Способ прогнозирования риска формирования гиперпластических процессов эндометрия

Изобретение относится к области медицины, а именно гинекологии, и может быть использовано для выявления риска развития гиперпластических процессов эндометрия у женщин русской национальности, уроженок Центрального Черноземья России. Выделяют ДНК из периферической венозной крови. Типируют методом полимеразной цепной реакции генетические полиморфизмы гена фактора некроза опухоли α (-308 G/А TNFα), рецептора фактора некроза опухоли 1 (+36 A/G TNFR1), интерферона индуцебельного хемоаттрактанта Т-клеток (А/G I-TAC), интерлейкина 1А (-889 С/Т IL-1A), лимфотаксина α (+250 А/G Ltα). Прогнозируют повышенный риск развития гиперпластических процессов эндометрия при выявлении сочетания аллелей -308 G TNFα, +36 A TNFR1, A I-TAC, -889 T IL-1A и/или сочетания аллелей+36 A TNFR1, A I-TAC, -889 T IL-1A и/или сочетания аллелей -308 G TNFα,+250 G Ltα, -889 T IL-1A. 2 ил., 1 табл., 1 пр.

 

Изобретение относится к области медицинской диагностики, а именно к гинекологии, и может быть использовано для прогнозирования риска развития гиперпластических процессов эндометрия (ГПЭ).

Эндометрий - это слизистая оболочка, выстилающая полость матки. Когда эта оболочка начинает избыточно разрастаться при нарушении гормональных процессов в организме женщины, говорят о гиперплазии эндометрия. Встречаются три вида гиперпластических процессов эндометрия:

- железисто-кистозная гиперплазия эндометрия (разрастание железистой ткани и появление в ней кист);

- железистые и железисто-кистозные полипы (полипы эндометрия - доброкачественные опухолевидные образования, растущие из стенки матки в ее просвет);

-атипическая гиперплазия - извращенное, нехарактерное разрастание ткани эндометрия (аденоматоз, аденоматозная гиперплазия) [Кипич Н.В. Значимость молекулярно-генетических и иммунных факторов в патогенезе и тактике ведения больных с гиперпластическими процессами эндометрия. //Автореф. дисс.к.м.н. - СПб., 2011. - 20 С.].

Гиперпластические процессы эндометрия возможны в любом возрасте, встречаются почти у каждой четвертой женщины с бесплодием и имеют разную степень проявлений, но их частота значительно возрастает к периоду перименопаузы. Распространенность гиперплазии эндометрия составляет 10-30%, полипов эндометрия - 0,5-35,7% [Лысенко О.В. Гиперпластические процессы эндометрия в различные возрастные периоды исследование цитокинового статуса и содержания SFAS -лиганда//Акушерство и гинекология. - 2011. - №4.- С.12-15].

Гиперпластические процессы эндометрия как возможная основа для формирования злокачественных опухолей в течение многих десятилетий представляют важную медико-социальную проблему. Частота озлокачествления гиперпластических процессов эндометрия колеблется в достаточно широких пределах (0,25-50%) и определяется морфологическими особенностями заболевания, длительностью его рецидивирования, а также возрастом пациенток. Простая гиперплазия эндометрия без атипии переходит в рак в 1% случаев, полиповидная форма без атипии - в 3 раза чаще.

Для клинической картины гиперплазии эндометрия характерны ановуляторные маточные кровотечения, возникающие, как правило, после задержки менструации. Кровотечение обычно бывает продолжительным, с умеренной кровопотерей или обильным, профузным. При гиперпластических процессах эндометрия (чаще при эндометриальных полипах) иногда появляются межменструальные кровянистые выделения [Максимов С.Я. Факторы риска возникновения злокачественных новообразований органов репродуктивной системы женщин//Вопросы онкологии.-2003. - Т.49, №3, - С.496 - 501].

Окончательное подтверждение диагноза ГПЭ возможно только после проведения гистероскопии с последующим гистологическим исследованием эндометрия. К сожалению, приходится констатировать, что ультразвуковая диагностика не всегда оказывается эффективной. В ряде случаев у пациенток с необъяснимым даже после проведения диагностической лапароскопии бесплодием ГПЭ, выявленная в процессе гистероскопического обследования, может оказаться единственной вероятной его причиной.

Патологическая трансформация эндометрия - сложный биологический процесс, затрагивающий все звенья нейрогуморальной регуляции организма женщины. Известно, что причиной развития ГПЭ могут быть дефекты овуляции, гиперэстрогения, дефицит прогестерона, нарушение процессов пролиферации и подавление апоптоза, а также изменение рецепторного фенотипа эндометрия. ГПЭ нередко возникает при эндометриозе, миоме и при хронических воспалительных процессах в эндометрии. В последние годы выявлена сложная система факторов, участвующих в клеточной регуляции, и расширены представления о межклеточном взаимодействии и внутриклеточных процессах в гормонозависимых тканях. Так, установлено, что в регуляции пролиферативной активности клеток эндометрия наряду с эстрогенами участвуют ряд биологически активных соединений (интерлейкины, факторы некроза опухоли, хемокины). В регуляции процессов тканевого гомеостаза и патогенезе пролиферативных заболеваний важная роль принадлежит не только усилению клеточной пролиферации, но и нарушению регуляции клеточной гибели (апоптоз). Резистентность клеток эндометрия к запрограммированной клеточной гибели (апоптозу) приводит к накоплению измененных и избыточно пролиферируюших клеток, что свойственно неопластическим изменениям эндометрия [Лысенко О.В. Гиперпластические процессы эндометрия в различные возрастные периоды, исследование цитокинового статуса и содержания SFAS-лиганда//Акушерство и гинекология. - 2011. - №4.- С.12-15].

Известен способ по патенту РФ №2466390, опубликованный 10.11.2012 г. по заявке на изобретение №2011105301/15 от 15.02.2011 г. «Способ прогнозирования развития рака тела матки при патологических процессах эндометрия у женщин репродуктивного возраста» (Сидорова И.С. Унанян А.Л. (RU), Власов Р.С. (RU) и др.), где предложен способ прогнозирования развития рака тела матки, включающий определение клинических признаков, выскабливание матки, гистологическое исследование, определение метилирования генов-супрессоров MLH1, RASSF1, GSTP1, р16, RAR-b, CDX1 опухолевого роста методом метил-чувствительной полимеразной цепной реакции (МЧ-ПЦР), расчет коэффициента вероятности развития рака тела матки. При величине р больше 0,6 прогнозируют высокую вероятность развития рака тела матки, при р, равном 0,3-0,59, - умеренную вероятность развития рака, при р ниже 0,29 - низкую вероятность развития рака.

Недостаток заключается в том, что он повышает точность прогнозирования развития рака тела матки при уже имеющихся патологических процессах эндометрия у женщин репродуктивного возраста, и не дает возможность спрогнозировать склонность пациенток к формированию изолированных гиперпластических процессов эндометрия.

Известен способ количественной морфологической оценки степени выраженности хронического эндометрита по патенту РФ №2475742, опубликованный 20.02.2013. Сущность способа состоит в том, что исследуют соскоб эндометрия. На гистологическом препарате оценивают в баллах наличие морфологических признаков хронического воспаления на преобладающей площади и на отдельных участках, в зависимости от их наличия и однородности. Сумма баллов, которая находится в диапазоне от 1 до 10 баллов, представляет собой количественную оценку степени выраженности хронического эндометрита. Сумма от 1 до 4-х баллов позволяет установить легкую степень выраженности хронического эндометрита. От 5 до 7 баллов - среднюю, от 8 до 10 - тяжелую. Недостатком является то, что способ может быть использован только путем исследования гистоморфологического исследования соскобов из полости матки.

Известен способ прогнозирования развития эндометриоза, приводящего к нарушению репродуктивной функции у девочек с альгоменореей по патенту РФ №2161311, опубликованный 27.12. 2000. Способ основан на исследовании ряда показателей иммунной системы и включает определение количества Т-лимфоцитов методом проточной цитометрии (с использованием цитометрической системы FACS Calibur фирмы Beckton Dickinson), определение концентрации иммуноглобулинов М (IgM) с помощью теста радиальной иммунодиффузии по Манчини, определение уровня циркулирующих иммунных комплексов (ЦИК) в сыворотке крови - методом выделения в полиэтиленгликоле с оценкой на спектрографе Multiscan фирмы Labsystems (длина волны 450 нм). Определение величины диагностического коэффициента F по формуле F=- K1 0,00793+K2 0,013 - K3 0,043+3,09, где K1 - показатель IgM, K2 - показатель ЦИК, K3 - показатель T-клеток (-CD3). Если F>0, то у пациента прогнозируют риск развития эндометриоза. Если F<0, то возникновение эндометриоза маловероятно. Предлагаемый способ дает вероятность правильного прогноза в 76% случаев.

Способ позволяет с учетом основных звеньев патогенеза эндометриоза прогнозировать развитие данного заболевания у девочек-подростков с альгоменореей и хроническими тазовыми болями, своевременно провести диагностику заболевания и рекомендовать патогенетически обоснованное лечение, что может повлиять на частоту тяжелых, запущенных форм эндометриоза и сопутствующего бесплодия.

Недостаток заключается в том, что он может быть использован только для прогноза развитие эндометриоза у девочек-подростков с альгоменореей и хроническими тазовыми болями, но не позволяет прогнозировать формирование изолированных гиперпластических процессов эндометрия.

Задачей настоящего исследования является расширение арсенала способов диагностики, а именно создание способа прогнозирования формирования изолированных гиперпластических процессов эндометрия у женщин русской национальности, уроженках Центрального Черноземья России, по сочетаниям генетических полиморфизмов: -308 G TNFα, +36 A TNFR1, A I-TAC, -889 T IL-1A и/или +36 A TNFR1, A I-TAC, -889 T IL-1A и/или -308 G TNFα, +250 G Ltα, -889 T IL-1A.

Технический результат использования изобретения - получение критериев оценки риска развития изолированных гиперпластических процессов эндометрия.

В соответствии с поставленной задачей был разработан способ прогнозирования формирования изолированных гиперпластических процессов эндометрия, включающий забор крови, выделение ДНК из периферической венозной крови, типирование генетических полиморфизмов методом полимеразной цепной реакции, при этом осуществляют типирование генетических полиморфизмов гена фактора некроза опухоли α (-308 G/А TNFα), рецептора фактора некроза опухоли 1 (+36 A/G TNFR1), интерферона индуцебельного хемоаттрактанта Т-клеток (А/G I-TAC), интерлейкина 1А (-889 С/Т IL-1A), лимфотаксина α (+250 А/G Ltα) и анализ сочетаний полиморфизмов гена фактора некроза опухоли α (-308 G TNFα), рецептора фактора некроза опухоли 1 (+36 A TNFR1), интерферона индуцебельного хемоаттрактанта Т-клеток (А I-TAC), интерлейкина

1А(-889 Т IL-1A), лимфотаксина α (+250 G Ltα), прогнозирование повышенного риска развития изолированных форм гиперпластических процессов эндометрия у больных в случае выявления сочетания аллелей -308 G TNFα 36 A TNFR1, A I-TAC, -889 T IL-1A и/или сочетания аллелей+36 A TNFR1, A I-TAC, -889 T IL-1A и/или сочетания аллелей -308 G TNFα,+250 G Ltα, -889 T IL-1A.

Новизна и изобретательский уровень заключается в том, что из уровня техники не известна возможность прогноза развития изолированных гиперпластических процессов эндометрия по наличию сочетаний аллеля -308 G гена фактора некроза опухоли α (полиморфизм -308 G TNFα), аллеля+36 A рецептора фактора некроза опухоли (полиморфизм+36 A TNFR1), аллеля А интерферона индуцебельного хемоаттрактанта Т-клеток (полиморфизм А I-TAC), аллеля -889 Т интерлейкина 1А (полиморфизм -889 Т IL-1A), аллеля+250 G лимфотаксина α (полиморфизм+250 G Ltα).

Изобретения характеризуют следующие графические изображения:

Фиг.1. Дискриминация аллелей по локусу G/A I-TAC (rs4512021) (где - гомозиготы GG, - гомозиготы AA, - гетерозиготы AG, - отрицательный контроль).

Фиг.2. Электрофоретическое разделение продуктов рестрикции гена -889 C/T IL-1А, где 2,3,4 - гомозиготы -889 ТТ; 5,6,10 - гомозиготы -889 СС; 1,7-9,11-14 -гетерозиготы -889 СТ.

Способ осуществляют следующим образом:

ДНК выделяют из образцов периферической венозной крови больных с изолированными гиперпластическими процессами эндометрия методом фенольно-хлороформной экстракции в 2 этапа. На первом этапе к 4 мл крови добавляют 25 мл лизирующего буфера, содержащего 320 мМ сахарозы, 1% тритон Х-100, 5 мМ MgCl2, 10 мМ трис-HCl (pH=7,6). Полученную смесь перемешивают и центрифугируют при 4ºС, 4000 об/мин в течение 20 минут. После центрифугирования надосадочную жидкость сливают, к осадку добавляют 4 мл раствора, содержащего 25 мМ ЭДТА (рН=8,0) и 75 мМ NaCl, ресуспензируют. Затем прибавляют 0,4 мл 10% SDS, 35 мкл протеиназы К (10 мг/мл) и инкубируют образец при 37ºС в течение 16 часов.

На втором этапе из полученного лизата последовательно проводят экстракцию ДНК равными объемами фенола, фенол-хлороформа (1:1) и хлороформа с центрифугированием при 4000 об/мин в течение 10 минут. После каждого центрифугирования производят отбор водной фазы. ДНК осаждают из раствора двумя объемами охлажденного 96% этанола. Сформированную ДНК растворяют в бидистиллированной, деионизованной воде и хранят при -200°С.

Выделенную ДНК затем подвергают полимеразной цепной реакции с использованием стандартных олигонуклеотидных праймеров (таблица 1).

Структура праймеров и зондов, используемых для генотипирования исследуемых ДНК-маркеров

Таблица 1

Ген и его полиморфизм Условия проведения ПЦР Структура праймеров и зондов Фермент рестрикции Литература
-308 G/A
TNFα
(rs 1800629)
95.0°C: 4.00m
54.0°С: 1.00m
95.0°C: 0.15m
F: 5'-GAAATGGAGGCAATAGGTTTTGAG-3'
R: 5'-GGCCACTGACTGATTTGTGTGTAG-3'
5'-FAM-CCGTCCTCATGCC- RTQ1-3'
5'-ROX-CCGTCCCCATGCC - RTQ1-3'
____ [Hulkkonen J., 2002]
+36 A/G TNFR1
(rs 767455)
95.0°C: 4.00m
59.0°С: 1.00m
95.0°C: 0.15m
F: 5'- AGCCCACTCTTCCCTTTGTC-3'
R: 5'-CCACCGTGCCTGACCTG-3'
5'- FAM: CTGCTGCCACTGGT-RTQ1-3'
5'- ROX: CTGCTGCCGCTGGT-BHQ2-3'
____ [Chae S. J.
et al., 2008]
A/G
I-TAC
(rs 4512021)
95.0°C: 4.00m
52.5°С: 1.00m
95.0°C: 0.15m
F: 5' - CAAAGACCTAAGGGAACTAGGTGATAG - 3'
R: 5' - GTGTCTTCCCAATGTGTGTTCCT - 3'
5' - FAM - ATGACTCTGGCTAGTC - RTQ1-3'
5' - ROX - AGCATGACTCCGGCTA-BHQ2-3'
____ [Derichs C., 2001]
-889 C/T
IL-1A
(rs 1800587)
95.0°C: 4.00m
94.0°С: 0.40m
60.0°C: 0.40m
72.0°С: 1.00m
5'-aagcttgttctaccacctgaactaggc-3'
5'-ttacatatgagccttccatg-3'
Bsp 19I [Trevilatto
et al., 2003]
+250 A/G
Lt α
(rs 909253)
95.0°C: 5.00m
56.3°С: 1.00m
95.0°C: 0.15m
F: 5'-CAG TCTCATTGTCTCTGTCACACATT-3'
R: 5'-ACAGAGAGAGACAGG AAGGGAACA-3'
5'-FAM:CCATGGTTCCTCTC-RTQ1-3'
5'-ROX:CTGCCATGATTCC-RTQ1-3'
____ [Sugiura S., 2002]

Молекулярно-генетический анализ проводят методом полимеразной цепной реакции синтеза ДНК. ПЦР осуществляют на амплификаторах IQ5 (BioRad) и ТП4-ПЦР-01-«ТЕРЦИК».

На амплификаторе IQ5 (Bio-Rad) проводят анализ полиморфизмов генов -308 G/А TNFα,+36 A/G TNFR1, А/G I-TAC,+250 А/G Ltα методом полимеразной цепной реакции синтеза ДНК с использованием стандартных олигонуклеотидных праймеров и специфических зондов с последующим анализом полиморфизма методом дискриминации аллелей. Реакционная смесь объемом 25 мкл включает: 6,7 мМ трис-HCl (pH=8,8), 2,5 мМ MgCl2, 0,1 мкг геномной ДНК, по 10 пМ каждого праймера, по 5 пкмоль каждого зонда, по 200 мкМ dATP, dGTP, dCTP, dTTP и 1 единицу активной Taq-полимеразы. После денатурации выполняют 40 циклов амплификации по схеме: отжиг праймеров и денатурация.

На амплификаторе ТП4-ПЦР-01-«ТЕРЦИК» проводят анализ полиморфизма гена -889 С/Т IL-1A методом полимеразной цепной реакции синтеза ДНК с использованием стандартных олигонуклеотидных праймеров по методике, указанной в работе [Hulkkonen, J.Inflammotory cytokines and cytokine gene polymorphisms in chronic lymphocytic leukaemia, in primary Sjögren's Syndrome and Haelthy Subjects: [acad. diss.] /J. Hulkkonen; University of Tampere, Medical School Tampere University Hospital. - Tampere, 2002. - 81 р.].

Реакцию проводят в 12,5 мкл общего объема смеси, содержащей 33,5 мМ трис-HCl (pH=8,8), 1,25 мМ MgCl2, 0,5 мкг геномной ДНК, по 5 пМ каждого праймера, по 100 мкМ dATP, dGTP, dCTP, dTTP и 1 единицу активной Taq-полимеразы. После денатурации выполняют 32 цикла амплификации по схеме: денатурация, отжиг праймеров и элонгация. Затем пробы выдерживают 5 мин при 72°С и охлаждают. Продукты амплификации анализируют в 2%-ном агарозном геле, окрашенным бромистым этидием, в течение 30 минут при 160V. В качестве электрофорезного буфера используют 1хТАЕ (трис-ацетатный буфер). Затем пробы идентифицируют в проходящем УФ-свете.

Генотипирование осуществляют методом дискриминации аллелей с использованием Tag Man зондов. При проведении ПЦР в амплификаторе с флюоресцентной детекцией (амплификатор IQ5) генотипирование осуществляют методом Tag Man зондов по данным величин ОЕФ (относительная единица флуоресценции) каждого зонда.

Две полосы, вертикальная и горизонтальная, делят график на четыре секции: одна для каждого гомозиготного состояния, одна для гетерозиготного состояния и секция без реакции. Присвоение генотипов неизвестным образцам определяют вычерчиванием ОЕФ для одного флуорофора на оси x относительно ОЕФ для другого флуорофора на оси y на диаграмме дискриминации аллелей.

• Если значения ОЕФ неизвестного образца находятся выше горизонтальной полосы и правее вертикальной полосы, генотип гетерозиготен (GA).

• Если значения ОЕФ неизвестного образца находятся выше горизонтальной полосы и левее вертикальной полосы, генотип гомозиготен по аллелю 2 (ОЕФ аллеля 2 отложены по оси y).

• Если значения ОЕФ неизвестного образца находятся ниже горизонтальной полосы и правее вертикальной, генотип гомозиготен по аллелю 1 (RFU аллеля 1 отложены по оси x).

• Если значения ОЕФ неизвестного образца находятся ниже горизонтальной полосы и левее вертикальной, то определение генотипа невозможно, в данном случае неопределенный образец - отрицательный контроль.

Генотипирование ДНК-маркеров (локус -889 С/Т IL-1A) производят методом анализа полиморфизма длин рестрикционных фрагментов (ПДРФ) продуктов ПЦР-амплификации специфических участков генома с использованием соответствующих ферментов рестрикции производства фирмы «Сибэнзим» (Новосибирск).

После инкубации рестрикционной смеси в течение 16 часов при температуре 37°С проводят разделение фрагментов ДНК с помощью горизонтального электрофореза на электрофоретических ячейках производства фирмы «Хеликон» (Россия). В зависимости от размера разделяемых фрагментов ДНК используют агарозный гель 2-3% концентрации, приготовленный на основе ТВЕ-буфера, окрашенный раствором бромистого этидия (0,01%). Визуализацию фореграмм осуществляют в темном боксе с трансиллюминатором фирмы UVP (Швеция).

Формирование базы данных и статистические расчеты осуществляют с использованием программы «STATISTICA 6.0» [Боровиков, В. Statistica: искусство анализа данных на компьютере /В. Боровиков. - 2-е изд. - СПб.: Питер, 2003. - 688 с.: ил. - (Для профессионалов)].

Изучение роли комбинаций генетических вариантов полиморфных маркеров генов интерлейкинов в формирование изолированной миомы матки проведено с помощью программного обеспечения APSampler [http:sources.redhat.com/cygwin/], использующего метод Монте-Карло марковских цепей и байесовскую непараметрическую статистику [Favorov A. V. A Gibbs sampler for identification of symmetrically structured, spaced DNA motifs with improved estimation of the signal length /A. V. Favorov, M. S. Gelfand, A. V. Gerasimova [et al.] //Вioinformatics. - 2005. - Vol.21, №10. - Р. 2240-2245].

Оценку уровня статистической значимости полученных результатов проводят с использованием поправки Бонферрони (рcor), т.е. поправки, минимизирующей вероятность получения ложноположительных результатов [Реброва О.Ю. Статистический анализ медицинских данных. https://sites.google.com/site/oyurebrova/book" \t "_blank /О.Ю. Реброва//М., МедиаСфера. - 2006 г. - 312 с.].

Возможность использования предложенного способа для оценки риска развития изолированных гиперпластических процессов эндометрия подтверждает анализ результатов наблюдений 713 больных с различными пролиферативными процессами репродуктивной системы, включающими миому матки, эндометриоз, гиперпластические процессы эндометрия и группы популяционного контроля из 500 человек. Среди 713 обследуемых у 150 женщин наблюдались гиперпластические процессы эндометрия. Пациенты включались в соответствующую группу больных только после установления диагноза заболевания, подтвержденного с помощью клинических, лабораторно-инструментальных методов обследования и подтвержденного результата гистологического исследования.

В исследуемые группы включались индивидуумы русской национальности, являющиеся уроженцами Центрального Черноземья России и не имеющие родства между собой.

Установлено, что сочетание молекулярно-генетических маркеров -308 G TNFα,+36 A TNFR1, A I-TAC, -889 T IL-1A встречается у 41,86% пациенток, что в 2 раза чаще, чем в контрольной группе (20,92%, р=0,000005, pcor=0,01, OR=2,72 95%CI 1,76 - 4,18). Также у больных с изолированными гиперпластическими процессами эндометрия встречается комбинация генетических вариантов +36 A TNFR1, A I-TAC, -889 T IL-1A (42,64%) в 1,9 раза чаще по сравнению с контролем (22,25%, р=0,0000008, pcor=0,02, OR=2,59, 95%CI 1,70 - 3,95). Сочетание трех генетических маркеров -308 G TNFα,+250 G Ltα, -889 T IL-1A (14,81%) в данной группе существенно чаще (в 4,5 раза) встречается, чем в контрольной группе (3,28%, р=0,000001, pcor=0,02, OR=5,12, 95%CI 2,47 - 10,61).

Конкретный пример.

Пациентке Х. русской национальности, уроженке Центрального Черноземья России, был проведен забор периферической венозной крови, выделение ДНК из периферической венозной крови; методом полимеразной цепной реакции типирование генетических полиморфизмов гена фактора некроза опухоли α (-308 G/А TNFα), рецептора фактора некроза опухоли 1 (+36 A/G TNFR1), интерферона индуцебельного хемоаттрактанта Т-клеток (А/G I-TAC), интерлейкина 1А (-889 С/Т IL-1A), лимфотаксина α (+250 А/G Ltα) и анализ сочетаний полиморфизмов гена фактора некроза опухоли α (-308 G TNFα), рецептора фактора некроза опухоли 1 (+36 A TNFR1), интерферона индуцебельного хемоаттрактанта Т-клеток (А I-TAC), интерлейкина 1А (-889 Т IL-1A), лимфотаксина α (+250 G Ltα). Результаты представлены на фигурах 1 и 2.

Выявлено, что в связи с наличием сочетания аллелей -308 G TNFα, +36 A TNFR1, A I-TAC, -889 T IL-1A и сочетания аллелей+36 A TNFR1, A I-TAC, -889 T IL-1A, женщину можно отнести в группу риска вероятности возникновения изолированных гиперпластических процессов эндометрия с целью предотвращения развития клинических проявлений, а также с целью их ранней диагностики для снижения частоты оперативного вмешательства и улучшения качества жизни женщины.

Таким образом, полученные данные свидетельствуют о том, что сочетания аллелей -308 G TNFα,+36 A TNFR1, A I-TAC, -889 T IL-1A, аллелей+36 A TNFR1, A I-TAC, -889 T IL-1A, а так же аллелей -308 G TNFα,+250 G Ltα, -889 T IL-1A являются факторами риска развития гиперпластических процессов эндометрия (OR=2,72, OR=2,59 и OR=5,12, соответственно) у женщин русской национальности, уроженках Центрального Черноземья России.

Применение данного способа позволит сформировать среди женщин русской национальности, уроженках Центрального Черноземья России, группу пациенток с повышенным риском развития гиперпластических процессов эндометрия для обязательного динамического ультразвукового исследования с целью контроля за состоянием эндометрия, проведением гистоморфологического исследования содержимого полости матки, с последующим выбором мер профилактики, наблюдением и медикаментозным лечением у врача-специалиста. При раннем выявлении и правильном дифференцированном подходе к ведению больных с гиперпластическими процессами эндометрия предоставится возможность предотвратить озлакочествление гиперпластических процессов эндометрия.

Способ прогнозирования риска развития гиперпластических процессов эндометрия у женщин русской национальности, уроженках Центрального Черноземья России, включающий выделение ДНК из периферической венозной крови, типирование методом полимеразной цепной реакции генетических полиморфизмов гена фактора некроза опухоли α (-308 G/А TNFα), рецептора фактора некроза опухоли 1 (+36 A/G TNFR1), интерферона индуцебельного хемоаттрактанта Т-клеток (А/G I-TAC), интерлейкина 1А (-889 С/Т IL-1A), лимфотаксина α (+250 А/G Ltα), и прогнозирование повышенного риска развития гиперпластических процессов эндометрия при выявлении сочетания аллелей -308 G TNFα, +36 A TNFR1, A I-TAC, -889 T IL-1A и/или сочетания аллелей+36 A TNFR1, A I-TAC, -889 T IL-1A и/или сочетания аллелей -308 G TNFα,+250 G Ltα, -889 T IL-1A.



 

Похожие патенты:

Изобретение относится к медицине и может быть использовано для определения целесообразности проведения иммунологического обследования у работников животноводства.

Изобретение относится к медицине, а именно к гинекологии, и может быть использовано для прогнозирования риска развития сочетания пролиферативных заболеваний репродуктивной системы у женщин русской национальности, являющихся уроженками Центрального Черноземья России.

Изобретение относится к области медицины и касается способа прогнозирования уровня артериального давления у женщин русской национальности, являющихся уроженками Центрально-Черноземного региона России.
Изобретение относится к иммунологии и медицинской диагностике и представляет собой способ иммунохроматографического анализа. В основе способа лежит контакт мембранной тест-полоски с анализируемой жидкой пробой и инициируемое этим контактом движение по мембранам тест-полоски реагентов, которые содержатся в пробе или нанесены на мембрану и в ходе взаимодействий в порах мембраны или на ее поверхности формируют детектируемые иммунные комплексы.

Изобретение относится к области медицины, в частности гепатологии и инфекционным болезням, и может использоваться для определения стадии фиброзного процесса при мониторинге больных хроническим гепатитом C.
Изобретение относится к медицине, а именно к способу прогнозирования спонтанного наступления беременности у женщин с I и II стадией наружного генитального эндометриоза.

Изобретение относится к медицине, в частности к области медицинской диагностики, и описывает способ прогноза эффективности биоуправления параметрами вариабельности сердечного ритма с учетом уровня интерлейкина-6 в периферической крови.

Изобретение относится к области биотехнологии и иммунологии. Описано антитело, которое специфически связывает денатурированный CD70.

Группа изобретений относится к медицине, а именно к иммунологии, и может быть использована для определения еx-vivo эффективности лечения рака. Для этого после введения одной или более доз иммуногенной композиции субъекту измеряют уровень активированных Т-лимфоцитов (CD3+ CD69+) в организме.

Изобретение относится к иммунологии и представляет собой способ определения нейтрализующей активности антител к иммуноглобулину Е, который заключается в связывании исследуемых антител с IgE человека в растворе с последующим инкубированием данного раствора с периферической кровью человека, индукцией дегрануляции клеток и последующим определением доли клеток с высоким уровнем экспрессии поверхностного маркера CD63 (CD63high) в популяции базофилов с фенотипом CD123+HLA-DR-.
Изобретение относится к медицине, а именно к иммунологии, и может быть использовано для определения иммуно-функционального резерва организма. Для этого определяют лейкоцитарные показатели периферической крови до и после нагрузочной пробы, используя ступенчатую субмаксимальную физическую нагрузку. Проводят дифференцированное выделение различных типов лейкоцитов из крови с получением препарата, определяют уровень общих Т-клеток (То) и активных Т-клеток (Та), рассчитывают индекс То/Та, мононуклеарные клетки инкубируют с гранулоцитами, оценивают индекс гранулоцитосвязывающих лимфоцитов (ИГЛ) по соотношению гранулоциторозеткообразующих (ГРЛ - контактно связанных с тремя гранулоцитами) и гранулоцитоконтактных лимфоцитов (ГЦЛ - контактно связанных с одним гранулоцитом) в препарате, определяют лейкоцитарные индексы: лимфоцитарный индекс (ЛИ), индекс иммунореактивности (ИИР), индекс адаптации, (СПНР), определяют коэффициенты адаптации иммуно-функционального состояния (К) для каждого показателя. Находят суммарный показатель иммуно-функционального состояния организма СПИФСО по формуле СПИФСО=Кспнр+Кли+Киир+Кигл+Китл до нагрузки - СПИФСО1 и после нагрузки - СПИФСО2. Рассчитывают удельный коэффициент иммуно-функционального резерва УКИФ по формуле УКИФ=(СПИФСО1+СПИФСО2)/5 и определяют уровень иммуно-функционального резерва УКИФ. При значениях УКИФ выше +1,0 считают уровень иммуно-функционального резерва оптимальным, при значениях УКИФ от 0 до 1,0 - удовлетворительным, при значениях УКИФ ниже 0 - неудовлетворительным. Данный способ позволяет оценить функциональные резервы организма, используя совокупную характеристику, включающую адаптационный потенциал организма (СПНР, ЛИ), иммунореактивность (ИИР, ИТЛ) и взаимодействие иммунных клеток между собой - лимфоцитов и гранулоцитов. 1 пр.

Настоящее изобретение относится к медицине, а именно к иммунологии, и может быть использовано для обнаружения контаминантов полимеров глюкозы. Для этого проводят анализ воспалительного ответа in vitro с применением клеточной линии, которая представляет собой клеточную линию либо макрофагов, либо дифференцируемую в макрофаги, либо клетку, экспрессирующую один или несколько толл-подобных рецепторов (TLR) или NOD-подобных рецепторов, выбранных из TLR2, TLR4 и NOD2. Анализ содержит этапы: (a) размещение макрофагов в присутствии препарата полимеров глюкозы, которые могут содержать провоспалительные контаминанты, и измерение продуцирования цитокина RANTES, причем продуцирование цитокина RANTES указывает на то, что препарат содержит контаминанты, способные к инициации воспалительной реакции, и (b) размещение клеточной линии, которая позволяет обнаружить активность рецептора врожденного иммунитета или нескольких рецепторов врожденного иммунитета, выбранных из TLR2 и NOD2, в присутствии препарата и обнаружение сигнала репортерного гена, связанного с этим рецептором, причем обнаружение данной активности или данного сигнала указывает на присутствие в препарате контаминанта, который представляет собой агонист рецептора. Использование данного способа позволяет обнаружить контаминанты полимеров глюкозы, причем добавление компонентов, таких как MDP или LPS, в тестируемый образец позволяет действовать синергично с контаминантами, что повышает чувствительность и понижает порог обнаружения, при этом синергитический ответ отмечен для RANTES. 27 з.п. ф-лы, 5 пр., 23 ил., 5 табл.
Изобретение относится к области медицины, а именно к гинекологии, и касается способа прогнозирования развития гиперплазии эндометрия у пациенток с миомой матки после проведения эмболизации маточных артерий (ЭМА). Сущность способа: до ЭМА всем пациенткам проводят лечебно-диагностическое выскабливание, через 6 мес после ЭМА проводят пайпель-биопсию эндометрия с последующим патоморфологическим исследованием биоптата. При отсутствии патологии биоптаты подвергают иммуногистохимическому исследованию с использованием моноклональных антител к Ki-67, определяют процентное содержание маркера пролиферации Ki-67 в эпителии желез эндометрия - коэффициент А и в строме эндометрия - коэффициент В и вычисляют прогностический индекс Д1 - при исходной (до ЭМА) гиперплазии без атипии и Д2 - при исходном (до ЭМА) эндометрии, соответствующем фазе поздней пролиферации: Д1=А*0.05-0.74 и Д2=В*0,02-0,3. При Д1, более или равном 0, прогнозируют рецидив гиперплазии эндометрия, а при Д1 менее 0 делают заключение о низком риске рецидива гиперплазии эндометрия. При Д2 более 0 судят о низком риске развития гиперплазии эндометрия, а при Д2, менее или равном 0, прогнозируют развитие гиперплазии эндометрия. Предлагаемый способ позволяет с высокой точностью прогнозировать развитие гиперплазии эндометрия после ЭМА, что дает возможность своевременно назначить превентивную гормональную терапию. 4 пр.
Изобретение относится к медицине, а именно к педиатрии, и может быть использовано для прогнозирования риска снижения уровня здоровья ребенка в возрасте 12-16 лет. Для этого через час после еды полость рта за 15 минут до забора ротовой жидкости промывается раствором натрия хлорида 0,9%. Проводится исследование ротовой жидкости ребенка с определением отношения концентрации иммуноглобулина А к концентрации иммуноглобулина G. Исследование проводится двукратно с разницей в 14 дней. В случае снижения отношения концентрации иммуноглобулина А к концентрации иммуноглобулина G при втором исследовании в 1,4 раза и более ребенка относят в группу риска снижения уровня здоровья. Использование данного способа позволяет проводить скрининг при проведении диспансеризации для планирования оздоровительных мероприятий в группах диспансерного наблюдения. 2 пр.
Изобретение относится к медицине, а именно к гемотрансфузиологии, и может быть использовано при отборе доноров, для получения плазмы крови. Для этого получают плазму крови, выявляют в ней антимикробные пептиды дефензины. При титре дефензинов у мужчин от 180 до 545 нг/мл и у женщин - от 128 до 386 нг/мл отбирают донора для получения плазмы крови. Изобретение позволяет использовать донорскую плазму при лечении пациентов с инфекционными заболеваниями и осложнениями после оперативных вмешательств, травм и ожогов.

Изобретение относится к медицине, а именно к инфекционным болезням, и может использоваться для прогнозирования устойчивого вирусологического ответа при проведении противовирусной терапии у больных с гепатитом C на фоне ВИЧ-инфекции. Для этого у коинфицированных пациентов оценивается динамика иммунологических маркеров интерферона α (ИФНα), интерферона γ (ИФНγ) и интерлейкина 4 (ИЛ-4) и их мониторинг до начала терапии и через 4 недели после начала терапии. При этом стабильная ремиссия прогнозируется при начальных уровнях цитокинов более 3,99 пг/мл для ИФНα, от 8,32 до 13,1 пг/мл для ИФНγ, при значении коэффициента ИФНγ/ИЛ-4 более 6,72, а также при увеличении уровня ИФНα в 100 раз и более через 4 недели от начала терапии, уровне ИФНγ от 8,32 до 13,1 пг/мл и увеличении коэффициента ИФНγ/ИЛ-4 в процессе терапии более 6,72. Использование данного способа позволяет на начальном этапе лечения прогнозировать исход противовирусной терапии у ВИЧ-инфицированных пациентов. 2 пр., 4 табл., 3 ил.
Изобретение относится к медицине, а именно к акушерству, и может быть использовано для прогнозирования плацентарной недостаточности у женщин I триместра с угрозой невынашивания беременности инфекционного генеза. Для этого с 6 недель гестации в сыворотке венозной крови беременных определяют содержание IL-18, и при его значении более 100 пг/мл прогнозируют развитие плацентарной недостаточности во второй половине беременности. Способ позволяет с высокой точностью прогнозировать развитие плацентарной недостаточности во второй половине беременности у женщин с угрозой невынашивания инфекционного генеза на ранних стадиях при его простоте, доступности и экономичности. 1 табл., 3 пр.
Изобретение относится к области медицины, а именно к пульмонологии, и может быть использовано при лабораторной диагностике пневмонии. Способ лабораторной диагностики пневмонии заключается в том, что исследуют уровень сурфактантного белка А и/или сурфактантного белка D в сыворотке крови методом иммуноферментного анализа (ИФА), и при значении уровня сурфактантного белка А более 49,56 ng/ml или уровня сурфактантного белка D более 234,39 ng/ml диагностируют пневмонию. Данный способ не травматичен и позволяет своевременно диагностировать пневмонию. 4 пр.

Изобретение относится к медицине, а именно к гинекологии, и позволяет сформировать группу женщин русской национальности, являющихся уроженками Центрального Черноземья России, с повышенным риском развития изолированного эндометриоза. Для этого проводят выделение ДНК из периферической венозной крови, типирование и анализ комбинаций генетических вариантов полиморфных маркеров генов цитокинов интерлейкина 6 (-174 G/C IL-6), интерлейкина 1B (-511 С/Т IL-1B), интерлейкина 10 (-592 С/А IL-10), генов хемокинов фактора стромальных клеток (-801 G/A SDF1), макрофагального воспалительного протеина -1β (+1931 А/Т MIP 1β), регулятора активности нормальной экспрессии и секреции Т-клеток (-403 G/A RANTES), интерферона индуцебельного хемоаттрактанта Т-клеток (A/G I-TAC). Повышенный риск развития изолированного эндометриоза прогнозируют при выявлении комбинаций сочетания аллелей -174 С IL-6, -801 A SDF1, +1931 A MIP1β, -592 С IL-10, аллелей -801 A SDF1, -403 G RANTES, +1931 A MIP1β, -592 С IL-10, аллелей -801 A SDF1, -403 G RANTES, -511 С IL-1B, -592 С IL-10, аллелей -801 A SDF1, +1931 A MIP1β, -592 С IL-10, аллелей -174 С IL-6, -801 A SDF1, -403 G RANTES, -592 С IL-10, аллелей -801 A SDF1, А I-TAC, -511 СС IL-1B. Изобретение обеспечивает простой неинвазивный метод диагностики эндометриоза, что повышает риск рецидива заболевания после прекращения любого метода терапии как консервативного, так и хирургического. 5 ил., 1 табл., 1 пр.

Изобретение относится к медицине и описывает хемилюминесцентный реактив для определения присутствия и/или количества анализируемого вещества в образце с предполагаемым содержанием анализируемого вещества, при этом реактив является недисперсным и растворимым в водной среде и содержит партнера по связыванию для анализируемого вещества и хемилюминесцентную композицию, содержащую олефиновое соединение и хелат металла, где олефиновое соединение является соединением, которое способно реагировать с синглетным кислородом присоединением 2+2 с образованием диоксетана или которое способно реагировать с синглетным кислородом с циклоприсоединением 4+2 с диенами, и где металл или хелат металла представляет собой редкоземельный металл или металл Группы VIII, и где металл координирован с двумя или более атомами той же молекулы или хелирующего агента, где два или более атомов выбраны из группы, состоящей из кислорода, азота и серы. 2 н. и 19 з.п. ф-лы, 5 ил., 11 пр.

Изобретение относится к области медицины, а именно гинекологии, и может быть использовано для выявления риска развития гиперпластических процессов эндометрия у женщин русской национальности, уроженок Центрального Черноземья России. Выделяют ДНК из периферической венозной крови. Типируют методом полимеразной цепной реакции генетические полиморфизмы гена фактора некроза опухоли α, рецептора фактора некроза опухоли 1, интерферона индуцебельного хемоаттрактанта Т-клеток, интерлейкина 1А, лимфотаксина α. Прогнозируют повышенный риск развития гиперпластических процессов эндометрия при выявлении сочетания аллелей -308 G TNFα, +36 A TNFR1, A I-TAC, -889 T IL-1A иили сочетания аллелей+36 A TNFR1, A I-TAC, -889 T IL-1A иили сочетания аллелей -308 G TNFα,+250 G Ltα, -889 T IL-1A. 2 ил., 1 табл., 1 пр.

Наверх