Эффективные мишени рнк-интерференции в геноме вич-1 и субстраты дайсера, предназначенные для их поражения

Изобретение относится к областям медицинской и молекулярной генетики, а также к генотерапии, и касается набора, включающего шесть субстратов Дайсера. Представленный набор включает шесть субстратов Дайсера, которые образуют в клетках человека шесть siРНК:

5'AAAAAGCAUCAGAAAGAACCUCCAUUU 3' - А1 (7)

5'AAAUGGAGGUUCUUUCUGAUGCUUUUU 3' - A1 (8)

5'AGACAUAGUUAUCUAUCAAUACAUGGA 3' - A2 (9)

5'UCCAUGUAUUGAUAGAUAACUAUGUCU 3' - A2 (10)

5'AGGAGUAGUGGAGUCUAUGAAUAAGGA 3' - A3 (11)

5'UCCUUAUUCAUAGACUCCACUACUCCU 3' - A3 (12)

5'GUGUGGACUAUAGUAGGUAUAGAAUAU 3' - A4 (13)

5'AUAUUCUAUACCUACUAUAGUCCACAC 3' - A4 (14)

5'ACCAGGACAGACAUGGUAUGGAACAGG 3' - A5 (15)

5'CCUGUUCCAUACCAUGUCUGUCCUGGU 3' - A5 (16)

5'GUGCGAGAGCGUCAGUAUUAAGUGGGG 3' - A6 (17)

5'CCCCACUUAAUACUGACGCUCUCGCAC 3' - A6 (18),

которые при введении в клетки человека способны поражать соответствующие консервативные мишени в мРНК ВИЧ-1 (А1-А6):

5'AAAAAGCATCAGAAAGAACCTCCATTT 3' - A1 (1)

5'AGACATAGTTATCTATCAATACATGGA 3' - А2 (2)

5'AGGAGTAGTGGAGTCTATGAATAAGGA 3' - A3 (3)

5'GTGTGGACTATAGTAGGTATAGAATAT 3' - А4 (4)

5'ACCAGGACAGACATGGTATGGAACAGG 3' - А5 (5)

5'GTGCGAGAGCGTCAGTATTAAGTGGGG 3' - А6 (6),

расположенные в доменах обратной транскриптазы (мишени А1 и А2) и интегразы (мишень A3) гена pol, в мРНК гена vpu (мишень А4), а также мРНК гена env в ее домене gp120 (мишень А5) и мРНК гена gag в домене р17 (мишень А6), и вызывать подавление продукции вируса в клетках человека. Изобретение может быть использовано в медицине и научных исследованиях. 2 ил., 4 табл., 1 пр.

 

Изобретение относится к областям медицинской и молекулярной генетики, а также к генотерапии, и связано с выявлением шести эффективных мишеней для РНК-интерференции в вирусе иммунодефицита человека 1 типа (ВИЧ-1) субтипа А. Данные мишени выявлены на основе детального анализа последовательностей нуклеотидов в жизненно важных генах pol, vpu, env, и gag ВИЧ-1, кодирующих соответственно обратную транскриптазу (RT), интегразу (Int), белок vpu, белок gp120 и белок р17.

Они находятся в наиболее консервативных 27-нуклетидных областях указанных генов. Кроме того, предложены прототипы препаратов, субстраты Дайсера, которые являются 27-нуклеотидными двухцепочечными РНК и эффективно поражают эти мишени в транскриптах вируса с помощью РНК-интерференции. При этом транскрипты разрезаются, в результате чего соответствующие гены не экспрессируются. Это вызывает обрыв жизненного цикла ВИЧ-1 и блокирует его наработку в клетках человека.

Обратная транскриптаза (RT) ВИЧ-1 синтезирует копии ДНК на РНК-матрицах вируса, а интеграза (Int) обеспечивает встраивание вирусной ДНК в хромосому клетки хозяина. Эти продукты кодируются геном pol.

Белок vpu необходим для выделения дочерних вирионов из клетки. Кроме того, он взаимодействует с клеточными факторами, блокируя противовирусную защиту хозяина.

Матриксный белок р17, который кодируется геном gag, содержит домен мембранной локализации (М, membrane targeting). Данный структурный белок, окружающий капсид, играет важную роль на многих стадиях жизненного цикла вируса, включая репликацию, нацеливание РНК на плазматическую мембрану, сборку вирионов и некоторые другие [Fiorentini S, Marini Е, Caracciolo S, Caruso A. Functions of the HIV-1 matrix protein p17. New Microbiol. 2006 Jan; 29(1):1-10].

Белок gp120, который кодируется геном env, необходим для проникновения вируса в клетку.

В настоящее время основным подходом лечения СПИДа и ВИЧ-инфекции является назначение пациентам противовирусной химиотерапии, включающей препараты, действующие на ключевые ферменты ВИЧ-1 - обратную транскриптазу, интегразу, протеазу. Однако, несмотря на большое количество разработанных препаратов, существует проблема эффективности применяемой противовирусной терапии. Основная причина, объясняющая неэффективность лечения - адаптивный мутагенез вируса, приводящий к появлению вариантов вируса, обладающих устойчивостью к противовирусным препаратам. Серьезными проблемами являются также токсичность и высокая стоимость применяемых лекарственных средств.

Известно применение рибозимов и антисмысловых РНК для терапии ВИЧ-инфекции [Dorman N. And Lever A.M. (2001) RNA-based gene therapy for HIV infection. HIV Med., 2, 114-122; Michienzi A., Conti L., Varano В., Prislei S., Gessani S., and Bozzoni I. (1998) Inhibition of human immunodeficiency virus type 1 replication by nuclear chimeric anti-HIVribozymes in a human T lymphoblastoid cell line. Hum. Gene Ther., 9., 621-628; Veres G., Junker U., Baker J., Barske C., Kalfoglou C., Ilves H., Escaich S., Kaneshima H., and Bohnlein E. (1998) Comparative analysis of intracellularly expressed antisense RNAs as inhibitors of human immunodeficiency virus type 1 replication. J. Virol., 72, 1894-1901], которые блокируют несколько генов ВИЧ, что снижает его активность.

РНК-интерференция - мощный природный механизм регуляции экспрессии генов. Он запускается с помощью нарезания ферментом Дайсером, двухцепочечных РНК на 21-нуклеотидные фрагменты, которые имеют двух нуклеотидные выступы на 3' концах. Дайсер облегчает загрузку таких РНК (двухцепочечные siРНК) в сложные белковые комплексы - RISC - в которых остается только антисмысловая цепь РНК (одноцепочечная siРНК). Она служит гидом, с помощью которого RISC узнает комплементарные нуклеотидные последовательности в мРНК и разрезает их. Тем самым блокируется экспрессия соответствующего гена. Механизмы РНК-интерференции требуют полной комплементарности между мишенью в транскрипте вируса и соответствующей siРНК [Pusch et al., Nucl. Acids Res., 2003, 31, 6444-6449; Senserrich et al., Virology, 2008, 372, 421-429]. ВИЧ-1 отличает высокая вариабельность. Именно поэтому для создания технологии генотерапии ВИЧ/СПИДа требуется тщательное изучение мишеней РНК-интерференции и отбор только таких полностью комплементарных мишеней, которые одинаковы в 70-95% клинических вариантах вирусов [Kretova OV, Chechetkin VR, Fedoseeva DM, Kravatsky YV, Sosin DV, Alembekov IR, Gorbacheva MA, Gashnikova NM, Tchurikov NA. Analysis of variability in HIV-1 subtype A strains in Russia suggests a combination of deep sequencing and multi-target RNA interference for silencing of the virus. AIDS Res Hum Retroviruses. 2016 Jul 30. Epub ahead of print DOI:10.1089/AID.2016.0088 PMID:27476852].

С помощью капиллярного и глубокого секвенирования генома ВИЧ-1 субтипа А в двух когортах больных в России была изучена вариабельность в шести выбранных мишенях РНК-интерференции. В результате был сделан вывод о том, что выбранные шесть мишеней являются высоко консервативными и вполне пригодными для использования в генотерапии (Таблица 1).

Предложены шесть субстратов Дайсера (Таблица 2), которые предназначены для эффективного подавления продукции данных клинических вариантов ВИЧ-1 в клетках человека. Они могут быть использованы в медицине для генотерапии СПИДа и ВИЧ-инфекции, а также в научных исследованиях для мощного подавления продукции ВИЧ-1 субтипа А.

Наиболее близким к данному изобретению является генетическая конструкция, обеспечивающая экспрессию двух анти-ВИЧ-1 siРНК, соответствующих мишеням А1 и A3 данной Заявки (патент РФ №2552486, опубликован 6 мая 2015 г.). Кроме того, такие же мишени А2, А4, А5 и А6 приведены в патенте РФ 2552607 (мишени А1 и А6), опубликованном 7 мая 2015 г.; в патенте РФ 2607381, опубликованном 10 января 2017 г. (мишени А1 и А2).

Настоящее изобретение отличается тем, что

1. предлагается использовать не две, а шесть указанных выше высоко консервативных мишеней РНК-интерференции в генах pol, vpu, env и gag ВИЧ-1, выявленных у больных в России;

2. использовать не генетические конструкции, экспрессирующие 27-30-нуклеотидные шпильки РНК, а 27-нуклеотидные двухцепочечные РНК, субстраты Дайсера.

Отличия в нуклеотидных последовательностях мишеней настоящей Заявки от мишеней в более ранних Заявках и Патентах представлены в Таблице 3.

Ранее было описано, что 27-нуклеотидные двухцепочечные РНК позволяют усиливать эффективность РНК-интерференции на два порядка [Kim DH, Behlke MA, Rose SD, Chang MS, Choi S, Rossi JJ. Synthetic dsRNA Dicer substrates enhance RNAi potency and efficacy. Nat Biotechnol. 2005; Grimm D, Streetz KL, Jopling CL, Storm ТА, Pandey K, Davis CR, Marion P, Salazar F, Kay MA. Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature. 2006 May 5; 441(7092):537-41]. Согласно другим данным эффективность РНК-интерференции, запускаемая субстратами Дайсера, возрастает для разных мишеней в 2-5 раз [Патент РФ №2385939, опуб. 10.04.2010; Алембеков И.Р., Кретова О.В., Чуриков Н.А.. Анализ генетических конструкций, экспрессирующих антивирусные siРНК, в невирусной тест-системе. Вопросы вирусологии, 2011, т. 56, №2, с. 32-35].

Данные о мишенях РНК-интерференции ВИЧ-1 субтипа А в клинических вариантах вируса, выделенных у больных в России, получены с помощью капиллярного и глубокого секвенирования шести мишеней РНК-интерференции и депонированы в GenBank (accession numbers: KC681847-KC681888) и NCBI (Biosamples: SAMN05823508 и SAMN05828325). Все выявленные мишени характерны для изолятов вируса в России и встречаются в 83-92% вирусов (Таблица 1). Кроме того, идентичные им мишени встречаются в изолятах ВИЧ-1 из разных стран, помимо России (Таблица 4). Поиск идентичных мишеней в текущих базах данных нуклеотидных последовательностей проводили с помощью программы BLAST (NCBI). Число изученных изолятов ВИЧ-1 в разных странах может значительно отличаться. Тем не менее данные поиска свидетельствуют о том, что выявленные мишени помимо России также часто встречаются в изолятах ВИЧ-1 11-20 субтипов разных стран на всех континентах. Кроме того, мишени, идентичные мишеням А1, A3 и А6 данной Заявки, имеются в рекомбинантных вирусах AG ВИЧ-1, которые были описаны ранее [Baryshev, P.B., Bogachev, V.V. and Gashnikova, N.M. Genetic characterization of an isolate of HIV type 1 AG recombinan form circulating in Siberia, Russia. J. Arch. Virol. 157 (12), 2335-2341 (2012)].

Техническим результатам предлагаемого изобретения являются выявленные с помощью капиллярного и глубокого секвенирования в изолятах ВИЧ-1 в России шесть консервативных мишеней РНК-интерференции (А1-А6), приведенные в Таблице 1, а также соответствующие им шесть субстратов Дайсера, которые при введении в клетки человека способны поражать транскрипты генов pol (домены обратной транскриптазы, RT, и интегразы, int), vpu, env (домен gp120) и gag (домен p17) ВИЧ-1 и вызывать подавления продукции вируса в клетках человека.

Представленный технический результат достигается путем доставки одного или нескольких субстратов Дайсера (Таблица 2) в клетки человека.

Указанные субстраты Дайсера тестировали с помощью невирусной системы. Данная система предназначена для количественной оценки биологической активности siРНК, которые образуются in vivo при экспрессии генетических конструкций или при введении двухцепочечных РНК. Система создана на базе вектора psiCHECK™-2 (Promega, номер последовательности в GenBank AY535007). Вектор содержит ген люциферазы светлячка (Photinus pyralis) и ген люциферазы коралла (Renilla). Указанные люциферазы вызывают свечение разной длины волны, и их экспрессию можно измерять с помощью люминометра. В 3' концевую некодирующую область гена Renilla порознь вставляли 27-нуклеотидные последовательности ДНК, содержащие мишени A1, А2, A3, А4, А5, А6, соответствующие выбранным мишеням РНК-интерференции в транскриптах вируса. Указанные ДНК получают с помощью химического синтеза олигонуклеотидов ДНК. В Таблице 1 представлены тексты мишеней. Фрагменты ДНК, содержащие мишени, клонируют в векторе psiCHECK™-2 по сайтам рестриктаз XhoI и NotI.

Тестирование биологической активности кассеты проводят в экспериментах по трансфекции культуральных клеток человека. При этом используют ДНК плазмиды, созданной на базе вектора psi-CHECK-2, в котором в составе 3' концевой некодирующей последовательности гена люциферазы Renilla клонирована последовательность ДНК, содержащая шесть мишеней РНК-интерференции, указанных в Таблице 1. В такие клетки человека, трансфецированые указанной плазмидой, вводят химически синтезированные препараты двухцепочечных РНК (субстраты Дайсера), указанные в Таблице 2. Они являются природным субстратом Дайсера, фермента, вырезающего 21 нуклеотидные дуплексы РНК из шпильки. Если Дайсер работает на дуплексе РНК длиной более 23 пар нуклеотидов (природный субстрат), то далее он, оставаясь связанным с двуспиральной siРНК, активно участвует также и в ее "загрузке" в белковый комплекс RISC. В данном комплексе происходит раскручивание цепей siРНК и освобождение его от одной из них (от так называемой "passenger"-цепи). Если в комплексе остается антисмысловая siРНК, то она используется как "наводчик", узнающий комплементарную мишень в транскриптах клетки. После связывания комплекса с соответствующей мРНК происходит ее разрезание одним из его белков, что приводит к выключению экспрессии соответствующего гена вируса и нарушает его размножение в клетке-хозяине. В трансфецированных клетках мРНК Renilla, содержащая в 3'-некодирующей области испытываемую мишень РНК-интерференции, разрезается, что приводит к резкому снижению голубого свечения, вызываемого данной люциферазой (478 nm). Желто-зеленое свечение, вызываемое люциферазой светлячка (557 nm), кодируемой той же ДНК psiCHECK-2, служит внутренним контролем и используется для нормализации данных.

Для отбора наиболее консервативных областей ВИЧ-1 проводили множественное выравнивание известных в 2001 году последовательностей вируса. Затем в наиболее консервативных областях проводили поиск мишеней, используя on-line сервисы, предназначенные для поиска siРНК. Использовали одиннадцать критериев для отбора последовательностей мишеней РНК-интерференции в мРНК генов ВИЧ-1. Большинство из них соответствует критериям отбора siРНК фирмы Dharmacon RNA Technologies, http://dharmacon.gelifesciences.com/design-center/.,skb. Так были отобраны мишени А2-А6. Мишень А1 была отобрана по критериям Тушла (Tom Tuschl's rules, http://www.protocol-online.org/prot/Protocols/Rules-of-siRNA-design-for-RNA-interference--RNAi--3210.html).

Указанные критерии важны для того, чтобы именно антисмысловая цепь siРНК оставалась в комплексе RISC. Каждый из приведенных в Таблице 2 субстратов Дайсера в генетических конструкциях соответствует, по крайней мере, десяти из одиннадцати ниже перечисленных критериев, которые использовались для отбора коровых 19-нуклеотидных последовательностей siРНК (соответствующие им области подчеркнуты в последовательностях мишеней, указанных в Таблице 1):

- состав G/C 30-52%

- не менее 3 A/U в позициях 15-19 смысловой цепи

- отсутствие внутренних повторов

- А в позиции 19 смысловой цепи

- А в позиции 3 смысловой цепи

- U в позиции 10 смысловой цепи

- отсутствие G/C в позиции 19 смысловой цепи

- отсутствие G в позиции 13 смысловой цепи

- отсутствие гомополимерных трактов (А)4-5 или (Т)4-5 в смысловой цепи

- локализация мишени в консервативном районе генома вируса

- отсутствие гомологии с известными транскриптами генома человека.

Часть вышеперечисленных критериев отбора биологически активных siРНК опубликована [Reynolds A., Leake D., Boese Q., Scaringe S., Marshall W.S., Khvorova A. (2004) Rational siRNA design for RNA interference. Nature Biotechnol. 22, 326-330].

Приведенные в Таблице 2 субстраты Дайсера обеспечивают целенаправленное воздействие на мРНК генов pol, vpu, env и gag ВИЧ-1. Терапевтическим результатом такого воздействия является подавление репродукции вариантов ВИЧ-1 субтипа А у больных в России.

Для вируса иммунодефицита человека первого типа характерно быстрое возникновение и отбор мутантных вариантов, обладающих резистентностью к различным противовирусным препаратам. Для решения проблемы вирусной изменчивости выявлены консервативные мишени и получены соответствующие им субстраты Дайсера, атакующие шесть разных мишеней в ВИЧ-1. Таким образом, вызывается значительное подавление продукции вируса в клетках человека, которое в значительной степени не зависит от изменчивости вируса.

Краткое описание таблиц и рисунков

В Таблице 1 указаны 27-bp последовательности, соответствующие выявленным мишеням РНК-интерференции в ВИЧ-1. Последовательности ДНК представлены в ориентации 5'-3'. В скобках указаны номера последовательностей. Подчеркнуты области, соответствующие коровым 19-нуклеотидным последовательностям siРНК. Указан процент вирусов, имеющих данную мишень в изолятах ВИЧ-1 в России. Указанные 27-нуклеотидные мишени РНК-интерференции клонировали в векторе psiCHECK-2. Искусственные сайты XhoI и NotI, которые использовали для клонирования, не указаны.

Таблица 2. Последовательности 27-нуклеотидных плюс- и минус-цепей РНК, которые после попарного отжига образуют субстраты Дайсера (в скобках указаны номера последовательностей).

Таблица 3. Отличия в нуклеотидных последовательностях мишеней РНК-интерференции и генетических конструкций из более ранних Патентов и Заявок от мишеней настоящей Заявки. Мишени A1-А6 - в настоящей Заявке короче на 1-3 нуклеотида (показаны зеленым в текстах предыдущих Патентов и Заявок). Кроме того, мишень А4 имеет отличие в одной позиции (показано желтым).

Таблица 4. Поиск гомологичных последовательностей ДНК мишеней в полных не избыточных нуклеотидных баз данных NCBI с помощью программы BLAST. Устанавливали показ 5000 последовательностей из баз данных [Nucleotide collection (nr/nt)]. В третьей колонке таблицы указано найденное число идентичных для данной мишени последовательностей. Мишень А5 обнаружена только в России.

Фиг. 1. Физическая карта вектора psiCHECK-2. Вектор использовался для создания невирусной системы количественной оценки эффективности РНК-интерференции, вызываемой созданной кассетной генетической конструкцией. Указаны ген устойчивости к ампициллину (Амп), сайт полиаденилирования и энхансер SV40.

Фиг. 2. Оценка эффективность РНК-интерференции в невирусной тест-системе. РНК-интерференцию вызывают введением субстратов Дайсера в клетки HEK293T, транфецированные плазмидами, созданными на основе вектора psiCHECK-2 и содержащего мишени РНК-интерференции (Таблица 1). Приведены данные свечения гена люциферазы Renilla при ко-трансфекции "рандомизированных" мишеней с субстратами Дайсера, мишенями без добавления препаратов Дайсера, а также мишеней вместе с соответствующими субстратами Дайсера. * - p<0.007. Эксперименты проводили в трех параллелях (n=3).

Осуществление изобретения

Пример 1. Оценка эффективности РНК-интерференции, вызываемой созданными субстратами Дайсера в невирусной системе

Накануне проведения трансфекции (за 18-20 часов) клетки HEK293 рассевают в лунки 24-луночного планшета Nunc - по 50 тыс. клеток в 500 мкл культуральной среды DMEM (ПанЭко), содержащей глютамин и сыворотку (полная среда), на лунку. В день эксперимента готовят пробы ДНК для трансфекции при комнатной температуре следующим образом (на одну экспериментальную точку). В 200 мкл среды DMEM, не содержащей сыворотки (SFM), добавляют 40 ng ДНК генетической конструкции в векторе psiCHECK-2, содержащую мишени РНК-интерференции (см. Таблицу 3). После перемешивания добавляют 1 мкл свежеразмороженного реагента TransFast (Promega), встряхивают смесь и инкубируют ее 15 мин. Затем отсасывают среду из лунок с "сидящими" клетками, встряхивают пробирку со смесью ДНК-TransFast и сразу добавляют смесь в лунки с клетками и инкубируют 1 час при 37°С в CO2-инкубаторе.

Для введения субстратов Дайсера в клетки сначала проводят отжиг пар комплементарных РНК в растворе, содержащем 10 mM tris-HCl, pH 7.4; 20 mM NaCl и по 40 pmol каждой из РНК (на одну точку) путем инкубации полученного раствора в водяной бане, охлаждающейся от 65°С до 25°С в течение 20 мин. Для трансфекции отожженной РНК (субстрат Дайсера) используют siTransfection Reagent (Santa Cruz). Сначала готовят две смеси - 1 мкл Субстрата Дайсера (40 pmol) в 50 мкл SFM, а также 2 μl siRNA Transfection Reagent в 50 μl SFM (на одну точку). Затем оба раствора смешивают, инкубируют 15-45 мин при комнатной температуре.

После чего среду над клетками отсасывают, проводят отмывку один раз 100 мкл SFM. Затем добавляют 400 мкл SFM в смесь, содержащую субстрат Дайсера и siRNA Transfection Reagent, смесь медленно пипетируют для перемешивания и добавляют в лунку. После инкубации в течение 7 часов в лунку добавляют полную среду - 500 мкл и продолжают инкубацию в течение 24 час.

Далее, около 1 мл среды над клетками отсасывают и добавляют подогретую до 37°С полную среду - 800 мкл. Инкубацию продолжают еще 48 час.

Для измерения экспрессии люцифераз среду над клетками в лунках планшета отсасывают, добавляют 100 мкл раствора трипсина-ЭДТА (ПанЭко) на лунку, после 10 мин инкубации при 37°С в СО2-инкубаторе добавляют по 100 мкл полной среды, переносят полностью суспензию клеток в пробирку эппендорф на 0.5 мл, осаждают центрифугированием при комнатной температуре в центрифуге Eppendorf (5 мин - 2000 rpm), надосадочную жидкость отсасывают, суспендируют клетки в 70 мкл 1×PBS и проводят измерение свечения люцифераз светлячка и Renilla согласно рекомендациям к набору Dual-Luciferase Reporter Assay System (Promega) на люминометре Reporter Microplate Luminometer (Turner BioSystems). На Фиг. 2 показаны результаты испытания генетических конструкций в невирусной системе. Видно, что субстраты Дайсера специфически подавляют экспрессию мишеней на 81-91%.

Эффективные мишени РНК-интерференции в геноме ВИЧ-1 и субстраты Дайсера, предназначенные для их поражения

Нуклеотидные последовательности ДНК:

5' AAAAAGCATCAGAAAGAACCTCCATTT 3' (1)

5' AGACATAGTTATCTATCAATACATGGA 3' (2)

5' AGGAGTAGTGGAGTCTATGAATAAGGA 3' (3)

5' GTGTGGACTATAGTAGGTATAGAATAT 3' (4)

5' ACCAGGACAGACATGGTATGGAACAGG 3' (5)

5' GTGCGAGAGCGTCAGTATTAAGTGGGG 3' (6),

Нуклеотидные последовательности РНК:

5' AAAAAGCAUCAGAAAGAACCUCCAUUU 3' (7)

5' AAAUGGAGGUUCUUUCUGAUGCUUUUU 3' (8)

5' AGACAUAGUUAUCUAUCAAUACAUGGA 3' (9)

5' UCCAUGUAUUGAUAGAUAACUAUGUCU 3' (10)

5' AGGAGUAGUGGAGUCUAUGAAUAAGGA 3' (11)

5' UCCUUAUUCAUAGACUCCACUACUCCU 3' (12)

5' GUGUGGACUAUAGUAGGUAUAGAAUAU 3' (13)

5' AUAUUCUAUACCUACUAUAGUCCACAC 3' (14)

5' ACCAGGACAGACAUGGUAUGGAACAGG 3' (15)

5' CCUGUUCCAUACCAUGUCUGUCCUGGU 3' (16)

5' GUGCGAGAGCGUCAGUAUUAAGUGGGG 3' (17)

5' CCCCACUUAAUACUGACGCUCUCGCAC 3' (18)

Набор, включающий шесть субстратов Дайсера, которые получают путем попарного отжига комплементарных последовательностей РНК:

5'AAAAAGCAUCAGAAAGAACCUCCAUUU 3' - А1 (7)

5'AAAUGGAGGUUCUUUCUGAUGCUUUUU 3' - A1 (8)

5'AGACAUAGUUAUCUAUCAAUACAUGGA 3' - A2 (9)

5'UCCAUGUAUUGAUAGAUAACUAUGUCU 3' - A2 (10)

5'AGGAGUAGUGGAGUCUAUGAAUAAGGA 3' - A3 (11)

5'UCCUUAUUCAUAGACUCCACUACUCCU 3' - A3 (12)

5'GUGUGGACUAUAGUAGGUAUAGAAUAU 3' - A4 (13)

5'AUAUUCUAUACCUACUAUAGUCCACAC 3' - A4 (14)

5'ACCAGGACAGACAUGGUAUGGAACAGG 3' - A5 (15)

5'CCUGUUCCAUACCAUGUCUGUCCUGGU 3' - A5 (16)

5'GUGCGAGAGCGUCAGUAUUAAGUGGGG 3' - A6 (17)

5'CCCCACUUAAUACUGACGCUCUCGCAC 3' - A6 (18),

которые при введении в клетки человека способны поражать соответствующие консервативные мишени в мРНК ВИЧ-1 (А1-А6):

5'AAAAAGCATCAGAAAGAACCTCCATTT 3' - A1 (1)

5'AGACATAGTTATCTATCAATACATGGA 3' - А2 (2)

5'AGGAGTAGTGGAGTCTATGAATAAGGA 3' - A3 (3)

5'GTGTGGACTATAGTAGGTATAGAATAT 3' - А4 (4)

5'ACCAGGACAGACATGGTATGGAACAGG 3' - А5 (5)

5'GTGCGAGAGCGTCAGTATTAAGTGGGG 3' - А6 (6),

расположенные в доменах обратной транскриптазы (мишени А1 и А2) и интегразы (мишень A3) гена pol, в мРНК гена vpu (мишень А4), а также мРНК гена env в ее домене gp120 (мишень А5) и мРНК гена gag в домене р17 (мишень А6), и вызывать подавление продукции вируса в клетках человека.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к способу борьбы с насекомыми, выбранными из группы, состоящей из Pseudoplusia includens, Anticarsia gemmatalis, Spodoptera frugiperda и Heliothis virescens, а также к способу борьбы с сорняками сельскохозяйственной культуры сои, который включает обработку сельскохозяйственной культуры сои гербицидом глюфосинатом.
Изобретение относится к мезомасштабной жидкостной системе, содержащей основу, содержащую камеру для образца и камеру для анализа; камера для образца содержит проницаемый для клеток фильтр, образующий отделение для внесения образца и отделение для кондиционирующей среды; камера для образца содержит впускное отверстие для образца в отделении для внесения образца; камера для анализа содержит входное отверстие и выходное отверстие; отделение для кондиционирующей среды находится в жидкостном сообщении с входным отверстием камеры для анализа через канал; при этом отделение для внесения образца находится ниже проницаемого для клеток фильтра, а отделение для кондиционирующей среды находится выше проницаемого для клеток фильтра.

Группа изобретений относится к медицине и касается средства для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с количественным снижением белка альфа-2 цепи коллагена I типа, на основе генно-терапевтических субстанций с геном COL1A2, где клетки органов и тканей выбраны из фибробластов, кератоцитов, хондробластов и эпителиальных клеток роговицы глаза, органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани человека, представляющего собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет собой генетическую конструкцию на основе векторной плазмиды, содержащей нативную кДНК гена COL1A2 SEQ ID No: 1 или модифицированной кДНК гена COL1A2, при этом в качестве модифицированной кДНК гена COL1A2 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы в сочетании с транспортной молекулой или без нее.

Изобретение относится к области биохимии. Описана группа изобретений, включающая конъюгат, снижающий уровень экспрессированной в печени РНК, содержащий антисмысловой LNA-олигомер и ковалентно связанную с ним конъюгатную группировку, содержащую группу, направленную на асиалогликопротеиновый рецептор и фармацевтическую композицию, содержащую вышеуказанный конъюгат в эффективном количестве.

Изобретение относится к области биохимии, в частности к молекуле рекомбинантной ДНК, указывающей на присутствие трансгенного события, где показательный образец семени, содержащего указанное трансгенное событие, депонирован в ATCC как РТА-12669.

Изобретение относится к биохимии. Описан одноцепочечный олигонуклеотид антигена, комплементарный к антисмысловой нити ДНК целевого гена, содержащий 12-24 нуклеотида, причем указанный олигонуклеотид характеризуется последовательностью, содержащей по меньшей мере три группы по меньшей мере из двух следующих друг за другом гуанинов.

Изобретение относится к генной инженерии, биотехнологии и иммунобиологии. Описан способ получения рекомбинантного белка склеростина позвоночного животного.

Настоящая группа изобретений относится к области медицины, в частности фармакологии, и раскрывает способ получения липидной наночастицы, инкапсулирующей молекулу siPHK и фармацевтическую композицию, содержащую липидную наночастицу, инкапсулирующую молекулу siPHK.

Изобретение относится к генетической инженерии, в частности к способу модификации целевого геномного локуса путем гомологичной рекомбинации в мышиной эмбриональной стволовой (ES) клетке.

Изобретение относится к области биотехнологии и медицины. Предложен аптамер, специфичный к внеклеточному гликозилированному домену человеческого рецептора CD47, способный блокировать его взаимодействие с природным лигандом SIRP-alpha.

Группа изобретений относится к области биотехнологии. Предложены изолированный полинуклеотидный субстрат для каталитической нуклеиновой кислоты с ферментативной активностью и его применение, способ детектирования присутствия мишени в образце, использующий указанный субстрат, а также набор для детекции молекулы-мишени и комплект для детекции молекулы-мишени, содержащие указанный субстрат, и набор для применения в сигнальном каскаде, содержащий указанный комплект. Предложенный изолированный полинуклеотидный субстрат способен эффективно каталитически модифицироваться в широком диапазоне температур. Предложенная группа изобретений может быть использована в биотехнологии для детектирования присутствия мишени в образце. 6 н. и 30 з.п. ф-лы, 13 ил., 25 табл., 10 пр.

Изобретение относится к области биотехнологии. Предложены кольцевой двухцепочечный полинуклеотид для интеграции экзогенной нуклеиновой кислоты в геном клетки и способ интеграции экзогенной последовательности нуклеиновой кислоты в эндогенный локус клетки. Предложенный кольцевой двухцепочечный полинуклеотид содержит экзогенную последовательность нуклеиновой кислоты и две последовательности, фланкирующие указанную экзогенную последовательность. При этом фланкирующие последовательности содержат два или более участков-мишеней для двух или более не встречающихся в природе нуклеаз. Указанные сайты-мишени фланкируют спейсерную последовательность длиной 4-20 нуклеотидов, не встречающуюся в геноме указанной клетки. Предложенный двухцепочечный полинуклеотид не содержит плеч гомологии. Предложенные полинуклеотид и способ могут быть использованы в биотехнологии для независимой от гомологии направленной вставки донорных молекул в геном клетки. 2 н. и 14 з.п. ф-лы, 61 ил., 33 табл., 10 пр.
Изобретение относится к области биохимии. Предложен набор реактивов для выделения ДНК из биологических объектов. Набор включает лизирующий буферный раствор, промывочные буферные растворы №1 и №2, элюирующий буферный раствор. Лизирующий буферный раствор содержит гуанидин тиоцианат, трис гидрохлорид, тритон и сорбент, в виде суспензии из магнитных микросфер в солевом растворе. Промывочный буфер №1 содержит гуанидин тиоцианат, трис гидрохлорид и этиловый спирт. Промывочный буфер №2 содержит трис гидрохлорид, хлорид натрия и этиловый спирт. Элюирующий раствор представляет собой деионизированную воду. Изобретение обеспечивает увеличение выхода ДНК. 1 пр.

Изобретение относится к области биохимии и молекулярно-генетической диагностики, в частности к способу выявления у субъекта предрасположенности к развитию панического расстройства. Настоящий способ включает совместное выявление комплексных генотипов в генах SLC6A4, HTR1A, CCKAR. Согласно указанному способу диагностическим признаком предрасположенности к развитию панического расстройства является наличие сочетания однонуклеотидных замен rs6295:C в гене HTR1A и rs3813034:CC в гене SLC6A4 или наличие сочетания однонуклеотидных замен rs1799723:A и rs1800908:T в гене CCKAR. Настоящее изобретение позволяет прогнозировать высокий риск развития панического расстройства у субъектов. 5 з.п. ф-лы, 1 ил., 5 табл., 3 пр.

Изобретение относится к биохимии. Описан антисмысловой олигомер, который вызывает пропуск 55-го экзона в гене дистрофина человека, состоящий из нуклеотидной последовательности, комплементарной любой из нуклеотидных последовательностей, состоящих из 14-го – 34-го или 15-го – 34-го нуклеотидов, считая от 5'-конца 55-го экзона гена дистрофина человека. Также описана фармацевтическая композиция для лечения мышечной дистрофии, включающая в качестве действующего ингредиента антисмысловой олигомер, или его фармацевтически приемлемую соль, или гидрат. Кроме того, представлен способ лечения мышечной дистрофии, включающий введение терапевтически эффективного количества заявленного олигомера. Изобретение расширяет арсенал средств для лечения мышечной дистрофии. 3 н. и 8 з.п. ф-лы, 31 ил., 15 табл., 39 пр.

Настоящее изобретение относится к биохимии, генной инженерии и биотехнологии, в частности к новым полипептидам с антимикробной активностью в отношении энтерогеморрагических бактерий вида Escherichia coli. Указанные полипептиды предназначены для медицинского использования, дезинфекции поверхностей, консервирования пищевых продуктов и для покрытия перевязочного материала. Изобретение также относится к способу получения указанных полипептидов и к композициям, содержащим указанные полипептиды. Настоящее изобретение позволяет получать новые полипептиды с антимикробной активностью в отношении энтерогеморрагических бактерий. 10 н. и 18 з.п. ф-лы, 6 ил., 3 табл., 5 пр.

Изобретение относится к биотехнологии. Описана молекула нуклеиновой кислоты, содержащая двухцепочечную структуру,где двухцепочечная структура образована первой цепью и второй цепью, где первая цепь состоит из следующей нуклеотидной последовательности:5'-acGaGcUgGaCcAcUgGuCdTSdT-3' и вторая цепь состоит из следующей нуклеотидной последовательности:5'-GAcCaGuGgUcCaGcUcGudTSdT-3', где то, что нуклеотид указан строчной буквой, указывает на то, что нуклеотид является 2'-F-модифицированным, и подчеркивание нуклеотида указывает на то, что нуклеотид является 2'-O-метил-модифицированным и где dTSdT указывает на то, что на 3'-конце присоединен динуклеотид, состоящий из двух нуклеотидов dT, где указанные два dT ковалентно связаны посредством фосфотиоатной связи. Описано применение описанной молекулы нуклеиновой кислоты в получении средства для восстановления чувствительности злокачественных клеток к лекарственному средству и для лечения и/или профилактики заболевания. Представлены фармацевтическая композиция и наноэмульсия, содержащие описанную молекулу нуклеиновой кислоты. 7 н. и 104 з.п. ф-лы, 5 ил., 3 табл., 5 пр.

Изобретение относится к области биохимии, в частности к нуклеиновой кислоте, кодирующей белок слияния из многих субъединиц гликолатдегидрогеназы, а также трансгенной клетке растения, трансгенному растению и трансгенному семени, содержащим вышеуказанную нуклеиновую кислоту. Также раскрыт способ увеличения производства биомассы и фиксации углерода в растениях по сравнению с диким видом растения, включающий введение в геном клетки растения нуклеиновой кислоты, кодирующей белок слияния из многих субъединиц гликолатдегидрогеназы. Изобретение позволяет эффективно получать растение с увеличенным производством биомассы и фиксации углерода по сравнению с диким видом растения. 5 н. и 14 з.п. ф-лы, 2 ил., 1 табл., 8 пр.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена SOD2, связанных с оксидативным стрессом, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, слизистой оболочки рта человека или мышечной ткани человека, представляющего собой совокупность биологически активных генотерапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена SOD2, с кодирующей последовательностью белка супероксиддисмутазы-1, с делециями 5' и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена SOD2 SEQ ID No: 1, или модифицированной кДНК гена SOD2, при этом в качестве модифицированной кДНК гена SOD2 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках, органов и тканей человека, в сочетании с транспортной молекулой или без нее. Группа изобретений также касается способа получения указанного средства; способа использования указанного средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена SOD2, связанных с количественным снижением белка SOD2. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 18 пр., 20 ил.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена GPX3, связанных с оксидативным стрессом, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, слизистой оболочки рта человека или мышечной ткани человека, представляющего собой совокупность биологически активных генно-терапевтических субстанций, причем каждая из совокупности биологически активных генно-терапевтических субстанций представляет собой генетическую конструкцию на основе векторной плазмиды, включающую участок кДНК гена GPX3 и содержащую также регуляторные элементы, обеспечивающие транскрипцию этой последовательности в эукариотических клетках, а именно в клетках органов и тканей человека, в сочетании с транспортной молекулой или без нее. Группа изобретений также касается способа получения указанного средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена GPX3, связанных с оксидативным стрессом; способа использования указанного средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека, на основе гена GPX3, связанных с количественным снижением белка GPX3. Группа изобретений обеспечивает высокий и стабильный уровень целевого белка в клетках. 3 н. и 2 з.п. ф-лы, 18 пр., 20 ил.

Изобретение относится к областям медицинской и молекулярной генетики, а также к генотерапии, и касается набора, включающего шесть субстратов Дайсера. Представленный набор включает шесть субстратов Дайсера, которые образуют в клетках человека шесть siРНК:5AAAAAGCAUCAGAAAGAACCUCCAUUU 3 - А1 5AAAUGGAGGUUCUUUCUGAUGCUUUUU 3 - A1 5AGACAUAGUUAUCUAUCAAUACAUGGA 3 - A2 5UCCAUGUAUUGAUAGAUAACUAUGUCU 3 - A2 5AGGAGUAGUGGAGUCUAUGAAUAAGGA 3 - A3 5UCCUUAUUCAUAGACUCCACUACUCCU 3 - A3 5GUGUGGACUAUAGUAGGUAUAGAAUAU 3 - A4 5AUAUUCUAUACCUACUAUAGUCCACAC 3 - A4 5ACCAGGACAGACAUGGUAUGGAACAGG 3 - A5 5CCUGUUCCAUACCAUGUCUGUCCUGGU 3 - A5 5GUGCGAGAGCGUCAGUAUUAAGUGGGG 3 - A6 5CCCCACUUAAUACUGACGCUCUCGCAC 3 - A6,которые при введении в клетки человека способны поражать соответствующие консервативные мишени в мРНК ВИЧ-1 :5AAAAAGCATCAGAAAGAACCTCCATTT 3 - A1 5AGACATAGTTATCTATCAATACATGGA 3 - А2 5AGGAGTAGTGGAGTCTATGAATAAGGA 3 - A3 5GTGTGGACTATAGTAGGTATAGAATAT 3 - А4 5ACCAGGACAGACATGGTATGGAACAGG 3 - А5 5GTGCGAGAGCGTCAGTATTAAGTGGGG 3 - А6,расположенные в доменах обратной транскриптазы и интегразы гена pol, в мРНК гена vpu, а также мРНК гена env в ее домене gp120 и мРНК гена gag в домене р17, и вызывать подавление продукции вируса в клетках человека. Изобретение может быть использовано в медицине и научных исследованиях. 2 ил., 4 табл., 1 пр.

Наверх