Способ проведения аллель-специфичной пцр для генотипирования крупного рогатого скота по аллельным вариантам аа, кк и ак гена фермента диацетил-глицерин о-ацетил трансферазы для определения наследуемости жирномолочности

Изобретение относится к области генетики и молекулярной биологии, в частности к селекции крупного рогатого скота молочного направления. Способ осуществляют с помощью двух K-аллель-специфичных праймеров и двух A-аллель-специфичных праймеров. Применение изобретения обеспечивает эффективную аллель-специфичную ПЦР для генотипирования крупного рогатого скота по аллелям K и А гена фермента DGAT для прогнозирования жирномолочности при селекции животных. 1 ил., 1 пр.

 

Изобретение относится к области генетики и селекции сельскохозяйственных животных, в частности к способу проведения аллель-специфичной ПЦР для генотипирования крупного рогатого скота по аллельным вариантам AA, KK и AK гена фермента диацетил-глицирин O-ацетил трансферазы для определения наследуемости жирномолочности.

Известны различные способы ДНК-анализа аллельного полиморфизма гена DGAT крупного рогатого скота [1-3]. В частности, метод секвенирования дает полную расшифровку нуклеотидной последовательности и на основании полученных данных можно проводить высокоточное генотипирование. Недостатком данного метода является высокая стоимость и сложность проведения анализа.

ПЦР-ПДРФ-анализ также можно использовать для целей генотипирования. Недостатком метода является его высокая чувствительность к условиям проведения реакции и качеству используемых реактивов. Кроме того, для проведения ПЦР-ПДРФ анализа требуется большое количество ДНК, что не всегда возможно в практических условиях проведения анализов.

Наиболее оптимальным для целей генотипирования является применение аллель-специфичных праймеров, в частности способа генотипирования с использованием тетра-праймерной ARMS-PCR.

Прототипом является «Способ проведения аллель-специфичной ПЦР для генотипирования крупного рогатого скота по аллелям A и B гена каппа-казеина» (4).

Существенным недостатком прототипа является наличие 5'-некомплементарных участков (n) в праймерах длиной 3-5 нуклеотидов. Включение в структуру добавочных некомплементарных нуклеотидов усложняет прохождение полимеразной цепной реакции, тем самым повышает возможность получение неспецифических результатов ПНР, а также увеличивает стоимость праймеров.

Цель изобретения - разработка эффективной техники проведения аллель-специфичной ПЦР для генотипирования крупного рогатого скота по аллельным вариантам KK, KA и AA гена фермента DGAT.

Указанная цель достигается проведением аллель-специфичной ПЦР для генотипирования крупного рогатого скота по аллелям K и A гена фермента DGAT, включающим: подготовку пробы нуклеиновой кислоты, внесением указанной пробы в реакционную смесь для ПЦР, состоящую из дНТФ, буферной системы, Taq ДНК полимеразы, 4-х праймеров; проведение ПЦР; детекцию амплифицированных фрагментов ДНК методом гель-электрофореза. Предложенный нами способ отличается от прототипа тем, что для анализа используется другой локус ДНК (нуклеотидная последовательность гена фермента DGAT вместо гена к-казеина) и новые, сконструированные нами последовательности праймеров (K-аллель-специфичные праймеры: fpdgatext ACACCATCCTCTTCCTCAAGCTGTTCT, rpindgatlis CAGCTCCCCCGTTGGCCTT, иницирующие амплификацию K-аллель-специфичного фрагмента ДНК гена фермента DGAT крупного рогатого скота размером 220bp, A-аллель-специфичные праймеры: fpindgatala GCTCGTAGCTTTGGCAGGTAAGGC, rpdgatext GAGATCTGGAAGGGAGGGCGG, иницирующие амплификацию A-аллель-специфичного фрагмента ДНК гена фермента DGAT крупного рогатого скота размером 158bp); проводят 2-стадийную ПЦР при температуре отжига 60,7°С.

Таким образом, по результатам практических исследований, направленных на апробацию предлагаемого способа проведения аллель-специфичной ПНР для генотипирования крупного рогатого скота по аллелям K и A гена фермента DGAT, нами получен обеспечиваемый заявленным способом технический результат, выраженный в способности ДНК-анализа аллельного полиморфизма гена фермента DGAT крупного рогатого скота (идентификация генотипов KK, KA и AA) при использовании разработанной нами техники аллель-специфичной ПЦР с предлагаемыми нами новыми праймерами «fpdgatext+rpindgatlis+fpindgatala+rpdgatext» (схема 1).

Пример проведения реакции

Предлагаемый способ проведения аллель-специфичной ПЦР для генотипирования крупного рогатого скота по аллелям K и A гена DGAT проводили на программируемом термоциклере «Терцик» (Россия) в объеме 20 мкл, содержащей 60 мМ Трис-HCl (pH 8,5), 1,5 мМ MgCl2, 25 мМ KCl, 10 мМ меркаптоэтанол; 0,1 мМ тритон Х-100; 0,2 мМ смесь дНТФ, 0.5 ед. Taq ДНК полимеразы, 2 пары аллель-специфичных праймеров: 1-я пара K-аллель-специфичных праймеров = 0.5 мкМ праймера fpdgatext: ACACCATCCTCTTCCTCAAGCTGTTCT-3', 0,5 мкМ праймера rpindgatlis: CAGCTCCCCCGTTGGCCTT-3' (ПЦР амплификация K-аллель-специфичного фрагмента ДНК гена фермента DGAT крупного рогатого скота размером 220bp); 2-я пара A-аллель-специфичных праймеров = 0.5 мкМ праймера fpindgatala: GCTCGTAGCTTTGGCAGGTAAGGC-3’, 0,5 мкМ праймера rpdgatext: GAGATCTGGAAGGGAGGGCGG-3’ (ПЦР амплификация A-аллель-специфичного фрагмента ДНК гена фермента DGAT крупного рогатого скота размером 158bp); 1 мкл пробы ДНК, выделенной из лейкоцитов крови крупного рогатого скота в следующем оптимальном режиме амплификации: ×1:94°С - 5 мин; ×40:94°С - 1 мин, 60,7°С - 1 мин; 72°С - 1 мин; ×1:72°С - 10 мин (схема 1, чертеж).

Визуализацию амплифицированной ДНК проводили методом гель-электрофореза. Для этого продукты амплификации смешивали с буфером для нанесения проб (0,25% бромфенолового синего, 40% (вес-объем) сахарозы в Н2О) в соотношении 6:1. Полученную смесь вносили в лунки 2,5% агарозного геля, приготовленного на ТАЕ буфере (0,04 М трис-ацетат, 0,002 М ЭДТА, рН 8,0) с содержанием бромистого этидия 0,5 мкг/мл, и подвергали горизонтальному электрофорезу в ТАЕ буфере при напряжении 15 В/см в течение 1 часа с последующей визуализацией в УФ-трансиллюминаторе (290-330 нм) и фиксацией результатов фотографированием через желтый фильтр.

Источники информации

1. Winter, A., Kramer, W., Werner, F.A., Kollers, S., Kata, S., Durstewitz, G., Buitkamp, J., Womack, J.E., Thaller, G. and Fries, R. Association of a lysine-232/alanine polymorphism in a bovine gene encoding acyl-CoA:diacylglycerolacyltransferase (DGAT1) with variation at a quantitative trait locus for milk fat content. Proc. Natl. Acad. Sci. U.S.A. 99 (14), 9300-9305 (2002).

2. Thaller G, Krämer W, Winter А, Kaupe B, Erhardt G, Fries R. Effects of DGAT1 variants on milk production traits in German cattle breeds. J Anim Sci. 2003 Aug; 81(8):1911-8.

3. Kühn C, Thaller G, Winter A, Bininda-Emonds O R, Kaupe В, Erhardt G, Bennewitz J, Schwerin М, Fries R. Evidence for multiple alleles at the DGAT1 locus better explains a quantitative trait locus with major effect on milk fat content in cattle. Genetics. 2004 Aug; 167(4): 1873-81.

4. Вафин P.P., Ахметов Т.М., Валиуллина Э.Ф., Зарипов О.Г., Вафин P.P. Способ проведения аллель-специфичной ПЦР для генотипирования крупного рогатого скота по аллелям А и В гена каппа-казеина. Патент на изобретение РФ RU 2337141 С2.

Способ проведения аллель-специфичной ПЦР для генотипирования крупного рогатого скота по аллелям К и А гена фермента DGAT, включающий подготовку пробы нуклеиновой кислоты, внесение указанной пробы в реакционную смесь для ПЦР, состоящую из дНТФ, буферной системы, Taq ДНК полимеразы, 4-х праймеров, проведения ПЦР, детекцию амплифицированных фрагментов ДНК методом гель-электрофореза, отличающийся тем, что используются нуклеотидные последовательности праймеров: К-аллель-специфичные праймеры: fpdgatext: ACACCATCCTCTTCCTCAAGCTGTTCT, rpindgatlis: CAGCTCCCCCGTTGGCCTT, инициирующие амплификацию К-аллель-специфичного фрагмента ДНК размером 220bp и А-аллель-специфичные праймеры fpindgatala: GCTCGTAGCTTTGGCAGGTAAGGC, rpdgatext: GAGATCTGGAAGGGAGGGCGG, инициирующие амплификацию А-аллель-специфичного фрагмента ДНК размером 158bp.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к способу обнаружения присутствия сайт-специфической интеграции донорной полинуклеотидной последовательности в целевой участок генома клетки кукурузы или сои.

Изобретение относится к биотехнологии. Изобретение касается способа диагностики миелоидных новообразований.

Изобретение относится к биотехнологии, а именно к средствам молекулярной диагностики. Разработаны олигонуклеотидные праймеры и флуоресцентно-меченый зонд для амплификации и детекции фрагмента гена наружного капсидного белка EEV вируса заразного узелкового дерматита (ЗУД) КРС, в котором у других представителей сем.

Изобретение относится к области биотехнологии. Описан конструкт ДНК для иммуномодуляции, состоящий из частично одноцепочечной, гантелеобразной цепи остатков ДНК с ковалентно закрытой структурой, дважды содержащей частично гибридизованную последовательность ДНК SEQ ID NO: 1.

Изобретение относится к области биохимии. Описан способ диагностики, прогнозирования или проведения мониторинга рака предстательной железы у нуждающегося в этом индивида (варианты).

Изобретение относится к биотехнологии. Изобретение включает новые зонды для изотермической амплификации нуклеиновой кислоты и способы обнаружения последовательности-мишени нуклеиновой кислоты с использованием этих зондов.

Изобретение относится к области молекулярной биологии, медицины и онкологии. Предложена аналитическая тест-система для определения чувствительности злокачественной опухоли конкретного пациента к онколитической биотерапии на основе мультиплексной ПЦР в режиме реального времени, включающая в себя список генов-маркеров CD74, CFI, CSF3, DNAJC24, FGF5, HCFC2, ИСК, IL15, IL1RAPL2, IL8, ITGA7, LEPR, MAP3K13, MAPKAPK3, MDK, PDGFRA, PDIK1L, PIK3CA, S100PBP, SCARB2, STK4, ТМЕМ54, TNFAIP6, TNFRSF1B, TRAF4 и тканеспецифичных референсных генов-хаускиперов GAPDH, АСТВ, RPN1, GUSB, инструкцию, планшеты для проведения ПЦР и смесь для амплификации.

Изобретение относится к области медицины, в частности к трансплантологии, и предназначено для анализа гемопоэтического химеризма при исследовании однонуклеотидных полиморфизмов генов фолатного цикла.

Изобретение относится к области генетики и селекции сельскохозяйственных животных. Предложен способ проведения ПЦР-ПДРФ-анализа для генотипирования крупного рогатого скота по гену RPS3A.

Изобретение относится к области медицины, в частности к гематологии, и предназначено для определения посттрансплантационного донорского химеризма при анализе точечных мутаций замены оснований в генах тромбофилии.

Изобретение относится к области биохимии, в частности к способу обнаружения присутствия сайт-специфической интеграции донорной полинуклеотидной последовательности в целевой участок генома клетки кукурузы или сои.

Изобретение относится к области биохимии, в частности к способу обнаружения присутствия сайт-специфической интеграции донорной полинуклеотидной последовательности в целевой участок генома клетки кукурузы или сои.

Изобретение относится к биотехнологии. Изобретение касается способа диагностики миелоидных новообразований.

Изобретение относится к биотехнологии. Изобретение касается способа диагностики миелоидных новообразований.

Изобретение относится к биотехнологии, а именно к средствам молекулярной диагностики. Разработаны олигонуклеотидные праймеры и флуоресцентно-меченый зонд для амплификации и детекции фрагмента гена наружного капсидного белка EEV вируса заразного узелкового дерматита (ЗУД) КРС, в котором у других представителей сем.

Изобретение относится к биотехнологии, а именно к средствам молекулярной диагностики. Разработаны олигонуклеотидные праймеры и флуоресцентно-меченый зонд для амплификации и детекции фрагмента гена наружного капсидного белка EEV вируса заразного узелкового дерматита (ЗУД) КРС, в котором у других представителей сем.

Изобретение относится к области биотехнологии. Описан конструкт ДНК для иммуномодуляции, состоящий из частично одноцепочечной, гантелеобразной цепи остатков ДНК с ковалентно закрытой структурой, дважды содержащей частично гибридизованную последовательность ДНК SEQ ID NO: 1.

Изобретение относится к области биотехнологии. Описан конструкт ДНК для иммуномодуляции, состоящий из частично одноцепочечной, гантелеобразной цепи остатков ДНК с ковалентно закрытой структурой, дважды содержащей частично гибридизованную последовательность ДНК SEQ ID NO: 1.

Изобретение относится к области биохимии. Описан способ диагностики, прогнозирования или проведения мониторинга рака предстательной железы у нуждающегося в этом индивида (варианты).

Изобретение относится к области биохимии. Описан способ диагностики, прогнозирования или проведения мониторинга рака предстательной железы у нуждающегося в этом индивида (варианты).

Изобретение относится к области генетики и молекулярной биологии, в частности к селекции крупного рогатого скота молочного направления. Способ осуществляют с помощью двух K-аллель-специфичных праймеров и двух A-аллель-специфичных праймеров. Применение изобретения обеспечивает эффективную аллель-специфичную ПЦР для генотипирования крупного рогатого скота по аллелям K и А гена фермента DGAT для прогнозирования жирномолочности при селекции животных. 1 ил., 1 пр.

Наверх