Способ выявления наследственной предрасположенности к быстрому росту миомы матки


 


Владельцы патента RU 2475740:

Федеральное государственное бюджетное учреждение "Ивановский научно-исследовательский институт материнства и детства имени В.Н. Городкова" Министерства здравоохранения и социального развития Российской Федерации (RU)

Изобретение относится к медицине, а именно к гинекологии и медицинской генетике, и может быть использовано для выявления наследственной предрасположенности женщины к быстрому росту миомы матки. Сущность способа состоит в том, что на выделенной из лимфоцитов ДНК амплифицируют фрагменты генов глутатион-S-трансферазы GSTM1 и метионин-синтазы-редуктазы MTRR, и при выявлении генотипа GSTM1 del/del в сочетании с генотипом MTRR 66G/G или MTRR 66A/G делают вывод о наличии у женщины генетической предрасположенности к быстрому росту миоматозных узлов в течение 5 лет с момента их появления. Способ расширяет арсенал прогностических средств выявления быстрого роста миоматозных узлов, позволяя своевременно провести комплекс первичных или вторичных профилактических мероприятий. 2 пр., 2 табл.

 

Изобретение относится к медицине, а именно к гинекологии и медицинской генетике, и может быть использовано для выявления наследственной предрасположенности к быстрому росту миомы матки.

Актуальность. Лейомиома матки является наиболее распространенным невоспалительным заболеванием женской репродуктивной системы. В последние годы большинство специалистов приходят к выводу о том, что главным подходом к лечению миомы матки является органосохраняющий. Тем не менее, около половины женщин с данной патологией в настоящий момент подвергаются оперативному лечению. Одним из основных показаний к операции является быстрый рост миоматозных узлов. Своевременный прогноз быстрого роста опухоли позволит врачу определиться с тактикой ведения пациентки, решить вопрос о необходимости первичной и вторичной профилактики.

На данный момент разработаны способы прогнозирования быстрого роста миоматозных узлов на основании оценки данных анамнеза, гистологических, биохимических и иммунологических исследований в биоптатах эндометрия или образцах крови. Существует метод прогнозирования быстрого роста миомы на основании учета количества медицинских абортов в анамнезе, наличия артериальной гипертензии во время предшествующих беременностей, угрозы невынашивания беременности, продолжительности родов, наличия аномалий родовой деятельности в предшествующих родах, воспалительных послеродовых заболеваний, а также хронических заболеваний желудочно-кишечного тракта. Показатель прогноза скорости роста миомы матки рассчитывают по разработанной авторами формуле (Патент №2350259. Российская Федерация. Способ прогнозирования быстрого роста миомы матки. / Кулагина Н.В., Козлов В.В. // Изобретения. Полезные модели. - 2009. - №9). Метод дает комплексную оценку факторов риска развития миомы матки, но не учитывает наследственный компонент патогенеза заболевания. В то же время, способов оценки роли генетических факторов в развитии миомы в доступной нам литературе не обнаружено.

Наиболее близким по техническому решению к заявляемому способу является способ прогнозирования быстрого роста лейомиомы матки, заключающийся в том, что в периферической крови женщин с лейомиомой матки определяют относительное количество IL-8+ моноцитов и при значении этого показателя 63% или более прогнозируют быстрый рост опухоли в течение года (Патент №2340897. Российская Федерация. Способ прогнозирования быстрого роста лейомиомы матки. / Сотникова Н.Ю., Соснина А.Е., Бойко О.М., Малышкина А.И., Анциферова Ю.С. // Изобретения. Полезные модели. - 2008. - №34).

Недостатки данного способа:

1) быстрый рост миомы матки прогнозируют только при наличии миоматозных узлов, до появления миомы матки данный метод применяться не может;

2) быстрый рост узлов прогнозируют не ранее чем за 1 год до его клинического проявления;

3) метод не учитывает роль наследственных факторов, играющих роль в развитии миомы.

Проведенный анализ специальной и патентной литературы показал, что предлагаемый нами способ не имеет аналогичных решений по прогнозированию наследственной предрасположенности к быстрому росту миомы матки.

Техническим результатом заявляемого способа является расширение арсенала прогностических средств, а именно выявление наследственной предрасположенности к быстрому росту миомы матки.

Заявляемый технический результат достигается тем, что в выделенной из лимфоцитов периферической венозной крови ДНК проводят анализ аллельного полиморфизма гена глутатион-S-трансферазы GSTM1 и гена метионин-синтазы-редуктазы MTRR, и при выявлении у женщины генотипа GSTM1 del/del в сочетании с генотипом MTRR 66G/G или MTRR 66A/G делают вывод о наличии у женщины генетической предрасположенности к быстрому росту миоматозных узлов в течение 5 лет с момента их появления.

Новизна предлагаемого способа состоит в том, что впервые предлагается способ выявления наследственной предрасположенности женщины к быстрому росту миомы матки.

Многочисленными исследованиями выявлено существование наследственной предрасположенности к развитию миомы матки (Morton C.C. Many tumors and many genes: Genetics of uterine leiomyomata. // American Journal of Pathology. - 1998. - Vol.153, No.4. - P.1015-1020). Доказано, что причиной возникновения и дальнейшей пролиферации клеток-предшественниц миоматозных узлов являются возникающие мутации в генах-кандидатах (Marshall R.D., Fejzo M.S., Friedman A.J., Mitchner N.. Nowak R.A., Rein M.S., Morton C.C., Sklar J. Analysis of androgen receptor DNA reveals the independent clonal origins of uterine leiomyomata and the secondary nature of cytogenetic aberrations in the development of leiomyomata. // Genes. Chromosomes. Cancer. - 1992. - Vol.11. - P.1-6). Факторы, повышающие риск возникновения соматических мутаций в гладкомышечных клетках (ГМК), могут, соответственно, способствовать быстрому росту миомы. Глутатион-S-трансферазы (GST) являются важнейшим компонентом системы детоксикации организма, поэтому делеции в генах GST могут обусловливать повышенную чувствительность организма к генотоксическим действиям ксенобиотиков и, тем самым, предрасполагать к быстрому прогрессированию опухоли. Метионин-синтазы-редуктаза MTRR относится к ключевым ферментам цикла фолиевой кислоты. Наличие мутантного аллеля MTRR 66G приводит к снижению активности соответствующего фермента и, как следствие, повышает риск фолат-зависимых хромосомных нарушений в гладкомышечных клетках, а также способствует накоплению в организме генотоксичного гомоцистеина. По-видимому, наличие в организме женщины генного дефекта одновременно в двух важных метаболических системах приводит к существенному увеличению частоты мутаций в ГМК, что клинически приводит к высокому риску быстрого роста миомы.

Ранее генотип GSTM1 del/del связывался с развитием мультифакториальной патологии: эндометриоза у женщин (Шарафисламова Э.Ф., Викторова Т.В., Хуснутдинова Э.К. Полиморфизм генов глутатион S-трансфераз M1 и Р1 у больных эндометриозом из Башкортостана. // Медицинская генетика. - 2003. - Т.2, №3. - С.136-140), бронхиальной астмы (Ivaschenko Т.Е., Sideleva O.G., Baranov V.S. Glutathione S-transferase micro and theta gene polymorphisms as new risk factors of atopic bronchial asthma. // J. Mol. Med. - 2002. - Vol.80(1). - P.39-43), онкологических заболеваний (Bailey L.R., Roodi N., Verrier C.S., Yee C.J., Dupont W.D. and Parl F.F. Breast cancer risk and CYP1A1, GSTM1, and GSTT1 polymorphisms: evidence of a lack of association in Caucasians and African Americans. // Cancer Res. - 1998. - №5. - P.65-70), а также использовались для прогнозирования развития железодефицитной анемии (Патент №2187812. Российская Федерация. Способ прогнозирования развития железодефицитной анемии (варианты) / Морозова А.А., Сафуанова Г.Ш., Хуснутдинова Э.К., Чепурная А.Н. // Изобретения. Полезные модели. - 2002. - №23) и мужского бесплодия (Патент №2314530. Российская Федерация. Способ прогнозирования нарушения фертильности у мужчин. / Фетисова И.Н., Дюжев Ж.А., Липин М.А., Серебрянников А.С. // Изобретения. Полезные модели. - 2008. - №1). Показано влияние полиморфного варианта гена MTRR 66G на развитие самопроизвольного прерывания беременности (Бескоровайная Т.С. Влияние некоторых генетических факторов на нарушение репродукции у человека / Т.С.Бескоровайная: дисс. … канд. мед. наук. - М., 2005. - 89 с.), тромбофилических осложнений беременности (Михайлин Е.С. Встречаемость некоторых наследственных тромбофилий при гестозе и преждевременной отслойке нормально расположенной плаценты. // Медицинская генетика. - 2005. - №5 (2). - С.230). Для прогнозирования быстрого роста миомы матки определение данных полиморфизмов не применяли.

Заявляемый нами способ осуществляется по стандартной методике следующим образом.

Выделение ДНК из лейкоцитов периферической крови выполняют с помощью набора реактивов для выделения Diatom™ DNA Prep 100 по протоколу производителя. В реакцию берут 100 мкл крови. Далее на полученных образцах проводят полимеразную цепную реакцию (ПЦР) фрагментов генов GSTM1 и MTRR в реакционной смеси объемом 25 µl следующего состава: 0,1-1,0 µg геномной ДНК, по 0,25 µM каждого оригинального олигопраймера, по 200 µM каждого dNTP, 1 U термофильной ДНК-полимеразы Termus aquaticus, буфер для ПЦР (67 mM Tris-HCl; 16.6 mM (NH4)2SO4; 0,01% Twin-20; pH 8.8), 20-30 µl минерального масла. В качестве внутреннего контроля служит амплификация фрагмента гена бета-глобина НВВ. Праймеры и условия амплификации, используемые в заявляемом способе, приведены в таблице 1.

Таблица 1
Реакция Ген Последовательность праймеров Условия амплификации Длина фрагмента (п.н.)
t° отжига (°C) [MgCl2] mM Кол-во циклов
1 НВВ F ACTCCTGAGGAGAAGTCTGCC 62 3 32 375
R AAGGTGAAATTGAGGTTGTCC
GSTM1 F AACTCCCTGAAAAGCTAAAGCTC 213
R GCTCAAATATACGGTGGAGGTC
2 MTRR A66G F GCAAAGGCCATCGCAGAAGACAT 62 6 30 121
R ACAAAACGGTAAAATCCACTGTAAC

Полиморфизм гена MTRR является однонуклеотидной заменой, которая определяется по наличию или отсутствию сайта рестрикции специфичной эндонуклеазы FauNDI («Сибэнзим», Россия). Реакцию проводят согласно протоколу фирмы-производителя.

Продукты амплификации и рестрикции фрагментов генов анализируют в 7%-ном полиакриламидном геле (соотношение акриламида и бисакриламида 29:1) с последующей окраской в растворе бромистого этидия (конечная концентрация 0,1 мкг/мл) и визуализацией в проходящем УФ-свете при длине волны 312 нм.

Наличие нормального аллеля «+» гена GSTM1 определяют по присутствию на электрофореграмме продукта амплификации размером 213 п.н. Отсутствие фрагмента указывает на гомозиготность индивидуума по делеции в соответствующем гене (del/del). Анализ полиморфных аллелей гена MTRR осуществляют на основе регистрации длин рестрикционных фрагментов. Аллель 66А определяют по наличию на электрофореграмме продуктов размерами 99 и 22 п.н., аллель 66G определяют по отсутствию рестрикции и сохранению исходного размера фрагмента гена 121 п.н.

Отличительные признаки способа. Установлен новый прогностический критерий быстрого роста миомы матки, когда на выделенной из лимфоцитов ДНК амплифицируют фрагменты генов GSTM1 и MTRR, и при выявлении у генотипа GSTM1 del/del в сочетании с генотипом MTRR 66G/G или MTRR 66A/G делают вывод о наличии у женщины генетической предрасположенности к быстрому росту миоматозных узлов в течение 5 лет с момента их появления.

Сущность заявляемого способа выявления наследственной предрасположенности к быстрому росту миомы матки поясняется примерами конкретного выполнения.

Пример 1. Больная А., 32 лет. В ходе планового профилактического осмотра впервые выявлена миома матки. Жалоб не предъявляет. В анамнезе 1 своевременные роды, 2 медицинских аборта. Контрацепция барьерными методами. Курит с 21 года. При влагалищном обследовании шейка матки без дефектов слизистой, матка увеличена до 6 недель беременности, плотная, подвижная, безболезненная. Придатки не пальпируются, своды свободные. По данным УЗИ тело матки 70×55×71 мм. М-эхо 4 мм, полость не деформирована, в области правого угла матки узел диаметром 15 мм. Правый яичник 36×26 мм, левый яичник 35×30 мм.

Клинический диагноз: интрамуральная лейомиома матки малых размеров.

При анализе генов GSTM1 и MTRR выявлен генотип GSTM1 del/del MTRR 66A/G. Заключение: Констатируется наследственная предрасположенность к быстрому росту миомы матки. Прогнозируется быстрый рост узла в течение 5 лет.

При осмотре через три года у пациентки появились жалобы на обильные, длительные менструации. При осмотре матка увеличена до 13 недель беременности, плотная, с неровной поверхностью, подвижная, безболезненная. По УЗИ тело матки 120×89×123 мм. Определяется три интрамурально-субсерозных узла в передней стенке матки, размерами 42, 66 и 68 мм. Hb 100 г/л.

Клинический диагноз: Интрамурально-субсерозная миома матки, быстрый рост. Гиперполименорея. Анемия 1 ст.

Таким образом, прогноз по заявляемому способу подтвердился.

Пример 2. Пациентка В., 28 лет. Консультирована по поводу планирования беременности. Жалоб не предъявляет. В анамнезе 1 медицинский аборт. Контрацепция барьерными методами. Не курит. При влагалищном обследовании шейка матки без дефектов слизистой, матка нормальной величины, плотная, подвижная, безболезненная. Придатки не пальпируются, своды свободные. Выделения слизистые. При УЗИ размер матки 43×37×43 мм, однородной структуры. Полость матки не деформирована. М-эхо 3 мм. Правый яичник 33×20 мм, левый яичник 30×32 мм.

Клинический диагноз: Практически здорова.

При анализе генов GSTM1 и MTRR выявлен генотип GSTM1 del/del MTRR 66G/G. Заключение: Констатируется наследственная предрасположенность к быстрому росту миомы матки. Прогнозируется быстрый рост узла в течение 5 лет после появления миомы матки.

Через один год у пациентки выявляется миома матки небольших размеров - 5 недель. В женской консультации не наблюдается.

При обращении больной через три года с момента первого обращения пациентка предъявляет жалобы на обильные длительные менструации. При влагалищном обследовании матка до 12 недель беременности, с неровной поверхностью, плотная, подвижная, безболезненная. Придатки не пальпируются. По данным УЗИ тело матки 86×71×109 мм, неоднородной структуры, с одним крупным межмышечно-подбрюшинным узлом по передней стенке размерами 38×41×46 и тремя межмышечно-подбрюшинными узлами по задней стенке (диаметром 22, 23 и 30 мм). Hb 140 г/л.

Клинический диагноз: Интрамурально-субсерозная миома матки больших размеров, быстрый рост. Гиперполименорея.

Таким образом, прогноз по заявляемому способу подтвердился.

Пример 3. Больная А., 39 лет. Наблюдается в женской консультации по поводу миомы матки малых размеров 4-5 недель в течение 3 лет. Жалоб не предъявляет. В анамнезе - 2 своевременных родов, 1 медицинский аборт, без осложнений. Не курит. Контрацепция - ВМС в течение 4 лет. При гинекологическом осмотре матка увеличена до 4-5 недель беременности, плотная, подвижная, безболезненная. Придатки не определяются, своды свободные. При УЗИ тело матки 48×60×60 мм, неоднородной структуры, с интрамуральным узлом в дне матки размерами 22 мм. Полость матки не деформирована, М-эхо 7 мм. Правый яичник 30×20 мм, левый яичник 32×25 мм.

Клинический диагноз: Интрамурально-субсерозная миома матки малых размеров.

При анализе генов GSTM1 и MTRR выявлен генотип GSTM1+MTRR 66A/G. Заключение: Наследственная предрасположенность к быстрому росту миомы матки не выявлена.

При повторном осмотре через 3 года больная жалоб не предъявляет. Гинекологический статус без изменений.

Клиническая апробация способа дала следующие результаты:

Таблица 2
Показатель Количество
Истинно-положительный результат 20
Ложно-положительный результат 11
Истинно-отрицательный результат 55
Ложно-отрицательный результат 21
Всего обследовано 105

Чувствительность метода: 48,8%

Специфичность метода: 83,3%

Точность метода: 70,0%

Преимущества заявляемого метода:

1. Выявляет наследственную предрасположенность к быстрому росту миомы.

2. Позволяет выявлять предрасположенность к быстрому росту миомы матки у женщин даже до того, как заболевание будет впервые выявлено.

3. Так как метод основан на оценке полиморфизма генов, исследование проводится один раз в жизни.

4. Позволяет своевременно провести первичную и вторичную профилактику быстрого роста миомы матки.

Способ выявления наследственной предрасположенности к быстрому росту миомы матки у женщин путем исследования периферической венозной крови, отличающийся тем, что на выделенной из лимфоцитов ДНК амплифицируют фрагменты генов глутатион-S-трансферазы GSTM1 и метионин-синтазы-редуктазы MTRR, и при выявлении генотипа GSTM1 del/del в сочетании с генотипом MTRR 66G/G или MTRR 66A/G делают вывод о наличии у женщины генетической предрасположенности к быстрому росту миоматозных узлов в течение 5 лет с момента их появления.



 

Похожие патенты:

Изобретение относится к медицине, а именно к нейрохирургии, и может быть использовано для лечения больных с осложненной травмой шейного отдела позвоночника. .
Изобретение относится к медицине, а именно к гастроэнтерологии. .
Изобретение относится к медицине, в частности к ранней диагностике развития различных форм клещевого энцефалита. .
Изобретение относится к медицине, а именно к лабораторной диагностике, и может быть использовано для газохроматографического анализа ротовой жидкости у детей. .

Изобретение относится к медицине, а именно кардиологии, кардиохирургии и спортивной медицине, и может быть использовано для оценки функционального состояния кровообращения в большом, малом и коронарном кругах у человека во время физической нагрузки.

Изобретение относится к области медицины, в частности к микробиологии, и может быть использовано для подготовки биологического материала для выделения ДНК Coxiella burnetii из тромбоцитов
Изобретение относится к пульмонологии, оториноларингологии, иммунологии и может быть использовано для оценки эффективности лечения хронических воспалительных процессов дыхательной системы

Изобретение относится к области медицины и может быть использовано для прогнозирования рецидивов лигатурных осложнений
Изобретение относится к медицине и касается проблемы нарушений психомоторного развития у детей и может быть использовано для оценки прогноза задержки психомоторного развития у детей с перинатальным поражением центральной нервной системы (ПП ЦНС) гипоксически-ишемического генеза в анамнезе
Изобретение относится к области медицины, а именно к акушерству, гинекологии и репродуктологии

Изобретение относится к аналитическому инструменту с тестовой лентой со сменным блоком (14) тестовой ленты, содержащим тестовую ленту (16), снабженную множеством тестовых элементов (18), на которые может наносится биологическая жидкость, и с лентопротяжным механизмом (12), соединенным с блоком (14) тестовой ленты, для прямой перемотки тестовой ленты (16), так что тестовые элементы (18) последовательно доставляются к месту применения
Изобретение относится к медицине, а именно к эндохирургии, и может быть использовано для прогнозирования развития острого панкреатита после эндоскопического транспапиллярного вмешательства у пациентов с синдромом желчной гипертензии
Наверх