Синтетические олигонуклеотидные праймеры и их использование в способе выявления и дифференциации генома вакцинного штамма в-82 от полевых изолятов вируса миксомы кроликов методом полимеразной цепной реакции в режиме реального времени

Группа изобретений относится к области биотехнологии и касается синтетических олигонуклеотидных праймеров и способа их использования. Предложенный способ выявления и дифференциации генома вакцинного штамма В-82 от полевых изолятов вируса миксомы кроликов включает: выделение ДНК из биологического материала, постановку мультиплексной полимеразной цепной реакции с использованием синтезированных праймеров, комплементарных участкам генов M130R и M151R вируса миксомы кролика и имеющих следующий нуклеотидный состав:

амплификацию ДНК вируса и оценку проведения реакции. Представленные изобретения могут быть использованы в ветеринарной вирусологии для выявления и дифференциации вакцинного штамма B-82 вируса миксомы кроликов от полевых изолятов. 2 н.п. ф-лы, 6 табл., 6 пр.

 

Изобретение относится к биотехнологии, а именно к генетической инженерии, и может быть использовано в ветеринарной вирусологии для выявления и дифференциации вакцинного штамма B-82 вируса миксомы кроликов от полевых изолятов.

Миксоматоз - остро протекающая, высоко контагиозная вирусная болезнь кроликов, которая характеризуется серозно-гнойным конъюнктивитом, воспалением слизистых оболочек, образованием опухолевых узелков на коже и подкожных студенистых отеков преимущественно в области головы, анального отверстия и половых органов. К вирусу миксомы кроликов чувствительны как домашние, так и дикие животные независимо от возраста [1].

Возбудитель миксоматоза, вирус миксомы кроликов, относится к роду Leporipoxvirus семейства Poxviridae. Вирус имеет форму параллелепипеда с закругленными углами и реплицируется в цитоплазме инфицированных клеток. Он вызывает острую и персистирующую инфекцию, способен интегрировать свою ДНК в геном хозяина. Геном вируса представлен двухцепочечной молекулой ДНК, размером около 160 тысяч пар оснований. Центральная часть генома содержит 100 генов, которые являются высоко консервативными генами поксвирусов, кодирующими основные структурные белки, также имеются терминально инвертированные повторы и закрытые локусы шпилек на каждом конце генома [2].

Лабораторная диагностика миксоматоза кроликов в Российской Федерации основана на гистологическом исследовании патологического материала. При отрицательном результате этого исследования и отсутствии характерных клинических признаков прибегают к биопробе на кроликах.

Для специфической профилактики применяют живые аттенуированные вакцины. Вакцинированные животные в результате контакта с полевыми штаммами могут становиться бессимптомными носителями вируса и служить резервуаром инфекции. В связи с этим, при обнаружении у животных вируса миксомы кроликов возникает необходимость в дифференциации вакцинных штаммов от полевых изолятов.

Целью данного изобретения является синтез праймеров для выявления и дифференциации генома вакцинного штамма B-82 от полевых изолятов вируса миксомы кроликов с помощью ПЦР в режиме реального времени.

Поставленная цель достигается за счет олигонуклеотидных праймеров и флуоресцентных зондов, комплементарных участкам генов M130R и M151R вируса миксомы кроликов и способом для выявления и дифференциации генома вируса миксомы кроликов в пробах органов и образцах крови больных и павших животных и в инфицированной культуре клеток. При этом вначале проводят выделение нуклеиновых кислот (НК) из исследуемого материала, а затем - амплификацию специфичных фрагментов генома вируса миксомы кроликов.

Для выделения НК из исследуемого материала используют метод нуклеосорбции, заключающийся в разрушении клеточных и вирусных мембран и последующем связывании НК с поверхностью сорбента.

Полученную НК используют для постановки ПЦР-РВ. Для обеспечения амплификации специфичных фрагментов генома вируса миксомы кроликов к ПЦР-смеси помимо матрицы добавляют олигонуклеотидные праймеры и флуоресцентные зонды, фланкирующие участки M130R и M151R. Нуклеотидный состав используемых праймеров и зондов приведен ниже:

MF TGG-AGC-TTT-TCA-AGC-ATT
MR ATA-TCT-CGG-CTC-TAG-GGC-GAG
MZ [FAM]-AG-CGT-CGG-ACG-TCT-TCG-TT-[RTQ1]
VF AGC-CCT-ATA-AAC-CCG-TAG-ACG-AAC
VR CAA-GCT-TTT-TTT-TAT-CCT-CGT-CCG
VZ [R6G]-TCG-ACG-GTT-TCG-TCC-GCC-TTC-TTG-[BHQ2]

Температурные режимы для проведения ПЦР-РВ включают следующие этапы: 5 мин предварительной денатурации при 95°C, 40 циклов амплификации (95°C - 15 сек, 58°C - 20 сек, 72°C - 20 сек).

Постановку ПЦР с гибридизационно-флуоресцентной детекцией в режиме «реального времени» проводят на приборе RotorGene-6000 («CorbettResearch», Австралия) или аналоге. Полученные в ходе экспериментов данные анализируют с помощью программного обеспечения, входящего в комплект прибора.

Техническим результатом изобретения является повышение степени специфичности и чувствительности, а также сокращение времени проведения диагностической работы по обнаружению и дифференциации генома вакцинного штамма B-82, вируса в образцах исследуемого биологического материала.

Сущность изобретения состоит в том, что при помощи указанных праймеров MF и MR и зонда MZ проводят ПЦР в реальном времени, позволяющую выявить геном как вакцинного штамма B-82 так и полевых изолятов вируса миксомы кроликов, при использовании праймеров VF и VR и зонда VZ дифференцируют геном вакцинного штамма B-82 от полевых изолятов вируса.

Использование разных красителей при синтезе зондов (краситель FAM присоединен к 5′-концу зонда, комплементарного фрагменту генома вируса миксомы кроликов, и краситель R6G - к 5′-концу зонда, комлементарного участку генома вакцинных штаммов) дало возможность одновременного выявления и дифференциации ДНК вируса за счет неперекрывающихся спектров флуоресценции и, как следствие, детекции флуоресцентных сигналов по отличающимся друг от друга каналам: канал Green - для выявления генома вируса как полевых, так и вакцинных штаммов и канал Yellow - только для ДНК вакцинного штамма B-82.

Существенным отличием данных праймеров и зондов является то, что они:

1. комплементарны участкам генов M130R и Ml51R вируса миксомы кроликов, и не комплементарны каким-либо участкам геномов близкородственных вирусов;

2. присутствие флуоресцентных зондов увеличивает специфичность реакции и позволяет проводить идентификацию и дифференциацию ДНК вакцинного штамма B-82 вируса миксомы кроликов уже в процессе реакции. Изобретение иллюстрируется несколькими примерами.

Пример 1. Расчет первичной структуры олигонуклеотидных праймеров и зонда для выявления генома вируса миксомы кроликов.

С помощью программы «BioEdit 7.0» выравнены доступные в базе данных GenBank нуклеотидные последовательности участка M151R вируса миксомы кроликов. В результате анализа последовательностей внутри данного участка генома вируса выбран участок, являющийся наиболее консервативным у всех проанализированных нами штаммов и изолятов. С помощью программы «Oligo 6.0» рассчитаны первичные структуры олигонуклеотидных праймеров MF и MR, фланкирующих участок M151R вируса миксомы кроликов длиной 150 п.н. Для детекции продуктов амплификации подобран олигонуклеотидный флуоресцентномеченый зонд MZ, комплементарный участку, находящемуся внутри нуклеотидной последовательности амплифицируемого фрагмента.

Основная характеристика рассчитанных олигонуклеотидов представлена в таблице 1.

Таблица 1
Характеристика сконструированных олигонуклеотидных праймеров и зонда, комплементарных участку M151R вируса миксомы кроликов
Название Состав олигонуклеотида, 5′-…-3′ Длина
MF TGG-AGC-TTT-TCA-AGC-ATT 18
MR ATA-TCT-CGG-CTC-TAG-GGC-GAG 21
MZ [FAM]-AG-CGT-CGG-ACG-TCT-TCG-TT-[RTQ1] 19

Пример 2. Расчет первичной структуры олигонуклеотидных праймеров и зонда для дифференциации генома вакцинного штамма B-82 вируса миксомы кроликов от полевых изолятов.

С помощью программы «BioEdit 7.0» выравнены доступные в базе данных GenBank нуклеотидные последовательности участка M130R вируса миксомы кроликов, а также нуклеотидные последовательности, полученные в результате секвенирования отечественных штаммов и изолятов вируса. В результате анализа последовательностей внутри данного участка генома вируса выбран участок, являющийся уникальным для вакцинного штамма B-82 и отсутствующим у других штаммов и полевых изолятов, вследствие чего происходит специфичная амплификация только у образцов, содержащих ДНК вакцинного штамма вируса. С помощью программы «Oligo 6.0» рассчитаны первичные структуры олигонуклеотидных праймеров VF и VR, фланкирующих участок M130R вируса миксомы кроликов длиной 148 п.н. Для детекции продуктов амплификации подобран олигонуклеотидный флуоресцентномеченый зонд VZ, комплементарный участку, находящемуся внутри нуклеотидной последовательности амплифицируемого фрагмента.

Основная характеристика рассчитанных олигонуклеотидов представлена в таблице 2.

Таблица 2
Характеристика сконструированных олигонуклеотидных праймеров и зонда, комплементарных участку M151R вируса миксомы кроликов
Название Состав олигонуклеотида, 5′-…-3′ Длина
VF AGC-CCT-ATA-AAC-CCG-TAG-ACG-AAC 24
VR CAA-GCT-TTT-TTT-TAT-CCT-CGT-CCG 24
VZ [R6G]-TCG-ACG-GTT-TCG-TCC-GCC-TTC-TTG-[BHQ2] 24

Пример 3. Экстракция ДНК вируса миксомы кроликов из проб крови, органов и вируссодержащего материала, полученного при выделении данного вируса в различных чувствительных системах (ПК, ФЭК, CV-1).

В необходимое количество пробирок объемом 1,5 миллилитра (мл) на N-ное число образцов (включая отрицательный контроль выделения - ОКВ) вносят по 500 микролитров (мкл) лизирующего раствора №1, содержащего гуанидин тиоцианат.Затем в них добавляют по 100 мкл исследуемого материала (кровь, суспензия вируса, 10%-ная суспензия органов), тщательно перемешивают содержимое пробирок и инкубируют при 56°C в течение 5 мин. Далее проводят центрифугирование проб в течение 15 с при 12000 об/мин для осаждения капель со стенок пробирок и добавляют к образцам 30-35 мкл предварительно ресуспендированного сорбента «силика», инкубируют при комнатной температуре 10 мин, периодически перемешивая смесь. После инкубации пробирки центрифугируют 30 сек при 7,0 тыс об. в мин, надосадочную жидкость отбрасывают. Добавляют 500 мкл отмывочного буфера, тщательно ресуспендируют сорбент, центрифугируют 30 сек при 7,0 тыс об/мин, удаляют надосадочную жидкость. Промывают сорбент 75%-ным этиловым спиртом в объеме 500 мкл, тщательно ресуспендируют сорбент, центрифугируют 30 сек при 13,0 тыс об/мин, удаляют надосадочную жидкость и далее подсушивают 10 мин при температуре 56°С. К осадку добавляют 50 мкл элюирующего буфера, перемешивают и инкубируют 10 мин при температуре 56°С. Центифугируют пробирки в течение 1 мин при 13,0 тыс об/мин, надосадочную жидкость переносят в новые пробирки. Супернатант используют в качестве матрицы для ПЦР-РВ.

Пример 4. Амплификация специфичных участков ДНК вируса миксомы кроликов в процессе ПЦР-РВ.

Для проведения ПЦР в отдельной пробирке готовят общую реакционную смесь на необходимое количество образцов (N), в число которых входит отрицательный контроль выделения (ОКВ), отрицательный контроль ПЦР (ОК) и положительный контроль ПЦР (ПК). Объем смеси для одной пробы составляет 20 мкл, содержащих: 5 мкл буфера для Taq-полимеразы 5-кратной концентрации, 0,5 мкл 25 мМ MgCl2, 8 мкл воды (составляют буфер №1), 0,2 мкл 25 мМ дезоксирибонуклеозидтрифосфатов, по 10 пМ каждого праймера, 5 пМ флуоресцентного зонда (составляют буфер №2) и 0,2 мкл Taq-полимеразы (20 ед/мкл). Приготовленную смесь перемешивают, избегая образования пены, и раскапывают по 20 мкл в предварительно промаркированные пробирки вместимостью 0,2 мл.

В подготовленные для ПЦР пробирки вносят по 5 мм3 ДНК, используя одноразовые наконечники с аэрозольным барьером. В пробирку для положительного контроля (ПК) вносят 5 мкл ПК, а в пробирку для отрицательного контроля ПЦР (ОК) - 5 мкл ОК.

Пробирки помещают в амплификатор «Rotorgene 6000» (Corbett Research, Австралия) со следующим температурным режимом:

1. Hold/Удержание температуры 95°C - 3 мин
2. Cycling/Циклирование 95°C - 15 сек
58°C - 20 сек
72°C - 20 сек
Cycle repeats/Цикл повторить - 5 times/раз
3. Cycling2/Циклирование2 95°C - 15 сек
58°C - 20 сек - Детекция!
72°C - 20 сек
Cycle repeats/Цикл повторить - 35 times/раз

Флуоресценцию измеряют при 58°C на каналах Green и Yellow.

Пример 5. Учет и интерпретация результатов амплификации.

Результаты интерпретируют на основании наличия (или отсутствия) пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией (что соответствует наличию (или отсутствию) значения порогового цикла «Ct» в соответствующей графе в таблице результатов).

5.1 Учет результатов на наличие генома вируса миксомы кроликов.

Результат считается достоверным только в случае прохождения положительного и отрицательного контролей амплификации и отрицательного контроля выделения (ОКО) (таблица 3).

Таблица 3
Оценка результатов анализа контрольных образцов
Контроля Контролируемый этап анализа Значение Ct по каналу FAM/GREEN
ОКО Выделение ДНК Нет значений
ОК ПЦР Нет значений
ПК ПЦР <33

Образец считают положительным на наличие ДНК вируса миксомы кроликов, если значение Ct по каналу FAM/GREEN составляет менее 33.

Образец считают отрицательным, если по каналу FAM/GREEN для него значение Ct отсутствует.

Результаты не подлежат учету:

- Отсутствие положительного сигнала в пробе с положительным контролем ПЦР (ПК) может свидетельствовать о неправильно выбранной программе амплификации и о других ошибках, допущенных на этапе постановки ПЦР. В таком случае необходимо провести ПЦР еще раз.

- Если значение Ct по каналу FAM/GREEN превышает 33, требуется повторить ПЦР и считать его положительным в случае повторения результата.

- Появление любого значения Ct в таблице результатов для отрицательного контрольного образца (ОКО) и для отрицательного контроля ПЦР (ОК) по каналу FAM/GREEN свидетельствует о наличии контаминации реактивов или образцов. В этом случае результаты анализа по всем пробам считаются недействительными. Требуется повторить анализ всех проб, а также предпринять меры по выявлению и ликвидации источника контаминации.

5.2 Учет результатов на наличие генома вакцинного штамма В-82 вируса миксомы кроликов.

Результат считается достоверным только в случае прохождения положительного и отрицательного контролей амплификации и отрицательного контроля выделения (ОКО) (таблица 4).

Таблица 4
Оценка результатов анализа контрольных образцов
Контроли Контролируемый этап анализа Значение Ct по каналу HEX/Yellow
ОКО Выделение ДНК Нет значений
OK ПЦР Нет значений
ПК ПЦР <33

Образец считают положительным на наличие ДНК вируса миксомы кроликов, если значение Ct по каналу HEX/Yellow составляет менее 33.

Образец считают отрицательным, если по каналу HEX/Yellow для него значение Ct отсутствует.

Результаты не подлежат учету:

- Отсутствие положительного сигнала в пробе с положительным контролем ПЦР (ПК) может свидетельствовать о неправильно выбранной программе амплификации и о других ошибках, допущенных на этапе постановки ПЦР. В таком случае необходимо провести ПЦР еще раз.

- Если значение Ct по каналу HEX/Yellow превышает 33, требуется

повторить ПЦР и считать его положительным в случае повторения результата.

- Появление любого значения Ct в таблице результатов для отрицательного контрольного образца (ОКО) и для отрицательного контроля ПЦР (ОК) по каналу HEX/Yellow свидетельствует о наличии контаминации реактивов или образцов. В этом случае результаты анализа по всем пробам считаются недействительными. Требуется повторить анализ всех проб, а также предпринять меры по выявлению и ликвидации источника контаминации.

Результаты не подлежат учету:

- Отсутствие положительного сигнала или наличие сигнала со значением Ct по каналу HEX/Yellow превышает 33 для каждой пробы, свидетельствует об ошибках на этапе выделения ДНК или постановки ГЩР. В таком случае необходимо провести выделение ДНК и ПЦР еще раз.

Пример 6. Определение чувствительности и специфичности ПЦР-РВ на основе синтетических олигонуклеотидных праймеров и зондов комплементарных генам M130R и M151R вируса миксомы кроликов.

Специфичность метода определили, используя пробы, содержащие ДНК вируса миксомы кроликов, близкородственных Поксвирусов (вирус фибромы Шоупа и вирусвакцина против оспы овец), а также интактные образцы.

Результаты оценки специфичности ПЦР-РВ представлены в таблице 5.

Таблица 5
Результаты проведения ПЦР с праймерами, комплементарными генам M130R и M151R вируса миксомы кроликов
Наименование материалов Результат
Геном вируса Геном вакцинного штамма вируса
Кровь от интактного кролика - -
Кровь, отобранная от кролика на 3 день после вакцинирования производственным штаммом В-82 вируса миксомы кроликов в дозе 1000 ИД50/см3 + +
Кровь, отобранная от кролика на 4 день после вакцинирования производственным штаммом B-82 вируса миксомы кроликов в дозе 1000 ИД50/см3 + +
Кровь, отобранная от кролика на 5 день после вакцинирования производственным штаммом B-82 вируса миксомы кроликов в дозе 1000 ИД50/см3 + +
Лиофилизированный материал (CV-1), содержащий штамм Микс-98 вируса миксомы кроликов, инфекционная активность 4,0 lg ИД50/см3 + +
Культуральный материал (ПК), содержащий штамм B-82 вируса миксомы кроликов, инфекционная активность 4,5 lg ТЦД50/см3 + +
Лиофилизированный материал, содержащий штамм B-82 вируса миксомы кроликов, инфекционная активность 4,1 lg ИД50/см3 + +
Лиофилизированный материал, содержащий штамм MP вируса миксомы кроликов, инфекционная активность 5,0 lg LD50/см3 + -
Ассоциированная вакцина против ВГБК и миксоматоза кроликов + +
10% суспензия кожи кролика, инфицированного вирусом миксомы кроликов, изолят Хабаровск-09 (полевой материал, г. Хабаровск, 2009 г.) + -
10% суспензия кожи кролика, инфицированного вирусом миксомы кроликов, изолят Смоленск-11 (полевой материал, г. Смоленск, 2011 г.) + -
10% суспензия кожи кролика, инфицированного вирусом миксомы кроликов, изолят Иваново-12 (полевой материал, г. Иваново, 2012 г.) + -
Интактная культура клеток ФЭК - -
Интактная культура клеток RK-13 - -
Вирусвакцина против оспы овец сухая культуральная (сер. №02-13) - -
Лиофилизированный материал вируса фибромы Шоупа, инфекционная активность 4,1 lg ИД50/см3, от 17.05.2004 - -

Таким образом, положительный результат зарегистрировали только в пробах, содержащих ДНК вируса миксомы кроликов, что является подтверждением специфичности разработанного метода.

Чувствительность метода определили, используя панель 10-кратных разведений культурального материала, содержащего штамм В-82 вируса миксомы кроликов с титром инфекционной активности 4,5 lg ТЦД50/см3. В результате ДНК вируса обнаружили в разведении 1:1000, что соответствует 1,5 lg ТЦД50/см3 (таблица 6).

Таблица 6
Результаты определения чувствительности метода на основе последовательных десятикратных разведений культурального вируссодержащего материала
Материал для исследования Результат
Материал исходной ДНК +
Разведенный в 10 раз +
Разведенный в 100 раз +
Разведенный в 1000 раз +
Разведенный в 10000 раз -
Разведенный в 100000 раз -
Разведенный в 1000000 раз -

Источники информации

1. Вирусные болезни животных / В.Н. Сюрин, А.Я. Самуйленко, Б.В. Соловьев, Н.В. Фомина. - М.: ВНИТИБП, 1998. - 928 с.

2. Moss, В. Poxviridae: The viruses and their replication / B. Moss // Fundamental Biology, 4th ed. / D.M. Knipe, and P.M. Howley, Eds. - Philadelphia, Lippincott-Raven Publishers, 2001.

1. Синтетические олигонуклеотидные праймеры, комплементарные участкам генов M130R и M151R вируса миксомы кроликов, используемые для выявления и дифференциации генома вакцинного штамма B-82 от полевых изолятов вируса, имеющие следующий нуклеотидный состав:

MF 5'TGG-AGC-TTT-TCA-AGC-ATT 3'
MR 5'ATA-TCT-CGG-CTC-TAG-GGC-GAG 3'
MZ 5' [FAM]-AG-CGT-CGG-ACG-TCT-TCG-TT-[RTQ1] 3'
VF 5'AGC-CCT-ATA-AAC-CCG-TAG-ACG-AAC 3'
VR 5'CAA-GCT-TTT-TTT-TAT-CCT-CGT-CCG 3'
VZ 5' [R6G]-TCG-ACG-GTT-TCG-TCC-GCC-TTC-TTG-[BHQ2] 3'

2. Способ выявления и дифференциации генома вакцинного штамма B-82 от полевых изолятов вируса миксомы кроликов, включающий выделение ДНК из биологического материала, постановку мультиплексной полимеразной цепной реакции с использованием синтезированных праймеров, амплификацию ДНК вируса, оценку проведения реакции, отличающийся тем, что используют праймеры по п.1, а температурные режимы для проведения ПНР в режиме реального времени включают следующие этапы: 1) 5 мин предварительной денатурации при 95°C; 2) 5 циклов амплификации (95°C - 15 сек, 58°C - 20 сек, 72°C - 20 сек), 3) 35 циклов амплификации с детекцией на стадии отжига праймеров (95°C - 15 сек, 58°C - 20 сек, 72°C - 20 сек), при этом результат считается положительным, если Ct по обоим каналам ниже 33.



 

Похожие патенты:

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела.

Группа изобретений относится к области биохимии. Предложено устройство для забора нуклеиновой кислоты, применение устройства для забора нуклеиновой кислоты, набор для амплификации нуклеиновой кислоты, а также способ амплификации нуклеиновой кислоты.

Изобретение относится к области биохимии, в частности к способу выявления соматических мутаций в гене PI3K, ответственных за чувствительность опухоли к таргетной терапии, с помощью технологии ДНК-биочипов.

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности вереска обыкновенного (Calluna vulgaris (L.) Hull.).

Изобретение относится к биотехнологии, в частности к способу выделения микроРНК из биологических жидкостей, содержащих экзосомы. Способ включает последовательное центрифугирование, ультрафильтрацию и ультрацентрифугирование культуральной конденсированной среды.

Изобретение относится к области биотехнологии и может быть использовано для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ММР9-1562 C>Т (rs3918242).

Настоящее изобретение относится к области биотехнологии, конкретно к предварительной оценке эффективности трансплантации аутологичного клеточного материала для стимуляции роста кровеносных сосудов, и может быть использовано в медицине.
Группа изобретений относится к области биотехнологии. Способ выявления генома вируса инфекционной анемии лошадей предусматривает постановку полимеразной цепной реакции, амплификацию ДНК вируса, оценку проведения реакции.

Изобретение относится к области медицины, фтизиатрии и медицинской микробиологии и касается способа генотипирования штаммов Mycobacterium tuberculosis. Охарактеризованный способ основан на однонуклеотидном полиморфизме генов систем токсин-антитоксин II типа суперсемейств VapBC, HigAB и MazEF и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора олигонуклеотидных праймеров для 10 генов систем токсин-анатоксин.

Группа изобретений относится к многоканальным устройствам, модифицированным нанослоями анилинсодержащих полимеров. Предложен многоканальный наконечник для выделения нуклеиновых кислот, белков, пептидов и способ изготовления многоканального элемента, входящего в состав многоканального наконечника.

Изобретение относится к области биотехнологии, вирусологии и иммунологии. В частности, настоящее изобретение относится к новому птичьему астровирусу; к антителам и их фрагментам, направленным против указанного нового вируса; к антигенным препаратам, белкам и ДНК-молекулам нового птичьего астровируса; к вакцинам на основе указанного нового вируса или к его антигенным препаратам, белку или ДНК; к способам получения таких вакцин и к диагностическим наборам.

Изобретение относится к области биотехнологии и вирусологии. Предложен способ получения вирусов гриппа А или В в культуре клеток, и композиция клеточной культуры для получения вирусов гриппа А или В.

Изобретение относится к области биотехнологии и вирусологии. Предложен способ получения вирусоподобных частиц вируса гриппа (ВПЧ) в растении или его части.

Изобретение относится к медицинской вирусологии и касается штамма вируса гриппа. Вакцинный штамм В/60/Массачусетс/2012/10 - реассортант, полученный путем скрещивания «дикого» вируса В/Массачусетс/2/2012 с холодоадаптированным температурочувствительным вирусом В/СССР/60/69 - донором аттенуации.
Изобретение относится к области ветеринарной вирусологии и касается перевиваемой гибридной сублинии клеток A4C2/9к SUS SCROFA. Представленная сублиния клеток A4C2/9к обладает высокой чувствительностью к вирусу АЧС.
Изобретение относится к медицинской вирусологии и касается штамма вируса гриппа. Вакцинный штамм А/17/Индиана/2011/72 (H3N2v) - реассортант, полученный путем скрещивания «дикого» вируса А/Индиана/10/2011 (H3N2v) с холодоадаптированным температурочувствительным вирусом А/Ленинград/13 4/17/57 (H2N2) - донором аттенуации.

Изобретение относится к медицинской вирусологии и касается вакцинного штамма вируса гриппа. Охарактеризованный штамм В/60/Висконсин/2010/125 - реассортант, полученный путем скрещивания эпидемического вируса В/Висконсин/1/2010 с холодоадаптированным температурочувствительным вирусом В/СССР/60/69 - донором аттенуации.
Изобретение относится к вирусологии и касается штамма вируса осповакцины. Предложенный штамм выделен из гомогената тканей легких морских свинок, инфицированных 7-м пассажем вируса осповакцины.

Представлены наборы олигонуклеотидных зондов и праймеров, биологический микрочип и тест-система для идентификации и типирования вируса гриппа А и В. Охарактеризованная тест-система содержит: набор реагентов для выделения РНК вируса гриппа из биологического материала человека; набор реагентов для проведения ПЦР-амплификации, совмещенной с обратной транскрипцией, с образованием флуоресцентно-меченных фрагментов генома вируса гриппа, содержащий описанные олигонуклеотиды-праймеры; набор реагентов для проведения гибридизации фрагментов ДНК, полученных после проведения амплификации на биочипе, содержащем элементы с иммобилизованными описанными олигонуклеотидными зондами; и при необходимости, отрицательный и положительный контрольные образцы.
Данное изобретение имеет отношение к таким композициям и фармацевтическим композициям, которые включают поксвирусы, и более конкретно, которые включают внеклеточные оболочечные вирусы. Данное изобретение также имеет отношение к такому способу, который предназначен для того, чтобы продуцировать поксвирусы, а также поксвирусы, полученные согласно этому изобретению. Кроме того, данное изобретение также имеет отношение к использованию указанного поксвируса и указанной композиции для приготовления лекарственного средства. 2 н. и 15 з.п. ф-лы, 3 ил.

Группа изобретений относится к области биотехнологии и касается синтетических олигонуклеотидных праймеров и способа их использования. Предложенный способ выявления и дифференциации генома вакцинного штамма В-82 от полевых изолятов вируса миксомы кроликов включает: выделение ДНК из биологического материала, постановку мультиплексной полимеразной цепной реакции с использованием синтезированных праймеров, комплементарных участкам генов M130R и M151R вируса миксомы кролика и имеющих следующий нуклеотидный состав:амплификацию ДНК вируса и оценку проведения реакции. Представленные изобретения могут быть использованы в ветеринарной вирусологии для выявления и дифференциации вакцинного штамма B-82 вируса миксомы кроликов от полевых изолятов. 2 н.п. ф-лы, 6 табл., 6 пр.

Наверх