Способ определения генетической предрасположенности к развитию панического расстройства



Способ определения генетической предрасположенности к развитию панического расстройства
Способ определения генетической предрасположенности к развитию панического расстройства
Способ определения генетической предрасположенности к развитию панического расстройства
Способ определения генетической предрасположенности к развитию панического расстройства
Способ определения генетической предрасположенности к развитию панического расстройства
Способ определения генетической предрасположенности к развитию панического расстройства
Способ определения генетической предрасположенности к развитию панического расстройства
Способ определения генетической предрасположенности к развитию панического расстройства
Способ определения генетической предрасположенности к развитию панического расстройства
Способ определения генетической предрасположенности к развитию панического расстройства
Способ определения генетической предрасположенности к развитию панического расстройства
C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2650867:

Общество с ограниченной ответственностью "Университетская диагностическая лаборатория" (RU)

Изобретение относится к области биохимии и молекулярно-генетической диагностики, в частности к способу выявления у субъекта предрасположенности к развитию панического расстройства. Настоящий способ включает совместное выявление комплексных генотипов в генах SLC6A4, HTR1A, CCKAR. Согласно указанному способу диагностическим признаком предрасположенности к развитию панического расстройства является наличие сочетания однонуклеотидных замен rs6295:C в гене HTR1A и rs3813034:CC в гене SLC6A4 или наличие сочетания однонуклеотидных замен rs1799723:A и rs1800908:T в гене CCKAR. Настоящее изобретение позволяет прогнозировать высокий риск развития панического расстройства у субъектов. 5 з.п. ф-лы, 1 ил., 5 табл., 3 пр.

 

Изобретение относится к биомедицине, молекулярно-генетической диагностике и медицине и может найти применение в неврологии и психиатрии для прогнозирования риска развития панического расстройства у человека. В частности, в изобретении раскрыт способ выявления предрасположенности к паническому расстройству у человека путем анализа генотипов четырех однонуклеотидных замен (SNV) в трех генах CCKAR (rs1800908 и rs1799723), HTR1A (rs6295), SLC6A4 (rs3813034) и выявления сочетаний генотипов и аллелей данных генов, которые могут быть использованы в качестве диагностического признака, имеющего высокую прогностическую силу.

Предшествующий уровень техники.

Термины и определения:

Наследуемость - доля фенотипической изменчивости в популяции, обусловленная генетической изменчивостью (в отношении к определенному качественному или количественному признаку)

Наследственная предрасположенность к развитию заболевания - наличие в геноме субъекта определенных наследственных влияний (мутаций или сочетаний аллелей), которые, в сочетании с факторами внешней среды, приводят к развитию определенного заболевания/функционального нарушения.

Относительный риск заболеваемости - мера риска появления определенного события в одной группе по сравнению с риском такого же события в другой группе (наличие/отсутствие признака или заболевание).

Генетический полиморфизм - в популяции обычно встречается несколько вариантов (аллелей) каждого гена. Если частота таких вариантов достаточно высока и не может быть объяснена случайным возникновением одинаковых мутаций в разных семьях, то говорят о полиморфизме данного локуса.

(ДНК-маркеры, молекулярно-генетические маркеры) - полиморфный признак, выявляемый методами молекулярной биологии на уровне нуклеотидной последовательности ДНК, для определенного гена или для любого другого участка хромосомы при сравнении различных генотипов.

Однонуклеотидная замена - генетический полиморфизм или мутация определенного локуса

Диагностический признак (показатель) - это биологический феномен, который ассоциирован с определенным физиологическим состоянием организма и может быть выявленным при помощи стандартизированного диагностического метода. Один показатель можно определить при помощи нескольких методов, которые отличаются по аналитическим характеристикам; из-за этого разными являются «границы нормы» и диагностическое значение показателя.

Диагностический тест - определение конкретного диагностического признака (показателя) при помощи конкретного метода, аналитические параметры которого остаются неизменными при условии контроля качества его выполнения.

Диагностический метод - клинический, лабораторный, инструментальный или морфологический - описывает определенный биологический феномен в организме человека.

Паническое расстройство - одно из самых распространенных тревожных расстройств, часто являющееся хроническим (Bruce et al., 2005; Kessler et al., 2006). Оно характеризуется паническими атаками и упреждающей тревогой. Многие исследователи сообщают о том, что болезнь вызывает сильное снижение качества жизни у пациентов (Davidoff et al., 2012). Ко всему прочему, Sherbourne et al. (1996) сообщает о том, что у пациентов с паническим расстройством это снижение даже существеннее, чем у пациентов с другими хроническими заболеваниями, например с диабетом, заболеваниями сердечно-сосудистой системы и заболеваниями легких.

Распространенность панического расстройства оценивается в 1-3%, причем женщины страдают от этого заболевания в два раза чаще мужчин (Eaton et al., 1994). Семейные и близнецовые исследования выявили, что наследуемость панического расстройства равна 0,43 (Hettema et al., 2001), а относительный риск заболеваемости у родственников пробанда, страдающего паническим расстройством, при родстве первой степени примерно в 6-17 раз выше, чем в целом по популяции (Crowe et al., 1983 и Goldstein et al., 1997). Конкордантность у монозиготных близнецов равна приблизительно 20,7-73,0% (Hettema et al., 2001). Считается, что и факторы внешней среды, и генетические факторы вовлечены в развитие панического расстройства.

Психологическое же обследование позволяет только диагностировать уже резвившееся заболевание, а не выявлять предрасположенность к развитию панического расстройства. Именно поэтому разработка панели молекулярно-генетических маркеров предрасположенности к паническому расстройству позволит предсказывать возможность возникновения заболевания, что является существенным для людей, работающих в сфере, связанной со стрессовыми ситуациями, способных спровоцировать развитие заболевание. Показано, что нахождение в стрессовых условиях способно провоцировать панические атаки у предрасположенных к тревожности людей (Schmidt etal., 1997).

Главным достоинством ДНК-диагностики является возможность определения предрасположенности к заболеванию на пресимптоматической стадии. В ряде случаев это дает возможность путем хирургического вмешательства, лекарственной терапии или изменения стиля жизни пациента предотвратить развитие самой болезни. В некоторых случаях генотипирование, т.е. выявление соответствующего генетического маркера, также позволяет выбрать наиболее адекватное лекарство. По мере развития фармакогенетики лекарственная терапия будет все больше опираться на анализ генотипа пациента.

Задачей данного изобретения является разработка способа выявления у человека высокого риска развития панического расстройства путем выявления у него молекулярно-генетических маркеров предрасположенности к паническому расстройству.

В качестве прототипа изобретения может быть назван способ диагностики предрасположенности к паническому расстройству, раскрытый в документе US 6225057 (В1), опубл. 01.05.2001, который основан на выявлении у испытуемых врожденной хромосомной дупликации 15q24-25.

Документом, наиболее подробно раскрывающим способы определения полиморфизмов, связанных с диагностикой психических заболеваний, может быть назван US 6844432 (В2).

В основе заявленного в настоящем изобретении способа лежат следующие предпосылки.

Ранее был обнаружен ряд генов-кандидатов, предположительно ассоциированных с паническим расстройством. Среди них МАО A (Deckert et al., 1999), СОМТ (Hamilton et al., 2002, Woo et al., 2002, Domschke et al., 2004 и Rothe et al., 2006), ADORA2A (Deckert et al., 1998 и Hamilton et al., 2004), HTR1A (Rothe et al., 2004a), HTR2A (Inada et al., 2003, Rothe et al, 2004b и Maron et al., 2005) и CCK (Wang et al., 1998, Hattori et al., 2001 и Ebihara et al., 2003). Тем не менее, многие из этих ассоциаций не подтверждаются при практических исследованиях, направленных на поиск маркеров, обладающих предсказательной силой. Развитие методов полногеномных исследований (genome-wide association studies - GWASs) и ДНК-микрочипов позволило проводить всесторонний анализ генома, не ограничиваясь несколькими генами-мишенями. Полногеномные исследования имеющих европейское происхождение пациентов с паническим расстройством позволили выдвинуть TMEM132D на роль гена-кандидата, ответственного за развитие панического расстройства. Этот результат удалось повторить на других европейских выборках, но не удалось повторить на японских (Erhardt et al., 2012). Причины таких расхождений могут быть различными, однако несомненным является необходимость практического подтверждения значимости каждого маркера. Значение OR (отношение шансов), полученное авторами в исследованиях, слишком мало, чтобы ген TMEM132D маркером панического расстройства.

Таким образом, до настоящего времени не выявлено значимых молекулярно-генетических маркеров панического расстройства, обладающих достаточными критериями прогнозирования высоких рисков развития заболевания. Следует отметить, что поиск генетических маркеров в российской популяции пациентов проводится только коллективом авторов патента (Коробейникова и др., 2011, Коробейникова и др. 2012).

Сущность изобретения

Предложенный в настоящем изобретении способ прогнозирования степени риска развития панического расстройства заключается в отборе биоматериала для выделения ДНК и проведении генотипирования ДНК любым из методов анализа последовательности ДНК. Для осуществления способа выявляют наличие у человека определенных полиморфизмов генов CCKAR (по сайтам rs1800908 и rs1799723), HTR1A (по сайту rs6295) и SLC6A4 (по сайту rs3813034), при этом высокую степень риска развития панического расстройства прогнозируют при наличии следующих сочетаний аллелей и генотипов однонуклеотидных вариантов: CCKAR_rs1799723:A+CCKAR_rs1800908:Т и HTR1A_rs6295:C+SLC6A4_rs3813034:CC. Определение данных полиморфизмов возможно проводить при помощи ряда молекулярно-генетических методов, которые лучше всего приспособлены к использованию в клинической практике, т.е. отвечающих следующим требованиям: достаточная чувствительность выявления мутаций, хорошая воспроизводимость, невысокая стоимость и возможность автоматизации. Данные методы хорошо известны специалистам, и разработка адаптированного варианта, позволяющего выявить у человека наличие раскрытых в данной заявке генетических маркеров с высокой прогностической значимостью является рутинной процедурой. К данным методам могут быть отнесены: мутационный скрининг, анализ макроперестроек ДНК-блоттингом, гетеродуплексный анализ, анализ полиморфизма конформации одноцепочечной ДНК, электрофорез двухцепочечной ДНК в градиенте денатуранта, денатурирующая высокоэффективная жидкостная хроматография, химическое обнаружение неспаренных нуклеотидов, защита от рнказы, скрининг мутаций, рестрикционный анализ, аллель-специфическая ПЦР, молекулярные бакены, гибридизация с аллель-специфическими олигонуклеотидами, аллель-специфическая лигазная реакция, мини-секвенирование.

Авторы патента впервые экспериментальным путем доказали статистически значимую ассоциацию данных генетических маркеров с паническим расстройством (Таблица 1) и предложили их использовать в качестве основного диагностического признака. Ассоциированные однонуклеотидные полиморфные варианты (SNV) локализованы в генах, участвующих в функционировании нейромедиаторных систем головного мозга и запускающих молекулярные сигнальные пути, ведущие к модуляции поведения и психических функций человека. Способ позволяет выявить объективно существующую у индивидуума генетическую предрасположенность к развитию панического расстройства. В источниках патентной информации не выявлено документов, раскрывающих заданные полиморфизмы, в комплексе или по отдельности, в связи с диагностикой панического расстройства, хотя связь данных генов с психическими заболеваниями изучалась (см, например, документы WO/1998/048785, WO/2014/20999).

Одним из востребованных технических результатов изобретения является разработка новых объективных и информативных критериев, позволяющих прогнозировать высокий риск развития панического расстройства, таким образом расширяя арсенал технических средств, применяемых для диагностики наследственной предрасположенности к развитию психических нарушений.

В проведенное нами исследование мы включили наиболее перспективные с нашей точки зрения генетические маркеры (Таблица 1). В связи с поставленной задачей был произведен отбор генов и их полиморфных вариантов для сравнения частот генотипов и аллелей в группе пациентов с паническим расстройством (n=131) и контрольной группе (популяционный контроль, n=363). Критериями включения пациентов в исследование были:

- диагноз “паническое расстройство”, соответствующий критериям DSM-IV;

- отсутствие других психических заболеваний, а также заболеваний нервной и эндокринной систем;

- наличие у них панических атак не реже 1 раза в месяц.

В исследовании были проанализировано 11 генов (BDNF, DBH, CCKAR, CCKBR, CCK, MIR22, HTR1A, СОМТ, SLC6A4, ТРН1, PDE4B), содержащих в общей сложности 17 полиморфных вариантов ДНК. Генотипирование обеих выборок позволило выявить частоты генотипов и аллелей данных 17 полиморфных вариантов.

Следующие гены, анализированные в нашей работе, не были ранее исследованы в связи с паническим расстройством: DBH, HTR1A, SLC6A4, ТРН1, однако молекулярные каскады, в которые они вовлечены, позволяют предположить, что они могут иметь связь с психиатрическими заболеваниями. В протокол обследования в т.ч. включено генотипирование на предмет выявления полиморфных вариантов генов HTR1A (rs6295), SLC6A4 (rs3813034), CCKAR (rs1799723 и rs1800908).

Значимые ассоциации сочетаний генотипов и аллелей были выявлены только для 3х генов (Таблица 1а).

В таблице 1а представлены данные по ассоциации выявленных авторами биомаркеров панического расстройства. Для всех указано название гена, регистрационный номер замены и ассоциированный генотип. В таблице также даны следующие статистические параметры:

Fi - значение p-value по Фишеру (двухзначный),

OR - отношение шансов,

CI95% - доверительный интервал,

RR - относительный риск развития заболевания,

SE - чувствительность маркера (доля носителей маркера среди больных),

AUC - прогностическая эффективность маркера,

PPV - диагностическую ценность маркера (вероятность заболеть при носительстве маркера).

Данные, представленные в таблице 1а, позволяют предсказывать относительный риск развития панического расстройства у носителей данных генотипов (RR). Прогностическая эффективность (AUC) для обоих маркеров примерно одинакова - более 0,6 (средний классификатор).

Выявленные комплексные маркеры панического расстройства определяют предрасположенность к заболеванию независимо друг от друга. Это объясняется независимым нарушением двух нейромедиаторных систем, приводящим к развитию панического расстройства, - серотонинергической (HTR1A и SLC6A4) и холецистокининергической (CCKAR). Таким образом, генотипирование по четырем SNV и определение сочетания аллелей и генотипов позволяет предсказывать риск развития панического расстройства: сочетание HTR1A_rs6295:C+SLC6A4_rs3813034:CC увеличивает риск развития в 2 раза, а сочетание аллелей CCKAR_rs 1799723:А+CCKAR_rs1800908:Т - более чем в 3 раза.

Заявленный способ позволяет выявить индивидов с высокой степенью риска развития панического расстройства.

Осуществление изобретения

Авторами изобретения было обнаружено, что большая часть генетических маркеров, которые, по данным из различных источников, ассоциированы с развитием психических заболеваний у их носителей, не могут быть использованы для осуществления диагностики предрасположенности к паническому расстройству. Авторы предлагают выявлять аллельные генотипы (однонуклеотидные замены) в 4-х генах: (rs1800908 и rs1799723 в гене CCKAR, rs6295 в гене HTR1A, rs3813034 в гене SLC6A4), для которых ими была показана высокая степень ассоциации наличия определенного генотипа с относительным риском заболеваемости психическим расстройством. Выявление замен может быть осуществлено с использованием известных методов молекулярной генетики (ПЦР, ПЦР-ПДРФ, аллель-специфичная ПЦР, аллель-специфичная ПЦР в реальном времени, ПЦР в реальном времени с использованием флуоресцентно-меченых зондов и/или праймеров, секвенирование, секвенирование нового поколения, пиросеквенирование, биочипы и др.).

На начальном этапе генотипирования производится сбор биологических образцов, которыми может служить указанные в таблице 2 биоматериалы.

ДНК выделяют из цельной данных образцов с помощью набора Magna™ DNA Prep 100, основанного на использовании гуанидинтиоционата и магнитных намагниченных стеклянных шариков в присутствии высокой концентрации хаотропного агента (ООО «Лаборатория Изоген», Россия).

Для проведения ПЦР-ПДРФ используют лиофилизированные готовые наборы GenPak® PCR Core (ООО «Лаборатория Изоген», Россия) или готовую смесь для ПЦР ScreenMix-HS (ЗАО «Евроген», Россия). Праймеры и условия ПЦР реакции, а также ферменты рестрикции и условия рестрикции описаны в таблице 3. Амплификацию проводят в амплификаторе Applied Biosystems 9700 (GeneAmp® PCR System 9700) или T-100 (Bio-Rad, USA). Визуализацию результатов ПЦР-ПДРФ осуществляют в 2% (rs3813034) и 2.5% (rs1799723 и rs1800908) агарозном геле с добавлением бромистого этидия.

Замены в гене CCKAR (rs1799723 и rs1800908) детектируются одновременно за счет внесения в оба праймера замен, образующих при наличии аллеля rs1800908_G и аллеля rs1799723_G сайты узнавания рестриктазы HinfI (НПО «СибЭнзим», Россия). Теоретически можно выявить девять различных генотипов по двум исследуемым заменам. Однако в ходе эксперимента в анализированной нами выборке удалось обнаружить только четыре генотипа (I - GG, АА; II - GT, АА; III - GT, AG; IV -,GG, AG). На электрофореграмме генотипу I - соответствует одна полоса 103 п.н., II генотипу - три полосы 103, 70 и 33 п.н., III генотипу, - четыре полосы 103, 50, 33 и 20 п.н. и IV генотипу - три полосы 103, 83 и 20 п.н. Картина электрофоретического разделения рестрикционных фрагментов представлена на Фиг. 1.

Замена rs6295 в гене HTR1A не попадает ни на один известный сайт рестрикции, поэтому для ее детекции сконструирован измененный обратный праймер. Внесенная в праймер замена приводит к появлению сайта ACGT, узнаваемого эндонуклеазой HpySE526 I (НПО «СибЭнзим», Россия).

Для проведения ПЦР в реальном времени используют лиофилизированные готовые наборы GenPak® PCR Core (ООО «Лаборатория Изоген», Россия) или готовую смесь для ПЦР ScreenMix-HS (ЗАО «Евроген», Россия) или SsoAdvanced Universal Probes Supermix (BioRad, США). Последовательности праймеров и зондов, а также условия ПЦР описаны в таблице 3. Амплификацию проводят в амплификаторе CFX-96 (Bio-Rad, USA) или 7500 Real Time PCR System (Applied Biosystems, США) с использованием протокола Allelic discrimination test, входящим в стандартное программное обеспечение к прибору.

Для выявления сочетаний аллелей и генотипов, ассоциированных с паническим расстройством, была использована программа APSampler 3.6.1 (Favorov et al., 2005).

Табл. 5.

Последовательности нуклеотидов праймеров и зондов (от 5' к 3' концу), которые могут применяться для выявления однонуклеотидных замен согласно изобретению в методах ПЦР, ПЦР-ПДРФ, аллель-специфичной ПЦР, аллель-специфичной ПЦР в реальном времени, ПЦР в реальном времени с использованием флуоресцентно-меченых зондов и/или праймеров, секвенировании, секвенировании нового поколения, пиросеквенировании, биочипах и других известных молекулярно-биологических методах, требующих гибридизации исследуемой ДНК с олигонуклеотидными фрагментами длиной 15-90 н.о.

В нижеследующих примерах приведены доказательства возможности реализации заявленного назначения и достижения указанного технического результата.

Пример 1. Пациент из исследованной группы (образец №085).

Диагноз: паническое расстройство

Возраст: 43 года

Длительность заболевания: 8 лет

Частота приступов в месяц за последние полгода: 1,7

Провокаторы приступа: нет закономерности

Время возникновения приступа: нет закономерности

Представленность симптомов панических атак: 4 симптома и более

Биоматериал: венозная кровь

Генотип пациента:

HTR1A (rs6295): CG

SLC6A4 (rs3813034): СС

CCKAR (rs1799723): AG

CCKAR (rs1800908): GT

Присутствуют оба маркера: HTR1A_rs6295: C + SLC6A4_rs3813034: CC и CCKAR_rs1799723: A + CCKAR_rs1800908: T

Сделан вывод о генетически обусловленной предрасположенности к развитию панического расстройства.

Пример 2. Пациент не входит в исследованную группу по причине несоответствия критериям включения в исследование.

Диагноз: паническое расстройство

Возраст: 36 лет

Длительность заболевания: 11 лет

Частота приступов в месяц за последние полгода: 0,8

Провокаторы приступа: публичные выступления

Время возникновения приступа: день, рабочее время

Представленность симптомов панических атак: 3-4 симптома

Биоматериал: букальный эпителий

Генотип пациента:

HTR1A (rs6295): CG

SLC6A4 (rs3813034): СС

CCKAR (rs1799723): АА

CCKAR (rs1800908): GG

Присутствует один маркер: HTR1A_rs6295: C + SLC6A4_rs3813034: CC.

Сделан вывод о генетически обусловленной предрасположенности к развитию панического расстройства.

Пример 3. Индивид из группы контроля (№003).

Диагноз: неизвестен

Возраст: 27 лет

Биоматериал: венозная кровь

Генотип пациента:

HTR1A (rs6295): CG

SLC6A4 (rs3813034): AC

CCKAR (rs1799723): AA

CCKAR (rs1800908): GG

Ассоциированных с паническим расстройством маркеров не выявлено, сделан вывод об отсутствии у пациента наследственной предрасположенности к развитию данного заболевания.

Пример 3. Здоровый индивид (нет панического расстройства).

Возраст: 39 лет

Биоматериал: букальный эпителий

Генотип пациента:

HTR1A (rs6295): CG

SLC6A4 (rs3813034): АА

CCKAR (rs1799723): АА

CCKAR (rs1800908): GG

Ассоциированных с паническим расстройством маркеров не выявлено, сделан вывод об отсутствии у пациента наследственной предрасположенности к развитию данного заболевания.

СПИСОК ЦИТИРУЕМОЙ ЛИТЕРАТУРЫ

1. Коробейникова Л.А., Азимова Ю.Э., Фокина Н.М., Рудько О.И., Климов Е.А. Частоты аллелей генов ССК, CCK1R и CCK2R у жителей Москвы, страдающих паническими расстройствами // Медицинская генетика. - 2011. - Т. 10, №3. - С. 37-42.

2. Коробейникова Л.А., Рудько О.И., Азимова Ю.Э., Фокина Н.М., Климов Е.А. Генетические основы предрасположенности к паническому расстройству // Успехи современной биологии. - 2012. - Т. 132, №1. - С. 21-35.

3. Bruce S.Е., Yonkers K.A., Otto М.W., Eisen J.L., Weisberg R.В., Pagano M., Shea M.Т., Keller M.B. Influence of psychiatric comorbidity on recovery and recurrence in generalized anxiety disorder, social phobia, and panic disorder: a 12-year prospective study // Am J Psychiatry. - 2005. - T. 162, №6. - С. 1179-87.

4. Crowe R.R., Noyes R., Pauls D.L., Slymen D.A family study of panic disorder // Arch Gen Psychiatry. - 1983. - T. 40, №10. - C. 1065-9.

5. Davidoff J., Christensen S., Khalili D.N., Nguyen J., IsHak W.W. Quality of life in panic disorder: looking beyond symptom remission // Qual Life Res. - 2012. - T. 21, №6. - C. 945-59.

6. Deckert J., Catalano M., Syagailo Y.V., Bosi M., Okladnova O., Di Bella D., Nothen M.M., Maffei P., Franke P., Fritze J., Maier W., Propping P., Beckmann H., Bellodi L., Lesch K.P. Excess of high activity monoamine oxidase A gene promoter alleles in female patients with panic disorder // Hum Mol Genet. - 1999. - T. 8, №4. - C. 621-4.

7. Deckert J., Nothen M.M., Franke P., Delmo C, Fritze J., Knapp M, Maier W., Beckmann H., Propping P. Systematic mutation screening and association study of the A1 and A2a adenosine receptor genes in panic disorder suggest a contribution of the A2a gene to the development of disease // Mol Psychiatry. - 1998. - T. 3, №1. - C. 81-5.

8. Domschke K., Freitag С.M., Kuhlenbaumer G., Schirmacher A., Sand P., Nyhuis P., Jacob C., Fritze J., Franke P., Rietschel M., Garritsen H.S., Fimmers R., Nothen M.M., Lesch K.P., Stogbauer F., Deckert J. Association of the functional V158M catechol-O-methyl-transferase polymorphism with panic disorder in women // Int J Neuropsychopharmacol. - 2004. - T. 7, №2. - C. 183-8.

9. Eaton W.W., Kessler R.C., Wittchen H.U., Magee W.J. Panic and panic disorder in the United States // Am J Psychiatry. - 1994. - T. 151, №3. - C. 413-20.

10. Ebihara M., Ohba H., Hattori E., Yamada K., Yoshikawa T. Transcriptional activities of cholecystokinin promoter haplotypes and their relevance to panic disorder susceptibility // Am J Med Genet В Neuropsychiatr Genet. - 2003. - Т. 118B, №1. - C. 32-5.

11. Erhardt A., Akula N., Schumacher J., Czamara D., Karbalai N., Muller-Myhsok В., Mors O., Borglum A., Kristensen A.S., Woldbye D.P., Koefoed P., Eriksson E., Maron E., Metspalu A., Nurnberger J., Philibert R.A., Kennedy J., Domschke K., Reif A., Deckert J., Otowa Т., Kawamura Y., Kaiya H., Okazaki Y., Tanii H., Tokunaga K., Sasaki Т., Ioannidis J.P., McMahon F.J., Binder E.B. Replication and meta-analysis of TMEM132D gene variants in panic disorder // Transl Psychiatry. - 2012. - T. 2. - C. e156.

12. Erhardt A., Czibere L., Roeske D., Lucae S., Unschuld P. G., Ripke S., Specht M., Kohli M.A., Kloiber S., Ising M., Heck A., Pfister H., Zimmermann P., Lieb R., Putz B., Uhr M., Weber P., Deussing J.M., Gonik M., Bunck M., Kebler M.S., Frank E., Hohoff C, Domschke K., Krakowitzky P., Maier W., Bandelow В., Jacob C, Deckert J., Schreiber S., Strohmaier J., Nothen M., Cichon S., Rietschel M., Bettecken Т., Keck М.Е., Landgraf R., Muller-Myhsok В., Holsboer F., Binder E.B. TMEM132D, a new candidate for anxiety phenotypes: evidence from human and mouse studies // Mol Psychiatry. - 2011. - T. 16, №6. - C. 647-63.

13. Favorov A.V., Andreewski Т.V., Sudomoina M.A., Favorova О.O., Parmigiani G., Ochs M.F.A Markov chain Monte Carlo technique for identification of combinations of allelic variants underlying complex diseases in humans // Genetics. - 2005. - T. 171, №4. - C. 2113-21.

14. Goldstein R.В., Wickramaratne P.J., Horwath E., Weissman M.M. Familial aggregation and phenomenology of 'early'-onset (at or before age 20 years) panic disorder // Arch Gen Psychiatry. - 1997. - T. 54, №3. - C. 271-8.

15. Hamilton S.P., Slager S.L., De Leon А.В., Heiman G.A., Klein D.F., Hodge S.E., Weissman M.M., Fyer A.J., Knowles J.A. Evidence for genetic linkage between a polymorphism in the adenosine 2A receptor and panic disorder // Neuropsychopharmacology. - 2004. - T. 29, №3. - C. 558-65.

16. Hamilton S.P., Slager S.L., Heiman G.A., Deng Z., Haghighi F., Klein D.F., Hodge S.E., Weissman M.M., Fyer A.J., Knowles J.A. Evidence for a susceptibility locus for panic disorder near the catechol-O-methyltransferase gene on chromosome 22 // Biol Psychiatry. - 2002. - T. 51, №7. - C. 591-601.

17. Han E.J., Kim Y.K., Hwang J.A., Kim S.H., Lee H.J., Yoon H.K., Na K.S. Evidence for Association between the Brain-Derived Neurotrophic Factor Gene and Panic Disorder: A Novel Haplotype Analysis // Psychiatry Investig. - 2015. - T. 12, №1. C. 112-7.

18. Hattori E., Ebihara M., Yamada K., Ohba H., Shibuya H., Yoshikawa T. Identification of a compound short tandem repeat stretch in the 5'-upstream region of the cholecystokinin gene, and its association with panic disorder but not with schizophrenia // Mol Psychiatry. - 2001. - T. 6, №4. - C. 465-70.

19. Hattori E., Yamada K., Toyota Т., Yoshitsugu K., Tom M., Shibuya H., Yoshikawa T. Association studies of the CT repeat polymorphism in the 5' upstream region of the cholecystokinin В receptor gene with panic disorder and schizophrenia in Japanese subjects // Am J Med Genet. - 2001. - T. 105, №8. - C. 779-82.

20. Hettema J.M., Neale M.C, Kendler K.S. A review and meta-analysis of the genetic epidemiology of anxiety disorders // Am J Psychiatry. - 2001. - T. 158, №10. - C. 1568-78.

21. Hosing V.G., Schumacher A., Kuhlenbaumer G., Freitag C, Sand P., Schlesiger C, Jacob C, Fritze J., Franke P., Rietschel M., Garritsen H., Nothen M.M., Fimmers R., Stogbauer F., Deckert J. Cholecystokinin- and cholecystokinin-B-receptor gene polymorphisms in panic disorder // J Neural Transm Suppl. - 2004. №68. - C. 147-56.

22. Inada Y., Yoneda H., Koh J., Sakai J., Himei A., Kinoshita Y., Akabame K., Hiraoka Y., Sakai T. Positive association between panic disorder and polymorphism of the serotonin 2A receptor gene // Psychiatry Res. - 2003. - Т. 118, №1. - C. 25-31.

23. Karacetin G., Bayoglu В., Cengiz M., Demir Т., Kocabasoglu N., Uysal O., Bayar R., Balcioglu I. Serotonin-2A receptor and catechol-O-methyltransferase polymorphisms in panic disorder // Prog Neuropsychopharmacol Biol Psychiatry. - 2012. - T. 36, №1. - C. 5-10.

24. Kennedy J.L., Bradwejn J., Koszycki D., King N., Crowe R., Vincent J., Fourie O. Investigation of cholecystokinin system genes in panic disorder // Mol Psychiatry. - 1999. - T. 4, №3. - C. 284-5.

25. Kessler R.C, Chiu W.Т., Jin R., Ruscio A.M., Shear K., Walters E.E. The epidemiology of panic attacks, panic disorder, and agoraphobia in the National Comorbidity Survey Replication // Arch Gen Psychiatry. - 2006. - T. 63, №4. - C. 415-24.

26. Koefoed P., Woldbye D.P., Hansen Т.O., Hansen E.S., Knudsen G.M., Bolwig T.G., Rehfeld J.F. Gene variations in the cholecystokinin system in patients with panic disorder // Psychiatr Genet. - 2010. - T. 20, №2. - C. 59-64.

27. Konishi Y., Tanii H., Otowa Т., Sasaki Т., Tochigi M., Umekage Т., Motomura E., Shiroyama Т., Kaiya H., Okazaki Y., Okada M. Genexgenexgender interaction of BDNF and COMT genotypes associated with panic disorder // Prog Neuropsychopharmacol Biol Psychiatry. - 2014. - T. 51. - С. 119-25.

28. Maron E., Lang A., Tasa G., Liivlaid L., Tom I., Must A., Vasar V., Shlik J. Associations between serotonin-related gene polymorphisms and panic disorder // Int J Neuropsychopharmacol. - 2005. - T. 8, №2. - C. 261-6.

29. Muinos-Gimeno M., Espinosa-Parrilla Y., Guidi M., Kagerbauer В., Sipila Т., Maron E., Pettai K., Kananen L., Navines R., Martin-Santos R., Gratacos M., Metspalu A., Hovatta I., Estivill X. Human microRNAs miR-22, miR-138-2, miR-148a, and miR-488 are associated with panic disorder and regulate several anxiety candidate genes and related pathways // Biol Psychiatry. - 2011. - T. 69, №6. - C. 526-33.

30. Na H.R., Kang E.H., Lee J.H., Yu В.H. The genetic basis of panic disorder // J Korean Med Sci. - 2011. - T. 26, №6. - C. 701 -10.

31. Otowa Т., Kawamura Y., Sugaya N., Yoshida E., Shimada Т., Liu X., Tochigi M., Umekage Т., Miyagawa Т., Nishida N., Kaiya H., Okazaki Y., Tokunaga K., Sasaki T. Association study of PDE4B with panic disorder in the Japanese population // Prog Neuropsychopharmacol Biol Psychiatry. - 2011. - T. 35, №2. - C. 545-9.

32. Rothe C, Gutknecht L., Freitag C., Tauber R., Mossner R., Franke P., Fritze J., Wagner G., Peikert G., Wenda В., Sand P., Jacob C., Rietschel M., Nothen M.M., Garritsen H., Fimmers R., Deckert J., Lesch K.P. Association of a functional 1019C>5-HT1A receptor gene polymorphism with panic disorder with agoraphobia // Int J Neuropsychopharmacol. - 2004. - T. 7, №2. - C. 189-92.

33. Rothe C., Koszycki D., Bradwejn J., King N., De Luca V., Shaikh S., Franke P., Garritsen H., Fritze J., Deckert J., Kennedy J. L. Association study of serotonin-2A receptor gene polymorphism and panic disorder in patients from Canada and Germany // Neurosci Lett. - 2004. - T. 363, №3. - C. 276-9.

34. Rothe C, Koszycki D., Bradwejn J., King N., Deluca V., Tharmalingam S., Macciardi F., Deckert J., Kennedy J. L. Association of the Vall58Met catechol O-methyltransferase genetic polymorphism with panic disorder // Neuropsychopharmacology. - 2006. - T. 31, №10. - C. 2237-42.

35. Schmidt N.В., Trakowski J.H., Staab J.P. Extinction of panicogenic effects of a 35% CO2 challenge in patients with panic disorder // J Abnorm Psychol. - 1997. - T. 106, №4. - C. 630-8.

36. Sherbourne C.D., Wells K.В., Judd L.L. Functioning and well-being of patients with panic disorder // Am J Psychiatry. - 1996. - T. 153, №2. - C. 213-8.

37. Wang Z., Valdes J., Noyes R., Zoega Т., Crowe R.R. Possible association of a cholecystokinin promotor polymorphism (CCK-36CT) with panic disorder // Am J Med Genet. - 1998. - T. 81, №3. - C. 228-34.

38. Wilson J., Markie D., Fitches A. Cholecystokinin system genes: associations with panic and other psychiatric disorders // J Affect Disord. - 2012. - T. 136, №3. - C. 902-8.

39. Woo J.M., Yoon K.S., Choi Y.H., Oh K.S., Lee Y.S., Yu В.H. The association between panic disorder and the L/L genotype of catechol-O-methyltransferase // J Psychiatr Res. - 2004. - T. 38, №4. - C. 365-70.

40. Woo J.M., Yoon K.S., Yu В.H. Catechol O-methyltransferase genetic polymorphism in panic disorder // Am J Psychiatry. - 2002. - T. 159, №10. - C. 1785-7.

1. Способ выявления у субъекта предрасположенности к развитию панического расстройства, отличающийся тем, что проводят совместное выявление комплексных генотипов в генах SLC6A4, HTR1A, CCKAR и наличие сочетания однонуклеотидных замен HTR1A_rs6295:C+ SLC6A4_rs3813034:CC или CCKAR_rs1799723:A+ CCKAR_rs1800908:T генах является диагностическим признаком предрасположенности к развитию панического расстройства.

2. Способ по п. 1, где однонуклеотидные замены выбраны из списка: (rs3813034) в гене SLC6A4, (rs6295) в гене HTR1A, (rs1800908) в гене CCKAR, (rs1799723) в гене CCKAR.

3. Способ по п. 1, где наличие мутаций в генах определяют следующими методами молекулярной генетики: ПЦР, ПЦР-ПДРФ, аллель-специфичная ПЦР, аллель-специфичная ПЦР в реальном времени, ПЦР в реальном времени с использованием флуоресцентно-меченых зондов и/или праймеров, секвенирование, секвенирование нового поколения (NGS), пиросеквенирование, биочипы (microarray).

4. Способ по п. 1, где наличие мутаций в генах определяют методом ПЦР-ПДРФ.

5. Способ по п. 4, где для проведения ПЦР применяют олигонуклеотидные фрагменты (праймеры), выбранные из списка: SEQ1, SEQ2, SEQ3, SEQ4, SEQ5, SEQ6.

6. Способ по п. 5, где для проведения ПДРФ используют рестриктазы, выбранные из списка: MseI, HinfI, HpySE526I.



 

Похожие патенты:

Изобретение относится к области биохимии. Описан способ сканирования генных мутаций в опухолях человека, включающий амплификацию исследуемого фрагмента гена, плавление дуплексов зондов TaqMan с однонитевыми ампликонами, построение пиков плавления, идентификацию мутаций по асимметрии пиков плавления, отличающийся двунитевым сканированием генных мутаций посредством симметричной ПЦР в реальном времени с двумя зондами TaqMan, используемыми для пост-амплификационного плавления ДНК.

Группа изобретений относится к области биотехнологии. Предложены изолированный полинуклеотидный субстрат для каталитической нуклеиновой кислоты с ферментативной активностью и его применение, способ детектирования присутствия мишени в образце, использующий указанный субстрат, а также набор для детекции молекулы-мишени и комплект для детекции молекулы-мишени, содержащие указанный субстрат, и набор для применения в сигнальном каскаде, содержащий указанный комплект.

Группа изобретений относится к области биотехнологии. Предложены изолированный полинуклеотидный субстрат для каталитической нуклеиновой кислоты с ферментативной активностью и его применение, способ детектирования присутствия мишени в образце, использующий указанный субстрат, а также набор для детекции молекулы-мишени и комплект для детекции молекулы-мишени, содержащие указанный субстрат, и набор для применения в сигнальном каскаде, содержащий указанный комплект.

Представлен способ амплификации и секвенирования целевых локусов в образце нуклеиновой кислоты. Способ включает (a) приведение образца нуклеиновой кислоты, содержащего целевые локусы, в контакт с библиотекой тестовых праймеров, содержащей по меньшей мере 1000 разных тестовых праймеров, при этом концентрация каждого тестового праймера составляет менее 20 нМ; (b) амплификация реакционной смеси с помощью полимеразной цепной реакции (ПЦР), при этом ПЦР включает этап отжига с продолжительностью более 10 минут; при этом одновременно амплифицируют по меньшей мере 1000 разных целевых локусов и при этом (i) менее 20% амплифицированных продуктов представлено димерами тестовых праймеров, (ii) по меньшей мере 80% амплифицированных продуктов представлено целевыми ампликонами и (iii) амплифицируется по меньшей мере 80% целевых локусов; и (c) секвенирование амплифицированных продуктов.

Представлен способ амплификации и секвенирования целевых локусов в образце нуклеиновой кислоты. Способ включает (a) приведение образца нуклеиновой кислоты, содержащего целевые локусы, в контакт с библиотекой тестовых праймеров, содержащей по меньшей мере 1000 разных тестовых праймеров, при этом концентрация каждого тестового праймера составляет менее 20 нМ; (b) амплификация реакционной смеси с помощью полимеразной цепной реакции (ПЦР), при этом ПЦР включает этап отжига с продолжительностью более 10 минут; при этом одновременно амплифицируют по меньшей мере 1000 разных целевых локусов и при этом (i) менее 20% амплифицированных продуктов представлено димерами тестовых праймеров, (ii) по меньшей мере 80% амплифицированных продуктов представлено целевыми ампликонами и (iii) амплифицируется по меньшей мере 80% целевых локусов; и (c) секвенирование амплифицированных продуктов.

Изобретение относится к биотехнологии, молекулярной биологии, эпидемиологии. Изобретение может быть использовано для внутривидовой дифференциации штаммов Histoplasma capsulatum специалистами референс-центров по мониторингу за возбудителями инфекционных болезней, а также научно-исследовательских организаций эпидемиологического и микробиологического профиля.

Изобретение относится к биотехнологии, молекулярной биологии, эпидемиологии. Изобретение может быть использовано для внутривидовой дифференциации штаммов Histoplasma capsulatum специалистами референс-центров по мониторингу за возбудителями инфекционных болезней, а также научно-исследовательских организаций эпидемиологического и микробиологического профиля.

Изобретение относится к области наноконструирования и может быть использовано для получения новых систем доставки терапевтических и тераностических средств, для создания диагностикумов, рН-чувствительных биогелей, 3D элементов биоэлектроники.

Изобретение относится к области биохимии и молекулярной биологии, в частности к набору синтетических олигонуклеотидов. Указанный набор предназначен для определения последовательности 1 интрона, примыкающей ко 2 экзону, генов системы HLA I и II классов (HLA-A и HLA-DRB1) методом ПЦР и состоит из следующих праймеров: dr1in6s 5’-GGATCCTCCTCCAGCTCCTG-3’, dr1in2a 5’-CCGCTCCGTCCCATTGAAGA-3’, A1in1s 5’-CTCCGAACCCTCCTCCTGCTA-3’, A1in2a 5’-GCTGTCGAACCGCACGGACTG-3’.

Изобретение относится к области биохимии и молекулярной биологии, в частности к набору синтетических олигонуклеотидов. Указанный набор предназначен для определения последовательности 1 интрона, примыкающей ко 2 экзону, генов системы HLA I и II классов (HLA-A и HLA-DRB1) методом ПЦР и состоит из следующих праймеров: dr1in6s 5’-GGATCCTCCTCCAGCTCCTG-3’, dr1in2a 5’-CCGCTCCGTCCCATTGAAGA-3’, A1in1s 5’-CTCCGAACCCTCCTCCTGCTA-3’, A1in2a 5’-GCTGTCGAACCGCACGGACTG-3’.
Изобретение относится к области биохимии. Предложен набор реактивов для выделения ДНК из биологических объектов.

Изобретение относится к области биотехнологии. Предложены кольцевой двухцепочечный полинуклеотид для интеграции экзогенной нуклеиновой кислоты в геном клетки и способ интеграции экзогенной последовательности нуклеиновой кислоты в эндогенный локус клетки.

Группа изобретений относится к области биотехнологии. Предложены изолированный полинуклеотидный субстрат для каталитической нуклеиновой кислоты с ферментативной активностью и его применение, способ детектирования присутствия мишени в образце, использующий указанный субстрат, а также набор для детекции молекулы-мишени и комплект для детекции молекулы-мишени, содержащие указанный субстрат, и набор для применения в сигнальном каскаде, содержащий указанный комплект.

Изобретение относится к областям медицинской и молекулярной генетики, а также к генотерапии, и касается набора, включающего шесть субстратов Дайсера. Представленный набор включает шесть субстратов Дайсера, которые образуют в клетках человека шесть siРНК:5'AAAAAGCAUCAGAAAGAACCUCCAUUU 3' - А1 (7)5'AAAUGGAGGUUCUUUCUGAUGCUUUUU 3' - A1 (8)5'AGACAUAGUUAUCUAUCAAUACAUGGA 3' - A2 (9)5'UCCAUGUAUUGAUAGAUAACUAUGUCU 3' - A2 (10)5'AGGAGUAGUGGAGUCUAUGAAUAAGGA 3' - A3 (11)5'UCCUUAUUCAUAGACUCCACUACUCCU 3' - A3 (12)5'GUGUGGACUAUAGUAGGUAUAGAAUAU 3' - A4 (13)5'AUAUUCUAUACCUACUAUAGUCCACAC 3' - A4 (14)5'ACCAGGACAGACAUGGUAUGGAACAGG 3' - A5 (15)5'CCUGUUCCAUACCAUGUCUGUCCUGGU 3' - A5 (16)5'GUGCGAGAGCGUCAGUAUUAAGUGGGG 3' - A6 (17)5'CCCCACUUAAUACUGACGCUCUCGCAC 3' - A6 (18),которые при введении в клетки человека способны поражать соответствующие консервативные мишени в мРНК ВИЧ-1 (А1-А6):5'AAAAAGCATCAGAAAGAACCTCCATTT 3' - A1 (1)5'AGACATAGTTATCTATCAATACATGGA 3' - А2 (2)5'AGGAGTAGTGGAGTCTATGAATAAGGA 3' - A3 (3)5'GTGTGGACTATAGTAGGTATAGAATAT 3' - А4 (4)5'ACCAGGACAGACATGGTATGGAACAGG 3' - А5 (5)5'GTGCGAGAGCGTCAGTATTAAGTGGGG 3' - А6 (6),расположенные в доменах обратной транскриптазы (мишени А1 и А2) и интегразы (мишень A3) гена pol, в мРНК гена vpu (мишень А4), а также мРНК гена env в ее домене gp120 (мишень А5) и мРНК гена gag в домене р17 (мишень А6), и вызывать подавление продукции вируса в клетках человека.

Изобретение относится к области биохимии, в частности к способу борьбы с насекомыми, выбранными из группы, состоящей из Pseudoplusia includens, Anticarsia gemmatalis, Spodoptera frugiperda и Heliothis virescens, а также к способу борьбы с сорняками сельскохозяйственной культуры сои, который включает обработку сельскохозяйственной культуры сои гербицидом глюфосинатом.
Изобретение относится к мезомасштабной жидкостной системе, содержащей основу, содержащую камеру для образца и камеру для анализа; камера для образца содержит проницаемый для клеток фильтр, образующий отделение для внесения образца и отделение для кондиционирующей среды; камера для образца содержит впускное отверстие для образца в отделении для внесения образца; камера для анализа содержит входное отверстие и выходное отверстие; отделение для кондиционирующей среды находится в жидкостном сообщении с входным отверстием камеры для анализа через канал; при этом отделение для внесения образца находится ниже проницаемого для клеток фильтра, а отделение для кондиционирующей среды находится выше проницаемого для клеток фильтра.

Группа изобретений относится к медицине и касается средства для коррекции состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с количественным снижением белка альфа-2 цепи коллагена I типа, на основе генно-терапевтических субстанций с геном COL1A2, где клетки органов и тканей выбраны из фибробластов, кератоцитов, хондробластов и эпителиальных клеток роговицы глаза, органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани человека, представляющего собой по крайней мере одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет собой генетическую конструкцию на основе векторной плазмиды, содержащей нативную кДНК гена COL1A2 SEQ ID No: 1 или модифицированной кДНК гена COL1A2, при этом в качестве модифицированной кДНК гена COL1A2 используют SEQ ID No: 2, или SEQ ID No: 3, или SEQ ID No: 4, или SEQ ID No: 5, или SEQ ID No: 6, или SEQ ID No: 7, или сочетание этих генетических конструкций, каждая из которых содержит также регуляторные элементы в сочетании с транспортной молекулой или без нее.

Изобретение относится к области биохимии. Описана группа изобретений, включающая конъюгат, снижающий уровень экспрессированной в печени РНК, содержащий антисмысловой LNA-олигомер и ковалентно связанную с ним конъюгатную группировку, содержащую группу, направленную на асиалогликопротеиновый рецептор и фармацевтическую композицию, содержащую вышеуказанный конъюгат в эффективном количестве.

Изобретение относится к области биохимии, в частности к молекуле рекомбинантной ДНК, указывающей на присутствие трансгенного события, где показательный образец семени, содержащего указанное трансгенное событие, депонирован в ATCC как РТА-12669.

Изобретение относится к биохимии. Описан одноцепочечный олигонуклеотид антигена, комплементарный к антисмысловой нити ДНК целевого гена, содержащий 12-24 нуклеотида, причем указанный олигонуклеотид характеризуется последовательностью, содержащей по меньшей мере три группы по меньшей мере из двух следующих друг за другом гуанинов.

Изобретение относится к биохимии. Описан антисмысловой олигомер, который вызывает пропуск 55-го экзона в гене дистрофина человека, состоящий из нуклеотидной последовательности, комплементарной любой из нуклеотидных последовательностей, состоящих из 14-го – 34-го или 15-го – 34-го нуклеотидов, считая от 5'-конца 55-го экзона гена дистрофина человека. Также описана фармацевтическая композиция для лечения мышечной дистрофии, включающая в качестве действующего ингредиента антисмысловой олигомер, или его фармацевтически приемлемую соль, или гидрат. Кроме того, представлен способ лечения мышечной дистрофии, включающий введение терапевтически эффективного количества заявленного олигомера. Изобретение расширяет арсенал средств для лечения мышечной дистрофии. 3 н. и 8 з.п. ф-лы, 31 ил., 15 табл., 39 пр.

Изобретение относится к области биохимии и молекулярно-генетической диагностики, в частности к способу выявления у субъекта предрасположенности к развитию панического расстройства. Настоящий способ включает совместное выявление комплексных генотипов в генах SLC6A4, HTR1A, CCKAR. Согласно указанному способу диагностическим признаком предрасположенности к развитию панического расстройства является наличие сочетания однонуклеотидных замен rs6295:C в гене HTR1A и rs3813034:CC в гене SLC6A4 или наличие сочетания однонуклеотидных замен rs1799723:A и rs1800908:T в гене CCKAR. Настоящее изобретение позволяет прогнозировать высокий риск развития панического расстройства у субъектов. 5 з.п. ф-лы, 1 ил., 5 табл., 3 пр.

Наверх