 для каждой группы было разделено на значение для PBS контроля. ISIS396443 не вызвал увеличение AIF1, даже в максимальной дозе. ISIS449220 вызвал увеличение AIF1 в головном мозге и люмбальном отделе спинного мозга. Данные в Таблице 18 показывают среднее значение относительно контроля для пяти мышей из каждой группы, за исключением максимальной дозы ISIS449220, полученными от трех выживших мышей.

Токсичность антисмысловых соединений для СМА мышей

Соединение Доза (мкг/день) AIF-1/GAPDH
Головной мозг Люмбальный отдел спинного мозга
396443 (2'-МОЭ) 0 1,0 1,0
3 10 1,0
10 1,1 1,2
30 1,0 1,0
100 0,9 1,0
449220 (2'-ОМе) 0 1,0 1,0
3 1,0 1,0
10 1,0 1,8
30 1,2 2,9
100* 1,8 3,3
439272 Контроль 0 0,9 0,9
30 0,9 1,0
100 0,9 1,2
* данные от 3 мышей, получавших указанную дозу

Пример 9 - Введение обезьянам

Обезьяны Cynomolgus были использованы для оценки распределения ISIS3 95443 в различных дозах и при различных способах введения. ISIS396443 вводился двум обезьянам. Одна обезьяна получала дозу 3 мг путем ИСВ инфузии, а другая получала 3 мг путем ИТ инфузии. Обе инфузии применялись в течение 24 часов. Обезьяны были умерщвлены, а ткани были выделены через 96 часов после окончания периода инфузии. Концентрация ISIS396443 была измерена в образцах спинного мозга шейной, грудной и поясничной (люмбальной) областей. Результаты представлены в таблице ниже.

Животное # Доза Способ введения Ткань Концентрация ISIS396443 (мкг/г)
1 3 мг в течение 24 часов ИСВ инфузия Шейный отдел 21,5
Грудной отдел 9,4
Поясничный отдел 23,9
2 3 мг в течение 24 часов ИТ инфузия Шейный отдел 12,5
Грудной отдел 22,6
Поясничный отдел 42,6

Поскольку обезьяны Cynomolgus имеют вес порядка 3 кг, доза составила около 1 мг/кг.

Для дальнейшей оценки распределения ISIS39644 двадцать-шесть обезьян были разделены на шесть групп, описанных в следующей таблице.

Группа Доза Способ введения Концентрация соединения (мг/мл) Продолжительность инфузии День умерщвления Число обезьян
1 0 ИСВ 0 14 дней 19 день 2М/2Ж
2 3 мг ИСВ 0,09 14 дней 19 день 2М/2Ж
3 3 мг ИТ 1,25 1 день 6 день 3М/2Ж
4 3 мг ИТ 0,42 3 дня Вдень 2М/2Ж
5 3 мг ИТ 0,18 7 дня 12 день 3М/2Ж
6 3 мг ИТ 0,09 14 дней 19 день 2М/2Ж

Величина инфузии для всех групп составила 100 мкл/час. Все обезьяны получили в общей сложности по 3 мг ISIS39644 в физиологическом растворе, за исключением группы 1, которая получала только физиологический раствор. Обезьяны были умерщвлены, а ткани выделены через 5 дней после окончания инфузии.

Концентрации ISIS39644 в образцах тканей обезьян были определены, использую стандартные методы. Результаты показаны на графиках фиг.12. Образцы также оценивались по гистологии. Гистология не показала каких-либо неблагоприятных эффектов лечения и подтвердила присутствие ISIS396443. Потеря клеток Пуркинье не нашла подтверждения.

Быстрая инфузия показала большее количество ISIS396443, чем медленная инфузия. Эти результаты позволяют предположить, что быстрая инфузия или болюсная инъекция могут быть более предпочтительными в некоторых вариантах воплощения. Поскольку болюсное введение имеет некоторые практические преимущества по сравнению с инфузией, в некоторых вариантах воплощения оно является предпочтительным способом введения в спинномозговую жидкость. В некоторых вариантах воплощения предпочтительный способ введения в спинномозговую жидкость представляет собой болюсную ИТ инъекцию.

Пример 10 - Создание модели тяжелой формы СМА на мышах и ИСВ лечение

Были получены мыши, имеющие фенотип тяжелой формы СМА. Гомозиготные мыши с тяжелой формой СМА несут 2 копии человеческого SMN2, но не имеют мышиного SMN. Средняя продолжительность жизни составляет около 10 дней. Кроме того, СМА мыши меньше по размеру и имеют более короткие хвосты. Гетерозиготы несут мышиный SMN и развиваются нормально.

Для изучения эффекта антисмысловых соединений у мышей с тяжелой формой СМА 20 мкг ISIS396443 было введено посредством ИСВ инъекции в день PL Лечение привело к увеличению средней продолжительности жизни с 9,9 дней (контрольными мыши, получавшие физиологический раствор) до 16,7 дней. Анализ с помощью ОТ-ПЦР показал увеличение РНК SMN полной длины в тканях мышей, получавших лечение.

Пример 11 - Системное введение ISIS 396443

Мыши, страдающие тяжелой формой СМА, и здоровые гетерозиготные контрольные мыши для изучения эффекта ISIS396443 с помощью болюсной ИСВ инъекции и/или болюсной подкожной инъекции были разделены на следующие группы:

Группа 1 - ИСВ + подкожно

Одна ИСВ инъекция 20 мкг в P1 или Р2 (1 или 2 день после рождения); и две подкожные инъекции 50 мкг/г введены между Р0 и Р3.

Группа 2 - подкожно + подкожно

Две подкожные инъекции 50 мкг/г вводились между Р0 и Р3; одна подкожная инъекция 50 мкг/г вводилась между Р5 и Р6; и подкожная инъекция 50 мкг/г вводилась между Р9 и Р10.

Группа 3 - подкожно

Две подкожные инъекции 50 мкг/г вводились между Р0 и Р3.

Группа 4 - СМА контроль, физиологический раствор

Одну ИСВ инъекцию физиологического раствора вводили в Р1 или Р2; и две подкожные инъекции физиологического раствора вводились между Р0 и Р3.

Группа 5 - Гетерозиготный контроль

Одна подкожная инъекция 20 мкг вводилась в Р1 или Р2; и две подкожные инъекции 50 мкг/г вводились между Р0 и Р3 гетерозиготным мышам.

Каждая группа включала от 14 до 22 мышей. Продолжительность жизни (в днях) каждой мыши из каждой группы указана в таблице ниже. Многие мыши в этом эксперименте выживали на протяжении всего исследования настоящего изобретения. Так, значение, обозначенное как ">", показывает, что продолжительность жизни мыши превышает указанное значение.

Мышь Группа 1 ИСВ + подкожно Группа 2 подкожно + подкожно Группа 3 подкожно Группа 4 Физ. раствор Группа 5 Гет.
1 >141 >130 >103 8 >146
2 >141 127 94 8 >146
3 22 >114 61 8 >146
4 >140 73 >103 8 >146
5 117 27 >103 8 >145
6 >124 27 >103 8 >145
7 >111 18 34 8 >145
8 >111 >102 26 8 >145
9 >111 >98 31 8 >145
10 >111 >98 69 9 >144
11 29 >102 69 9 >144
12 >110 >102 67 9 >144
13 >110 >102 >91 9 >144
14 >110 >102 >90 9 >143
15 >110 н.д. >90 9 >143
16 >108 н.д. >90 9 >143
17 >108 н.д. >90 10 >129
18 >109 н.д. 86 10 >129
19 18 н.д. >75 10 >129
20 н.д. н.д. 69 10 н.д.
21 н.д. н.д. 18 11 н.д.
22 н.д. н.д. >71 12 н.д.
23 н.д. н.д. н.д. 12 н.д.
24 н.д. н.д. н.д. 13 н.д.
25 н.д. н.д. н.д. 13 н.д.
26 н.д. н.д. н.д. 14 н.д.

Пример 12 - Зависимость «доза-ответ» для подкожного введения

Выживаемость мышей с тяжелой формой СМА, получавших подкожно различные дозы ISIS396443, оценивалась в следующих группах.

Группа 1-SC400 (доза составляла от 80 мг/кг до 180 мг/кг)

Две подкожные инъекции, в сумме составляющие 400 мкг на мышь, вводились между Р0 и Р3, первая доза составляла 150 мкг (объемом 3 мкл) и вводилась в Р0 или P1, a вторая - 250 мкг в Р2 или Р3 (объемом 5 мкл).

Группа 2-SC200 (доза составляла от 40 мг/кг до 90 мг/кг)

Две подкожные инъекции, в сумме составляющие 200 мкг на мышь, вводились между Р0 и Р3, первая доза составляла 75 мкг (объемом 1,5 мкл) и вводилась в Р0-Р1, а вторая -125 мкг в Р2 или Р3 (объемом 2,5 мкл).

Группа 3-SC 100 (доза составляла от 20 мг/кг до 45 мг/кг)

Две подкожные инъекции, в сумме составляющие 100 мкг на мышь, вводилась между Р0 и Р3, первая доза составляла 40 мкг в Р0 или Р1 (объемом 2 мкл), а вторая - 60 мкг (объемом 3 мкл) и вводилась в Р2 или Р3.

Группа 4 - СМА физиологический раствор (отрицательный контроль)

Две подкожные инъекции физиологического раствора между Р0 и Р3 днями, первая была сделана в день Р0 или Р1 (объемом 5 мкл), а вторая вводилась в Р2 или Р3 (объемом 5 мкл).

Группа 5 - Гетерозиготный контроль (положительный контроль)

Мыши не получали никакого лечения.

Каждая группа включала от 14 до 26 мышей. Продолжительность жизни в днях для каждой мыши из каждой группы приведена в таблице ниже. Многие мыши в этом эксперименте выживали на протяжении всего исследования настоящего изобретения. Так, значение, обозначенное как ">", показывает, что продолжительность жизни мыши превышает указанное значение.

Мышь Группа 1 SC400 Группа 2 SC200 Группа 3 SC100 Группа 4 Физ. раствор Группа 5 Гет.
1 >82 >93 11 8 >87
2 >82 >91 11 8 >87
3 >82 >91 11 9 >87
4 >82 >91 11 9 >87
5 >82 14 11 9 >87
6 >82 25 12 9 >87
7 >82 92 18 9 >86
8 >82 >93 19 9 >86
9 >82 >93 22 9 >86
10 >82 >90 69 9 >86
11 >82 >90 >77 9 >86
12 >80 >91 >77 10 >86
13 >80 >91 >77 10 >86
14 25 >90 >77 10 >86
15 н.д. >90 >75 10 >85
16 н.д. >90 >74 11 >85
17 н.д. 86 >74 11 >85
18 н.д. >90 >74 12 н.д.
19 н.д. >52 >74 12 н.д.
20 н.д. н.д. >74 13 н.д.
21 н.д. н.д. >74 13 н.д.
22 н.д. н.д. >71 13 н.д.
23 н.д. н.д. >49 13 н.д.
24 н.д. н.д. >49 14 н.д.
25 н.д. н.д. >49 15 н.д.
26 н.д. н.д. 23 н.д. н.д.

Пример 13 - Сравнение ИСВ инфузии и ИСВ болюса

Введение с помощью интрасеребровентрикулярной болюсной инъекции (ИСВ болюс) сравнивалось с введением с помощью продолжительной интрасеребровентрикулярной инфузии (ИСВ инфузия). Трансгенные мыши с типом III CMA дозированно получали ISIS387954. Мыши для ИСВ инфузии получали общую дозу 0 (PBS контроль), 87,5 мкг, 175 мкг, 350 мкг или 700 мкг, инфузированные в течение 7 дней, и были умерщвлены спустя 2 дня. Мыши для ИСВ болюсного введения получали такие же дозы, 0 (PBS контроль), 87,5 мкг, 175 мкг, 350 мкг или 700 мкг, в однократной ИСВ инъекции и были умерщвлены через 9 дней. Каждая группа включала 5 мышей. РНК была выделена из спинного мозга поясничного отдела и проанализирована с помощью ПЦР в реальном времени. Включение интрона 7 соотнесено с контрольными значениями от мышей, получавших физиологический раствор. Результаты представлены в следующей таблице.

Группа Доза Кратное увеличение включения интрона 7 относительно PBS
1 PBS (контроль) 1,0
2 87,5 мкг с помощью ИСВ инфузии 2,1
в течение 7 дней
3 175 мкг с помощью ИСВ инфузии в течение 7 дней 2,4
4 350 мкг с помощью ИСВ инфузии в течение 7 дней 3,2
5 700 мкг с помощью ИСВ инфузии в течение 7 дней 3,6
6 PBS (контроль) 1,0
7 87,5 мкг с помощью ИСВ болюса 3,1
8 175 мкг с помощью ИСВ болюса 3,7
9 350 мкг с помощью ИСВ болюса 3,8
10 700 мкг с помощью ИСВ болюса 3,8

В этом эксперименте одинаковые дозы, вводимые посредством ИСВ болюсной инъекции, вызвали увеличение активности по сравнению с введением с помощью ИСВ инфузии в течение 7 дней.

ПЦР в реальном времени также была проведена для определения уровня экспрессии фактора воспаления аллотрансплантата (AIF1) для оценки воспаления. Ни один из образцов, полученных от исследуемых мышей, не показал существенное отличие от контрольных значений.

Пример 14 - Зависимость «доза-ответ» при интрасеребровентрикулярном болюсном введении

Интрасеребровентрикулярное болюсное введение было протестировано на дополнительных дозах. Трансгенные мыши получили 0, 10,9 мкг, 21,9 мкг, 43,4 мкг, 87,5 мкг или 175 мкг ISIS3 87954 путем однократной болюсной интрасеребровентрикулярной инъекции и были умерщвлены через 9 дней, как описано в Примере 13. Были получены образцы из головного мозга и спинного мозга поясничного отдела позвоночника. РНК была подготовлена и проанализирована с помощью ОТ-ПЦР на изменения включения интрона 7 и изменения в AIF1. Ни один из образцов не показал изменение в AIF1 по сравнению с контролем. Результаты включения интрона 7 приведены в таблице ниже. ED50 находится на отметке примерно 22 мкг.

Группа Доза Кратное увеличение включение интрона 7 относительно контроля PBS
Головной мозг Люмбальный отдел спинного мозга
1 PBS (контроль) 1,0 1,0
2 10,9 мкг с помощью ИСВ болюса 2,4 2,2
3 21,9 мкг с помощью ИСВ болюса 2,8 2,7
4 43,4 мкг с помощью ИСВ болюса 3,2 3,4
5 87,5 мкг с помощью ИСВ болюса 3,5 3,4
6 175 мкг с помощью ИСВ болюса 4,4 3,7

1. Способ облегчения по меньшей мере одного симптома спинальной мышечной атрофии у субъекта, способ содержит введение субъекту, имеющему по меньшей мере один симптом, ассоциированный со спинальной мышечной атрофией, антисмыслового соединения, содержащего антисмысловой олигонуклеотид, комплементарный интрону 7 пре-мРНК, кодирующей человеческий SMN2, где антисмысловый олигонуклеотид имеет нуклеиновую последовательность, состоящую из нуклеиновой последовательности SEQ ID NO: 1, где каждый нуклеозид антисмыслового олигонуклеотида содержит модифицированный остаток сахара, где каждый модифицированный остаток сахара представляет собой 2'-метоксиэтил остаток сахара и где каждая межнуклеозидная связь представляет собой фосфоротиоатную связь.

2. Способ по п.1, где антисмысловое соединение вводят в цереброспинальную жидкость.

3. Способ по п.1, где антисмысловое соединение вводят в интратекальное пространство.

4. Способ по п.1, где антисмысловое соединение вводят в цереброспинальную жидкость в головном мозге.

5. Способ по п.1, где введение включает (i) болюсную инъекцию или (ii) введение с помощью нагнетающего насоса.

6. Способ по п.1, где антисмысловое соединение вводят в дозе от 0,01 до 10 милиграммов антисмыслового соединения на килограмм веса тела субъекта.

7. Способ по п.1, где по меньшей мере один нуклеозид антисмыслового олигонуклеотида содержит модифицированное нуклеиновое основание.

8. Способ по п.7, где модифицированное нуклеиновое основание представляет собой 5-метилцитозин.

9. Способ по п.1, где антисмысловое соединение также вводят системно, необязательно путем подкожного введения, внутривенной или внутрибрюшинной инъекции; и/или необязательно где системное введение и введение в центральную нервную систему производятся в разное время.

10. Применение антисмыслового соединения, содержащего антисмысловой олигонуклеотид, комплементарный интрону 7 пре-мРНК, кодирующей человеческий SMN2, в производстве лекарственного средства для облегчения или лечения по меньшей мере одного симптома спинальной мышечной атрофии у субъекта, где антисмысловой олигонуклеотид имеет нуклеиновую последовательность, состоящую из нуклеиновой последовательности SEQ ID NO: 1, где каждый нуклеозид антисмыслового олигонуклеотида содержит модифицированный остаток сахара, где каждый модифицированный остаток сахара представляет собой 2'-метоксиэтил остаток сахара и где каждая межнуклеозидная связь представляет собой фосфоротиоатную связь.

11. Применение по п.10 в лечении болезни или состояния, ассоциированного с фактором выживаемости мотонейронов 1 (SMN1), где необязательно субъект имеет (i) спинальную мышечную атрофию типа I; (ii) спинальную мышечную атрофию типа II или (iii) спинальную мышечную атрофию типа III.

12. Применение по п.10, где по меньшей мере один нуклеозид антисмыслового олигонуклеотида содержит модифицированное нуклеиновое основание.

13. Применение по п.12, где модифицированное нуклеиновое основание представляет собой 5-метилцитозин.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к получению стимулированных дендритных клеток (ДК), и может быть использовано в медицине для иммунотерапии рака.

Настоящее изобретение относится к способу получения пэгилированного олигонуклеотида, который может быть использован для получения биологически активных веществ.

Изобретение относится к области биотехнологии, конкретно к получению популяции Tr1-клеток, направленных против коллагена типа II, и может быть использовано в медицине.

Изобретение относится к области биотехнологии, конкретно к гибридным белкам рецептора фактора роста фибробластов (FGFR), и может быть использовано в медицине для лечения заболеваний, связанных с избыточной экспрессией FGF.

Настоящее изобретение относится к биотехнологии и представляет собой конъюгат для внутриклеточной доставки миРНК, содержащий миРНК, которая посредством ковалентной связи конъюгирована с одной стороны с гидрофильным соединением, например, с ПЭГ, а с другой стороны с гидрофобным соединением, например с холестерином.

Изобретение относится к области молекулярной биологии и может быть использовано в медицине. Предложен олигодезоксирибонуклеотидный ингибитор ДНК-метилтрансферазы 1 человека (Dnmt1), характеризующийся тем, что он имеет самокомплементарную структуру, которая образует двуцепочечную шпильку, имеет неспаренную СА пару в сайте узнавания фермента ДНК-метилтрансферазы 1 человека и содержит в своем составе 5-метилцитозин (5mC) и тиофосфаты вместо фосфатов.

Изобретение относится к медицине, а именно к экспериментальной хирургии, и может быть использовано для лечения инфекционного перитонита в эксперименте. Для этого крысам внутривенно вводят суспензию аллогенных мезенхимальных стволовых клеток из расчета 1,5×106 на 100 г массы животного в 2 мл физиологического раствора.

Изобретение относится к области биотехнологии, конкретно к лентивирусной доставке апоптина в опухолевые ткани, и может быть использовано в медицине. Способ включает получение лентивирусного конструкта, экспрессирующего модифицированный апоптин, слитый с секреторным сигналом лактотрансферрина и трансдукторным сигналом (ST-CTP-апоптин), с последующим получением рекомбинантных лентивирусных частиц, дефектных по репликации и несущих модифицированный апоптин, которые затем вводятся в Т-лимфоциты (TILs), полученные при хирургическом удалении опухоли или в процессе получения биопсии, которые обладают способностью проникать в опухолевые ткани.

Изобретение относится к области биотехнологии, конкретно к получению олигопептидных соединений, содержащих мотив, взаимодействующий с ядерным антигеном пролиферирующих клеток (PCNA), и может быть использовано в медицине.

Настоящее изобретение относится к области биотехнологии, конкретно к предварительной оценке эффективности трансплантации аутологичного клеточного материала для стимуляции роста кровеносных сосудов, и может быть использовано в медицине.

Изобретение относится к медицине и касается композиции для подавления экспрессии гена цитокина интерлейкина-4 посредством механизма интерференции РНК, состоящей из катионного дендримерного пептида LTP с формулой (Arg)8(Lys)4(Lys)2Lys-Ala-Cys-NH2, выступающего в качестве носителя, и двух молекул siRNA с формулами 5-UUGAUGAUCUCCUGUAAGGtt-3 и 5-AAAGAUGUCUGUUACGGUCtt-3.

Настоящее изобретение относится к миметикам ПАР и способу их получения для создания новых медицинских препаратов общей формулы где Y - остаток нуклеозида, аминопроизводного алифатического соединения, флуоресцентного красителя; Z - остаток нуклеозида, (k+1)·m=1-200; X является О или S; R1 и R2 являются остатком дисахаридного нуклеозида или остаток формул где n=2-6; 2-6 или 1-4 соответственно, N=остаток нуклеозида, или -((CH2)nO)m-(P=X(OH))O-N-, где n=2-6, m=1-6, R3 представляет собой разветвитель формулы где N′- остаток дисахаридного нуклеозида, n число до 100, или остаток формул n=2-6; или n=2-6; или n=1-4 где В=аденин-9-ил, урацил-1-ил, цитозин-1-ил или гуанин-9-ил.

Изобретение относится к области биотехнологии, конкретно к использованию антисмыслового олигонуклеотида ISIS 301012 для долгосрочного понижения уровней АроВ, и может быть использовано в медицине.

Изобретение относится к области биохимии. Предложена конкатемерная молекула некодирующей нуклеиновой кислоты, содержащая по меньшей мере четыре одноцепочечных участка с неметилированными CG-мотивами, для модуляции активности иммунной системы человека и животного.

Изобретение относится к области биотехнологии, конкретно к получению олигопептидных соединений, содержащих мотив, взаимодействующий с ядерным антигеном пролиферирующих клеток (PCNA), и может быть использовано в медицине.

Изобретение относится к химико-фармацевтической промышленности и представляет собой способ уменьшения продуцирующих внеклеточный матрикс клеток в легких или подавления увеличения продуцирующих внеклеточный матрикс клеток в легких, содержащий введение субъекту композиции, содержащей (i) носитель, содержащий ретиноид в качестве направляющего агента, и (ii) лекарственное средство, выбранное из группы, состоящей из миРНК, рибозима, антисмысловой нуклеиновой кислоты и ДНК/РНК химерного полинуклеотида, который нацелен на HSP47, и векторов, экспрессирующих указанные миРНК, рибозим, антисмысловую нуклеиновую кислоту и/или ДНК/РНК химерный полинуклеотид.

Группа изобретений относится к области биотехнологии и медицины. Введение субъекту молекулы нуклеиновой кислоты при лечении волчаночного нефрита, которая способна связываться с MCP-1 и является антагонистом МСР-1, где молекула нуклеиновой кислоты содержит последовательность нуклеиновой кислоты SEQ ID NO:37 совместно с иммуносупрессивным средством, позволяет снизить дозу вводимого иммуносупрессивного средства.

Изобретение относится к области молекулярной биологии и генной инженерии. Предложена молекула RNAi для супрессии экспрессии тимидилатсинтазы за счет действия RNAi, содержащая домен двухцепочечной РНК, состоящий из смысловой цепи, состоящей из нуклеотидной последовательности, представленной SEQ ID NO: 1, гибридизованной с антисмысловой цепью, гибридизующейся в жестких условиях со смысловой цепью.

Изобретение относится к области биотехнологии. Описаны антисмысловые соединения, способы снижения уровня фактора 11 и способы лечения или предупреждения тромбоэмболических осложнений у индивидуума, нуждающегося в этом.
Изобретение относиться к области ветеринарии. Способ заключается в применении стельным коровам за 30 дней до отела иммуностимулятора «Риботан» внутримышечно в дозе 10 мл на животное однократно в сочетании с углеводно-минеральной добавкой «Фелуцен» ежедневно с кормом из расчета 50 г на животное.

Группа изобретений относится к области медицины и касается антибактериального комплекса, содержащего последовательность нуклеиновой кислоты нативного клеточного связывающего сайта для бактериального фактора транскрипции и группу доставки, выбранную из соединений четвертичного амина и бис-аминоалканов и их ненасыщенных производных, при этом аминокомпонент аминоалкана является аминогруппой, образующей часть гетероциклического кольца. Антибактериальный комплекс и фармацевтическая композиция, содержащая его, применяются для лечения бактериальных инфекций. Группа изобретений обеспечивает средства, которые являются эффективными при низких концентрациях, обладают синергетическим антибактериальным эффектом. 5 н. и 17 з.п. ф-лы, 22 ил., 5 табл., 9 пр.

Предложенная группа изобретений относится к области медицины. Предложен способ облегчения по меньшей мере одного симптома спинальной мышечной атрофии у субъекта, включающий введение субъекту антисмыслового соединения, содержащего антисмысловой олигонуклеотид, комплементарный интрону 7 пре-мРНК, кодирующей человеческий SMN2. Предложено применение такого антисмыслового соединения в производстве лекарственного средства для облегчения или лечения по меньшей мере одного симптома спинальной мышечной атрофии у субъекта. Предложенная группа изобретений обеспечивает эффективные средства и методы облегчения спинальной мышечной атрофии у субъекта. 2 н. и 11 з.п. ф-лы, 13 ил., 14 табл., 14 пр.

Наверх