Конъюгаты олигонуклеотидов



Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
Конъюгаты олигонуклеотидов
C12N2310/11 - Микроорганизмы или ферменты; их композиции (биоциды, репелленты или аттрактанты или регуляторы роста растений, содержащие микроорганизмы, вирусы, микробные грибки, ферменты, агенты брожения или вещества, получаемые или экстрагируемые из микроорганизмов или из материала животного происхождения A01N 63/00; пищевые составы A21,A23; лекарственные препараты A61K; химические аспекты или использование материалов для бандажей, перевязочных средств, впитывающих подкладок или хирургических приспособлений A61L; удобрения C05); размножение, консервирование или сохранение микроорганизмов (консервирование живых тканей или органов людей или животных A01N 1/02); мутации или генная инженерия; питательные среды (среды для микробиологических испытаний C12Q)
C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2653438:

РОШ ИННОВЕЙШЕН СЕНТЕР КОПЕНГАГЕН А/С (DK)

Настоящее изобретение относится к области биотехнологии, конкретно к конъюгату антисмыслового олигомера, и может быть использовано в медицине. Изобретение направлено на получение конструкции, позволяющей улучшить терапевтический индекс представляющего интерес антисмыслового олигонуклеотида и его высвобождение в клетках вследствие конъюгации олигонуклеотида с расщепляемой фосфодиэфирной областью и направляющей группой, способствующей доставке полученного конструкта в нужное место в клетке и обеспечивающей направленный захват действующего антисмыслового олигомера целевыми клетками. 3 н. и 18 з.п. ф-лы, 25 ил., 19 табл., 11 пр.

 

Область изобретения

Изобретение относится к области олигонуклеотидных терапевтических средств и, в частности, к применению конъюгата, направляющей группы или блокирующей группы для улучшения свойств олигонуклеотидов, например, для улучшения терапевтического индекса.

Родственные заявки

Эта заявка претендует на приоритет заявок ЕР 12192773.5, ЕР 13153296.2, ЕР 13157237.2 и ЕР 13174092.0, которые включены в данный документ посредством ссылки.

Уровень техники

Конъюгаты олигонуклеотидов были тщательно изучены для применения в siРНК (киРНК), где они рассматриваются как необходимые для получения достаточной эффективности in vivo. Например, WO 2004/044141 относится к модифицированным олигомерным соединениям, которые модулируют экспрессию гена с помощью пути РНК-интерференции (РНК-интерференции). Олигомерные соединения включают одну или более чем одну конъюгационную группировку, которая может модифицировать или усиливать фармакокинетические и фармакодинамические свойства присоединенного олигомерного соединения.

Напротив, одноцепочечные антисмысловые олигонуклеотиды, как правило, вводят терапевтически без конъюгации или состава. Основными тканями-мишенями для антисмысловых олигонуклеотидов являются печень и почки, хотя для антисмысловой модальности также доступен широкий диапазон других тканей, в том числе лимфатические узлы, селезенка, костный мозг.

WO 2008/113832 раскрывает фосфоротиоатные гэпмерные LNA-олигонуклеотиды (locked nucleic acid; закрытая нуклеиновая кислота, ЗНК), где фланкирующие области содержат по меньшей мере одну фосфодиэфирную связь между или смежно с LNA-нуклеозидом. Олигомеры преимущественно нацелены на почки.

WO 2004/087931 относится к олигонуклеотидам, содержащим расщепляемый в кислой среде гидрофильный полимерный (PEG) конъюгат.

WO 2005/086775 относится к адресной доставке терапевтических агентов к определенным органам с помощью терапевтической химической группировки, расщепляемого линкера и меченого домена. Расщепляемый линкер может быть, например, дисульфидной группой, пептидом или олигонуклеотидным доменом, расщепляемым рестрикционным ферментом.

WO 2009/126933 относится к специфической доставке нуклеиновых кислот siРНК путем объединения направляющих лигандов с эндосомолитическими компонентами.

WO 2011/126937 относится к целевой внутриклеточной доставке олигонуклеотидов через конъюгацию с низкомолекулярными лигандами.

WO 2009/025669 относится к полимерным (полиэтиленгликолевым) линкерам, содержащим пиридилдисульфидные группировки. См. также Zhao et al., Bioconjugate Chem. 2005 16 758-766.

В Chaltin et al., Bioconjugate Chem. 2005 16 827-836 сообщается о холестерин-модифицированных моно-, ди- и тетрамерных олигонуклеотидах, используемых для включения антисмысловых олигонуклеотидов в катионные липосомы, чтобы получать дендримерные системы доставки. Холестерин конъюгирован с олигонуклеотидами через лизиновый линкер.

Другие нерасщепляемые конъюгаты холестерина были использованы для доставки siРНК и антагомиров в печень - см., например, Soutscheck et al., Nature 2004 vol. 432 173-178 и et al., Nature 2005 vol 438, 685-689. Для частично фосфорилированных siРНК и антагомиров было установлено, что применение холестерина в качестве объекта, нацеленного на печень, имеет важное значение для активности in vivo.

Данное изобретение основано на открытии того, что весьма эффективная адресная доставка олигонуклеотидов достигается за счет применения устройства наведения, связанного с олигонуклеотидом посредством короткой области лабильных к нуклеазам нуклеозидов, таких как связанные фосфодиэфирными связями ДНК- или РНК-нуклеозиды.

Сущность изобретения

Данное изобретение предлагает олигомерное соединение, содержащее три области:

i) первую область (область А), которая содержит 7-26 последовательных нуклеотидов;

ii) вторую область (область В), которая содержит 1-10 нуклеотидов, ковалентно связанную с 5'- или 3'-нуклеотидом первой области, например через межнуклеозидную связывающую группу, такую как фосфодиэфирная связь, где или

a. межнуклеозидная связь между первой и второй областями является фосфодиэфирной связью, а нуклеозид второй области, примыкающий (например, непосредственно) к первой области, представляет собой либо ДНК, либо РНК; и/или

b. по меньшей мере один нуклеозид второй области является ДНК- или РНК-нуклеозидом, связанным фосфодиэфирной связью;

iii) третью область (С), которая содержит конъюгационную группировку, направляющую группировку, реакционноспособную группу, активационную группу или блокирующую группировку, где третья область ковалентно связана со второй областью.

В некоторых воплощениях область А и область В формируют единую непрерывную нуклеотидную последовательность длиной 8-35 нуклеотидов.

В некоторых аспектах межнуклеозидная связь между первой и второй областями может рассматриваться как часть второй области.

В некоторых воплощениях между второй и третьей областями есть фосфорсодержащая связывающая группа. Фосфорсодержащая связывающая группа, может, например, представлять собой фосфатную (фосфодиэфирную), фосфоротиоатную, фосфородитиоатную или боранофосфатную группу. В некоторых воплощениях эта фосфорсодержащая связывающая группа расположена между второй областью и линкерной областью, которая присоединена к третьей области. В некоторых воплощениях фосфатная группа является фосфодиэфирной.

Таким образом, в некоторых аспектах олигомерное соединение содержит по меньшей мере две фосфодиэфирные группы, где по меньшей мере одна соответствует приведенной выше сущности изобретении, а другая расположена между второй и третьей областями, возможно, между линкерной группой и второй областью.

В некоторых воплощениях третья область представляет собой активационную группу, такую как активационная группа для применения в конъюгации. В этом отношении изобретение также предусматривает активированные олигомеры, содержащие область А и В и активационную группу, например промежуточный продукт, который подходит для последующего связывания с третьей областью, например, который подходит для конъюгации.

В некоторых воплощениях третья область является реакционноспособной группой, например, реакционноспособной группой для применения в конъюгации. В этом отношении изобретение также предусматривает олигомеры, содержащие область А и В и реакционноспособную группу, например промежуточный продукт, который подходит для последующего связывания с третьей областью, например, который подходит для конъюгации. Реакционноспособная группа может в некоторых воплощениях включать амин спиртовой группы, например аминогруппу.

В некоторых воплощениях область А содержит по меньшей мере одну, например, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 или 24 межнуклеозидные связи, отличные от фосфодиэфирной, такие как межнуклеозидные связи, которые (возможно, независимо) выбраны из группы, состоящей из фосфоротиоатной, фосфородитиоатной, боранофосфатной и метилфосфонатной, например фосфоротиоатной. В некоторых воплощениях область А содержит по меньшей мере одну фосфоротиоатную связь. В некоторых воплощениях по меньшей мере 50%, например по меньшей мере 75%, например по меньшей мере 90% межнуклеозидных связей, например, все межнуклеозидные связи в пределах области А, отличны от фосфодиэфирной, например, являются фосфоротиоатными связями. В некоторых воплощениях все межнуклеозидные связи в области А отличны от фосфодиэфирной.

В некоторых воплощениях олигомерное соединение содержит антисмысловой олигонуклеотид, например, конъюгат антисмыслового олигонуклеотида. Антисмысловой олигонуклеотид может быть или может содержать первую область и, возможно, вторую область. В этом отношении в некоторых воплощениях область В может формировать часть непрерывной нуклеотидной последовательности, которая комплементарна (нуклеиново-кислотной) мишени. В других воплощениях в области В может отсутствовать комплементарность к мишени.

Иначе говоря, в некоторых воплощениях данное изобретение предусматривает олигонуклеотид, связанный нефосфодиэфирными связями, например, связанный фосфоротиоатными связями, (например, антисмысловой олигонуклеотид), который имеет по меньшей мере один концевой (5' и/или 3') ДНК- или РНК-нуклеозид, связанный со смежным нуклеозидом олигонуклеотида через фосфодиэфирную связь, где концевой ДНК- или РНК-нуклеозид также ковалентно связан с конъюгационной группировкой, направляющей группировкой или блокирующей группировкой, возможно, через линкерную группировку.

Данное изобретение предусматривает фармацевтическую композицию, содержащую олигомерное соединение согласно данному изобретению и фармацевтически приемлемый разбавитель, носитель, соль или адъювант.

Изобретение предусматривает олигомерное соединение согласно данному изобретению для применения в ингибировании нуклеиновой кислоты-мишени в клетке. В некоторых воплощениях применение осуществляется in vitro. В некоторых воплощениях применение осуществляется in vivo.

Изобретение предусматривает олигомерное соединение согласно данному изобретению для применения в медицине, например, для применения в качестве лекарственного средства.

Изобретение предусматривает олигомерное соединение согласно данному изобретению для применения в лечении заболевания или нарушения.

Изобретение предусматривает олигомерное соединение согласно данному изобретению для изготовления лекарственного препарата для лечения заболевания или нарушения, такого как метаболическое заболевание или нарушение.

Изобретение предусматривает способ синтеза (или производства) олигомерного соединения, такого как олигомерное соединение согласно изобретению, причем указанный способ включает либо:

a) этап получения подложки для (твердофазного) олигонуклеотидного синтеза, к которой присоединена одна из следующих (третьих) областей:

i) возможно, линкерная группа (-Y-),

ii) группа X, содержащая группу, выбранную из группы, состоящей из конъюгата, направляющей группы, блокирующей группы, реакционноспособной группы (например, амина или спирта) или активационной группы (Х-), или группа -X-Y,

и

b) этап (последовательного) олигонуклеотидного синтеза области В, а затем области А,

и/или:

c) этап (последовательного) олигонуклеотидного синтеза первой области (А) и второй области (В), где после этапа синтеза следует

d) этап добавления третьей области (содержащей фосфорамидит)

i) возможно, линкерной группы (-Y-),

ii) группы X, содержащей группу, выбранную из группы, состоящей из конъюгата, направляющей группы, блокирующей группы, реакционноспособной группы (например, амина или спирта) или активационной группы (Х-), или группы -X-Y,

а затем

e) отщепление олигомерного соединения от (твердофазной) подложки, где, возможно, указанный способ также включает дополнительный этап, выбранный среди следующих:

f) если третья группа является активационной группой, то этап активации активационной группы для получения реакционноспособной группы с последующим добавлением конъюгата, блокирующей или направляющей группы к реакционноспособной группе, возможно, через линкерную группу (Y);

g) если третья область является реакционноспособной группой, то этап добавления конъюгата, блокирующей или направляющей группы к реакционноспособной группе, возможно, через линкерную группу (Y);

h) если третья область является связывающей группой (Y), то этап добавления конъюгата, блокирующей или направляющей группы к линкерной группе (Y),

где этапы f), g) или h) выполняются либо до, либо после отщепления олигомерного соединения от подложки для олигонуклеотидного синтеза. В некоторых воплощениях способ может быть осуществлен с использованием стандартной фосфорамидитной химической реакции, и в качестве такой области X и/или области X или области X и Y перед включением в олигомер может быть предложен фосфорамидит. См. фиг. 5-10, которые иллюстрируют неограничивающие аспекты способа согласно данному изобретению.

Изобретение предусматривает способ синтеза (или производства) олигомерного соединения, такого как олигомерное соединение согласно изобретению, причем указанный способ включает этап (последовательного) олигонуклеотидного синтеза первой области (А) и, возможно, второй области (В), где после этапа синтеза следует этап добавления третьей области (включающей фосфорамидит), области X (также упоминаемой как область С) или Y, например, области, включающей группу, выбранную из группы, состоящей из конъюгата, направляющей группы, блокирующей группы, функциональной группы, реакционноспособной группы [например, амина или спирта] или активационной группы (Х-) или группы -X-Y, с последующим отщеплением олигомерного соединения от (твердофазной) подложки.

Тем не менее, следует знать, что область X или X-Y может быть добавлена после отщепления от твердой подложки. Альтернативно, способ синтеза может включать этапы синтеза первой (А) и, возможно, второй области (В) с последующим отщеплением олигомера от подложки, с последующим этапом добавления к олигомеру третьей области, такой как группа X или X-Y. Добавление третьей области может быть достигнуто, например, путем добавления аминофосфорамидитного звена на конечном этапе синтеза олигомера (на подложке), который может после отщепления от подложки быть использован для соединения с группой X или X-Y, возможно, через активационную группу на группе X или Y (если она присутствует). В воплощениях, когда расщепляемый линкер не является нуклеотидной областью, область В может быть ненуклеотидным расщепляемым линкером, например пептидным линкером, который может формировать часть области X (также называемой областью С) или быть областью Y (или ее частью).

В некоторых воплощениях способа область X (такая как С) или X-Y, например, конъюгат (например, GalNAc-конъюгат), содержит активационную группу (активированную функциональную группу), и в способе синтеза активированного конъюгата (или области X или X-Y) она добавляется к первой и второй областям, например, аминосвязанный олигомер. Аминогруппа может быть добавлена к олигомеру путем стандартной фосфорамидатной химической реакции, например, на финальном этапе синтеза олигомера (который, как правило, будет образовывать аминогруппу на 5'-конце олигомера). Например, на последнем этапе олигонуклеотидного синтеза используется защищенный амино-алкил-фосфорамидит, например, TFA-амино-С6-фосфорамидит (6-(трифторацетиламино)-гексил-(2-цианоэтил)-(N,N-диизопропил)-фосфорамидит).

Область X (или область С, упоминаемая в данном документе), такая как конъюгат (например, GalNac-конъюгат), может быть активирована с помощью NHS-эфирного способа, а затем добавляется аминосвязанный олигомер. Например, N-гидроксисукцинимид (NHS) может быть использован в качестве активирующей группы для области X (или области С), такой как конъюгат, например, группировка GalNac-конъюгата.

Изобретение предусматривает олигомер, полученный согласно способу данного изобретения.

В некоторых воплощениях область X и/или область X или области X и Y могут быть ковалентно соединены (связаны) с областью В с помощью фосфатнуклеозидной связи, такой как описана в данном документе, включая фосфодиэфирную или фосфоротиоатную, или с помощью альтернативной группы, такой как триазол-группа.

Изобретение предусматривает способ лечения заболевания или нарушения у субъекта, нуждающегося в лечении, причем указанный способ включает этапы введения указанному субъекту фармацевтической композиции, содержащей олигомерное соединение согласно данному изобретению, в терапевтически эффективном количестве.

Данное изобретение предусматривает способ ингибирования экспрессии гена-мишени в клетке, включающий введение олигомерного соединения согласно изобретению в клетку, которая экспрессирует указанный ген-мишень, предпочтительно в количестве, эффективном для снижения экспрессии гена-мишени в указанной клетке. В некоторых воплощениях способ осуществляется in vitro (т.е. не в организме, но может осуществляться в клетке или ткани (например, ex vivo)). В некоторых воплощениях способ осуществляется in vivo.

Изобретение также предусматривает LNA-олигомер, содержащий непрерывную область из 8-24 связанных фосфоротиоатными связями нуклеозидов, а также содержащий от 1 до 6 ДНК-нуклеозидов, которые являются смежными с LNA-олигомером, где межнуклеозидные связи между ДНК и/или смежные с ДНК-нуклеозидом(ами) являются физиологически лабильными, например, являются фосфодиэфирными связями. Такой LNA-олигомер может находиться в форме конъюгата, как описано в данном документе, или может быть, например, промежуточным продуктом, используемым в последующем этапе конъюгации. В случае конъюгации конъюгат может, например, представлять собой или содержать стерин, такой как холестерин или токоферол, или может представлять собой или содержать (ненуклеотидный) углевод, такой как GalNac-конъюгат, такой как GalNac-кластер, например triGalNac, или другой конъюгат, описанный в данном документе.

Изобретение предусматривает антисмысловой LNA-олигомер (который может упоминаться в данном документе как область А), содержащий антисмысловой олигомер и конъюгационную группировку с группировкой, нацеленной на рецептор асиалогликопротеина, такую как GalNAc-группировка, которая может формировать часть дополнительной области (именуемой областью С). Антисмысловой LNA-олигомер может содержать 7-30, например, 8-26 нуклеозидов в длину, и он содержит по меньшей мере одно LNA-звено (нуклеозид).

Данное изобретение предусматривает антисмысловой LNA-олигомер, ковалентно присоединенный к (например, связанный с) (ненуклеозидной) углеводной группировке, такой как углеводная конъюгационная группировка. В некоторых воплощениях углеводная группировка не является линейным углеводным полимером. Углеводная группировка может, тем не менее, быть многовалентной, например, 2, 3, 4 или 4 одинаковые или неодинаковые углеводные группировки могут быть ковалентно присоединены к олигомеру, возможно, через линкер или линкеры.

Данное изобретение предусматривает антисмысловой LNA-олигомер (конъюгат), содержащий антисмысловой олигомер и конъюгационную группировку, которая содержит углевод, например, углеводную конъюгационную группировку.

Данное изобретение предусматривает фармацевтическую композицию, содержащую олигомерное LNA-соединение согласно данному изобретению и фармацевтически приемлемый разбавитель, носитель, соль или адъювант.

Данное изобретение предусматривает олигомерное соединение согласно данному изобретению для применения в ингибировании нуклеиновой кислоты-мишени в клетке. В некоторых воплощениях применение осуществляется in vitro. В некоторых воплощениях применение осуществляется in vivo.

Данное изобретение предусматривает олигомерное соединение согласно данному изобретению для применения в медицине, например, для применения в качестве лекарственного средства.

Данное изобретение предусматривает олигомерное соединения согласно данному изобретению для применения в лечении заболевания или нарушения.

Данное изобретение предусматривает применение олигомерного соединения согласно данному изобретению для получения лекарственного средства для лечения заболевания или нарушения, такого как метаболическое заболевание или нарушение.

Краткое описание графических материалов

Фиг. 1. Неограничивающая иллюстрация олигомеров изобретения, прикрепленных к активационной группе (т.е. защищенной реакционноспособной группе - в качестве третьей области). Межнуклеозидная связь L может быть, например, фосфодиэфирной, фосфортиоатной, фосфородитиоатной, боранофосфатной или метилфосфонатной, например, фосфодиэфирной. РО представляет собой фосфодиэфирную связь. Соединение а) имеет область В с одной ДНК или РНК, связь между второй и первой областью представляет собой РО. Соединение b) имеет два ДНК/РНК- (например, ДНК-) нуклеозида, соединенных фосфодиэфирной связью. Соединение с) имеет три ДНК/РНК-(например, ДНК-) нуклеозида, соединенных фосфодиэфирной связью. В некоторых воплощениях область В может быть удлинена другой связанной фосфодиэфирной связью ДНК/РНК (например, ДНК-нуклеозидом). Активационная группа показана на левой стороне каждого соединения и, возможно, может быть связана с концевым нуклеозидом области В через фосфорсодержащую нуклеозидную связывающую группу, такую как фосфодиэфирная, фосфортиоатная, фосфородитиоатная, боранофосфатная или метилфосфонатная, или в некоторых воплощениях через триазоловую связь. Соединения d), е) и f) также содержат линкер (Y) между областью В и активационной группой, и область Y может быть связана с областью В, например, с помощью фосфорсодержащей нуклеозидной связывающей группы, такой как фосфодиэфирная, фосфортиоатная, фосфородитиоатная, боранофосфатная или метилфосфонатная, а в некоторых воплощениях с помощью триазоловой связи.

Фиг. 2. Соединения, эквивалентные тем, что показаны на фиг. 1; однако вместо активационной группы используется реакционноспособная группа. Реакционноспособная группа в некоторых воплощениях может быть результатом активации активационной группы (например, результатом удаления защитной группы). Реакционноспособная группа в неограничивающих примерах может быть амином или спиртом.

Фиг. 3. Неограничивающая иллюстрация соединений согласно изобретению. Такая же номенклатура, как на фиг. 1. X в некоторых воплощениях может быть конъюгатом, таким как липофильный конъюгат, например холестериновый, или другой конъюгат, такой как описанные в данном документе. Кроме того или альтернативно, X может быть направляющей группой или блокирующей группой. В некоторых аспектах X может быть активационной группой (см. фиг. 1) или реакционноспособной группой (см. фиг. 2). X может быть ковалентно присоединен к области В через фосфорсодержащую нуклеозидную связывающую группу, такую как фосфодиэфирная, фосфортиоатная, фосфородитиоатная, боранофосфатная или метилфосфонатная, или может быть связан с помощью альтернативной связи, например триазоловой связи (см. L в соединениях d), е), и f)).

Фиг. 4. Неограничивающая иллюстрация соединений изобретения, где соединения содержат возможный линкер между третьей областью (X) и второй областью (область В). Та же номенклатура, как на фиг. 1. Подходящие линкеры описаны в данном документе и включают, например, алкильные линкеры, например, С6-линкеры. В соединениях А, В и С линкер между X и областью В прикреплен к области В через фосфорсодержащую нуклеозидную связывающую группу, такую как фосфодиэфирная, фосфортиоатная, фосфородитиоатная, боранофосфатная или метилфосфонатная, или может быть связан с помощью альтернативной связи, например триазоловой связи (Li). В этих соединениях Lii представляет межнуклеозидную связь между первой (А) и второй (В) областями.

Фиг. 5а и b. 5b показывает неограничивающий пример способа синтеза соединений данного изобретения. US представляет собой подложку для олигонуклеотидного синтеза, которая может быть твердой подложкой. X представляет собой третью область, такую как конъюгат, направляющая группа, блокирующая группа и т.д. В качестве возможного предварительного этапа X добавляют к подложке для олигонуклеотидного синтеза. В противном случае может быть получена подложка с уже присоединенным X (i). На первом этапе синтезируют область В (и), затем область А (iii), а затем проводят отщепление олигомерного соединения согласно данному изобретению от подложки для олигонуклеотидного синтеза (iv). В альтернативном способе предварительный этап включает получение подложки для олигонуклеотидного синтеза с областью X и присоединенной линкерной группой (Y) (см фиг. 5а). В некоторых воплощениях X или Y (если они присутствуют) присоединяются к области В через фосфорсодержащую нуклеозидную связывающую группу, например, фосфодиэфирную, фосфортиоатную, фосфородитиоатную, боранофосфатную или метилфосфонатную, или через альтернативную связь, такую как триазоловая связь.

Фиг. 6. Неограничивающий пример способа синтеза соединений согласно данному изобретению, которые содержат линкер (Y) между третьей областью (X) и второй областью (В). US представляет собой подложку для олигонуклеотидного синтеза, которая может быть твердой подложкой. X представляет собой третью область, такую как конъюгат, направляющая группа, блокирующая группа и т.д. На возможном предварительном этапе Y добавляют к подложке для олигонуклеотидного синтеза. В противном случае может быть получена подложка с уже присоединенным Y (i). На первом этапе синтезируют область В (и), затем область A (iii), а затем проводят отщепление олигомерного соединения согласно данному изобретению от подложки для олигонуклеотидного синтеза (iv). В некоторых воплощениях (как показано) область X может быть добавлена к линкеру (Y) после этапа отщепления (v). В некоторых воплощениях Y присоединен к области В через фосфорсодержащую нуклеозидную связывающую группу, например, фосфодиэфирную, фосфортиоатную, фосфородитиоатную, боранофосфатную или метилфосфонатную, или через альтернативную связь, такую как триазоловая связь.

Фиг. 7. Неограничивающий пример способа синтеза соединений согласно данному изобретению, которые используют активационную группу. На возможном предварительном этапе активационную группу присоединяют к подложке для олигонуклеотидного синтеза (i) или, в противном случае, получают подложку для олигонуклеотидного синтеза с активационной группой. На этапе и) синтезируют область В, а затем область A (iii). Затем олигомер отщепляют от подложки для олигонуклеотидного синтеза (iv). Затем может быть активирован промежуточный олигомер (содержащий активационную группу) (vi) или (viii) и добавлена третья область (X) (vi), возможно, через линкер (Y) (ix). В некоторых воплощениях X (или Y, если он присутствует) присоединяется к области В через фосфорсодержащую нуклеозидную связывающую группу, такую как фосфодиэфирная, фосфортиоатная, фосфородитиоатная, боранофосфатная или метилфосфонатная, или через альтернативную связь, такую как триазоловая связь.

Фиг. 8. Неограничивающий пример способа синтеза соединений согласно данному изобретению, в котором используется бифункциональная подложка для олигонуклеотидного синтеза (i). В таком способе олигонуклеотид синтезируется в начальной серии этапов (ii)-(iii) с последующим присоединением третьей области (возможно, через линкерную группу Y), а олигомерное соединение согласно данному изобретению затем может быть отщеплено (v). Альтернативно, как показано на этапах (vi)-(ix), третья область (возможно, с линкерной группой (Y)) прикреплена к подложке для олигонуклеотидного синтеза (это может быть дополнительным предварительным этапом) - или, в противном случае, предусмотрена подложка для олигонуклеотидного синтеза с третьей областью (возможно, с Y), а затем синтезируется олигонуклеотид (vii-viii). Затем олигомерное соединение согласно данному изобретению может быть отщеплено (ix). В некоторых воплощениях X (или Y, если он присутствует) прикреплен к области В через фосфорсодержащую нуклеозидную связывающую группу, такую как фосфодиэфирная, фосфортиоатная, фосфородитиоатная, боранофосфатная или метилфосфонатная, или альтернативную связь, такую как триазоловая связь. US в некоторых воплощениях может включать перед способом (например, на предварительном этапе) этап добавления двунаправленной (бифункциональной) группы, которая делает возможным независимый синтез олигонуклеотида и ковалентное присоединение группы X, Y (или X и Y) к подложке (как показано) - это, например, может быть достигнуто с помощью триазоловой или нуклеозидной группы. Затем двунаправленная (бифункциональная) группа с прикрепленным олигомером может быть отщеплена от подложки.

Фиг. 9. Неограничивающий пример способа синтеза соединений согласно данному изобретению. На первом этапе синтезируют первую область (A) (ii), а затем область В. Затем в некоторых воплощениях прикрепляют третью область к области В (iii), возможно, через фосфорсодержащую нуклеозидную связь (или, например, триазоловую связь). Затем олигомерное соединение согласно данному изобретению может быть отщеплено (iv). Если используется линкер (Y), то в некоторых воплощениях могут следовать этапы (v)-(viii): после синтеза области В добавляют линкерную группу (Y), а затем либо прикрепляют к (Y), либо на следующем этапе добавляют область X (vi). Затем олигомерное соединение согласно данному изобретению может быть отщеплено (vii). В некоторых воплощениях X (или Y, если он присутствует) прикреплен к области В через фосфорсодержащую нуклеозидную связывающую группу, такую как фосфодиэфирная, фосфортиоатная, фосфородитиоатная, боранофосфатная или метилфосфонатная, или через альтернативную связь, такую как триазоловая связь.

Фиг. 10. Неограничивающий пример способа синтеза соединений согласно данному изобретению. В этом способе используется активационная группа: этапы (i)-(iii) являются такими, как показано на фиг. 9. Тем не менее, после олигонуклеотидного синтеза (этап iii) к области В добавляют активационную группу (или реакционноспособную группу), возможно через фосфатную нуклеозидную связь. Затем олигонуклеотид отщепляют от подложки (v). Затем активационная группа может быть активирована с получением реакционноспособной группы, а затем к реакционноспособной группе добавляют третью область (X), например, конъюгат, блокирующую группу или направляющую группу (которая может быть активированной активационной группой или реакционноспособной группой), с получением олигомера (vi). Как показано в (vii)-(viii), после отщепления добавляют линкерную группу (Y) (vii), а затем либо прикрепляют к (Y), либо на последующем этапе добавляют область X, получая олигомер (viii). Следует признать, что в качестве альтернативы все этапы (ii)-(viii) могут быть выполнены на подложке для олигонуклеотидного синтеза, и в таких случаях может быть проведен последний этап отщепления олигомера от подложки. В некоторых воплощениях реакционноспособная группа или активационная группа прикреплена к области В через фосфорсодержащую нуклеозидную связывающую группу, такую как фосфодиэфирная, фосфортиоатная, фосфородитиоатная, боранофосфатная или метилфосфонатная, или через альтернативную связь, такую как триазоловая связь.

Фиг. 11. Сайленсинг (подавление экспрессии) мРНК (messenger РНК; матричная РНК, мРНК) АроВ (аполипопротеин В) холестериновыми конъюгатами in vivo. Мышам вводили однократную дозу 1 мг/кг неконъюгированного антисмыслового LNA-олигонуклеотида (№3833) или эквимолярные количества антисмысловых LNA-олигонуклеотидов, конъюгированных с холестерином с помощью различных линкеров (таб. 3), и умерщвляли их в дни 1, 3, 7 и 10 после введения дозы. РНК выделяли из печени и почек и подвергали АроВ-специфической RT-qPCR (real-time reverse transcription polymerase chain reaction; полимеразная цепная реакция с обратной транскрипцией в режиме реального времени; ОТ-кПЦР) А. Количество мРНК АроВ из образцов печени нормализовано по GAPDH и показано в процентах от среднего значения эквивалентных контролей с физиологическим раствором В. Количество мРНК АроВ из образцов почек нормализовано по GAPDH и показано в процентах от среднего значения эквивалентных контролей с физиологическим раствором.

Фиг. 12. Показывает холестерин-С6-конъюгат, который может быть использован в качестве X-Y- в соединениях согласно данному изобретению, а также в качестве конкретных соединений, используемых в примерах, включая конкретные соединения согласно данному изобретению.

Фиг. 13. Примеры конъюгатов холестерина, трехвалентного GalNac, FAM, фолиевой кислоты, одновалентного GalNac и токоферола, используемые в экспериментах (например, соединения, показанные на фиг. 12).

Фиг. 14. Сайленсинг мРНК АроВ холестериновыми конъюгатами in vivo. Мышам вводили однократную дозу 1 мг/кг неконъюгированного антисмыслового LNA-олигонуклеотида (№3833) или эквимолярные количества антисмысловых LNA-олигонуклеотидов, конъюгированных с холестерином с помощью различных линкеров (таб. 3), и умерщвляли их в дни 1, 3, 7, 10, 13 и 16 после введения дозы. РНК выделяли из печени и почек и подвергали АроВ-специфической RT-qPCR А. Количество мРНК АроВ из образцов печени нормализовано по GAPDH и показано в процентах от среднего значения эквивалентных контролей с физиологическим раствором В. Количество мРНК АроВ из образцов почек нормализовано по GAPDH и показано в процентах от среднего значения эквивалентных контролей с физиологическим раствором.

Фиг. 15. Содержание специфического LNA-олигонуклеотида в печени и почках in vivo. Мышам вводили однократную дозу 1 мг/кг неконъюгированного антисмыслового LNA-олигонуклеотида (№1) или эквимолярные количества антисмысловых LNA-олигонуклеотидов, конъюгированных с холестерином с помощью различных линкеров (таб. 4), и умерщвляли их в дни 1, 3, 7, 10, 13 и 16 после введения дозы. Содержание LNA-олигонуклеотид измеряли с помощью ELISA (enzyme-linked immunosorbent assay; иммуноферментный анализ, ИФА) "сэндвич"-формата на основе LNA.

Фиг. 16. Сайленсинг мРНК PCSK9 с холестериновыми конъюгатами in vivo. Мышам вводили однократную дозу 10 мг/кг неконъюгированного антисмыслового LNA-олигонуклеотида (№7) или эквимолярные количества антисмысловых LNA-олигонуклеотидов, конъюгированных с холестерином с помощью различных линкеров (табл. 5), и умерщвляли их в дни 1, 3, 7 и 10 после введения дозы. РНК выделяли из печени и почек и подвергали PCSK9-специфической RT-qPCR А. Количество мРНК PCSK9 из образцов печени нормализовано по ВАСТ и показано в процентах от среднего значения эквивалентных контролей с физиологическим раствором В. Количество мРНК PCSK9 из образцов почек нормализовано по ВАСТ и показано в процентах от среднего значения эквивалентных контролей с физиологическим раствором.

Фиг. 17. Примеры три-GalNac-конъюгатов, которые могут быть использованы. Конъюгаты 1-4 иллюстрируют 4 соответствующие GalNac-конъюгационные группировки, а конъюгаты 1а-4а обозначают те же самые конъюгаты с дополнительной линкерной группировкой (Y), которая используется для связывания конъюгата с олигомером (с областью А или с биорасщепляемым линкером, таким как область В). Волнистая линия представляет ковалентную связь с олигомером. Также показаны примеры холестериновых и токофероловых конъюгированных группировок (5а и 6а). Волнистая линия представляет ковалентную связь с олигомером.

Фиг. 18. Пример 7а: уровни белка FVII в сыворотке крови.

Фиг. 19. Пример 7а: уровни мРНК FVII в печени на 4-й день.

Фиг. 20. Пример 7а: содержание олигонуклеотидов в печени и почках на 4-й день.

Фиг. 21. Пример 7b: уровни белка FVII в сыворотке крови.

Фиг. 22. Уровни мРНК FVII в печени на 24-й день.

Фиг. 23. Содержание олигонуклеотидов в печени и почках на 4-й день.

Фиг. 24. Сайленсинг мРНК АроВ различными конъюгатами и РО-линкером in vivo.

Мышам вводили 1 мг/кг ASO с различными конъюгатами либо без биорасщепляемого линкера, с дитио-линкером (SS), либо с ДНК/РО-линкером (РО). РНК выделяли из образцов печени (А) и почек (В) и анализировали на нокдаун мРНК АроВ. Данные показаны в сравнении с физиологическим раствором (=1).

Фиг. 25. Сайленсинг мРНК мишени X посредством ASO образующей петлю LNA (looped LNA) с РО-линкером.

Клетки Neuro 2а обрабатывали ASO образующей петлю LNA с РО-линкером или без него, соответственно. Через 6 дней гимнозис-мРНК выделяли и анализировали на нокдуаун мРНК мишени X. Экспрессия мРНК показана как процент контрольных (ложно обработанных) образцов.

Описание изобретения

Данное изобретение относится к олигомерным соединениям, таким как антисмысловые олигонуклеотиды, которые ковалентно связаны с конъюгационной группой, направляющей группой, реакционноспособной группой, активационной группой или блокирующей группой через короткую область, содержащую (например, 1-10) связанные фосфодиэфирными связями ДНК- или РНК-нуклеозиды.

Олигомер

Данное изобретение использует олигомерные соединения (также называемые в данном документе олигомерами) для модуляции, например ингибирования, нуклеиновой кислоты-мишени в клетке. Олигомеры могут иметь 8-35 последовательных нуклеотидов в длину и содержат первую область из 7-25 последовательных нуклеотидов и вторую область из 1-10 последовательных нуклеотидов, где, например, либо межнуклеозидная связь между первой и второй областями является фосфодиэфирной связью с первым (или единственным) ДНК- или РНК-нуклеозидом второй области, либо область В содержит по меньшей мере один связанный фосфодиэфирной связью ДНК- или РНК-нуклеозид.

Вторая область в некоторых воплощениях может содержать дополнительные ДНК- или РНК-нуклеозиды, которые могут быть связаны фосфодиэфирной связью. Вторая область дополнительно ковалентно связана с третьей областью, которая может быть, например, конъюгатом, направляющей группой, реакционноспособной группой, активационной группой и/или блокирующей группой.

В некоторых аспектах данное изобретение основано на получении лабильной области, второй области, связывающей первую область, например, антисмысловой олигонуклеотид, и конъюгата или функциональной группы, например, направляющей или блокирующей группы. Лабильная область содержит по меньшей мере один связанный фосфодиэфирной связью нуклеозид, например, ДНК- или РНК-нуклеозид, такой как 1, 2, 3, 4, 5, 6, 7, 8, 9 и 10 связанных фосфодиэфирными связями нуклеозидов, таких как ДНК или РНК. В некоторых воплощениях олигомерное соединение содержит расщепляемый (лабильный) линкер. В этом отношении расщепляемый линкер предпочтительно присутствует в области В (или, в некоторых воплощениях, между областями А и В).

Термин "олигомер" в контексте данного изобретения относится к молекуле, образованной ковалентной связью двух или более нуклеотидов (т.е. к олигонуклеотиду). При этом один нуклеотид (звено) также может упоминаться как мономер или звено. В некоторых воплощениях термины "нуклеозид", "нуклеотид", "звено" и "мономер" используются взаимозаменяемо. Следует знать, что в отношении последовательности нуклеотидов или мономеров то, к чему они относятся, является последовательностью оснований, таких как А, Т, G, С или U.

Олигомер состоит из или содержит непрерывную нуклеотидную последовательность длиной 8-25, например, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 нуклеотидов, например, длиной 10-20 нуклеотидов.

В различных воплощениях соединение согласно изобретению не содержит РНК (звеньев). В некоторых воплощениях соединение согласно изобретению, первая область или первая и вторая области вместе (например, в виде одной непрерывный последовательности) являются линейной молекулой или синтезируются в виде линейной молекулы. Поэтому олигомер может быть одноцепочечной молекулы. В некоторых воплощениях олигомер не содержит короткие области, например, по меньшей мере из 3, 4 или 5 последовательных нуклеотидов, которые комплементарны эквивалентным областям в пределах того же самого олигомера (т.е. не содержит дуплексы). Олигомер в некоторых воплощениях может быть (по существу) не двухцепочечным. В некоторых воплощениях олигомер по существу является не двухцепочечным, например, представляет собой не siРНК.

В некоторых воплощениях олигомер может содержать первую область, которая не содержит коротких областей, например, по меньшей мере из 3, 4 или 5 последовательных нуклеотидов, которые комплементарны областям в пределах той же самой первой области (т.е. не содержит дуплексы внутри области). В этом отношении первый олигомер в некоторых воплощениях может не гибридизоваться с нековалентно связанной комплементарной цепью, например, не формировать часть siРНК.

Например, в некоторых воплощениях олигомерное соединение не содержит область комплементарности, например, когда первая область формирует часть siРНК, или, например, когда третья область содержит аптамер или блокирующий олигонуклеотид, олигомерное соединение согласно изобретению в некоторых воплощениях может содержать области двухцепочечной нуклеиновой кислоты. В таких воплощениях области двухцепочечной нуклеиновой кислоты, например, образующие дуплекс по меньшей мере из 3, например, по меньшей мере из 4, например, по меньшей мере из 5, например, по меньшей мере из 6 нуклеотидов в длину, могут находиться в третьей области или между третьей областью и, например, первой областью, или, в некоторых воплощениях, во второй области или в области на протяжении первой и второй областей (например, когда третья область содержит олигонуклеотидную блокирующую область).

В некоторых воплощениях олигомерное соединение находится не в форме дуплекса с (по существу) комплементарным олигонуклеотидом, например, не является siРНК.

В некоторых воплощениях олигомерное соединение представляет собой LNA-олигомер, например, антисмысловой LNA-олигомер (который может упоминаться в данном документе как область А), содержащий антисмысловой олигомер, область В, определенную в данном документе, и углеводный конъюгат (который может упоминаться как область С). Антисмысловой LNA-олигомер может иметь в длину 7-30, например, 8-26, нуклеозидов, и он содержит по меньшей мере одно LNA-звено (нуклеозид). В некоторых воплощениях углеводная группировка не является линейным углеводным полимером.

В некоторых воплощениях олигомерное соединение представляет собой LNA-олигомер, например, антисмысловой LNA-олигомер (который может упоминаться в данном документе как область А), содержащий антисмысловой олигомер, область В, определенную в данном документе, и конъюгационную группировку с группировкой, нацеленной на асиалогликопротеиновый рецептор, такую как GalNAc-группировка (которая может упоминаться как область С). Углеводная группировка может быть многовалентной, например, 2, 3, 4 или 4 идентичные или неидентичные углеводные группировки могут быть ковалентно присоединены к олигомеру, возможно, через линкер или линкеры (например, область Y).

Первая область

В некоторых воплощениях первая область может содержать олигомер на основе нуклеиновой кислоты, например, антисмысловой олигонуклеотид. В некоторых воплощениях первая область содержит или состоит из связанного фосфортиоатной связью олигонуклеотида, такого как антисмысловой олигонуклеотид, длиной 7-25 нуклеотидов. Первая область может содержать по меньшей мере один модифицированный нуклеозид (нуклеозидный аналог), например, по меньшей мере один бициклический нуклеозид (например, LNA) или 2'-замещенный нуклеозид. В некоторых воплощениях все нуклеозиды первой области или некоторые из них могут быть модифицированными нуклеозидами, которые в данном документе также называются нуклеозидными аналогами. В некоторых воплощениях модифицированные нуклеозиды являются сахар-модифицированными (например, содержат сахар или сахарную суррогатную группировку, отличную от рибозы или дезоксирибозы).

В некоторых воплощениях первая область представляет собой антисмысловой олигомер (антисмысловой олигонуклеотид), такой как одноцепочечной олигомер, который содержит последовательность, комплементарную нуклеиновой кислоте-мишени.

В некоторых воплощениях первая область включает или представляет собой гэпмер. В некоторых воплощениях первая область включает или представляет собой миксмер. В некоторых воплощениях первая область включает или представляет собой тоталмер.

В некоторых воплощениях первая область содержит по меньшей мере один, например, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19, по меньшей мере 20, по меньшей мере 21, по меньшей мере 22, по меньшей мере 23, по меньшей мере 24 или 25 нуклеозидных аналогов. В некоторых воплощениях нуклеозидные аналоги представляют собой (возможно, независимо выбраны из группы, включающей) бициклические нуклеозидные аналоги (например, LNA) и/или 2'-замещенные нуклеозидные аналоги, например, (возможно, независимо) выбранные из группы, состоящей из 2'-O-алкил-РНК-звеньев, 2'-ОМе-РНК-звеньев, 2'-амино-ДНК-звеньев, 2'-АР, 2'-FANA, 2'-(3-гидрокси)пропила и 2'-фтор-ДНК-звеньев и/или других (возможно) сахар-модифицированных нуклеозидных аналогов, таких как морфолино, пептидо-нуклеиновая кислота (peptide nucleic acid, PNA), CeNA, несвязанная нуклеиновая кислота (unlinked nucleic acid, UNA), гекситол-нуклеиновая кислота (hexitol nucleic acid, HNA), бицикло-HNA (см., например, WO 2009/100320). В некоторых воплощениях нуклеозидные аналоги повышают аффинность первой области к их нуклеиновой кислоте-мишени (или комплементарной ДНК- или РНК-последовательности) Различные нуклеозидные аналоги раскрыты в Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443; и Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, которые включены в данный документ посредством ссылки.

В некоторых воплощениях олигомер, например, его первая область, например, гэпмер, миксмер или тоталмер, содержит по меньшей мере один бициклический нуклеотидный аналог, такой как LNA. В некоторых воплощениях первая область включает по меньшей мере один бициклический нуклеозидный аналог (например, LNA) и/или 2'-замещенный нуклеозидный аналог. В некоторых воплощениях все нуклеозидные аналоги, присутствующие в первой области, содержат одну и ту же модификацию сахара. В некоторых воплощениях по меньшей мере один нуклеозидный аналог, присутствующий в первой области, представляет собой бициклический нуклеозидный аналог, например, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, например, все нуклеозидные аналоги (или в тотамере все нуклеозиды), бициклические нуклеозидные аналоги, такие как LNA, например бета-DX-LNA или альфа-LX-LNA (где X представляет собой окси, амино или тио), или другие описанные здесь LNA, в том числе, но не ограничиваясь ими, (R/S) сЕТ, сМОЕ или 5'-Me-LNA. В некоторых воплощениях олигомер или его первая область состоит из ДНК и сахар-модифицированных нуклеозидных аналогов, таких как бициклические нуклеозидные аналоги и/или 2'-замещенные нуклеозидные аналоги. В некоторых воплощениях олигомер или его первая область состоит из ДНК- и LNA-нуклеозидных аналогов.

WO 05013901, WO 07/027775, WO 07027894 относятся к полностью 2'-замещенным олигомерам, таким как полностью 2'-О-МОЕ. В некоторых воплощениях первая область олигомера может содержать 2'-замещенные нуклеозиды. WO 07/027775 также относится к МОЕ-, LNA-, ДНК-миксмерам для применения в направляющих microРНК (микроРНК).

В некоторых воплощениях первая область или первая и вторая области в сочетании не содержат область с более чем 4 или 5 последовательными ДНК-звеньями. Такие первые области могут быть (по существу) неспособны привлекать PHKseH (РНКазу Н).

Первая область ковалентно связана со второй областью, например, через 5'-концевую или 3'-концевую межнуклеозидную связь, такую как фосфодиэфирная связь. Поэтому фосфодиэфирная связь может находиться между наиболее 5'-расположенным нуклеозидом в области А и наиболее 3'-расположенным нуклеозидом в области В и/или между наиболее 3'-расположенным нуклеозидом в области А и наиболее 5'-расположенным нуклеозидом в области В. В связи с этим в некоторых воплощениях может быть две области В, ковалентно присоединенные к области А, одна на 5'-конце области А, и одна на 3'-конце области А. Две области В могут быть одинаковыми или различными, и они могут быть ковалентно связаны с такими же или с другими третьими областями, возможно и независимо через линкер (Y).

В некоторых воплощениях некоторые или все нуклеозиды из первой области могут быть модифицированными нуклеозидами, также называемыми в данном документе нуклеозидными аналогами, такими как сахар-модифицированные аналоги нуклеозидов, например бициклические нуклеозидные аналоги (например, LNA) и/или 2'-замещенные нуклеозидные аналоги. В некоторых воплощениях все нуклеозидные аналоги, присутствующие в первой области, содержат одну и ту же модификацию сахара, например, все являются бициклическими нуклеозидными аналогами, такими как LNA, например, бета-D-X-LNA или альфа-L-X-LNA (где X представляет собой окси, амино или тио), или другими LNA, описанными в данном документе, в том числе, но не ограничиваясь ими, (R/S) сЕТ, сМОЕ или 5'-Me-LNA.

В некоторых воплощениях межнуклеозидные связи первой области содержат по меньшей мере одну межнуклеозидную связь, отличную от фосфодиэфирной, например, по меньшей мере одну, например, по меньшей мере 50%, например, по меньшей мере 75%, например, по меньшей мере 90%, например, 100% межнуклеозидных связей в области А отличаются от фосфодиэфирной. В некоторых воплощениях межнуклеозидные связи, отличные от фосфодиэфирных, являются серосодержащими межнуклеозидными связями, такими как фосфоротиоатная, фосфородитиоатная и боранофосфатная, например, фосфоротиоатная.

Вторая область (область В)

Вторая область может содержать или состоит по меньшей мере из одного ДНК- или РНК-нуклеозида, связанного с первой областью с помощью фосфодиэфирной связи. В некоторых аспектах межнуклеозидная связь между первой и второй областями считается частью области В.

В некоторых воплощениях вторая область содержит или состоит по меньшей мере из 1-10 связанных нуклеозидов, например, из 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10 связанных ДНК- или РНК-нуклеотидов. Хотя область ДНК/РНК-фосфодиэфирной связи считается важной для получения расщепляемого линкера, вполне возможно, что область В также содержит сахар-модифицированные аналоги нуклеозидов, такие как те, которые указаны выше для первой области. Тем не менее, в некоторых воплощениях нуклеозиды области В (возможно, независимо) выбраны из группы, состоящей из ДНК и РНК. Следует понимать, что нуклеозиды области В может включать природные или неприродные нуклеотидные основания. Область В содержит по меньшей мере один связанный фосфодиэфирной связью ДНК- или РНК-нуклеозид (который в некоторых воплощениях может быть первым нуклеозидом, примыкающим к области А). Если область В содержит другие нуклеозиды, то область В также может содержать другие связи нуклеозидов, отличные от фосфодиэфирных, такие как (возможно, независимо) фосфоротиоатная, фосфородитиоатная, боранофосфатная или метилфосфонатная. Тем не менее, в других воплощениях все межнуклеозидные связи в области В являются фосфоротиоатными. В некоторых воплощениях все нуклеозиды области В содержат (возможно, независимо) либо 2'-ОН-рибозный сахар (РНК), либо 2'-Н-сахар - т.е. РНК или ДНК.

В некоторых воплощениях вторая область содержит или состоит по меньшей мере из 1-10 связанных (например, фосфодиэфирной связью) ДНК- или РНК-нуклеозидов, например, из 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10 связанных (например, фосфодиэфирной связью) ДНК- или РНК-нуклеотидов.

В некоторых воплощениях область В содержит не более 3 или не более 4 последовательных ДНК- или РНК-нуклеозидов (например, ДНК-нуклеозидов). Поскольку такая область В может быть настолько короткой, что она не привлекает РНКазу Н, то это может быть важным аспектом, когда область В не является частью одной непрерывной нуклеотидной последовательности, которая комплементарна мишени. Более короткие области В, например, длиной 1-4 нуклеотида, могут быть также предпочтительными в некоторых воплощениях, так как они вряд ли будут мишенью рестрикционного фермента, специфичного к последовательности. Таким образом можно варьировать восприимчивость области В к эндонуклеазному расщеплению, и тем самым точно настраивать скорость активации активного олигомера in vivo или даже внутриклеточно. Соответственно, если требуется очень быстрая активация, то могут быть использованы более длинные области В и/или области В, которые содержат сайты распознавания рестрикционных ферментов (например, специфических к клеткам или тканям или дифференциально экспрессируемых).

Как показано в примерах, область В может быть конъюгирована с конъюгатом, направляющей реакционноспособной группой, активационной группой или блокирующей группой (X) через линкерную группу, которая может, например, содержать фосфодиэфирную связь и/или, возможно, подходящую линкерную группу, такую как предусмотрены в данном документе. Примерами являются фосфатная нуклеозидная связь (например, фосфодиэфирная, фосфоротиоатная, фосфордитиоатная, боранофосфатная или метилфосфонатная) или триазоловая группа. В некоторых аспектах линкерная группа является такой же, как линкерная группа между областями А и В, и, таким образом, может быть фосфодиэфирной связью. В некоторых аспектах линкерная группа является фосфоротиоатной связью.

В некоторых воплощениях ДНК- или РНК-нуклеотиды второй области независимо выбраны среди ДНК- и РНК-нуклеотидов. В некоторых воплощениях ДНК- или РНК-нуклеотиды второй области являются ДНК-нуклеотидами. В некоторых воплощениях ДНК- или РНК-нуклеотиды второй области являются РНК-нуклеотидами.

В контексте второй области термин "ДНК- и РНК-нуклеозид" может включать природные или неприродные основания (также называемые аналогами оснований или модифицированными основаниями).

Следует понимать, что в некоторых воплощениях вторая область может дополнительно включать другие нуклеотиды или нуклеотидные аналоги. В некоторых воплощениях вторая область содержит только ДНК- или РНК-нуклеозиды. В некоторых воплощениях, когда вторая область включает более одного нуклеозида, межнуклеозидные связи во второй области включают фосфодиэфирные связи. В некоторых воплощениях, когда вторая область включает более одного нуклеозида, все межнуклеозидные связи во второй области включают фосфодиэфирные связи.

В некоторых воплощениях по меньшей мере два последовательных нуклеозида из второй области являются ДНК-нуклеозидами (например, по меньшей мере 3 или 4 или 5 последовательными ДНК-нуклеотидами). В некоторых воплощениях по меньшей мере два последовательных нуклеозида второй области являются РНК-нуклеозидами (например, по меньшей мере 3 или 4 или 5 последовательных РНК-нуклеотидов). В некоторых воплощениях по меньшей мере два последовательных нуклеозида из второй области являются по меньшей мере одним ДНК и по меньшей мере одним РНК-нуклеозидом. Межнуклеозидная связь между областью А и областью В является фосфодиэфирной связью. В некоторых воплощениях, когда область В содержит более одного нуклеозида, по меньшей мере одна межнуклеозидная связь является фосфодиэфирной - такой как линкерная группа (группы) между 2 (или 3 или 4 или 5) нуклеозидами, прилегающими к области А.

Вторая область фланкирована с одной стороны (или 5', или 3') первой областью, например, антисмысловым олигонуклеотидом, а с другой стороны (или 3', или 5' предпочтительно, через конъюгационную группировку или аналогичную группу (например, блокирующую группировку/группу, направляющую группировку/группу или терапевтическую низкомолекулярную группировку), возможно, через линкерную группу (т.е. между второй областью и конъюгационной/блокирующей группой и т.п. группировкой).

В таком воплощении олигонуклеотид согласно изобретению может быть описан в соответствии со следующей формулой:

5'-А-РО-В[Y)X-3' или 3'-А-РО-В[Y)X-5',

где А представляет собой область А, РО представляет собой фосфодиэфирную связь, В представляет собой область В, Y представляет собой возможную линкерную группу, а X представляет собой конъюгат, направляющую, блокирующую группу или реакционноспособную или активационную группу.

В некоторых воплощениях область В содержит 3'-5' или 5'-3': i) фосфодиэфирную связь с 5'-нуклеозидом области A, ii) ДНК- или РНК-нуклеозид, такой как ДНК-нуклеозид, и iii) другую фосфодиэфирную связь

5'-А-РО-В-РО-3' или 3'-А-РО-В-РО-5'

Другая фосфодиэфирная связь связывает нуклеозид области В с одним или более чем одним дополнительным нуклеозидом, например, с одним или более чем одним ДНК- или РНК-нуклеозидом, или может связывать с X (который представляет собой конъюгат, направляющую или блокирующую группу или реакционноспособную или активационную группу), возможно, через связывающую группу (Y).

В некоторых воплощениях область В содержит 3'-5' или 5'-3': i) фосфодиэфирную связь с 5'-нуклеозидом области A, ii) от 2 до 10 связанных фосфодиэфирной связью ДНК- или РНК-нуклеозидов, таких как ДНК-нуклеозид, и, возможно, iii) другую фосфодиэфирную связь:

5'-A-[PO-B]n-[Y]-X 3' или 3'-A-[PO-B]n-[Y]-X 5'

5'-A-[PO-B]n-PO-[Y]-X 3' или 3'-A-[PO-B]n-PO-[Y]-X 5',

где А представляет собой область А, [РО-В]n представляет собой область В, где n составляет 1-10, например, 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10, РО является возможной фосфодиэфирной линкерной группой между областью В и X (или Y, если она есть).

В некоторых воплощениях изобретение относится к соединениям в соответствии с (или содержащим) одной из следующей формул:

5' [Область А] - РО - [область В] 3' -Y - X

5' [Область А] - РО - [область В] -РО 3' - Y - X

5' [Область А] - РО - [область В] 3' - X

5' [Область А] - РО - [область В] -РО 3' - X

3' [Область А] - РО - [область В] 5' -Y - X

3' [Область А] - РО - [область В] -РО 5' - Y - X

3' [Область А] - РО - [область В] 5' - X

3' [Область А] - РО - [область В] -РО 5' - X

Область В, например, может содержать или состоять из:

5' ДНК 3'

3' ДНК 5'

5' ДНК-РО-ДНК-3'

3' ДНК-РО-ДНК-5'

5' ДНК-РО-ДНК-РО-ДНК 3'

3' ДНК-РО-ДНК-РО-ДНК 5'

5' ДНК-РО-ДНК-РО-ДНК-РО-ДНК 3'

3' ДНК-РО-ДНК-РО-ДНК-РО-ДНК 5'

5' ДНК-РО-ДНК-РО-ДНК-РО-ДНК-РО-ДНК 3'

3' ДНК-РО-ДНК-РО-ДНК-РО-ДНК-РО-ДНК 5'

Выбор последовательности во второй области:

В некоторых воплощениях область В не образует комплементарную последовательность, когда олигонуклеотидные области А и В выровнены с комплементарной последовательностью-мишенью.

В некоторых воплощениях область В не образует комплементарную последовательность, когда олигонуклеотидные области А и В выровнены с комплементарной последовательностью-мишенью. В этой связи области А и В вместе могут образовывать одну непрерывную последовательность, комплементарную последовательности-мишени.

В некоторых воплощениях последовательность оснований в области В выбрана так, чтобы обеспечить оптимальный сайт расщепления эндонуклеазой, основываясь на преобладающих ферментах эндонуклеазового расщепления, присутствующих в ткани-мишени или клетке или субклеточном компартменте. В этой связи путем выделения клеточных экстрактов из тканей-мишеней и нецелевых тканей могут быть выбраны последовательности эндонуклеазового расщепления для применения в области В на основе предпочтительной расщепляющей активности в нужной клетке-мишени (например, печени/гепатоцитах) по сравнению с нецелевой клеткой (например, почечной). В этой связи эффективность соединения в отношении понижающей регуляции мишени может быть оптимизирована для нужной ткани/клетки.

В некоторых воплощениях область В содержит динуклеотид с последовательностью АА, AT, AC, AG, ТА, ТТ, ТС, TG, СА, СТ, СС, CG, GA, GT, GC, или GG, где С может быть 5-метилцитозином, и/или Т может быть заменен на U. В некоторых воплощениях область В содержит тринуклеотид с последовательностью AAA, ААТ, AAC, AAG, ATA, АТТ, АТС, ATG, АСА, ACT, АСС, ACG, AGA, AGT, AGC, AGG, ТАА, TAT, ТАС, TAG, ТТА, ТТТ, ТТС, TAG, ТСА, ТСТ, ТСС, TCG, TGA, TGT, TGC, TGG, САА, CAT, САС, CAG, СТА, CTG, СТС, СТТ, CCA, ССТ, ССС, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC и GGG, где С может быть 5-метилцитозином, и/или Т может быть заменен на U. В некоторых воплощениях область В содержит тринуклеотид с последовательностью АААХ, ААТХ, ААСХ, AAGX, АТАХ, АТТХ, АТСХ, ATGX, АСАХ, АСТХ, АССХ, ACGX, AGAX, AGTX, AGCX, AGGX, ТААХ, ТАТХ, ТАСХ, TAGX, ТТАХ, ТТТХ, ТТСХ, TAGX, ТСАХ, ТСТХ, ТССХ, TCGX, TGAX, TGTX, TGCX, TGGX, СААХ, САТХ, САСХ, CAGX, СТАХ, CTGX, СТСХ, СТТХ, ССАХ, ССТХ, СССХ, CCGX, CGAX, CGTX, CGCX, CGGX, GAAX, GATX, GACX, CAGX, GTAX, GTTX, GTCX, GTGX, GCAX, GCTX, GCCX, GCGX, GGAX, GGTX, GGCX и GGGX, где X может быть выбран из группы, состоящей из А, Т, U, G, С и их аналогов, где С может быть 5-метилцитозином, и/или Т может быть заменен на U. Следует понимать, что когда речь идет о (природных) нуклеотидах Т, U, G, С, они могут быть замещены аналогами нуклеиновых оснований, которые функционируют как эквивалентные природные нуклеотиды (например, пары оснований с комплементарным нуклеозидом).

В некоторых воплощениях соединение согласно данному изобретению может содержать более чем одну конъюгационную группу (или более чем одну функциональную группу X - такую как конъюгационная, направляющая, блокирующая или активированная группа или реакционноспособная или активационная группа), например, 2 или 3 такие группы. В некоторых воплощениях область В ковалентно связана (возможно, через (например, ненуклеотидную) линкерную группу) по меньшей мере с одной функциональной группой, например, с двумя или тремя функциональными группами. В некоторых воплощениях первая область может быть ковалентно связана (например, с помощью межнуклеозидных связей, таких как фосфодиэфирные связи) с двумя областями В, например, с одной на 5' и с одной на 3'-конце первой области, где каждая область В может быть (возможно, независимо) выбрана из области В, описанной в данном документе. В этой связи одна область В может иметь одну или более чем одну функциональную группу, и вторая область В может иметь одну или более чем одну функциональную группу, где функциональные группы в каждой области В могут быть независимо выбраны среди конъюгата, направляющей группы, блокирующей группой или реакционноспособной/активационной группы.

Полиолигомерные соединения

Данное изобретение предусматривает полиолигомерное соединение, которое может включать первую область (область А), вторую область (область В) и третью область (область С), где первая область ковалентно связана по меньшей мере с одним дополнительным олигомерным соединением (областью А'), где первая область (область А) и область А' ковалентно связаны через биорасщепляемый линкер (область В'), который может соответствовать, например, второй области, описанной в данном документе, например, области по меньшей мере с одним связанным фосфодиэфирной связью ДНК- или РНК-(например ДНК-) нуклеозидом, например, двумя, тремя, четырьмя или пятью связанными фосфодиэфирной связью ДНК- или РНК- (например, ДНК-) нуклеозидами. Области В и В' в некоторых воплощениях могут иметь одинаковую структуру, например, одинаковое число ДНК/РНК-нуклеозидов и фосфодиэфирных связей и/или одинаковую последовательность нуклеотидов. В других воплощениях области В и В' могут быть различными. В качестве примера такие полиолигомерные соединения могут иметь такую структуру как: (5'-3' или 3'-5') конъюгат-PO-ON-PO'-ON', где конъюгат представляет собой область С, РО представляет собой область В, РО' представляет собой область В', a ON 1 представляет собой область А'.

Следует понимать, что область А' в некоторых воплощениях может включать несколько дополнительных олигомерных соединений (например, еще 2 или 3 олигомерных соединения), связанных последовательно (или параллельно) через биорасщепляемые линкеры, например: конъюгат-PO-ON-PO-ON'-PO''-ON'' или конъюгат-PO-ON-[PO-ON']n, где n может составлять, например, 1, 2 или 3, а ON' могут быть одинаковыми или различными, и если они отличаются, то могут иметь одинаковые или различные мишени.

Мультиконъюгационные олигомерные соединения

В некоторых воплощениях олигомерное соединение может быть конъюгировано более чем с одной конъюгационной областью (областью С), которые могут быть одинаковыми или различными. Например, олигомерное соединение согласно изобретению может иметь следующую структуру: (5'-3' или 3'-5') ON-PO'-Conj1-PO''-Conj2, где Conj1 и conj2 являются двумя конъюгационными группами, по меньшей мере одна или обе из РО или РО' соответствуют области В согласно данному документу, a ON представляет собой область A. Conj1 и Conj2 могут быть одинаковыми или могут быть различными. Например, в некоторых воплощениях один из Conj1 и Conj2 является углеводным или стероловым конъюгатом, а другой является липофильным конъюгатом, например. 5'-3' или 3'-5' : ON-РО'-пальмитоил-РО''-Chol или ON-PO'-пальмитоил-PO''-GalNac.

Углеводная конъюгационная группировка (представлена GalNac в предыдущих формулах (например, при использовании в качестве conj1 или conj2)) может быть, например, выбрана из группы, состоящей из галактозы, галактозамина, N-формил-галактозамина, N-ацетилгалактозамина, N-пропионилгалактозамина, N-н-бутаноилгалактозамина и N-изобутаноилгалактозамина. Липофильный конъюгат (например, используемый в качестве conj1 или conj2 и представленный в виде пальмитоила в предыдущих формулах) может быть гидрофобной группой, такой как гидрофобная С16-20-группа, стерол, холестерин. Другие углеводные и липофильные группы, которые могут быть использованы, описаны, например, в данном документе.

Мишень

В некоторых воплощениях в качестве неограничивающего примера олигомер согласно изобретению применяется для модуляции нуклеиновой кислоты (например, мишени), выбранной из группы, состоящей из мРНК, микроРНК, IncPHK (long non-coding РНК; длинная некодирующая РНК), snPHK (small nuclear РНК; малая ядерная РНК), snoРНК (small nucleolar РНК; малая ядрышковая РНК) и вирусной РНК.

Иллюстративные, но не ограничивающие мишени мРНК и микроРНК включают, например, следующие:

Гены, указывающие на рак, такие как Hif1-альфа, сурвивин, Bcl2, Mcl1, Her2, андрогеновый рецептор, бета-катенин, человеческий трансформирующий фактор роста TGF-бета2, ras, TNF-альфа, C-RAF, HSP, например, Hsp27, elF-4E (например, ISIS-EIF4ERx), STAT3 (например, ISIS-STAT3Rx), кластерин (например, OGX-011), AurkB, AurkA, PBK, miR-155, miR-21, miR-10b, mir-34 (см. WO 2011088309), miR-199a, miR-182.

мРНК генов, участвующих в воспалении, например ICAM-1 (например, аликафорсен), CD49d, VLA-4-остеопонтин, miR-21 (псориаз).

Другие релевантные с медицинской точки зрения мишени мРНК включают CTGF (локальный фиброз) и c-Raf-киназу (глазное заболевание), miR-29 (фиброз сердца), фактор XI (свертывание), фактор VII (свертывание), miR15 (постмиокардиальное моделирование), miR-159 (постмиокардиальное моделирование), miR-138 (остеопороз), mir-21 (см. WO 12148952) и mir214 (фиброз) - см. WO 2012012716.

Мишени заболеваний или нарушений обмена веществ, такие как Аро-В (высокий уровень холестерина LDL (low density lipoprotein; липопротеины низкой плотности, ЛПНП), ACS), ApoCIII (высокий уровень TG (триглицеридов) в сыворотке крови, сахарный диабет), Аро(а) (сердечно-сосудистые заболевания), FGFR4 (ожирение), GCCR (диабет 2 типа), GCGR (диабет 2 типа), РТР1В (диабет 2 типа), DGAT2 (NASH), PCSK9 (гиперлипидемия и связанные нарушения), MtGPAT (ожирение и NAFLD), miR-122 (высокий уровень холестерина), miR-33 (метаболический синдром, атеросклероз), miR-208 (хроническая сердечная недостаточность), miR-499 (хроническая сердечная недостаточность), miR-378 (кардиометаболическое заболевание), miR-143 (сосудистое заболевание), miR-145 (сосудистое заболевание), miR-92 (заболевание периферических артерий), miR-375 (сахарный диабет), miR-27b (сахарный диабет), miR-34a (сахарный диабет), miR-199a, miR-27a (заболевание сердца, ишемия), miR-338 (сахарный диабет).

Болезни обмена веществ включают, например, метаболический синдром, ожирение, гиперлипидемию, дисбаланс HDL/LDL, дислипидемии, например, семейную комбинированную гиперлипидемию (Familial combined hyperlipidemia, FCHL), приобретенную гиперлипидемию, устойчивую к лечению статинами гиперхолестеринемию, болезнь коронарных артерий (coronary artery disease, CAD), ишемическую болезнь сердца (coronary heart disease, CHD)., атеросклероз, заболевания сердца, сахарный диабет (I и/или II), NASH (nonalcoholic steatohepatitis; неалкогольный стеатогепатит), острый коронарный синдром (acute coronary syndrome; ACS).

Вирусные заболевания: miR-451 (полицитемия), miR-122 (HCV), HBV, HCV, BKV и т.д. Тяжелые и редкие заболевания включают SMN2 (спинальную мышечную атрофию), TTR (TTR-амилоидоз), GHr (акромегалию), ААТ (AATD-ассоциированная болезнь печени), дистофин (мышечная дистрофия Дюшенна).

В некоторых воплощениях олигомер согласно изобретению нацелен на экспрессированную в печени нуклеиновую кислоту, такую как экспрессированная в печени мРНК, например PCSK9, АроВ или MtGPAT. В некоторых воплощениях олигомер согласно изобретению нацелен на мРНК PCSK9. В некоторых воплощениях олигомер согласно изобретению нацелен на мРНК АроВ. В некоторых воплощениях олигомер согласно изобретению нацелен на экспрессированную в печени microРНК, например, miR-122.

В некоторых воплощениях олигомер согласно изобретению способен к понижающей регуляции (например, к снижению или устранению) экспрессии мишени (например, нуклеиновой кислоты-мишени). В связи с этим олигомер согласно изобретению может влиять на ингибирование мишени. В некоторых воплощениях олигомеры согласно изобретению связываются с нуклеиновой кислотой-мишенью и ингибируют экспрессию по меньшей мере на 10% или 20% по сравнению с нормальным уровнем экспрессии, более предпочтительно ингибируют по меньшей мере на 30%, 40%, 50%, 60%, 70%, 80%, 90% или 95% по сравнению с нормальным уровнем экспрессии (например, уровнем экспрессии в отсутствие олигомера(ов) или конъюгата(ов)). В некоторых воплощениях такая модуляция наблюдается при применении концентрации от 0,04 до 25 нМ, например, от 0,8 до 20 нМ соединения согласно данному изобретению. В том же самом или другом воплощении ингибирование экспрессии составляет менее 100%, например, ингибирование менее 98%, ингибирование менее 95%, ингибирование менее 90%, ингибирование менее 80%, например, ингибирование менее 70%. Модуляция уровня экспрессии может быть определена путем измерения уровня белка, например с помощью таких способов, как SDS-PAGE с последующим вестерн-блотом с использованием соответствующих антител против белка-мишени. Альтернативно, модуляция уровней экспрессии может быть определена путем измерения уровней мРНК, например, путем нозерн-блота или количественной RT-PCR. При измерении с помощью уровней мРНК в некоторых воплощениях уровень понижающей регуляции при применении соответствующей дозировки, например, концентрации от 0,04 до 25 нМ, например, от 0,8 до 20 нМ, составляет, как правило, 10-20% от нормальных уровней в отсутствие соединения, конъюгата или композиции согласно данному изобретению.

Таким образом, изобретение предусматривает способ понижающей регуляции или ингибирования экспрессии мишени в клетке, которая экспрессирует мишень, причем указанный способ включает введение олигомера или конъюгата согласно изобретению в указанную клетку для понижающей регуляции или ингибирования экспрессии мишени в указанной клетке. Подходящая клетка представляет собой клетку млекопитающего, такую как клетка человека. В некоторых воплощениях введение может происходить in vitro. В некоторых воплощениях введение может происходить in vivo.

Соединения согласно данному изобретению, такие как олигомеры и их конъюгаты, могут быть нацелены на различные мишени, такие как мРНК или microРНК или другие нуклеиновокислотные мишени, которые экспрессируются в печени (ссылки на NCBI Genbank/Gene ID приведены в качестве примеров последовательностей, которые могут быть мишенью соединений согласно изобретению - последовательности Genbank/NCBI включены в данный документ посредством ссылки).

АроВ

В некоторых воплощениях первая область (или первая и вторая области) образует единую непрерывную последовательность нуклеиновых оснований, которая комплементарна соответствующей области мишени мРНК АроВ (т.е. мишеням) АроВ-100 (NCBI Genbank ID NM_000384.2 GI: 105990531, включена в данный документ посредством ссылки).

Соединения согласно изобретению, которые нацелены на АроВ, могут быть использованы в лечении острого коронарного синдрома (см. WO 20100076248). Таким образом, изобретение предусматривает применение олигомера согласно изобретению, который нацелен на АроВ100, в лечении острого коронарного синдрома. Изобретение также относится к способу лечения острого коронарного синдрома, где указанный способ включает введение олигомера согласно изобретению субъекту, нуждающемуся в указанном лечении.

Соединения согласно изобретению, которые нацелены на АроВ, могут быть использованы в лечении атеросклероза. Таким образом, изобретение предусматривает олигомер согласно изобретению, который нацелен на АроВ100, для применения в лечении атеросклероза. Данное изобретение также относится к способу лечения атеросклероза, причем указанный способ включает введение олигомера согласно изобретению субъекту, нуждающемуся в таком лечении.

Соединения согласно изобретению, которые нацелены на АроВ, могут быть использованы в лечении гиперхолестеринемии или гиперлипидемии. Таким образом, изобретение предусматривает олигомер согласно изобретению, который нацелен на АроВ100, для применения в лечении гиперхолестеринемии или гиперлипидемии. Данное изобретение также относится к способу лечения гиперхолестеринемии или гиперлипидемии, причем указанный способ включает введение олигомера согласно изобретению субъекту, нуждающемуся в таком лечении.

Изобретение предусматривает способ ингибирования in vivo или in vitro АроВ в клетке, которая экспрессирует АроВ, причем указанный способ включает введение олигомера или конъюгата или фармацевтической композиции согласно изобретению в указанную клетку, чтобы ингибировать АроВ в указанной клетке.

Примеры LNA-олигомеров, которые могут быть использованы в качестве первой области в олигомерах/конъюгатах согласно изобретению, включают, например, те, которые раскрыты в WO 2007/031081, WO 2008/113830, WO 2007131238 и WO 2010142805, которые включены в данный документ посредством ссылки. Конкретные предпочтительные соединения включают следующие:

(SEQ ID №1)

(SEQ ID №53),

где заглавные буквы представляют собой бета-D-окси-LMA-звенья (нуклеозиды), строчные буквы представляют собой ДНК-звенья, индекс s представляет собой фосфоротиоатную связь, а индекс m перед заглавной С показывает, что все цитозины LNA являются 5-метилцитозинами. Соединения согласно данному изобретению, нацеленные на АроВ, могут быть конъюгированы с конъюгатом, который направляет олигомер в печень и описан в данном документе, такой как углеводный или липофильный конъюгат, например, GalNac-конъюгат или стериновый конъюгат (например, холестериновый или токофероловый). Конъюгат может быть, например, на 5'-конце или 3'-конце олигомерного соединения (соответственно через область В). Другие олигомеры, которые нацелены на АроВ, раскрыты в WO 03/011887, WO 04/044181, WO 2006/020676, WO 2007/131238, WO 2007/031081 и WO 2010142805.

PCSK9

В некоторых воплощениях первая область (или первая и вторая области) образует единую непрерывную последовательность нуклеиновых оснований, которая комплементарна соответствующей области мишени мРНК PCSK9 (т.е. мишеням), такой как человеческая мРНК PCSK9: NCBI Genbank ID NM_174936. 3 GI: 299523249, включена в данный документ посредством ссылки.

Данное изобретение предусматривает олигомер согласно изобретению, который нацелен на PCSK9, для применения в качестве лекарственного средства, например, для лечения гиперхолестеринемии или связанного нарушения, такого как нарушение, выбранное из группы, состоящей из атеросклероза, гиперлипидемии, гиперхолестеринемии, семейной гиперхолестеринемии, например, усиления функциональных мутаций в PCSK9, дисбаланса HDL/LDL-холестерина, дислипидемий, например, семейной гиперлипидемии (FCHL), устойчивой к лечению статинами гиперхолестеринемии, болезни коронарных артерий (CAD) и ишемической болезни сердца (CHD).

Данное изобретение предусматривает применение олигомера согласно изобретению, который нацелен на PCSK9, для производства лекарственного средства для лечения гиперхолестеринемии или связанного нарушения, такого как нарушение, выбранное из группы, состоящей из атеросклероза, гиперлипидемии, гиперхолестеринемии, семейной гиперхолестеринемии, например, усиления функциональных мутаций в PCSK9, дисбаланса HDL/LDL-холестерина, дислипидемий, например, семейной гиперлипидемии (FCHL), устойчивой к лечению статинами гиперхолестеринемии, болезни коронарных артерий (CAD) и ишемической болезни сердца (CHD).

Данное изобретение предусматривает способ лечения гиперхолестеринемии или связанного нарушения, такого как нарушение, выбранное из группы, состоящей из атеросклероза, гиперлипидемии, гиперхолестеринемии, семейной гиперхолестеринемии, например, усиления функциональных мутаций в PCSK9, дисбаланса HDL/LDL-холестерина, дислипидемий, например, семейной гиперлипидемии (FCHL), устойчивой к лечению статинами гиперхолестеринемии, болезни коронарных артерий (CAD) и ишемической болезни сердца (CHD), где указанный способ включает введение эффективного количества олигомера согласно изобретению, нацеленного на PCSK9, пациенту, страдающему или, по-видимому, страдающему от гиперхолестеринемии или связанных нарушений.

Изобретение предусматривает способ ингибирования in vivo или in vitro PCSK9 в клетке, которая экспрессирует PCSK9, причем указанный способ включает введение олигомера согласно изобретению, который нацелен на PCSK9, в указанную клетку, чтобы ингибировать PCSK9 в указанной клетке.

Ниже приведен олигомер, который нацелен на человеческую мРНК PCSK9 и может быть использован в качестве области А в соединениях согласно данному изобретению.

(SEQ ID №37),

где заглавные буквы представляют собой бета-D-окси-LNA-звенья (нуклеозиды), строчные буквы представляют собой ДНК-звенья, индекс s представляет собой фосфоротиоатную связь, а индекс m перед заглавной С показывает, что все цитозины LNA являются 5-метилцитозинами. Соединения согласно данному изобретению, нацеленные на PCSK9, могут быть конъюгированы с конъюгатом, который направляет олигомер в печень и описан в данном документе, такой как углеводный или липофильный конъюгат, например, GalNac-конъюгат или стериновый конъюгат (например, холестериновый или токофероловый). Конъюгат может быть, например, на 5'-конце или 3'-конце олигомерного соединения (соответственно, через область В). Другие олигомеры, которые нацелены на PCSK9, раскрыты как SEQ ID №36-52, а другие раскрыты в WO 2008/043753, WO 2011/009697, WO 08/066776, WO 07/090071, WO 07/146511, WO 07/143315, WO 09/148605, WO 11/123621 и WO 11133871, которые включены в данный документ посредством ссылки.

miR-122

В некоторых воплощениях первая область (или первая и вторая области) образует единую непрерывную последовательность нуклеотидных оснований, которая комплементарна соответствующей области microРНК-122, такой как miR-122а (т.е. мишени), например последовательности has-miR-122 (miRBase выпуск 20: MI0000442), например:

>hsa-mir-122 MI0000442

CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGCUAGGC

>hsa-miR-122-5p MIMAT0000421

UGGAGUGUGACAAUGGUGUUUG

miR-122 была показана при HCV-инфекции, где она была существенным для хозяина фактором, требуемым для поддержания инфекции. Таким образом, ингибиторы miR-122 могут быть использованы в лечении гепатита С.

Соединения согласно изобретению, которые нацелены на miR-122, могут быть использованы в лечении HCV-инфекции. Таким образом, изобретение предусматривает олигомер согласно изобретению, который нацелен на miR-122, для применения в лечении HCV-инфекции. Данное изобретение также предусматривает способ лечения HCV-инфекции, где указанный способ включает введение олигомера согласно изобретению субъекту, нуждающемуся в таком лечении.

Изобретение предусматривает применение олигомера согласно изобретению, который нацелен на miR-122, для изготовления лекарственного средства для лечения HCV-инфекции.

Данное изобретение предусматривает способ лечения HCV-инфекции, причем указанный способ включает введение эффективного количества олигомера согласно изобретению, который нацелен на miR-122, пациенту, страдающему от HCV-инфекции.

Данное изобретение предусматривает способ ингибирования miR-122 in vivo или in vitro в клетке, экспрессирующей miR-122, такой как HCV-инфицированная клетка или клетка, экспрессирующая HCV-репликон, причем указанный способ включает введение олигомера или конъюгата или фармацевтической композиции согласно изобретению в указанную клетку, чтобы ингибировать miR-122 в указанной клетке.

miR-122 также был показана в метаболизме холестерина, и было выдвинуто предположение, что ингибирование miR-122 может быть использовано в лечении для уменьшения уровня холестерина в плазме (Esau, Cell Metab. 2006 Feb; 3(2): 87-98).

Следовательно, ингибиторы miR-122 могут быть использованы в лечении для снижения уровня холестерина в плазме или в лечении метаболического заболевания, связанного с повышенными уровнями холестерина (связанных расстройств), такого как показания, выбранные из группы, состоящей из атеросклероза, гиперлипидемии, гиперхолестеринемии, семейной гиперхолестеринемии, дислипидемий, болезни коронарных артерий (CAD) и ишемической болезни сердца (CHD).

Соединения согласно изобретению, которые нацелены на miR-122, могут быть использованы в лечении повышенных уровней холестерина или связанных нарушений. Таким образом, изобретение предусматривает олигомер согласно изобретению, который нацелен на miR-122, для применения в лечении повышенных уровней холестерина или связанных нарушений. Данное изобретение также предусматривает способ лечения повышенных уровней холестерина или связанных нарушений, где указанный способ включает введение олигомера согласно изобретению субъекту, нуждающемуся в указанном лечении.

Изобретение предусматривает применение олигомера согласно изобретению, который нацелен на miR-122, для изготовления лекарственного средства для лечения повышенных уровней холестерина или связанных нарушений.

Данное изобретение предусматривает способ лечения повышенных уровней холестерина или связанных нарушений, причем указанный способ включает введение эффективного количества олигомера согласно изобретению, который нацелен на miR-122, пациенту, страдающему от указанного нарушения.

Изобретение предусматривает способ ингибирования in vivo или in vitro miR-122 в клетке, которая экспрессирует miR-122, такой как HCV-инфицированная клетка или клетка, экспрессирующая HCV-репликон, причем указанный способ включает введение олигомера или конъюгата или фармацевтической композиции согласно изобретению в указанную клетку, чтобы ингибировать miR-122 в указанной клетке.

Олигомеры, нацеленные на miR-122, представлены в WO 2007/112754, WO 2007/112753, WO 2009/043353, и могут быть миксмерами, такими как SPC3649, который также называется миравирсеном, см. ниже, или очень маленькими LNA (tiny LNA), такими как описанные в WO 2009/043353 (например, 5'-АСАСТСС-3', 5'-САСАСТСС-3', 5'-ТСАСАСТСС-3', где заглавные буквы представляют собой бета-D-окси-LNA, полностью фосфоротиоатную, a LNA С представляют собой 5-метил-цитозины). В некоторых воплощениях нацеленные на miR-122 олигомеры имеют длину 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 или 18 (или 19, 20, 21, 22 или 23) нуклеотидов. В некоторых воплощениях нацеленные на miR-122 олигомеры имеют последовательность, которая полностью комплементарна miR-122 при измерении по всей длине олигомера, и предпочтительно включают последовательность 5'-САСАСТСС-3'. В некоторых воплощениях олигомер, нацеленный на microРНК, такую как miR-122, комплементарен соответствующей области microРНК вдоль всей длины олигомера, и в некоторых воплощениях 3'-нуклеозид олигомера комплементарен (т.е. выровнен с ними) первому, второму, третьему или четвертому 5'-нуклеотидам microРНК, например miR-122, таким как второй 5'-нуклеотид microРНК, например, miR-122.

Ниже приведен олигомер, который нацелен на has-miR-122 (человеческая miR-122) и может быть использован в качестве области А в соединениях согласно данному изобретению.

Миравирсен:

Другие соединения, нацеленные на miR-122, которые могут быть использованы в контексте данного изобретения (область А), раскрыты в WO 2007/027894, WO 2007/027775.

MtGPAT: (NCBI ген ID 57678 - хромосома: 10; NC_000010.10 (113907971.113975153, комплемент). Митохондриальная глицерол-3-фосфат-ацилтрансфераза 1 (ЕС 2.3.1.15, также известная как GPAT1, mtGPATI, GPAM, mtGPAM) играет важную роль в формировании печеночных триглицеридов, где высокие уровни активности mtGPATI приводят к жировой дистрофии печени (гепатостеатозу), тогда как отсутствие mtGPATI приводит к низким уровням триглицеридов в печени и стимулирует окисление жирных кислот (см. WO 2010/000656, который раскрывает олигомеры, нацеленные на mtGPAT). Соединения изобретения, которые нацелены на MtGPAT, могут быть использованы для лечения заболеваний, таких как избыточный вес, ожирение, жировая дистрофия печени, гепатостеатоз, неалкогольная жировая дистрофия печени (NAFLD), неалкогольный стеатогепатит (NASH), резистентность к инсулину, диабет, такой как инсулиннезависимый сахарный диабет (NIDDM).

Фактор VII (NCBI ген ID 2155, NCBI J02933.1 GI: 180333, или EU 557239.1 GI: 182257998). Олигомер или конъюгат согласно изобретению могут быть нацелены на фактор VII и, таким образом, могут ингибировать продукцию фактора VII, ключевого компонента внешнего пути активации каскада свертывания. Соединения согласно изобретению, которые нацелены на фактор VII, могут быть использованы в лечении или профилактике тромботических заболеваний (как правило, не вызывая кровотечение) и инфаркта, инсульта и сгустков крови или воспалительных заболеваний. В WO 2013/119979 и WO 2012/174154, которые включены в данный документ посредством ссылки, представлены олигонуклеотидные соединения, которые нацелены на FVII и которые могут быть включены в конъюгаты согласно данному изобретению.

Фактор XI (NCBI GenBank, ВС122863.1 GI: 114108211) - фактор XI, фактор свертывания, который вырабатывается в печени. Высокие уровни фактора XI связаны с сердечным приступом, инсультом и образованием тромбов. В WO 2013/070771, который включен в данный документ посредством ссылки, представлены олигонуклеотидные соединения, которые нацелены на фактор XI и которые могут быть включены в конъюгаты согласно данному изобретению. Соединения согласно данному изобретению, которые нацелены на фактор XI, могут быть использованы в лечении или профилактике тромботических заболеваний, а также инфаркта миокарда, инсульта и сгустков крови или воспалительных заболеваний, таких как артрит и колит.

ApoCIII (NCBI GenBank, ВС027977.1 GI: 20379764) - белок, который регулирует метаболизм триглицеридов в крови. Высокие уровни ароС-III связаны с воспалением, высоким уровнем триглицеридов, атеросклерозом и метаболическим синдромом. Соединения согласно данному изобретению, которые нацелены на ApoCIII, могут быть использованы для снижения уровня триглицеридов в сыворотке крови или для лечения, например, синдрома семейной хиломикронемии и тяжелого повышения уровня триглицеридов, либо в виде монотерапии, либо в комбинации с другими агентами, снижающими уровень триглицеридов. В WO 11085271, который включен в данный документ посредством ссылки, представлены олигонуклеотидные соединения, которые нацелены на ApoCIII, который может быть включен в конъюгаты данного изобретения.

Аро(а) (NCBI Genbank NM_005577.2 GI: 116292749) ингибирует продукцию Аро(а) в печени и разработан таким образом, чтобы предложить прямой подход к снижению Lp(a), независимого фактора риска сердечно-сосудистых заболеваний. Высокие уровни Lp(a) связаны с повышенным риском атеросклероза, ишемической болезни сердца, инфаркта и инсульта. Lp(a) способствует преждевременному наросту бляшек в артериях, или атеросклерозу. Соединения согласно данному изобретению, которые нацелены на Аро(а), могут быть использованы в лечении, например, атеросклероза и ишемической болезни сердца. В WO 05000201 и WO 03014307, которые включены в данный документ посредством ссылки, представлены олигонуклеотидные соединения, которые нацелены на аполипопротеин (а) и которые могут быть включены в конъюгаты согласно данному изобретению.

Вирус гепатита В (HBV) (см., например, NCBI D23684.1 GI: 560092; D23683.1 GI: 560087; D23682.1 GI: 560082; D23681.1 GI: 560077; D23680.1 GI: 560072; D23679.1 GI: 560067; D23678.1 GI: 560062; D23677.1 GI: 560057; все включены в данный документ посредством ссылки).

Олигомеры, которые нацелены на HBV, хорошо известны в данной области, например, см. WO 96/03152, WO 97/03211, WO 2011/052911, WO 2012/145674, WO 2012/145697, WO 2013/003520 и WO 2013/159109.

Соединения согласно данному изобретению, которые нацелены на HBV, могут быть использованы в лечении HBV-инфекции. Таким образом, изобретение предусматривает олигомер согласно изобретению, который нацелен на HBV, для применения в лечении HBV. Изобретение также относится к способу лечения HBV-инфекции, где указанный способ включает введение олигомера согласно данному изобретению субъекту, нуждающемуся в указанном лечении.

Данное изобретение предусматривает олигомер или конъюгат согласно изобретению, который нацелен на вирус гепатита В (HBV), для применения в качестве лекарственного средства, например, для лечения инфекции гепатита В или связанных нарушений.

Данное изобретение предусматривает применение олигомера или конъюгата или фармацевтической композиции согласно изобретению, которые нацелены на вирус гепатита В (HBV), для изготовления лекарственного средства для лечения инфекции гепатита В и связанных нарушений.

Данное изобретение предусматривает способ лечения инфекции гепатита В и связанных нарушений, включающий введение эффективного количества олигомера или конъюгата согласно изобретению, который нацелен на HBV, пациенту, инфицированному вирусом гепатита В.

Данное изобретение предусматривает способ ингибирования репликации HBV in vivo или in vitro в клетке, инфицированной HBV, где указанный способ включает введение олигомера или конъюгата согласно изобретению, который нацелен на HBV, в указанную клетку, чтобы ингибировать репликацию HBV. Пример LNA-олигомера, который нацелен на HBV (и описан в WO 2011/47312), может представлять собой используемый в качестве олигомера (область А) согласно изобретению . Другие соединения описаны в таблице 1 WO 2011/47312 и в WO 2011/052911, WO 2012/145674, WO 2012/145697, WO 2013/003520 и WO 2013/159109, которые включены в данный документ посредством ссылки.

RG-101 представляет собой соединение, которое нацелено на miR-122 и включает GalNac-конъюгат, и оно в настоящее время разрабатывается Regulus Therapeutics для лечения HCV.

Ангиопоэтин-подобный белок 3 (angiopoietin-like 3, ANGPTL3) (например, NCBI ВС007059.1 GI: 14712025 или ВС058287.1 GI: 34849466) - белок, который регулирует липидный, глюкозный и энергетический обмен. Люди с повышенным уровнем ANGPTL3 имеют гиперлипидемию, связанную с повышенным риском преждевременных инфарктов, увеличением толщины артериальной стенки, а также некоторыми метаболическими нарушениями, такими как резистентность к инсулину. Напротив, люди с низким уровнем ANGPTL3 имеют более низкие уровни LDL-C и триглицеридов и низкий риск развития сердечно-сосудистых заболеваний. Соединения согласно данному изобретению, которые нацелены на ANGPTL3, могут быть использованы в лечении, например, гиперлипидемии и связанных нарушений, нарушения обмена веществ, атеросклероза, ишемической болезни сердца или резистентности к инсулину. В WO 11085271, который включен в данный документ посредством ссылки, представлены олигонуклеотидные соединения, которые нацелены на ANGPTL3 и которые могут быть включены в конъюгаты согласно данному изобретению.

Рецептор глюкагона (glucagon receptor, GCGR) (ВС112041.1 GI: 85567507; L20316.1 GI: 405189): Глюкагон является гормоном, который выступает против действия инсулина и стимулирует печень к продукции глюкозы, особенно у больных сахарным диабетом 2 типа. У пациентов с прогрессирующим сахарным диабетом неконтролируемое действие глюкагона приводит к значительному увеличению уровня глюкозы в крови. Таким образом, ослабление действия глюкагона может оказать существенный эффект снижения уровня глюкозы у пациентов с тяжелой формой диабета. Кроме того, снижение GCGR дает более активный глюкагон-подобный пептид, или GLP-1, гормон, который сохраняет функции поджелудочной железы и повышает секрецию инсулина. Соединения согласно данному изобретению, которые нацелены на GCGR, могут быть использованы для лечения, например, резистентности к инсулину, гипергликемии, сахарного диабета, такого как сахарный диабет типа 1 или 2, для сохранения функции поджелудочной железы, а также для контроля уровня глюкозы в крови. В WO 2007/134014 представлены олигонуклеотидные соединения, которые нацелены на GCGR и которые могут быть включены в конъюгаты согласно данному изобретению.

Рецептор фактора роста фибробластов 4 (fibroblast growth factor receptor 4, FGFR4). NCBI ген 2264 - NC_000005.9 (176513906.176525143) FGFR4 экспрессируется в печени и жировых тканях и указывает на уменьшение способности организма накапливать жир с одновременным увеличением сжигания жира и расхода энергии. Многие препараты против ожирения действуют в головном мозге, подавляя аппетит, что обычно приводит к побочным эффектам со стороны ЦНС. Соединения согласно данному изобретению, которые нацелены на FGFR4, могут быть использованы для лечения, например, резистентности к инсулину, гипергликемии, сахарного диабета, такого как сахарный диабет типа 1 или 2, для сохранения функции поджелудочной железы, для предотвращения ожирения (например, при использовании в комбинации с подавляющими аппетит лекарствами), снижения массы тела и повышения чувствительности к инсулину, диабета, такого как диабет типа 1 или 2, и для контроля уровня глюкозы в крови. В WO 09046141 и WO 12174476, которые включены в данный документ посредством ссылки, представлены олигонуклеотидные соединения, которые нацелены на FGFR4 и которые могут быть включены в конъюгаты согласно данному изобретению.

Диацилглицерол-ацилтрансфераза-2 (diacylglycerol acyltransferase 2, DGAT-2) (NCBI ген ID 84649): ключевой компонент в синтезе триглицеридов. Ингибирование DGAT может уменьшить ожирение печени у пациентов с неалкогольным стеатогепатитом (NASH), а также может быть использован для лечения сахарного диабета 2 типа и резистентности к инсулину. Соединения согласно изобретению, которые нацелены на DGAT-2, могут быть использованы для лечения NASH, для уменьшения ожирения печени, для лечения диабета, например диабета 2 типа, и для лечения резистентности к инсулину. В WO 05019418 и WO 2007136989, которые включены в данный документ посредством ссылки, представлены олигонуклеотидные соединения, которые нацелены на DGAT-2 и которые могут быть включены в конъюгаты согласно данному изобретению.

Глюкокортикоидный рецептор (glucocorticoid receptor, GCCR) (ВС150257.1 GI: 152013043): глюкокортикоидные гормоны влияют на различные процессы во всем организме, а чрезмерные уровни глюкокортикоидных гормонов могут иметь пагубное влияние на многие ткани и органы в организме. Синдром Кушинга является орфанным заболеванием, вызванным длительным воздействием высоких уровней глюкокортикоидов. В отсутствие лечения у пациентов с синдромом Кушинга может развиться гипертония, сахарный диабет и нарушение иммунных функций, и такие пациенты имеют повышенный риск ранней смерти. Несмотря на утвержденные способы лечения синдрома Кушинга, лекарства, использующиеся в настоящее время, связаны со значительными побочными эффектами, такими как гипертония и диабет, и сохраняется высокая медицинская потребность в новых способах лечения таких пациентов, неудовлетворенная в данный момент. Соединения согласно данному изобретению, которые нацелены на GCCR-2, могут быть использованы для лечения синдрома Кушинга и связанных состояний (например, таких, которые перечислены выше). В WO 07035759 и WO 2007136988, которые включены в данный документ посредством ссылки, представлены олигонуклеотидные соединения, которые нацелены на GCCR и которые могут быть включены в конъюгаты согласно данному изобретению.

Компонент комплемента С5 (М57729.1 GI: 179982): система комплемента играет центральную роль в иммунитете в качестве защитного механизма для защиты хозяина, но нарушение его регуляции приводит к серьезным угрожающим жизни осложнениям в широком диапазоне заболеваний человека, включая, помимо прочих, пароксизмальную ночную гемоглобинурию (paroxysmal noctuРНКI hemoglobinuria, PNH), атипичный гемолитико-уремический синдром (atypical hemolytic uremic syndrome, aHUS), миастению гравис, оптиконевромиелит. Соединения согласно данному изобретению, которые нацелены на компонент комплемента С5, могут быть использованы для лечения одного или более из этих нарушений. С5 является генетически и клинически подтвержденной мишенью; человеческие мутации с потерей функции связаны с ослабленной иммунной защитой против некоторых инфекций, и терапия с внутривенным введением моноклонального анти-С5-антитела показала клиническую активность и переносимость при ряде комплемент-опосредованных заболеваний. Трансмембранная протеаза, серии 6 (Tmprss6) для лечения бета-талассемии и нарушений с перегрузкой железом.

Альфа-1-антитрипсин (alpha-1-antitrypsin, ААТ): (М11465.1 GI: 177826) Заболевание печени, связанное с - WO 13142514, который включен в данный документ посредством ссылки, раскрывает олигонуклеотидные соединения, которые нацелены на ААТ и которые могут быть включены в конъюгаты согласно данному изобретению. Соединения согласно данному изобретению, которые нацелены на ААТ, могут быть использованы в способах уменьшения mРНК и экспрессии белка AIAT и для лечения, облегчения, профилактики, замедления прогрессирования или остановки прогрессирования фиброза, такого как AIATD-ассоциированное заболевание печени, и заболевания легких, такого как AIATD-ассоциированное заболевание легких, у индивидуума, нуждающегося в этом.

Транстиретин (transthyretin, TTR) (ВС005310.1 GI: 13529049): Олигомеры согласно данному изобретению, которые нацелены на TTR, могут быть использованы для лечения транстиретинового амилоидоза, или TTR-амилоидоза, тяжелого и редкого генетического заболевания, при котором пациент наследует мутантный ген, который продуцирует неправильно свернутую форму TTR, которая постепенно накапливается в тканях. У пациентов с TTR-амилоидозом и мутантная, и нормальная формы TTR могут образовывать фибриллы в тканях, включая сердце, периферические нервы и желудочно-кишечный тракт. Наличие TTR-фибрилл препятствует нормальному функционированию этих тканей, белковые TTR-фибриллы увеличивают повреждение ткани и болезнь ухудшается. TTR является белком-носителем, который транспортирует гормон щитовидной железы и ретинол в крови. У пациентов с TTR-амилоидозом и мутантная, и нормальная формы TTR могут образовывать фибриллы в ткани. Соединения согласно изобретению могут быть использованы для лечения TTR-амилоидоза. См. Benson et al., Amyloid. 2010 Jun; 17(2): 43-9, и Ackermann et al., Amyloid. 2012 Jun; 19 Suppl 1: 43-4.). Антисмысловые соединения, нацеленные на ТТР, которые могут быть использованы в олигомерах или конъюгатах согласно изобретению, описаны в US 8101743, WO 11139917 и WO 10017509, которые включены в данный документ посредством ссылки.

Аминолевулинат-синтаза-1 (aminolevulinate synthase-1, ALAS-1) (ВС011798.2 GI: 33877783; AK312566.1 GI: 164690365; NM_199166.2 GI: 362999012; NM_000688.5 GI: 362999011). ALAS1 является утвержденной мишенью для лечения порфирии, например для лечения печеночных порфирий, в том числе острой перемежающейся порфирии (acute intermittent porphyria, AIP). Соединения согласно изобретению, которые нацелены на ALAS-1, могут быть использованы в лечении этих заболеваний.

Фактор роста эндотелия сосудов (vascular endothelial growth factor, VEGF) (ген ID 7422, человеческая последовательность: Хромосома: 6; NC_000006.11 (43737946.43754224)). VEGF показан при раке. Соединения согласно изобретению, которые нацелены на VEGF, могут быть использованы в лечении гиперпролиферативных заболеваний, таких как рак, например, рак печени.

В таблице 1 приведены группы печеночных мишеней, которые могут быть мишенью соединений согласно изобретению, а также медицинские показания/нарушения, для лечения которых могут быть использованы такие соединения (например, для человека, страдающего от связанного нарушения) (см. Sehgal et al., Liver as a target for oligonucleotide therapeutics, J. of Hepatology 2013, в печати).

Последовательности

В некоторых воплощениях олигомеры или их первые области включают непрерывную нуклеотидную последовательность, которая соответствует обратному комплементу нуклеотидной последовательности, присутствующей в нуклеиновой кислоте-мишени (т.е. последовательности, на которую нацелен олигомер). В таблице 3 приведена группа mРНК- и microРНК-мишеней, которые находятся на этапе доклинической или клинической разработки с использованием олигонуклеотидных соединений для связанного показания и поэтому пригодны для направления соединений согласно данному изобретению.

В некоторых воплощениях мишень выбрана из группы, состоящей из: miR-122, АроВ-100, ApoCIII, PCSK9, CRP, KSP, VEGF, PLK1, miR-34, FGFR4, фактора IXa, фактора XI, TTR, GCCR, PTP-1B, GCGR, ААТ, ALDH2, пути HAMP, miR-33, Apo(a), miR-7, miR-378, miR-21, Мyc, miR-122, генома HCV, например, HCV 5'UTR или HCV NS5B РНК или NS3 РНК, TMPRSS6, антитромбина III, ApoCIII, ANGPLT3, MTP, DGAT2, ALAS1, антитромбина III, сывороточного амилоида А и фактора VII.

В некоторых воплощениях непрерывная нуклеотидная последовательность содержит не более одного несоответствия при гибридизации с последовательностью-мишенью.

При определении степени "комплементарности" олигомеров согласно изобретению (или их областей) и целевой области нуклеиновой кислоты, такой как раскрыты в данном описании, степень "комплементарности" (также "гомология" или "идентичность") выражена как процент идентичности (или процент гомологии) последовательности олигомера (или его области) и последовательности области-мишени (или обратного комплемента области-мишени) при их наилучшем выравнивании. Процент рассчитывается путем подсчета числа выровненных оснований, которые идентичны в двух последовательностях, деления на общее число непрерывных мономеров в олигомере и умножения на 100. При таком сравнении, если существуют промежутки, то желательно, чтобы такие промежутки представляли собой только области, в которых число мономеров в промежутке отличается в олигомере согласно изобретению и в области-мишени.

Используемые в данном документе термины "гомологичный" и "гомология" являются взаимозаменяемыми с терминами "идентичный" и "идентичность".

Термины "соответствующий" и "соответствует" относятся к сравнению нуклеотидной последовательности олигомера (т.е. последовательности нуклеиновых сонований или оснований) или непрерывной нуклеотидной последовательности (первой области) с эквивалентной непрерывной нуклеотидной последовательностью другой последовательности, выбранной либо среди i) подпоследовательности обратного комплемента нуклеиновой кислоты-мишени. Нуклеотидные аналоги сравнивают непосредственно с их эквивалентами или соответствующими нуклеотидами. Первая последовательность, которая соответствует другой последовательности i) или ii), как правило, совпадает с этой последовательностью по всей длине первой последовательности (такой как непрерывная нуклеотидная последовательность) или, как описано в данном документе, в некоторых воплощениях может быть гомологичной соответствующей последовательности по меньшей мере на 80%, например по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 91%, по меньшей мере на 92%, по меньшей мере на 93%, по меньшей мере на 94%, по меньшей мере на 95%, по меньшей мере на 96%, например гомологичны на 100% (идентичны).

Термины "соответствующий нуклеотидный аналог" и "соответствующий нуклеотид" предназначены для указания того, что нуклеотид в нуклеотидном аналоге и природном нуклеотиде идентичны. Например, когда 2-дезоксирибозное звено нуклеотида связано с аденином, то "соответствующий нуклеотидный аналог" содержит пентозное звено (отличное от 2-дезоксирибозы), связанное с аденином.

Термины "обратный комплемент", "обратно комплементарный" и "обратная комплементарность", используемые в данном документе, являются взаимозаменяемыми с терминами "комплемент", "комплементарный" и "комплементарность".

Таким образом, непрерывная нуклеотидная последовательность олигомера (первая область или первая и вторая области) может быть комплементарной мишени, такой, как описана в данном документе.

В некоторых воплощениях первая область или первая и вторая области образуют единую непрерывную нуклеотидную последовательность, которая комплементарна области mРНК-мишени, такой как описана в данном документе, в том числе, например, АроВ-100 (NM_000384.2 GI: 105990531 или PCSK9 (NM_174936.3 GI: 299523249).

Длина

Олигомеры могут содержать или состоять из непрерывной нуклеотидной последовательности, содержащей в общей сложности 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 и 35 последовательных нуклеотидов в длину.

В некоторых воплощениях олигомеры содержат или состоят из непрерывной нуклеотидной последовательности, содержащей в общей сложности 10-22, например 12-18, например 13-17 или 12-16, например 13, 14, 15, 16 смежных нуклеотидов в длину.

В некоторых воплощениях олигомеры содержат или состоят из непрерывной нуклеотидной последовательности, содержащей в общей сложности 10, 11, 12, 13 или 14 последовательных нуклеотидов в длину.

В некоторых воплощениях олигомер согласно изобретению состоит не более чем из 22 нуклеотидов, например, не более чем из 20 нуклеотидов, например, не более чем из 18 нуклеотидов, например, из 15, 16 или 17 нуклеотидов. В некоторых воплощениях олигомер согласно изобретению содержит менее 20 нуклеотидов. Следует понимать, что когда для олигомера приведен диапазон или длина непрерывной последовательности нуклеотидов, она включает нижние и верхние значения, предусмотренные в диапазоне, например, 10-30 (от 10 до 30) включает как 10, так и 30.

Нуклеозиды и нуклеозидные аналоги

Термин "нуклеотид", используемый в данном документе, относится к гликозиду, содержащему сахарную группировку (или ее аналог), основную группировку и ковалентно связанную группу (связывающую группу), например, фосфатную или фосфоротиоатную межнуклеотидную связывающую группу, и охватывает как природные нуклеотиды, такие как ДНК или РНК, так и неприродные нуклеотиды, содержащие модифицированные сахарные и/или основные группировки, которые в данном документе также называют "нуклеотидными аналогами". При этом один нуклеотид (звено) также может упоминаться как мономер или нуклеиново-кислотное звено.

Следует понимать, что в контексте данного изобретения термины "нуклеозид" и "нуклеотид" используются для обозначения как природных нуклеотидов/побочных продуктов, таких как ДНК и РНК, так и аналогов нуклеотидов/побочных продуктов.

В области биохимии термин "нуклеозид" обычно используется для обозначения гликозида, содержащего сахарную группировку и основную часть, и, следовательно, может быть использован по отношению к нуклеотидным звеньям, которые ковалентно связаны межнуклеозидными связями между нуклеотидами олигомера. В области биотехнологии термин "нуклеотид" часто используется для обозначения нуклеиново-кислотного мономера или звена и, таким образом, в контексте олигонуклеотида может относиться к основанию - например, "нуклеотидная последовательность", как правило, относится к последовательности нуклеиновых оснований (т.е. подразумевается наличие сахарного остова и межнуклеозидных связей). Кроме того, в частности, в случае олигонуклеотидов, когда модифицирована одна или более из межнуклеозидных связывающих групп, термин "нуклеотид" может относиться к "нуклеозиду", например, термин "нуклеотид" может быть использован даже при указании на наличие или природу связей между нуклеозидами.

Специалисту в данной области будет понятно, что 5'-концевой нуклеотид олигонуклеотида не содержит 5'-межнуклеозидную связывающую группу, хотя может содержать или не содержать 5'-концевую группу.

Неприродные нуклеотиды включают нуклеотиды с модифицированными сахарными группировками, такие как бициклические нуклеотиды или 2'-модифицированные нуклеотиды, например, 2'-замещенные нуклеотиды.

"Нуклеотидные аналоги" являются вариантами природных нуклеотидов, таких как ДНК- или РНК-нуклеотиды, в силу модификаций в сахарной и/или основной группировках. Аналоги в принципе могут быть лишь "молчащими" или "эквивалентными" природным нуклеотидам в контексте олигонуклеотида, т.е. не иметь функционального влияния на путь, по которому олигонуклеотид ингибирует экспрессию гена-мишени. Тем не менее, такие "эквивалентные" аналоги могут быть полезны, например, если они легче и дешевле в производстве или более стабильны при хранении и в производственных условиях, или представляют собой тэг или метку. Тем не менее, предпочтительно, чтобы аналоги имели функциональное влияние на тот путь, по которому олигомер ингибирует экспрессию; например, давая повышенную аффинность связывания с мишенью и/или повышенную устойчивостью к действию внутриклеточных нуклеаз и/или повышенное удобство транспортировки в клетку. Конкретные примеры нуклеозидных аналогов описаны, например, в Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 и Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, и на схеме 1:

Таким образом, олигомер может содержать или состоять из простой последовательности природных нуклеотидов - предпочтительно 2'-дезоксинуклеотидов (как правило, упоминаемых в данном документе как "ДНК"), но также, возможно, рибонуклеотидов (как правило, называемых в данном документе как "РНК"), или из комбинации таких природных нуклеотидов и одного или более чем одного неприродного нуклеотида, т.е. нуклеотидных аналогов. Такие нуклеотидные аналоги могут соответствующим образом усиливать аффинность олигомера к последовательности-мишени.

Примеры подходящих и предпочтительных нуклеотидных аналогов приведены в WO 2007/031091 или в ссылках в нем. Другие нуклеотидные аналоги, которые могут быть использованы в олигомере согласно изобретению, включают трициклические нуклеиновые кислоты, например, см. WO 2013154798 и WO 2013154798, которые включены в данный документ посредством ссылки.

Включение в олигомер нуклеотидных аналогов с повышенной аффинностью, таких как LNA или 2'-замещенные сахара, позволяет сократить размер специфически связывающегося олигомера, а также снизить верхнюю границу размера олигомера до того, как происходит неспецифическое или аберрантное связывание.

Олигомерные соединения, такие как антисмысловые олигонуклеотиды, такие как соединения, упоминаемые в данном документе, в том числе область А, а в некоторых дополнительных воплощениях область В, могут содержать один или более чем один нуклеозид, в котором сахарная группа была модифицирована. Такие сахар-модифицированные нуклеозиды (аналоги нуклеозидов) могут придавать антисмысловым соединениям повышенную устойчивость к действию нуклеаз, повышенную аффинность связывания или какое-либо другое полезное биологическое свойство. В некоторых воплощениях нуклеозиды содержат химически модифицированную рибофуранозную кольцевую группировку.

В некоторых воплощениях олигомер или его первая область содержит по меньшей мере один, например, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19, по меньшей мере 20, по меньшей мере 21, по меньшей мере 22, по меньшей мере 23, по меньшей мере 24 или 25 нуклеозидных аналогов, таких как сахар-модифицированные нуклеозидные аналоги.

Бициклические нуклеозидные аналоги включают нуклеозидные аналоги, которые содержат мостик (или бирадикал), связывающий второй и последующий углерод рибозного кольца, (мостик или бирадикал С4*-С2*). Наличие бирадикала между вторым и четвертым углеродом закрывает рибозу в 3'-эндо- (северной) конформации, и такие бициклические нуклеозидные аналоги с С2*-С4*-бирадикалом часто называют закрытыми нуклеиновыми кислотами (LNA). В некоторых воплощениях нуклеозидные аналоги (возможно, независимо) выбраны из группы, состоящей из бициклических нуклеозидных аналогов (например, LNA) и/или 2'-замещенных нуклеозидных аналогов, например, выбраны (возможно, независимо) из группы, состоящей из 2'-O-алкил-РНК-звеньев, 2'-ОМе-РНК-звеньев, 2'-амино-ДНК-звеньев, 2'-АР, 2'-FANA, 2'-(3-гидрокси)пропила и 2'-фтор-ДНК-звеньев и/или других (возможно) сахар-модифицированных нуклеозидных аналогов, таких как морфолино, пептиднуклеиновая кислота (PNA), CeNA, несвязанная нуклеиновая кислота (UNA), гекситол-нуклеиновая кислота (HNA), бицикло-HNA (см., например, WO 2009/100320). В некоторых воплощениях нуклеозидные аналоги повышают аффинность первой области к ее нуклеиновой кислоте-мишени (или комплементарной ДНК- или РНК-последовательности).

В некоторых воплощениях олигомер содержит по меньшей мере один бициклический нуклеотидный аналог, например, LNA. В некоторых воплощениях первая область включает по меньшей мере один бициклический нуклеозидный аналог (например, LNA) и/или 2'-замещенный нуклеозидный аналог. В некоторых воплощениях все нуклеозидные аналоги, присутствующие в олигомере, содержат одну и ту же модификацию сахара. В некоторых воплощениях по меньшей мере один нуклеозидный аналог, присутствующий в первой области, представляет собой бициклический нуклеозидный аналог, например, по меньшей мере 2, по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, например, все нуклеозидные аналоги (за исключением ДНК- и/или РНК-нуклеозидов области В) являются сахар-модифицированными нуклеозидными аналогами, такими как бициклические нуклеозидные аналоги, такие как LNA, например бета-DX-LNA или альфа-LX-LNA (где X представляет собой окси, амино или тио), или другие описанные здесь LNA, в том числе, но не ограничиваясь ими, (R/S) сЕТ, сМОЕ или 5'-Me-LNA.

Примеры химически модифицированных рибофуранозных колец включают, но не ограничиваясь ими, добавление замещающих групп (в том числе 5'- и 2'-замещающие групп); образование мостиков от негеминальных кольцевых атомов с формированием бициклических нуклеиновых кислот (bicyclic nucleic acid, BNA); замену рибозильного кольцевого атома кислорода на S, N(R) или C(R1)(R2) (R=Н, C12-алкил или защитную группу); и их комбинации. Примеры химически модифицированных Сахаров включают 2'-F-5'-метил-замещенный нуклеозид (см. международную заявку на патент РСТ WO 2008/101157, опубликованную 8/21/08, для других раскрытых 5',2'-бис-замещенных нуклеозидов), замену рибозильного атома кислорода на S с последующим замещением в 2'-позиции (см. заявку на патент США US 2005/0130923, опубликованную 16 июня 2005 г) или, в качестве альтернативы, 5'-замещение BNA (см. международную заявку на патент РСТ WO 2007/134181, опубликованную 11/22/07, в которой LNA замещена, например, 5'-метил- или 5'-винил-группой).

Примеры нуклеозидов с модифицированными сахарными группировками включают, но не ограничиваясь ими, нуклеозиды, содержащие 5'-винил-, 5'-метил- (R или S), 4'-S-, 2'-F-, 2'-ОСН3- и 2'-O(СН2)2ОСН3-замещающие группы. Заместитель в 2'-положении также может быть выбран среди аллила, амино, азидо, тио, О-аллила, O-C110-алкила, OCF3, О (CH2)2SCH3, О (СН2)2-O-N(Rm)(Rn) и O-CH2-C(=O)-N(Rm)(Rn), где каждый Rm и Rn независимо представляет собой Н или замещенный или незамещенный С110-алкил.

Используемый в данном документе термин "бициклические нуклеозиды" относится к модифицированным нуклеозидам, включающим бициклическую сахарную группировку. Примеры бициклических нуклеозидов включают, но не ограничиваясь ими, нуклеозиды, содержащие мостик между рибозильными кольцевыми 4'- и 2'-атомами. В некоторых воплощениях соединения, предлагаемые в данном изобретении, включают один или более чем один бициклический нуклеозид, где мостик содержит бициклический 4'-2'-нуклеозид. Примеры таких бициклических 4'-2'-нуклеозидов включают, но не ограничиваясь ими, одну из формул: 4'-(СН2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(СН2)2-O-2' (ENA); 4'-СН(СН3)-O-2' и 4'-СН(СН2ОСН3)-O-2* и их аналоги (см. патент США 7399845, выданный 15 июля 2008 г); 4'-С(СН3)(СН3)-O-2' и ее аналоги (см. международную заявку на патент РСТ WO 2009/006478, опубликованную 8 января 2009); 4'-СН2-N(OCH3)-2' и ее аналоги (см. международную заявку на патент РСТ WO 2008/150729, опубликованную 11 декабря 2008); 4'-CH2-O-N(CH3)-2' (см. заявку на патент США US 2004/0171570, опубликованную 2 сентября 2004); 4'-CH2-N(R)-O-2', где R представляет собой Н, С110-алкил или защитную группу (см. патент США 7427672, выданный 23 сентября 2008); 4'-СН2-С(Н)(СН3)-2' (см. Chattopadhyaya, et al, J. Org. Chem.,2009, 74, 118-134); и 4'-CH2-C(=CH2)-2' и ее аналоги (см. международную заявку на патент РСТ WO 2008/154401, опубликованную 8 декабря 2008). Также см., например: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc, 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol, 2001, 8, 1-7; Oram et al, Curr. Opinion Mol. Ther., 2001, 3, 239-243; патенты США U.S. №№6670461, 7053207, 6268490, 6770748, 6794499, 7034133, 6525191, 7399845; опубликованные международные заявки на патент РСТ WO 2004/106356, WO 94/14226, WO 2005/021570 и WO 2007/134181; публикации патентных заявок США US 2004/0171570, US 2007/0287831 и US 2008/0039618; серии патентов США №№12/129154, 60/989574, 61/026995, 61/026998, 61/056564, 61/086231, 61/097787 и 61/099,844; и международные заявки на патент №№ PCT/US 2008/064591, PCT/US 2008/066154 и PCT/US 2008/068922. Каждый из вышеуказанных бициклических нуклеозидов может быть получен с одной или более чем одной стереохимической конфигурацией сахара, включая, например, a-L-рибофуранозу и бета-D-рибофуранозу (см. международную заявку на патент РСТ DK98/00393, опубликованную 25 марта 1999 года как WO 99/14226).

В некоторых воплощениях бициклические сахарные группировки BNA-нуклеозидов включают, но не ограничиваясь ими, соединения, имеющие по меньшей мере один мостик между 4' и 2'-положением пентафуранозильной сахарной группировки, причем такие мостики независимо содержат 1 или от 2 до 4 связанных групп, независимо выбранных среди -[CiRaXRb)]-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -О-, -Si(Ra)2-, -S(=O)x- и -N(Ra)-; где: x составляет 0, 1 или 2; n составляет 1, 2, 3 или 4; каждый из Ra и Rb независимо представляет собой Н, защитную группу, гидроксильную группу, С112-алкил, замещенный С112-алкил, С212-алкенил, замещенный С212-алкенил, С212-алкинил, замещенный С212-алкинил, С520-арил, замещенный С520-арил, гетероциклический радикал, замещенный гетероциклический радикал, гетероарил, замещенный гетероарил, ациклический С57-радикал, замещенный ациклический С57-радикал, галоген, OJ1, NJ1J2, SJ1, N3, COOJ1, ацил (C(=O)-H), замещенный ацил, CN, сульфонил (S(=O)2-J1), или сульфонил (S(=O)-J1); и каждый из J1 и J2 независимо представляет собой Н, С16-алкил, замещенный С112-алкил, С212-алкенил, замещенный С212-алкенил, С212-алкинил, замещенный С212-алкинил, С520-арил, замещенный С520-арил, ацил (С(=O)-Н), замещенный ацил, гетероциклический радикал, замещенный гетероциклический радикал, С1-С12-аминоалкил, замещенный С112-аминоалкил или защитную группу.

В некоторых воплощениях мостик бициклической сахарной группировки представляет собой -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(RaRb)-N(R)-O- или -C(RaRb)-O-N(R)-. В некоторых воплощениях мостик представляет собой 4'-СН2-2', 4'-(СН2)2-2', 4'-(СН2)3-2', 4'-CH2-O-2', 4*-(СН2)2-O-2', 4'-CH2-O-N(R)-2' и 4'-CH2-N(R)-O-2'-, где каждый из R независимо представляет собой Н, защитную группу или С1-C12-алкил.

В некоторых воплощениях бициклические нуклеозиды дополнительно определяются изомерной конфигурацией. Например, нуклеозид, включающий 4'-2'-метиленокси-мостик, может быть в a-L-конфигурации или в бета-D-конфигурации. Ранее a-L-метиленокси-(4'-CH2-O-2')-BNA был включены в антисмысловые олигонуклеотиды, которые показали антисмысловую активность (Frieden et al, Nucleic Acids Research, 2003, 21, 6365- 6372).

В некоторых воплощениях бициклические нуклеозиды включают, но не ограничиваясь ими, (A) a-L-метиленокси-(4'-CH2-O-2')-BNA, (В) бета-D-метиленокси-(4'-СН2-O-2')-BNА, (С) этиленокси-(4'-(СН2)2-О-2')-BNА, (D) аминоокси-(4'-CH2-O-N(R)-2')-BNA, (Е) оксиамино-(4'-CH2-N(R)-O-2')-BNA, (F) метил(метиленокси)-(4'-CH(CH3)-O-2')-BNA, (G) метилен-тио-(4'-CH2-S-2')-BNA, (H) метилен-амино-(4'-CH2-N(R)-2')-BNA, (I) карбоциклическую метил-(4'-СН2-CH(CH3)-2')-BNA и (J) карбоциклическую пропилен-4'-(CH2)3-2')-BNA, изображенные ниже.

,

где Вх является основной группировкой, a R независимо представляет собой Н, защитную группу или С12-алкил. В некоторых воплощениях бициклический нуклеозид имеет формулу I:

где:

Вх является гетероциклической основной группировкой;

-Qa-Qb-Qc- представляет собой -CH2-N(Rc)-CH2-, -C(=O)-N(Rc)-CH2-, -СН2-O-N(Rc)-, -CH2-N(Rc)-O- или -N(Rc)-O-CH2;

Rc представляет собой С112-алкил или амино-защитную группу; и

каждый Та и Тb независимо представляет собой Н, гидроксил-защитную группу, конъюгационную группу, реакционноспособную фосфорсодержащую группу, фосфорсодержащую группировку или ковалентно присоединен к поддерживающей среде.

В некоторых воплощениях бициклический нуклеозид имеет формулу II:

,

где:

Вх является гетероциклической основной группировкой;

каждый из Та и Тb независимо представляет собой Н, гидроксил-защитную группу, конъюгационную группу, реакционноспособную фосфорсодержащую группу, фосфорсодержащую группировку или ковалентно присоединен к поддерживающей среде; Za представляет собой С16-алкил, С26-алкенил, С26-алкинил, замещенный С16-алкил, замещенный С26-алкенил, замещенный С26-алкинил, ацил, замещенный ацил, замещенный амид, тиол или замещенный тио.

В некоторых воплощениях каждая из замещенных групп независимо моно- или полизамещена замещающей группой, независимо выбранной среди галогена, оксо, гидроксил, OJc, NJd, SJC, N3, OC(=X)Jc и NJeC(=X)NJcJd, где каждый из Jc, Jd, и Je независимо представляет собой Н, С16-алкил или замещенный С16-алкил, а X представляет собой О или NJC.

В некоторых воплощениях бициклический нуклеозид имеет формулу III:

,

где:

Вх является гетероциклической основной группировкой;

каждый из Та и Тb независимо представляет собой Н, гидроксил-защитную группу, конъюгационную группу, реакционноспособную фосфорсодержащую группу, фосфорсодержащую группировку или ковалентно присоединен к поддерживающей среде;

Rd представляет собой С16-алкил, С26-алкенил, С26-алкинил, замещенный С16-алкил, замещенный С26-алкенил, замещенный С26-алкинил или замещенный ацил (С(=O)-).

В некоторых воплощениях бициклический нуклеозид имеет формулу IV:

,

где:

Вх является гетероциклической основной группировкой;

каждый из Та и Тb независимо представляет собой Н, гидроксил-защитную группу, конъюгационную группу, реакционноспособную фосфорсодержащую группу, фосфорсодержащую группировку или ковалентно присоединен к поддерживающей среде;

Rd представляет собой С16-алкил, замещенный С16-алкил, С26-алкенил, замещенный С26-алкенил, С26-алкинил, замещенный С26-алкинил; каждый из qb, qc и qd независимо представляет собой Н, галоген, С16-алкил, замещенный С16-алкил, С26-алкенил, замещенный С26-алкенил, С26-алкинил или замещенный С26-алкинил, С16-алкоксил, замещенный С16-алкоксил, ацил, замещенный ацил, С16-аминоалкил или замещенный С16-аминоалкил.

В некоторых воплощениях бициклический нуклеозид имеет формулу V:

,

где:

Вх является гетероциклической основной группировкой;

каждый из Та и Тb независимо представляет собой Н, гидроксил-защитную группу, конъюгационную группу, реакционноспособную фосфорсодержащую группу, фосфорсодержащую группировку или ковалентно присоединен к поддерживающей среде; каждый из qa, qb, qc и qf независимо представляет собой водород, галоген, С112-алкил, замещенный С112-алкил, С212-алкенил, замещенный С212-алкенил, С212-алкинил, замещенный С212-алкинил, С112-алкокси, замещенный С112-алкокси, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(=O)OJj, C(=O)NJjJk, C(=O)Jj, O-C(=O)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=O)NJjJk или N(H)C(=S)NJjJk; или qe и qf вместе представляют собой =C(qg)(qh); каждый из qg и qh независимо представляет собой Н, галоген, С112-алкил или замещенный С112-алкил.

Синтез и получение метиленокси-(4'-СН2-O-2')-ВМА-мономеров аденина, цитозина, гуанина, 5-метилцитозина, тимина и урацила вместе с их олигомеризацией, а также свойства распознавания нуклеиновых кислот были описаны (см., например, Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNA и их получение описаны также в WO 98/39352 и WO 99/14226.

Также были получены аналоги метиленокси-(4'-СН2-O-2')-ВNА, метиленокси-(4'-СН2-O-2')-ВNА и 2'-тио-ВNА (см., например, Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Получение закрытых нуклеозидных аналогов, содержащих олигодезоксирибонуклеотидные дуплексы в качестве субстратов для полимераз нуклеиновых кислот, также было описано (см., например, Wengel et al., WO 99/14226). Кроме того, в данной области был описан синтез 2'-амино-ВNА, нового конформационно ограниченного высокоаффинного олигонуклеотидного аналога (см., например, Singh et al., J. Org. Chem., 1998, 63, 10035-10039). Кроме того, были получены 2'-амино- и 2'-метиламино-BNA, и термическая стабильность их дуплексов с комплементарными РНК- и ДНК-нитями уже приводилась ранее.

В некоторых воплощениях бициклический нуклеозид имеет формулу VI:

,

где:

Вх является гетероциклической основной группировкой;

каждый из Та и Тb независимо представляет собой Н, гидроксил-защитную группу, конъюгационную группу, реакционноспособную фосфорсодержащую группу, фосфорсодержащую группировку или ковалентно присоединен к поддерживающей среде; каждый из qj, qj, qk и ql независимо представляет собой Н, галоген, С112-алкил, замещенный С112-алкил, С212-алкенил, замещенный С212-алкенил, С212-алкинил, замещенный С212-алкинил, С112-алкоксил, замещенный С212-алкоксил, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(=O)OJj, C(=O)NJjJk, C(=O)Jj, O-C(=O)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=O)NJjJk или (H)C(=S)NJjJk; a qi и qj или ql и qk вместе представляют собой =C(qg)(qh), где каждый из qg и qh независимо представляет собой Н, галоген, С112-алкил или замещенный С16-алкил.

Был описан один карбоциклический бициклический нуклеозид с 4'-(СН2)3-2'-мостиком и алкенил-аналог, мостик 4'-СН=СН-СН2-2', (см., например, Freier et al, Nucleic Acids Research, 1997, 25(22), 4429-4443 и Albaek et al, J. Org. Chem., 2006, 71, 7731-77 '40). Синтез и получение карбоциклических бициклических нуклеозидов вместе с их олигомеризацией, а также биохимические исследования также были описаны (см., например, Srivastava et al, J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

Используемый в данном документе термин "4'-2'-бициклический нуклеозид" относится к бициклическому нуклеозиду, содержащему фуранозное кольцо с мостиком, соединяющим 2-атом углерода и 4-атом углерода.

Используемый в данном документе термин "моноциклические нуклеозиды" относится к нуклеозидам, содержащим сахар-модифицированные группировки, которые не являются бициклическими сахарными группировками. В некоторых воплощениях сахарная группировка или аналог сахарной группировки нуклеозида может быть изменен или замещен в любом положении.

Используемый в данном документе термин "2'-модифицированный сахар" означает фуранозильный сахар, модифицированный в 2'-положении. В некоторых воплощениях такие модификации включают заместители, выбранные среди: галогенида, включая, но не ограничиваясь ими, замещенный и незамещенный алкокси, замещенный и незамещенный тиоалкил, замещенный и незамещенный аминоалкил, замещенный и незамещенный алкил, замещенный и незамещенный аллил и замещенный и незамещенный алкинил. В некоторых воплощениях 2'-модификации выбраны среди заместителей, включая, но не ограничиваясь ими: O[(CH2)nO]mCH3, , , , OCH2C(=O)N(H)CH3 и O(CH2)nON[(CH2)nCH3]2, где n и m составляют от 1 до примерно 10. Другие 2'-замещающие группы также могут быть выбраны среди: С112-алкила; замещенного алкила; алкенила; алкинила; алкарила; аралкила; О-алкарила или О-аралкила; SH; SCH3; OCN; Cl; Br; CN; CF3; OCF3; SOCH3; S02CH3; ONO2; NO2; N3; NH2; гетероциклоалкила; гетероциклоалкарила; аминоалкиламино; полиалкиламино; замещенного силила; R; расщепляющей группы; репортерной группы; интеркалятора; группы для улучшения фармакокинетических свойств; группы для улучшения фармакодинамических свойств антисмыслового соединения, и других заместителей, имеющих аналогичные свойства. В некоторых воплощениях модифицированные нуклеозиды содержат боковую цепь 2'-МОЕ (см., например, Baker et al., J. Biol. Chem., 1997, 272, 1 1944-12000). Такое 2'-МОЕ-замещение было описано как имеющее улучшенную аффинность связывания по сравнению с немодифицированными нуклеозидами и с другими модифицированными нуклеозидами, такими как 2'-O-метил, О-пропил, и О-аминопропил. Также было показано, что олигонуклеотиды, имеющие 2'-МОЕ-заместитель, являются антисмысловыми ингибиторами экспрессии генов с перспективной возможностью применения in vivo (см., например, Martin, P., He/v. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; и Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

Используемый в данном документе термин "модифицированный тетрагидропирановый нуклеозид" или "модифицированный ТНР-нуклеозид" означает нуклеозид, имеющий шестичленный тетрагидропирановый "сахар", замещенный пентафуранозильным остатком в нормальных нуклеозидах (сахарный суррогат). Модифицированные ТНР-нуклеозиды включают, но не ограничиваясь ими, то, что называют в данной области гекситол-нуклеиновой кислотой (HNA), анитол-нуклеиновой кислотой (anitol nucleic acid, ANA), маннитол-нуклеиновой кислотой (manitol nucleic acid, MNA) (см. Leumann, CJ. Bioorg. and Med. Chem. (2002) 10: 841-854), фтор-HNA (F-HNA), или соединения, имеющие формулу X:

Формула X

где независимо для каждого из указанных (по меньшей мере одного) тетрагидропирановых нуклеозидных аналогов формулы X:

Вх представляет собой гетероциклическую основную группировку;

каждый из Т3 и Т4 независимо представляет собой межнуклеозидную связывающую группу, связывающую тетрагидропирановый нуклеозидный аналог с антисмысловым соединением, или один из Т3 и Т4 представляет собой межнуклеозидную связывающую группу, связывающую тетрагидропирановый нуклеозидный аналог с антисмысловым соединением, а другой из Т3 и Т4 представляет собой Н, гидроксил-защитную группу, связанную конъюгационную группу или 5'- или 3'-концевую группу; каждый из q1 q2 q3 q4 q5, q6 и q7 независимо представляет собой H, С16-алкил, замещенный С16-алкил, С26-алкенил, замещенный С26-алкенил, С26-алкинил или замещенный С26-алкинил; и один из R1 и R2 представляет собой водород, а другой выбран среди галогена, замещенного или незамещенного алкокси, NJ, J2, SJ, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X) NJ1J2 и CN, где X представляет собой О, S или NJ1, а каждый из J1, J2 и J3 независимо представляет собой Н или C16-алкил.

В некоторых воплощениях предусмотрены модифицированные ТНР-нуклеозиды формулы X, в которой каждый из qm, qn, qp, qr, qs, qt и qu представляет собой H. В некоторых воплощениях по меньшей мере один из qm, qn, qp, qr, qs, qt и qu отличается от H. В некоторых воплощениях по меньшей мере один из qm, qn, qp, qr, qs, qt и qu представляет собой метил. В некоторых воплощениях предусмотрены ТНР-нуклеозиды формулы X, в которой один из R1 и R2 представляет собой F. В некоторых воплощениях R1 представляет собой фтор, а R2 представляет собой Н, R1 представляет собой метокси, a R2 представляет собой Н, и R1 представляет собой метоксиэтокси, a R2 представляет собой Н.

Используемый в данном документе термин "2'-модифицированный" или "2'-замещенный" относится к нуклеозиду, содержащему сахар, содержащий заместитель в 2'-положении, отличный от Н или ОН. 2'-модифицированные нуклеозиды включают, но не ограничиваясь ими, нуклеозиды с немостиковыми 2'-заместителями, такими как аллил, амино, азидо, тио, О-аллил, O-C110-алкил, -OCF3, O-(СН2)2-O-СН3, 2'-O(CH2)2SCH3, O-(СН2)2-O-N(Rm)(Rn) или O-СН2-С(=O)-N(Rm)(Rn), где каждый из Rm и Rn независимо представляет собой Н или замещенный или незамещенный C110-алкил. 2'-модифицированные нуклеозиды могут дополнительно содержать другие модификации, например, в других положениях сахара и/или на нуклеиновом основании.

Используемый в данном документе термин "2'-F" относится к сахару, включающему фторсодержащую группу в 2'-положении.

Используемые в данном документе термины "2'-ОМе" или "2'-ОСН3" или "2'-O-метил" относятся к нуклеозиду, содержащему сахар с -ОСН3-группой в 2'-положении сахарного кольца.

Используемый в данном документе термин "олигонуклеотид" относится к соединению, содержащему множество связанных нуклеозидов.

В некоторых воплощениях один или более чем один из множества нуклеозидов модифицирован. В некоторых воплощениях олигонуклеотид содержит один или более чем один рибонуклеозид (РНК) и/или дезоксирибонуклеозид (ДНК).

В данной области также известны многие другие бицикло- и трицикло-сахаро-суррогатные кольцевые системы, которые могут быть использованы для модификации нуклеозидов для включения в антисмысловые соединения (см., например, обзорную статью: Leumann, J. С, Bioorganic and Medicinal Chemistry, 2002, 10, 841-854). Такие кольцевые системы также могут подвергаться различным дополнительным заменам для повышения активности. Способы получения модифицированных Сахаров хорошо известны специалистам в данной области. В нуклеотидах с такими модифицированными сахарными группировками нуклеотидные группировки (природные, модифицированные или их сочетание) сохраняются для гибридизации с соответствующей нуклеиновой кислотой-мишенью.

В некоторых воплощениях антисмысловые соединения содержат один или более чем один нуклеотид, имеющий модифицированные сахарные группировки. В некоторых воплощениях модифицированная сахарная группировка представляет собой 2'-МОЕ. В некоторых воплощениях 2'-МОЕ-модифицированные нуклеотиды расположены в гэпмерном мотиве. В некоторых воплощениях модифицированная сахарная группировка представляет собой cEt. В некоторых воплощениях cEt-модифицированные нуклеотиды расположены по всей длине крыльев гэпмерного мотива.

В некоторых воплощениях в BNA (LNA) R4* и R2* вместе обозначают бирадикал -O-СН(СН2ОСН3)- (2'O-метоксиэтил-бициклическую нуклеиновую кислоту - Seth at al., 2010, J. Org. Chem) либо в R-, либо в S-конфигурации.

В некоторых воплощениях в BNA (LNA) R4* и R2* вместе обозначают бирадикал O-СН(СН2СН3)- (2'O-этил-бициклическую нуклеиновую кислоту - Seth at al., 2010, J. Org. Chem) либо в R-, либо в S-конфигурации.

В некоторых воплощениях в BNA (LNA) R4* и R2* вместе обозначают бирадикал O-СН(СН3)- либо в R-, либо в S-конфигурации. В некоторых воплощениях R4* и R2* вместе обозначают бирадикал -O-СН2-O-СН2- (Seth at al., 2010, J. Org. Chem)

В некоторых воплощениях в BNA (LNA) R4* и R2* вместе обозначают бирадикал O-NR-CH3- (Seth at al., 2010, J. Org. Chem).

В некоторых воплощениях LNA-звенья имеют структуру, выбранную из следующей группы:

Таким образом, олигомер может содержать или состоять из простой последовательности природных нуклеотидов - предпочтительно 2'-дезоксинуклеотидов (как правило, называемых в данном документе "ДНК"), но также, возможно, рибонуклеотидов (как правило, называемых в данном документе "РНК") или из комбинации таких природных нуклеотидов и одного или более чем одного неприродного нуклеотида, т.е. нуклеотидного аналога. Такие нуклеотидные аналоги могут соответствующим образом усиливать аффинность олигомера к последовательности-мишени.

Включение в олигомер повышающих аффинность нуклеотидных аналогов, таких как BNA, (например) LNA или 2'-замещенных сахаров, позволяет уменьшить размер специфически связывающегося олигомера, а также снизить верхнюю границу размера олигомера, прежде чем происходит неспецифическое или аберрантное связывание.

В некоторых воплощениях олигомер содержит по меньшей мере один нуклеозидный аналог. В некоторых воплощениях олигомер содержит по меньшей мере два нуклеотидных аналога. В некоторых воплощениях олигомер содержит 3-8 нуклеотидных аналогов, например 6 или 7 нуклеотидных аналогов. В воплощениях, далеких от наиболее предпочтительных, по меньшей мере один из указанных нуклеотидных аналогов представляет собой BNA, например, закрытую нуклеиновую кислоту (LNA); например, по меньшей мере 3, или по меньшей мере 4, или по меньшей мере 5, или по меньшей мере 6, или по меньшей мере 7 или 8 нуклеотидных аналогов могут быть BNA, такими как LNA. В некоторых воплощениях все нуклеотидные аналоги могут быть BNA, такими как LNA.

Следует понимать, что когда речь идет о предпочтительном мотиве нуклеотидной последовательности или нуклеотидной последовательности, которая состоит только из нуклеотидов, олигомеры согласно изобретению, которые определены с помощью этой последовательности, могут содержать соответствующий нуклеотидный аналог вместо одного или более чем одного из нуклеотидов, присутствующих в указанной последовательности, например, BNA-звеньев или других нуклеотидных аналогов, которые повышают стабильность/Тm дуплекса олигомер/мишень (т.е. нуклеотидные аналоги с повышенной аффинностью).

Предпочтительный нуклеотидный аналог представляет собой LNA, например, окси-LNA (например, бета-D-окси-LNA и альфа-L-окси-LNА), и/или амино-LNA (например, бета-D-амино-LNA и альфа-L-амино-LNА), и/или тио-LNA (например, бета-D-тио-LNA и альфа-L-тио-LNA), и/или ENA (например, бета-D-ENA и альфа-L-ENA). Наиболее предпочтительной является бета-D-окси-LNA.

В некоторых воплощениях нуклеотидные аналоги, присутствующие в олигомере согласно изобретению, независимо выбраны, например, среди следующих: 2'-О-алкил-РНК-звенья, 2'-амино-ДНК-звенья, 2'-фтор-ДНК-звенья, BNA-звенья, например LNA-звенья, арабино-нуклеиновокислотные (arabino nucleic acid, ANA) звенья, 2'-фтор-АNА-звенья, HNA-звенья, INA (intercalating nucleic acid, интеркалирующая нуклеиновая кислота - Christensen, 2002. Nucl. Acids. Res. 2002 30: 4918-4925, включен в данный документ посредством ссылка-звенья и 2'-МОЕ-звенья. В некоторых воплощениях имеется только один из вышеуказанных типов нуклеотидных аналогов, присутствующих в олигомере согласно изобретению, такой как первая область или ее непрерывная нуклеотидная последовательность.

В некоторых воплощениях нуклеотидные аналоги представляют собой 2'-О-метоксиэтил-РНК (2'МОЕ), 2'-фтор-ДНК-мономеры или нуклеотидные LNA-аналоги, и такой олигонуклеотид согласно изобретению может содержать нуклеотидные аналоги, которые независимо выбраны среди этих трех типов аналогов, или может содержать только один тип аналога, выбранный среди этих трех типов. В некоторых воплощениях по меньшей мере один из указанных нуклеотидных аналогов представляет собой 2'-МОЕ-РНК, например, 2, 3, 4, 5, 6, 7, 8, 9 или 10 2'-МОЕ-РНК-нуклеотидных звена. В некоторых воплощениях по меньшей мере один из указанных нуклеотидных аналогов представляет собой 2'-фтор-ДНК, например, 2, 3, 4, 5, 6, 7, 8, 9 или 10 2'-фтор-ДНК нуклеотидных звена.

В некоторых воплощениях олигомер согласно изобретению содержит по меньшей мере одну BNA, например, звено закрытой нуклеиновой кислоты (LNA), например, 1, 2, 3, 4, 5, 6, 7 или 8 BNA/LNA-звеньев, например, 3-7 или 4-8 BNA/LNA-звеньев, или 3, 4, 5, 6 или 7 BNA/LNA-звеньев. В некоторых воплощениях все нуклеотидные аналоги представляют собой BNA, такие как LNA. В некоторых воплощениях олигомер может содержать и бета-D-окси-LNA, и один или более чем один из следующих LNA-звеньев: тио-LNA, амино-LNA, окси-LNA и/или ENA либо в бета-D-, либо в альфа-L-конфигурации, либо их комбинацию. В некоторых воплощениях во всех BNA, таких как LNA, цитозиновые звенья представляют собой 5'-метил-цитозин. В некоторых воплощениях изобретения олигомер (например, первая и, возможно, вторая области) может включать и BNA-, и LNA-, и ДНК-звенья. В некоторых воплощениях объединенное общее количество LNA- и ДНК-звеньев составляет 10-25, например, 10-24, предпочтительно 10-20, например, 10-18, например, 12-16. В некоторых воплощениях изобретения нуклеотидная последовательность олигомера в его первой области, такая как непрерывная нуклеотидная последовательность, состоит по меньшей мере из одной BNA, например LNA, а остальные нуклеотидные звенья представляют собой ДНК-звенья. В некоторых воплощениях олигомер или его первая область включает только BNA, например LNA, нуклеотидные аналоги и природные нуклеотиды (например, РНК или ДНК, наиболее предпочтительно ДНК-нуклеотиды), возможно, с модифицированными межнуклеотидными связями, такими как фосфоротиоатные.

Термин "нуклеиновое основание" относится к основной группировке нуклеотида и охватывает как природные, так и неприродные варианты. Таким образом, "нуклеиновое основание" охватывает не только известные пуриновые и пиримидиновые гетероциклы, но и гетероциклические аналоги и их таутомеры. Следует понимать, что ДНК- или РНК-нуклеозиды области В могут содержать природное и/или неприродное нуклеиновое основание(я).

Примеры нуклеиновых оснований включают, но не ограничиваясь ими, аденин, гуанин, цитозин, тимидин, урацил, ксантин, гипоксантин, 5-метилцитозин, изоцитозин, псевдоизоцитозин, 5-бромурацил, 5-пропинилурацил, 6-аминопурин, 2-аминопурин, инозин, диаминопурин и 2-хлор-6-аминопурин. В некоторых воплощениях нуклеиновые основания могут быть независимо выбраны из группы, состоящей из аденина, гуанина, цитозина, урацила, тимидина, 5-метилцитозина. В некоторых воплощениях нуклеиновые основания могут быть независимо выбраны из группы, состоящей из аденина, гуанина, цитозина, тимидина и 5-метилцитозина.

В некоторых воплощениях по меньшей мере один из нуклеиновых оснований, присутствующих в олигомере, представляет собой модифицированное нуклеиновое основание, выбранное из группы, состоящей из 5-метилцитозина, изоцитозина, псевдоизоцитозина, 5-бромурацила, 5-пропинилурацила, 6-аминопурина, 2-аминопурина, инозина, диаминопурина и 2-хлор-6-аминопурина.

LNA

Термин "LNA" относится к бициклическому нуклеозидному аналогу, который включает С2*-С4*-бирадикал (мостик) и известен как "закрытая нуклеиновая кислота". Он может относиться к LNA-мономеру или, при использовании в контексте "LNA-олигонуклеотид", LNA означает олигонуклеотид, содержащий один или более чем один такой бициклический нуклеотидный аналог. В некоторых аспектах бициклические нуклеозидные аналоги являются LNA-нуклеотидами и, следовательно, эти термины могут быть использованы взаимозаменяемо, и в таких воплощениях они оба будут характеризоваться наличием линкерной группы (например, мостика) между С2' и С4' рибозного сахарного кольца.

В некоторых воплощениях LNA, используемая в олигонуклеотидных соединениях согласно изобретению, предпочтительно имеет структуру общей формулы II:

,

где Y выбран из группы, состоящей из -О-, -СН2O-, -S-, -NH-, N(Re) и/или -СН2-; Z и Z* независимо выбраны среди межнуклеотидной связи, RH, концевой группы или защитной группы; В обозначает природную или неприродную нуклеотидную основную группировку (нуклеиновое основание), a RH выбран среди водорода и C1-4-алкила; Ra, Rb Rc, Rd и Re, возможно, независимо выбраны из группы, включающей водород, возможно замещенный С1-12-алкил, возможно замещенный С2-12-алкенил, возможно замещенный С2-12-алкинил, гидрокси, С1-12-алкокси, С2-12-алкоксиалкил, С2-12-алкенилокси, карбокси, С1-12-алкоксикарбонил, С1-12-алкилкарбонил, формил, арил, арилоксикарбонил, арилокси, арилкарбонил, гетероарил, гетероарилоксикарбонил, гетероарилокси, гетероарилкарбонил, амино, моно- и ди(C1-6-алкил)амино, карбамоил, моно- и ди(С1-6-алкил)-амино-карбонил, амино-С1-6-алкил-аминокарбонил, моно- и ди(С1-6-алкил)амино-С1-6-алкиламинокарбонил, С1-6-алкилкарбониламино, карбамидо, С1-6-алканоилокси, сульфоно, С1-6-алкилсульфонилокси, нитро, азидо, сульфанил, C1-6-алкилтио, галоген, ДНК-интеркаляторы, фотохимически активные группы, термохимически активные группы, хелатирующие группы, репортерные группы и лиганды, где арил и гетероарил, возможно, могут быть замещенными, и где два геминальных заместителя Ra и Rb вместе могут обозначать возможно замещенный метилен (=СН2); a RH выбран среди водорода и С1-4-алкила. В некоторых воплощениях Ra, Rb Rc, Rd и Re, возможно, независимо выбраны из группы, состоящей из водорода и С1-6-алкила, такого как метил. Для всех хиральных центров асимметричные группы могут быть найдены в R- или в S-ориентации, например, два иллюстративных стереохимических изомера включают бета-D- и альфа-L-изоформы, которые могут быть проиллюстрированы следующим образом:

Конкретные иллюстративные LNA-звенья показаны ниже:

Термин "тио-LNA" включает закрытый нуклеотид, в котором Y в общей формуле, приведенной выше, выбран среди S или CH2-S-. Тио-LNA может находиться как в альфа-L-, так и в бета-D-конфигурации.

Термин "амино-LNA" включает закрытый нуклеотид, в котором Y в общей формуле, приведенной выше, выбран среди -N(H)-, N(R)-, CH2-N(H)- и -CH2-N(R)-, где R выбран среди водорода и C1-4-алкила. Амино-LNA может находиться как в альфа-L-, так и в бета-D-конфигурации.

Термин "окси-LNA" включает закрытый нуклеотид, в котором Y в общей формуле, приведенной выше, представляет собой -О-. Окси-LNA может находиться как в альфа-L-, так и в бета-О-конфигурации.

Термин "ENA" включает закрытый нуклеотид, в котором Y в общей формуле, приведенной выше, представляет собой -СН2-O- (где атом кислорода в -СН2-O- присоединен в 2'-положении по отношению к основной В). Re представляет собой водород или метил.

В некоторых иллюстративных воплощениях LNA выбрана среди бета-D-окси-LNA, альфа-L-окси-LNA, бета-D-амино-LNA и бета-D-тио-LNA, в частности бета-D-окси-LNA.

Привлечение РНКазы

Следует признать, что олигомерные соединения могут функционировать через неопосредованную РНКазой деградацию mРНК-мишени, например, за счет стерического несоответствия трансляции или другими способами. В некоторых воплощениях олигомеры согласно изобретению способны привлекать эндорибонуклеазу (РНКазу), например, РНКазу Н.

Предпочтительно такие олигомеры, такие как область А, или непрерывная нуклеотидная последовательность состоит из области длиной по меньшей мере 6, например, по меньшей мере 7 последовательных нуклеотидных звеньев, например, по меньшей мере 8 или по меньшей мере 9 последовательных нуклеотидных звеньев (остатков), в том числе 7, 8, 9, 10, 11, 12, 13, 14, 15 или 16 последовательных нуклеотидов, которые при формировании дуплекса с комплементарной РНК-мишенью способны привлекать РНКазу. Непрерывная последовательность, которая способна привлекать РНКазу, может быть областью Y', о которой говорится в контексте гэпмера, описанного в данном документе. В некоторых воплощениях размер непрерывной последовательности, которая способна привлекать РНКазу, такой как область Y', может быть больше, например, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 нуклеотидных звеньев.

ЕР 1222309 предусматривает in vitro способы определения активности РНКазы Н, которые можно использовать для определения способности привлекать РНКазу Н. Считается, что олигомер способен привлекать РНКазу Н, если при условии комплементарности с РНК-мишенью он имеет начальную скорость, измеряемую в пмоль/л/мин, по меньшей мере 1%, например, по меньшей мере 5%, например, по меньшей мере 10% или более 20% от первоначальной скорости, определяемой с помощью только ДНК-олигонуклеотида, имеющего такую же последовательность оснований, но содержащего только ДНК-мономеры без 2'-замен с фосфоротиоатными связывающими группами между всеми мономерами в олигонуклеотиде, используя методологию, предоставленную в примерах 91-95 в ЕР 1222309.

В некоторых воплощениях олигомер считается по существу неспособным привлекать РНКазу Н, если при комплементарности с РНК-мишенью начальная скорость РНКазы Н, измеряемая в пмоль/л/мин, составляет менее 1%, например, менее 5%, например, менее 10% или менее 20% от первоначальной скорости, определяемой с помощью эквивалентного только ДНК-олигонуклеотида без 2'-замен с фосфоротиоатными связывающими группами между всеми нуклеотидами в олигонуклеотиде, используя методологию, предоставленную в примерах 91-95 в ЕР 1222309.

В других воплощениях олигомер считается по существу неспособным привлекать РНКазу Н, если, при условии комплементарности с РНК-мишенью, начальная скорость РНКазы Н, измеряемая в пмоль/л/мин, составляет менее 1%, например, менее 5%, например, менее 10% или менее 20% от первоначальной скорости, определяемой с помощью эквивалентного только ДНК-олигонуклеотида, без 2'-замен, с фосфоротиоатными линкерными группами между всеми мономерами в олигонуклеотиде, используя методологию, предоставленную в примерах 91-95 в ЕР 1222309.

Как правило, область олигомера, которая формирует непрерывные нуклеотидные звенья и при формировании дуплекса с комплементарной РНК-мишенью способна привлекать РНКазу, состоит из нуклеотидных звеньев, образующих ДНК/РНК-подобный дуплекс с РНК-мишенью. Олигомер согласно изобретению, такой как первая область, может содержать нуклеотидную последовательность, которая включает как нуклеотиды, так и нуклеотидные аналоги, и может быть, например, в виде гэпмера, хэдмера или миксмера.

"Хэдмер (headmer)" определяется как олигомер, который содержит область X' и область Y', прилегающую к ней, где наиболее близкий к 5'-концу мономер области Y' связан с наиболее близким к 3'-концу мономером области X'. Область X' представляет собой непрерывный участок не привлекающих РНКазу нуклеозидных аналогов, а область Y' представляет собой непрерывный участок (например, по меньшей мере 7 смежных мономеров) ДНК-мономеров или мономеров нуклеозидных аналогов, узнаваемых и расщепляемых РНКазой.

"Тэйлмер (tailmer)" определяется как олигомер, который содержит область X' и область Y', прилегающую к ней, где наиболее близкий к 5'-концу мономер области Y' связан с наиболее близким к 3'-концу мономером области X'. Область X' представляет собой непрерывный участок (например, по меньшей мере 7 смежных мономеров) ДНК-мономеров или мономеров нуклеозидных аналогов, узнаваемых и расщепляемых РНКазой, а область X' представляет собой непрерывный участок не привлекающих РНКазу нуклеозидных аналогов.

Другие "химерные" олигомеры, называемые "миксмерами (mixmer)", имеют переменный состав из (i) ДНК-мономеров или мономеров нуклеозидных аналогов, узнаваемых и расщепляемых РНКазой, и (ii) мономеров нуклеозидного аналога, не привлекающих РНКазу.

В некоторых воплощениях в дополнение к повышению аффинности олигомера к целевой области, некоторые нуклеозидные аналоги также опосредуют связывание и расщепление РНКазы (например, РНКазы Н). Поскольку мономеры α-L-LNA (BNA) в некоторой степени привлекают активность РНКазы Н, то в некоторых воплощениях области разрыва (например, область Y', описанная в данном документе) олигомеров, содержащих α-L-LNA-мономеры, состоят из меньшего количества мономеров, узнаваемых и расщепляемых РНКазой Н, и в конструкцию миксмера вводится большая гибкость.

Дизайн гэпмера

В некоторых воплощениях олигомер изобретения, такой как первая область, содержит или представляет собой гэпмер. Гэпмерный олигомер представляет собой олигомер, который содержит непрерывный участок нуклеотидов, который способен привлекать РНКазу, например РНКазу Н, например, область, содержащую по меньшей мере 6 или 7 ДНК-нуклеотидов, называемых в данном документе областью Y' (Y'), где область Y' примыкает и к 5'-, и к 3'-областям нуклеотидных аналогов с повышенной аффинностью, например, 1-6 нуклеотидных аналогов, расположенных на 5'- и 3'-концах непрерывного участка нуклеотидов, который способен привлекать РНКазу - эти области называют областями X'(X') и Z'(Z'), соответственно. Примеры гэпмеров раскрыты в WO 2004/046160, WO 2008/113832 и WO 2007/146511.

В некоторых воплощениях мономеры, которые способны привлекать РНКазу, выбраны из группы, состоящей из ДНК-мономеров, альфа-L-LNA-мономеров, С4'-алкилированных ДНК-мономеров (см. РСТ/ЕР 2009/050349 и Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296-2300, которые включены в данный документ посредством ссылки) и UNA (несвязанная нуклеиновая кислота)-нуклеотидов (см. Fluiter et al., Mol. Biosyst., 2009, 10, 1039, который включен в данный документ посредством ссылки). UNA представляет собой незакрытую нуклеиновую кислоту, в которой, как правило, С-С-связь С2-С3 рибозы была удалена с формированием незакрытого "сахарного" остатка. Предпочтительно гэпмер содержит (поли)нуклеотидную последовательность формулы (от 5' к 3'), X'-Y'-Z', где область Х'(Х') (5'-область) состоит из или содержит по меньшей мере один нуклеотидный аналог, например, по меньшей мере одно BNA (например LNA)-звено, например, 1-6 нуклеотидных аналогов, таких как BNA (например LNA)-звенья; область Y'(Y') состоит из или содержит по меньшей мере пять последовательных нуклеотидов, которые способны привлекать РНКазу (при формировании дуплекса с комплементарной молекулой РНК, такой как mРНК-мишень), таких как ДНК-нуклеотиды; а область Z'(Z') (3'-область) состоит из или содержит по меньшей мере один нуклеотидный аналог, например, по меньшей мере одно BNA (например LNА)-звено, например, 1-6 нуклеотидных аналогов, таких как BNA (например LNА)-звенья.

В некоторых воплощениях область X' состоит из 1, 2, 3, 4, 5 или 6 нуклеотидных аналогов, таких как BNA (например LNA)-звенья, например, из 2-5 нуклеотидных аналогов, таких как 2-5 LNA-звенья, например, из 3 или 4 нуклеотидных аналогов, таких как 3 или 4 LNA-звенья; и/или область Z' состоит из 1, 2, 3, 4, 5 или 6 нуклеотидных аналогов, таких как BNA (например LNA)-звенья, например, из 2-5 нуклеотидных аналогов, таких как 2-5 BNA (например LNA)-звенья, например, из 3 или 4 нуклеотидных аналогов, таких как 3 или 4 BNA (например LNA)-звенья.

В некоторых воплощениях Y' состоит или содержит 5, 6, 7, 8, 9, 10, 11 или 12 последовательных нуклеотидов, которые способны привлекать РНКазу, или 6-10, или 7-9, например 8, последовательных нуклеотидов, которые способны привлекать РНКазу. В некоторых воплощениях область Y' состоит из или содержит по меньшей мере одно нуклеотидное ДНК-звено, например, 1-12 ДНК-звеньев, предпочтительно 4-12 ДНК-звеньев, более предпочтительно 6-10 ДНК-звеньев, например, 7-10 ДНК-звеньев, наиболее предпочтительно 8, 9 или 10 ДНК-звеньев.

В некоторых воплощениях область X' состоит из 3 или 4 нуклеотидных аналогов, таких как BNA (например LNA), область X' состоит из 7, 8, 9 или 10 ДНК-звеньев, а область Z' состоит из 3 или 4 нуклеотидных аналогов, например BNA (например LNA). Такие дизайны включают (X'-Y'-Z') 3-10-3, 3-10-4, 4-10-3, 3-9-3, 3-9-4, 4-9-3, 3-8-3, 3-8-4, 4-8-3, 3-7-3, 3-7-4, 4-7-3.

Прочие гэпмерные конструкции раскрыты в WO 2004/046160, который включен в данный документ посредством ссылки. WO 2008/113832, который испрашивает приоритет предварительной заявки US 60/977409, включенной в данный документ посредством ссылки, сообщает о "шортмерных (shortmer)" гэпмерных олигомерах. В некоторых воплощениях олигомеры, представленные в данном документе, могут быть такими шортмерными гэпмерами.

В некоторых воплощениях олигомер, например, область X', состоит из непрерывной нуклеотидной последовательности длиной 10, 11, 12, 13 или 14 нуклеотидных звеньев, где непрерывная нуклеотидная последовательность включает или представляет собой формулу (5'-3'), X'-Y'-Z', где X' состоит из 1, 2 или 3 звеньев нуклеотидных аналогов, таких как BNA (например, LNА)-звенья; Y' состоит из 7, 8 или 9 смежных нуклеотидных звеньев, которые способны привлекать РНКазу при формировании дуплекса с комплементарной молекулой РНК (например, mРНК-мишенью); a Z' состоит из 1, 2 или 3 звеньев нуклеотидных аналогов, таких как BNA (например, LNА)-звенья.

В некоторых воплощениях X' состоит из одного BNA (например LNA)-звена. В некоторых воплощениях X' состоит из двух BNA (например, LNA)-звеньев. В некоторых воплощениях X' состоит из трех BNA (например, LNA)-звеньев. В некоторых воплощениях Z' состоит из одного BNA (например, LNA)-звена. В некоторых воплощениях Z' состоит из двух BNA (например, LNA)-звеньев. В некоторых воплощениях Z' состоит из трех BNA (например, LNA)-звеньев. В некоторых воплощениях Y' состоит из 7 нуклеотидных звеньев. В некоторых воплощениях Y' состоит из 8 нуклеотидных звеньев. В некоторых воплощениях Y' состоит из 9 нуклеотидных звеньев. В некоторых воплощениях область Y' состоит из 10 нуклеозидных мономеров. В некоторых воплощениях область Y' состоит из или содержит 1-10 ДНК-мономеров. В некоторых воплощениях Y' содержит 1-9 ДНК-звеньев, например 2, 3, 4, 5, 6, 7, 8 или 9 ДНК-звеньев. В некоторых воплощениях Y' состоит из ДНК-звеньев. В некоторых воплощениях Y' состоит по меньшей мере из одного BNA-звена, которое находится в альфа-L-конфигурации, например из 2, 3, 4, 5, 6, 7, 8 или 9 LNA-звеньев в альфа-L-конфигурации. В некоторых воплощениях Y' состоит по меньшей мере из одного альфа-L-окси-ВМА/LNА-звена, или где все LNA-звенья в конфигурации альфа-L являются альфа-L-LNA-окси-звеньями. В некоторых воплощениях число нуклеотидов, присутствующих в X'-Y'-Z', выбирают из группы, включающей (звенья нуклеотидных аналогов - область Y' - звенья нуклеотидных аналогов): 1-8-1, 1-8-2, 2-8-1, 2-8-2, 3-8-3, 2-8-3, 3-8-2, 4-8-1, 4-8-2, 1-8-4, 2 8-4, или, 1-9-1, 1-9-2, 2-9-1, 2-9-2, 2-9-3, 3-9-2, 1-9-3, 3 9-1, 4-9-1, 1-9-4 или 1-10-1, 1-10-2, 2-10-1, 2-10-2, 1-10-3, 3-10-1. В некоторых воплощениях число нуклеотидов в X'-Y'-Z' выбирают из группы, состоящей из: 2-7-1, 1-7-2, 2-7-2, 3-7-3, 2 7-3, 3-7-2, 3-7-4 и 4-7-3. В некоторых воплощениях каждая из областей X' и Y' состоит из трех BNA (например LNA)-мономеров, а область Y' состоит из 8 или 9 или 10 нуклеозидных мономеров, предпочтительно ДНК-мономеров. В некоторых воплощениях и X', и Z' состоят из двух BNA (например, LNA)-звеньев каждый, a Y' состоит из 8 или 9 нуклеотидных звеньев, предпочтительно ДНК-звеньев. В различных воплощениях другие гэпмерные конструкции включают такие, в которых участки X' и/или Z' состоят из 3, 4, 5 или 6 нуклеозидных аналогов, таких как мономеры, содержащие 2'-O-метоксиэтилрибозный сахар (2'-МОЕ), или мономеры, содержащие 2'-фтор-дезоксирибозный сахар, а область Y' состоит из 8, 9, 10, 11 или 12 нуклеозидов, таких как ДНК-мономеры, где области X'-Y'-Z' имеют 3-9-3, 3-10-3, 5-10-5 или 4-12-4 мономеров. Другие гэпмерные конструкции раскрыты в WO 2007/146511 А2, который включен в данный документ посредством ссылки.

Олигомеры с переключением сплайсинга

В некоторых воплощениях антисмысловой олигонуклеотид является олигомером с переключением сплайсинга - т.е. олигомером, который нацелен на pre-mРНК (пре-мРНК), вызывая альтернативный сплайсинг pre-mРНК.

Мишени для олигомеров с переключением сплайсинга могут включать TNF-рецептор, например SSO (splice switching oligomer, олигомер с переключением сплайсинга) может быть одним или более чем одним из TNFR SSO, раскрытых в WO 2007/058894 А1, WO 08051306 и РСТ/ЕР 2007/061211, которые включены в данный документ посредством ссылки.

Олигомеры с переключением сплайсинга, как правило, (по существу) не способны привлекать РНКазу Н, и такие гэпмерные, тэйлмерные или хэдмерные конструкции, как правило, не желательны. Тем не менее, миксмерные и тоталмерные конструкции являются подходящими конструкции для SSO.

Олигомеры с переключением сплайсинга также используются для направления на дефицит дистрофина при мышечной дистрофии Дюшенна.

Миксмеры

Большинство антисмысловых олигонуклеотидов представляют собой соединения, которые разработаны для привлечения РНКазных ферментов (например, РНКазы Н) для разрушения их намеченной мишени. Такие соединения включают фосфоротиоатные ДНК-олигонуклеотиды и гэпмер, хэдмеры и тэйлмеры. Эти соединения, как правило, содержат область по меньшей мере из 5 или 6 ДНК-нуклеотидов, и в случае гэпмеров они с обеих сторон фланкированы нуклеотидными аналогами с повышенной аффинностью.

Олигомеры согласно данному изобретению могут работать через механизм, независимый от РНКазы (например, РНКазы Н). Примерами олигомеров, которые действуют через независимый от РНКазы Н (или РНКазы) механизм, являются миксмеры и тоталмеры.

Термин "миксмер" относится к олигомерам, которые содержат и природные, и неприродные нуклеотиды, где в отличие от гэпмеров, тэйлмеров и хэдмеров нет непрерывной последовательности более чем из 5, а в некоторых воплощениях более чем из 4 последовательных, например, не более 3 последовательных природных нуклеотидов, таких как ДНК-звенья. В некоторых воплощениях миксмер содержит не более 5 последовательных нуклеозидных аналогов, таких как BNA (LNA), а в некоторых воплощениях не более 4 последовательных, например, трех последовательных нуклеозидных аналогов, таких как BNA (LNA). В таких миксмерах остальные нуклеозиды могут, например, быть ДНК-нуклеозидами и/или, в небициклических нуклеозидных аналогах, такими как описанные в данном документе, например, 2'-замещенными нуклеозидными аналогами, такими как 2'-О-МОЕ и или 2'-фтор.

Олигомер согласно данному изобретению может быть миксмером - действительно различные миксмерные конструкции обладают высокой эффективностью в качестве олигомера или его первой области, в частности, при направлении на microРНК (antimiR), сайты связывания microРНК на mРНК (Blockmirs) или олигомеры с переключением сплайсинга (SSO). См., например, WO 2007/112754 (LNA-AntimiRs™), WO 2008/131807 (LNA-олигонуклеотиды с переключением сплайсинга).

В некоторых воплощениях олигомер или миксмер может содержать BNA и 2'-замещенные нуклеозидные аналоги, возможно с ДНК-нуклеозидами - см., например, WO 07027894 и WO 2007/112754, которые включены в данный документ посредством ссылки. Конкретные примеры включают олигомеры или первые области, которые включают LNA, 2'-O-МОЕ и ДНК, LNA, 2'-фтор и 2'-O-МОЕ, 2'-O-МОЕ и 2'-фтор, 2'-О-МОЕ и 2'-фтор и LNA, или LNA и 2'-О-МОЕ и LNA и ДНК.

В некоторых воплощениях олигомер или миксмер содержит или состоит из непрерывной нуклеотидной последовательности повторяющегося паттерна нуклеотидных аналогов и природных нуклеотидов, либо одного типа нуклеотидных аналогов и второго типа нуклеотидных аналогов. Повторяющийся паттерн может быть, например, каждым вторым или каждым третьим нуклеотидом нуклеотидного аналога, таким как BNA (LNA), а остальные нуклеотиды представляют собой природные нуклеотиды, такие как ДНК, или 2'-замещенные нуклеотидные аналоги, такие как 2'МОЕ или 2'-фтор-аналоги, описанные в данном документе или, в некоторых воплощениях, выбранные из группы нуклеотидных аналогов, описанных в данном документе. Следует знать, что повторяющийся паттерн нуклеотидных аналогов, таких как LNA-звенья, может быть объединен с нуклеотидными аналогами в фиксированных позициях - например, на 5'- или 3'-конце.

В некоторых воплощениях первый нуклеотид олигомера или миксмера, считая с 3'-конца, представляет собой нуклеотидный аналог, такой как LNA-нуклеотид.

В некоторых воплощениях, которые могут быть одинаковыми или различными, второй нуклеотид олигомера или миксмера, считая с 3'-конца, представляет собой нуклеотидный аналог, такой как LNA-нуклеотид.

В некоторых воплощениях, которые могут быть одинаковыми или различными, седьмой и/или восьмой нуклеотид олигомера или миксмера, считая с 3'-конца, представляет собой нуклеотидный аналог, такой как LNA-нуклеотид.

В некоторых воплощениях, которые могут быть одинаковыми или различными, девятый и/или десятый нуклеотид первого и/или второго олигомера, считая с 3'-конца, представляет собой нуклеотидный аналог, такой как LNA-нуклеотид.

В некоторых воплощениях, которые могут быть одинаковыми или различными, 5'-конец олигомера или миксмера представляет собой нуклеотидный аналог, такой как LNA-нуклеотид.

Вышеуказанные конструкции в некоторых воплощениях могут быть включены в миксмерную конструкцию, такую как antimiR-миксмер.

В некоторых воплощениях олигомер или миксмер не содержит область из более чем 4 последовательных ДНК-нуклеотидных звеньев или более чем 3 последовательных ДНК-нуклеотидных звеньев. В некоторых воплощениях миксмер не содержит область из более чем двух последовательных ДНК-нуклеотидных звеньев.

В некоторых воплощениях олигомер или миксмер содержит по меньшей мере область, состоящую по меньшей мере из двух последовательных звеньев нуклеотидных аналогов, например, по меньшей мере из двух последовательных LNA-звеньев.

В некоторых воплощениях олигомер или миксмер содержит по меньшей мере область, состоящую по меньшей мере из трех последовательных звеньев нуклеотидных аналогов, например по меньшей мере из трех последовательных LNA-звеньев.

В некоторых воплощениях олигомер или миксмер согласно данному изобретению не содержит область более 7 последовательных звеньев нуклеотидных аналогов, таких как LNA-звенья. В некоторых воплощениях олигомер или миксмер согласно данному изобретению не содержит область более 6 последовательных звеньев аналоговых нуклеотидов, таких как LNA-звенья. В некоторых воплощениях олигомер или миксмер согласно данному изобретению не содержит область длиной более 5 последовательных звеньев аналоговых нуклеотидов, таких как LNA-звенья. В некоторых воплощениях олигомер или миксмер согласно данному изобретению не содержит область длиной более 4 последовательных звеньев аналоговых нуклеотидов, таких как LNA-звенья. В некоторых воплощениях олигомер или миксмер согласно данному изобретению не содержит область длиной более 3 последовательных звеньев аналоговых нуклеотидов, таких как LNA-звенья. В некоторых воплощениях олигомер или миксмер согласно данному изобретению не содержит область длиной более 2 последовательных звеньев аналоговых нуклеотидов, таких как LNA-звенья.

Миксмер представляет собой олигомер, который может содержать одну или более чем одну короткую область ДНК длиной не более 4 последовательных ДНК-нуклеотидов и, как правило, включает чередующиеся области нуклеотидного аналога (например, LNA-звенья) и ДНК-нуклеотиды, возможно, области других нуклеотидных аналогов (например, не-LNA-нуклеотидных аналогов). Тоталмеры не содержат ДНК- или РНК-нуклеотиды (хотя могут включать аналоги или производные ДНК и РНК).

В некоторых воплощениях олигомер (например, область А) согласно данному изобретению может включать не более 4 последовательных ДНК-нуклеотидов или не более 3 последовательных ДНК-нуклеотидов.

Следующие воплощения могут применяться к миксмерным или тоталмерным олигомерам (таким как область А):

Олигомер (например, область А) согласно данному изобретению в некоторых воплощениях может включать по меньшей мере две чередующиеся области LNA- и нe-LNA-нуклеотидов (например, ДНК или 2'-замещенные нуклеотидные аналоги).

Олигомер согласно данному изобретению в некоторых воплощениях может включать непрерывную последовательность формулы: 5'([LNA-нуклеотиды]1-5 и [нe-LNA-нуклеотиды]1-4)2-12. 3'.

В некоторых воплощениях 5'-нуклеотид непрерывной нуклеотидной последовательности (или олигомера) представляет собой LNA-нуклеотид.

В некоторых воплощениях 3'-нуклеотид непрерывной нуклеотидной последовательности представляет собой нуклеотидный аналог, такой как LNA, либо 2, 3, 4, 5 3'-нуклеотидов представляют собой нуклеотидные аналоги, такие как LNA-нуклеотиды или другие нуклеотидные аналоги, которые придают олигомеру повышенную стабильность в сыворотке.

В некоторых воплощениях непрерывная нуклеотидная последовательность олигомера имеет формулу 5' ([LNА-нуклеотиды]1-5-[не-LNA-нуклеотиды]1-4)2-11-[LNА-нуклеотиды]1-5 3'.

В некоторых воплощениях непрерывная нуклеотидная последовательность олигомера имеет 2, 3 или 4 непрерывные области LNA- и не-LNA-нуклеотидов - например, содержит формулу 5' ([LNA-нуклеотиды]1-5 и [не-LNA-нуклеотиды]1-4)2-3, возможно с последующей 3' LNA-областью [LNA-нуклеотиды]1-5.

В некоторых воплощениях непрерывная нуклеотидная последовательность олигомера содержит 5' ([LNA-нуклеотиды]1-3 и [не-LNA-нуклеотиды]1-3)2-5, возможно с последующей 3' LNA-областью [LNA-нуклеотиды]1-3.

В некоторых воплощениях непрерывная нуклеотидная последовательность олигомера содержит 5' ([LNA-нуклеотиды]1-3 и [не-LNA-нуклеотиды]1-3)3, возможно с последующей 3' LNA-областью [LNA-нуклеотиды]1-3.

В некоторых воплощениях все нe-LNA-нуклеотиды представляет собой ДНК-нуклеотиды.

В некоторых воплощениях нe-LNA-нуклеотиды независимо или зависимо выбраны из группы, состоящей из ДНК-звеньев, РНК-звеньев, 2'-O-алкил-РНК-звеньев, 2'-ОМе-РНК-звеньев, 2'-амино-ДНК-звеньев и 2'-фтор-ДНК-звеньев.

В некоторых воплощениях нe-LNA-нуклеотиды (возможно, независимо) выбраны из группы, состоящей из 2'-замещенных нуклеозидных аналогов, например, выбранных (возможно, независимо) из группы, состоящей из 2'-O-алкил-РНК-звеньев, 2'-ОМе-РНК-звеньев, 2'-амино-ДНК-звеньев, 2'-АР, 2-FANA, 2'-(3-гидрокси)пропила и 2'-фтор-ДНК-звеньев и/или других (возможно) сахаро-модифицированных нуклеозидных аналогов, таких как морфолино, пептидо-нуклеиновая кислота (PNA), CeNA, несвязанная нуклеиновая кислота (UNA), гекситол-нуклеиновая кислота (HNA), бицикло-HNA (см., например, WO 2009/100320). В некоторых воплощениях нуклеозидные аналоги повышают аффинность первой области к их нуклеиновой кислоте-мишени (или комплементарной ДНК- или РНК-последовательности) Различные нуклеозидные аналоги раскрыты в Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 и Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, включенной в данный документ посредством ссылки.

В некоторых воплощениях не-LNA-нуклеотиды представляют собой ДНК-нуклеотиды. В некоторых воплощениях олигомер или непрерывная нуклеотидная последовательность включает LNA-нуклеотиды и, возможно, другие нуклеотидные аналоги (например, нуклеотидные аналоги, перечисленные среди не-LNA-нуклеотидов), которые могут быть нуклеотидными аналогами с повышенной аффинностью и/или нуклеотидными аналогами, которые повышают стабильность в сыворотке.

В некоторых воплощениях олигомер или непрерывная нуклеотидная последовательность состоит из непрерывной нуклеотидной последовательности указанных нуклеотидных аналогов.

В некоторых воплощениях олигомер или непрерывная нуклеотидная последовательность состоит из непрерывной нуклеотидной последовательности LNA-нуклеотидов.

В некоторых воплощениях олигомер или непрерывная нуклеотидная последовательность содержит 8-12, например 8-10 или 10-20, например, 12-18 или 14-16 нуклеотидов в длину.

В некоторых воплощениях олигомер или непрерывная нуклеотидная последовательность способны образовывать дуплекс с комплементарной одноцепочечной нуклеиновокислотной РНК-молекулой с помощью фосфодиэфирных межнуклеозидных связей, где дуплекс имеет Тm по меньшей мере примерно 60°С, например, по меньшей мере 65°С.

Пример анализа Тm: Олигонуклеотид: дуплексы олигонуклеотида и РНК-мишени (РО) разбавляют до 3 мМ в 500 мл безРНКазной воды и смешивают с 500 мл 2-кратного Тm-буфера (200 мМ NaCl, 0,2 мМ EDTA, 20 мМ фосфата Na, рН 7,0). Раствор нагревают до 95°С в течение 3 мин и затем оставляют для отжига при комнатной температуре в течение 30 мин. Температура плавления дуплекса (Тm) измеряется на спектрофотометре Lambda 40 UV/VIS, снабженном элементом Пельтье РТР6 с программируемой температурой с использованием программного обеспечения РЕ Templab (Perkin Elmer). Температуру повышают с 20°С до 95°С, а затем понижают до 25°С, регистрируя абсорбцию при 260 нм. Первая производная и локальные максимумы плавления и отжига используются для оценки Тm дуплекса.

Тоталмеры

Тоталмер представляет собой одноцепочечной олигомер, который содержит только неприродные нуклеозиды, такие как сахаро-модифицированные аналоги нуклеозидов.

Первая область в соответствии с изобретением может быть тоталмером - действительно, различные конструкции тоталмеров весьма эффективны в качестве олигомеров или их первых областей, в частности, направляющих microРНК (antimiR) или олигомеров с переключением сплайсинга (SSO). В некоторых воплощениях тоталмер содержит или состоит по меньшей мере из одного мотива с последовательностью XYX или YXY, например, из повторяющейся последовательности XYX или YXY, где X представляет собой LNA, a Y представляет собой альтернативный (т.е. не LNA) нуклеотидный аналог, такой как 2'-O-МОЕ-РНК-звено и 2'-фтор-ДНК-звено. В некоторых воплощениях указанная выше последовательность мотива может быть, например, XXY, XYX, YXY или YYX.

В некоторых воплощениях тоталмер может содержать или состоять из непрерывной нуклеотидной последовательности длиной от 7 до 16 нуклеотидов, например, 9, 10, 11, 12, 13, 14 или 15 нуклеотидов, например, от 7 до 12 нуклеотидов.

В некоторых воплощениях непрерывная нуклеотидная последовательность тоталмера включает по меньшей мере 30%, например по меньшей мере 40%, например по меньшей мере 50%, например по меньшей мере 60%, например по меньшей мере 70%, например по меньшей мере 80%, например по меньшей мере 90%, например 95%, например 100% BNA (LNA)-звеньев. Остальные звенья могут быть выбраны среди не-LNA-нуклеотидных аналогов, описанных в данном документе, например, могут быть выбраны из группы, состоящей из 2'-O-алкил-РНК-звена, 2'-ОМе-РНК-звена 2'-амино-ДНК-звена, 2'-фтор-ДНК-звена, LNA-звена, PNA-звена, HNA-звена, INA-звена и 2'МОЕ-РНК-звена или 2'-ОМе-РНК-звена и 2'-фтор-ДНК-звена.

В некоторых воплощениях тоталмер состоит из или содержит непрерывную нуклеотидную последовательность, которая состоит только из LNA-звеньев. В некоторых воплощениях тоталмер, такой как LNA-тоталмер, составляет 7-12 нуклеозидных звеньев в длину. В некоторых воплощениях тоталмер (в качестве олигомера или его первой области) может быть нацелен против microРНК (т.е. может быть antimiR) - как описано в WO 2009/043353, который включен в данный документ посредством ссылки.

В некоторых воплощениях олигомер или непрерывная нуклеотидная последовательность включает LNA-нуклеотиды и, возможно, другие нуклеотидные аналоги, которые могут быть нуклеотидными аналогами, которые повышают аффинность, и/или нуклеотидными аналогами, которые повышают стабильность в сыворотке.

В некоторых воплощениях олигомер или непрерывная нуклеотидная последовательность состоит из непрерывной нуклеотидной последовательности указанных нуклеотидных аналогов.

В некоторых воплощениях олигомер или непрерывная нуклеотидная последовательность состоит из непрерывной нуклеотидной последовательности LNA-нуклеотидов.

Модуляция микроРНК с помощью олигомера или его первой области

В некоторых воплощениях олигомер или его первая область представляют собой antimiR, которая содержит или состоит из непрерывной нуклеотидной последовательности, которая соответствует или полностью комплементарна целой зрелой microРНК. Применение данного изобретения в контроле активности microРНК in vivo имеет первостепенное значение в связи с тем, что microРНК, как правило, регулируют многочисленные mРНК у субъекта. Поэтому способность инактивировать терапевтические antimiR является очень желательной.

Многочисленные микроРНК связаны с рядом заболеваний. Например: неограничивающие примеры терапевтических показаний, которые можно лечить с помощью фармацевтических композиций согласно данному изобретению:

мРНК опухолевого супрессора гена тропомиозина 1 (ТРМ1) была указана в качестве мишени miR-21. mРНК миотропина (mtpn) была указана в качестве мишени miR-375.

Следовательно, олигомер или его первая область могут представлять собой анти-микроРНК, которая нацелена (т.е. содержит или состоит из непрерывной нуклеотидной последовательности, полностью комплементарной ей (в соответствующей области)) на одну из перечисленных выше microРНК, или содержит не более чем одно несоответствие с ней.

Таким образом, некоторые аспекты данного изобретения относятся к лечению заболевания, связанного с экспрессией микроРНК и выбранного из группы, состоящей из инфекционных заболеваний, таких как вирусные заболевания, например, вирус гепатита С и ВИЧ, умственной отсталости с ломкой Х-хромосомы, воспалительных заболеваний, рака, такого как хронический лимфолейкоз, рак молочной железы, рак легких и рак толстой кишки.

MicroРНК (микроРНК, miРНК) представляют собой распространенный класс коротких эндогенных РНК, которые действуют как посттранскрипционные регуляторы экспрессии генов за счет спаривания оснований с их mРНК-мишенями. Зрелые микроРНК последовательно процессируются из более длинных шпильковых транскриптов с помощью РНКазы III (рибонуклеазы Drosha). Зрелые microРНК (miR), как правило, содержат от 20 до 25 последовательных РНК-нуклеотидов. В настоящее время широко известно, что несколько microРНК связаны с медицинскими состояниями и заболеваниями, и несколько компаний разрабатывают терапевтические препараты на основе олигомеров, которые либо имитируют microРНК, либо специфически гибридизуются с конкретными microРНК, связанными с фенотипами заболеваний - такие олигомеры упоминаются в данном документе как имитирующие microРНК и анти-miR почтительно, и олигомер или первая его область в некоторых воплощениях может быть таким модулирующим microРНК-олигомером.

В некоторых воплощениях олигомер или его первая область согласно изобретению состоит из или содержит непрерывную нуклеотидную последовательность, которая соответствует или полностью комплементарна последовательности microРНК, такой как последовательность зрелой microРНК, например, человеческая microРНК, опубликованная в miRBase (http://микроРНК.sanger.ac.uk/cgi-bin/sequences/miРНК_summary.pl?org=hsa). В некоторых воплощениях microРНК представляет собой вирусную microРНК. На момент написания этой заявки в miRbase 19 есть 1600 последовательностей предшественников и 2042 последовательности зрелых microРНК человека, которые включены в данный документ посредством ссылки, в том числе последовательность зрелой microРНК каждой человеческой microРНК. Другие microРНК человека, которые могут быть нацелены на олигомер или его первую область, включают те, которые раскрыты в WO 08040355A, который включен в данный документ посредством ссылки. В некоторых воплощениях олигомер или его первая область согласно изобретению состоит из или содержит непрерывную нуклеотидную последовательность, которая соответствует или полностью комплементарна последовательности microРНК, выбранной из группы, состоящей из hsa-miR19b, hsa-miR21, hsa-miR 122, hsa-miR 142 a7b, hsa-miR 155 и hsa-miR 375. В некоторых воплощениях олигомер или его первая область в соответствии с изобретением состоит из или содержит непрерывную нуклеотидную последовательность, которая соответствует или полностью комплементарна последовательности microРНК, выбранной из группы, состоящей из hsa-miR221 и hsa-miR222. В некоторых воплощениях олигомер или его первая область согласно изобретению состоит из или содержит непрерывную нуклеотидную последовательность, которая соответствует или полностью комплементарна hsa-miR122 (NR_029667.1 GI: 262205241), например зрелой hsa-miR-122.

В некоторых воплощениях, когда олигомер или его первая область нацелены на miR-122, олигомер используется для лечения инфекции гепатита С.

Анти-miR-олигомеры

Предпочтительный олигомер или его первая область с конструкцией 'анти-miR' и олигомеры раскрыты в WO 2007/112754, WO 2007/112753, PCT/DK2008/000344 и в предварительных заявках США 60/979217 и 61/028062, которые включены в данный документ посредством ссылки. В некоторых воплощениях олигомер или его первая область представляет собой анти-miR, который является миксмером или тоталмером.

Анти-miR-олигомеры представляют собой олигомеры, которые состоят из или содержат непрерывную нуклеотидную последовательность, которая полностью комплементарна или по существу комплементарна (т.е. может содержать одно или два несоответствия) последовательности microРНК или соответствующей подпоследовательности. В этом отношении считается, что анти-miR может содержать непрерывную нуклеотидную последовательность, комплементарную или по существу комплементарную всей зрелой microРНК, или анти-miR может содержать непрерывную нуклеотидную последовательность, комплементарную или по существу комплементарную подпоследовательности зрелой microРНК или pre-microРНК - такая подпоследовательность (и, следовательно, соответствующая непрерывная нуклеотидная последовательность), как правило, содержит не менее 8 нуклеотидов в длину, например, от 8 до 25 нуклеотидов, например, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 нуклеотидов в длину, например, 10-17 или 10-16 нуклеотидов, например, 12-15 нуклеотидов.

Были предложены многочисленные конструкции анти-miR, и, как правило, анти-miR для терапевтического применения, такие как их непрерывные нуклеотидные последовательности, содержат одно или более чем одно звено нуклеотидных аналогов.

В некоторых воплощениях анти-miR может иметь гэпмерную структуру, описанную в данном документе. Тем не менее, как описано в WO 2007/112754 и WO 2007/112753, могут быть предпочтительными другие конструкции, например, миксмеры или тоталмеры.

WO 2007/112754 и WO 2007/112753, которые включены в данный документ посредством ссылки, предлагают анти-miR-олигомеры и анти-miR-олигомерные конструкции, где олигомеры комплементарны зрелой microРНК.

В некоторых воплощениях подпоследовательность анти-miR соответствует затравочной области microРНК. В некоторых воплощениях первое или второе с 3'-конца нуклеиновое основание олигомера соответствует второму 5'-нуклеотиду последовательности microРНК.

В некоторых воплощениях анти-miR нуклеотидные звенья олигомера с 1 по 6 (включительно) при измерении с 3'-конца области олигомера комплементарны затравочной области последовательности microРНК.

В некоторых воплощениях анти-miR нуклеотидные звенья олигомера с 1 по 7 (включительно) при измерении с 3'-конца области олигомера комплементарны затравочной области последовательности microРНК.

В некоторых воплощениях анти-miR нуклеотидные звенья олигомера с 2 по 7 (включительно) при измерении с 3'-конца области олигомера комплементарны затравочной области последовательности microРНК.

В некоторых воплощениях анти-miR-олигомер содержит по меньшей мере одно звено нуклеотидного аналога, например, по меньшей мере одно LNA-звено, в положении, которое находится в области, комплементарной затравочной области microРНК. Анти-miR-олигомер в некоторых воплощениях может содержать по меньшей от 1 до 6 или от 1 до 7 звеньев нуклеотидного аналога, например, от 1 до 6 и от 1 до 7 LNA-звеньев в положении, которое находится в области, комплементарной затравочной области miРНК.

В некоторых воплощениях анти-miR изобретения составляет 7, 8 или 9 нуклеотидов в длину и содержит непрерывную нуклеотидную последовательность, комплементарную затравочной области человеческой или вирусной microРНК, где по меньшей мере 80%, например 85%, например 90%, например 95%, например 100% нуклеотидов представляют собой LNA.

В некоторых воплощениях анти-miR изобретения составляет 7, 8 или 9 нуклеотидов в длину и содержит непрерывную нуклеотидную последовательность, комплементарную затравочной области человеческой или вирусной microРНК, где по меньшей мере 80% нуклеотидов представляют собой LNA, и где по меньшей мере 80%, например 85%, например 90%, например 95%, например 100% межнуклеотидных связей представляют собой фосфоротиоатные связи.

В некоторых воплощениях анти-miR содержит один или два LNA-звена в позициях с 3 по 8, считая с 3'-конца. Это считается выгодным для стабильности А-спирали, образованной дуплексом "олигонуклеотид : microРНК", который похож на структуру дуплекса "РНК : РНК".

Таблица со страницы 48, строка 15, до страницы 51, строка 9, из WO 2007/112754 предлагает примеры анти-microРНК-олигомеров (т.е. анти-miR, которые могут быть олигомером или его первой областью) и включена в данный документ посредством ссылки.

Имитирующая microРНК

В некоторых воплощениях олигомер или его первая область находятся в форме имитирующей miРНК, которая может быть введена в клетку для подавления экспрессии одной или более чем одной mРНК-мишени. Имитирующие miРНК, как правило, полностью комплементарны последовательности полноразмерной miРНК. Имитирующие miРНК представляют собой соединения, содержащие непрерывную нуклеотидную последовательность, гомологичную соответствующей области одной или более чем одной из последовательностей miРНК, предусмотренных или описанных в данном документе. Имитирующие miРНК или анти-miR могут быть использованы также для (возможного) дополнительного подавления mРНК-мишеней, или для подавления (понижающей регуляции) miРНК, тем самым ингибируя функцию эндогенной miРНК, вызывая дерепрессию и повышенную экспрессию mРНК-мишени.

Аптамеры

В некоторых воплощениях олигомер или его первая область может представлять собой терапевтический аптамер, шпигельмер. Обратите внимание, что аптамеры также могут быть лигандами, такими как рецепторные лиганды, и, следовательно, могут быть использованы в качестве направляющей группировки (т.е. области 3). Аптамеры (также называемые шпигельмерами (spiegelmer)) в контексте данного изобретения являются нуклеиновыми кислотами длиной от 20 до 50 нуклеотидов, которые были отобраны на основании их конформационной структуры, а не последовательности нуклеотидов - они вызывают их терапевтический эффект путем связывания с белком-мишенью непосредственно in vivo и, следовательно, не содержат обратный комплемент их мишени - действительно, их мишенью является не нуклеиновая кислота, а белок. Конкретные аптамеры, которые могут быть олигомерами или первыми областями, включают Macugen (OSI Pharmaceuticals) или ARC1779 (Archemix, Кембридж, Массачусетс). В некоторых воплощениях олигомер или его первая область не являются аптамером. В некоторых воплощениях олигомер или его первая область не являются аптамером или шпигельмером.

Комплексы siРНК

В некоторых воплощениях олигомер или его первая область могут быть частью siРНК-комплекса - т.е. антисмысловой или "пассажирской" нитью siРНК-комплекса. siРНК-комплекс может опосредовать РНК-интерференцию.

В некоторых воплощениях siРНК-комплекс состоит из двух одноцепочечных олигомеров длиной 17-25 нуклеотидов, например, длиной 18, 19, 20, 21, 22, 23, 24 нуклеотида, например, длиной 21-23 нуклеотида. В некоторых воплощениях смысловая и/или антисмысловая нить siРНК может содержать 3'-выступ, как правило, из 1, 2 или 3 нуклеотидов. Соответственно, смысловая и антисмысловая нити или могут содержать один или более чем один нуклеотидный аналог.

В некоторых воплощениях siРНК-комплекс представляет собой siLNA, например, конструкции siРНК, описанные в WO 2004/000192, WO 2005/073378, WO 2007/085485, которые включены в данный документ посредством ссылки. siLNA представляет собой siРНК, которая содержит по меньшей мере одно LNA-звено.

В некоторых воплощениях siРНК-комплекс представляет собой sisiLNA, такую как описана, в WO 2007/107162, который включен в данный документ посредством ссылки. В некоторых воплощениях олигомер или его первая область согласно изобретению представляют собой смысловую нить siРНК и, таким образом, могут быть не комплементарны мишени (в самом деле, они могут быть гомологичны намеченной мишени).

В некоторых воплощениях олигомер или соединение согласно изобретению представляет собой не siРНК или siLNA.

Межнуклеотидные связи

Нуклеозидные мономеры олигомеров (например, первая и вторая области), описанные в данном документе, соединены друг с другом с помощью (межнуклеозидной) связывающей группы. Соответственно, каждый мономер связан с 3'-прилегающим мономером помощью связывающую группы.

Специалисту в данной области будет понятно, что в контексте данного изобретения 5'-мономер на конце олигомера не содержит 5'-связывающую группу, хотя он может содержать или не содержать 5'-концевую группу.

Термины "связывающая группа" или "межнуклеотидная связь" обозначают группу, способную ковалентно соединять вместе два нуклеотида. Конкретные и предпочтительные примеры включают фосфатные группы и фосфортиоатные группы.

Нуклеотиды олигомера согласно изобретению или их непрерывные нуклеотидные последовательности соединены вместе с помощью связывающих групп. Соответственно, каждый нуклеотид соединен с 3'-прилегающим нуклеотидом с помощью связывающей группы.

Подходящие межнуклеотидные связи включают те, которые перечислены в WO 2007/031091, например, межнуклеотидные связи, которые перечислены в первом пункте на странице 34 WO 2007/031091 (включен в данный документ посредством ссылки).

В некоторых воплощениях кроме фосфодиэфирной связи (связей) или области В предпочтительно модифицировать межнуклеотидную связь из нормальной фосфодиэфирной в такую, которая будет более устойчивой к нуклеазной атаке, например, в фосфоротиоатную или боранофосфатную - эти две, будучи расщепленными РНКазой Н, также вызывают антисмысловое ингибирование этого пути со снижением экспрессии гена-мишени.

Предпочтительными могут быть подходящие серо(S)-содержащие межнуклеотидные связи, описанные в данном документе, например, фосфоротиоатные или фосфордитиоатные. Фосфоротиоатные межнуклеотидные связи также являются предпочтительными, в частности, для первой области, например, в гэпмерах, миксмерах, анти-miR, олигомерах с переключением сплайсинга и тоталмерах.

Для гэпмеров межнуклеотидные связи в олигомере могут быть, например, фосфоротиоатными или боранофосфатными, так что РНКаза Н может расщепить РНК-мишень. Фосфоротиоатные связи являются предпочтительными для повышения устойчивости к нуклеазам и по другим причинам, таким как легкость производства.

В одном аспекте, за исключением фосфодиэфирной связи между первой и второй областью и, возможно, в области В, остальные межнуклеозидные связи олигомера согласно изобретению, нуклеотиды и/или нуклеотидные аналоги связаны друг с другом посредством фосфортиоатных групп. В некоторых воплощениях по меньшей мере 50%, например, по меньшей мере 70%, например, по меньшей мере 80%, например, по меньшей мере 90%, например, все межнуклеозидные связи между нуклеозидами в первой области отличаются от фосфодиэфирной связи (фосфатной), например, выбраны из группы, состоящей из фосфоротиоатной, фосфородитиоатной или боранофосфатной связей. В некоторых воплощениях по меньшей мере 50%, например, по меньшей мере 70%, например, по меньшей мере 80%, например, по меньшей мере 90%, например, все межнуклеозидные связи между нуклеозидами в первой области являются фосфоротиоатными.

WO 09124238 относится к олигомерным соединениям, имеющим по меньшей мере один бициклический нуклеозид, прикрепленный к 3'- или 5'-концу нейтральной межнуклеозидной связью. Поэтому олигомеры согласно изобретению могут иметь по меньшей мере один бициклический нуклеозид, прикрепленный к 3'- или 5'-концу нейтральной межнуклеозидной связи, такой как один или более чем один фосфотриэфир, метилфосфонат, MMI, амид-3, формацеталь или тиоформацеталь. Остальные связи могут быть фосфоротиоатными.

Конъюгаты, направляющие группировки и блокирующие группы

Термин "конъюгат" обозначает гетерогенную молекулу, образованную путем ковалентного присоединения ("конъюгации") олигомера, описанного в данном документе, с одной или более чем одной ненуклеотидной или неполинуклеотидной группировкой. Примеры ненуклеотидных или неполинуклеотидных группировок включают высокомолекулярные агенты, такие как белки, цепи жирных кислот, сахарные остатки, гликопротеины, полимеры или их комбинации. Как правило, белки могут быть антителами к белку-мишени. Типичные полимеры могут быть полиэтиленгликолями.

Таким образом, в различных воплощениях олигомер согласно изобретению может содержать как полинуклеотидную область, которая обычно состоит из непрерывной последовательности нуклеотидов, так и другую не нуклеотидную область. В отношении олигомера согласно изобретению, состоящему из непрерывной нуклеотидной последовательности, соединение может содержать ненуклеотидные компоненты, такие как конъюгационные компоненты.

В различных воплощениях изобретения олигомерное соединение связано с лигандами/конъюгатами, которые могут быть использованы, например, для повышения клеточного поглощения олигомерных соединений. WO 2007/031091 предусматривает подходящие лиганды и конъюгаты, которые включены в данный документ посредством ссылки.

В различных воплощениях, где соединение согласно изобретению состоит из определенной нуклеиновой кислоты или нуклеотидной последовательности, описанной в данном документе, соединение также может содержать по меньшей мере одну ненуклеотидную или неполинуклеотидную группировку (например, не содержащую один или более нуклеотид или нуклеотидный аналог), ковалентно присоединенную к указанному соединению.

В некоторых воплощениях конъюгат может быть липофильным конъюгатом или белками (например, антителами, ферментами, белками сыворотки); пептидами; витаминами (водорастворимыми или жирорастворимыми); полимерами (водорастворимыми или жирорастворимыми); малыми молекулами, включая лекарства, токсины, репортерные молекулы и лиганды рецепторов; углеводными комплексами; нуклеиновокислотными расщепляемыми комплексами; хелаторами металлов (например, порфиринами, тексафиринами, краун-эфирами и т.д.); интеркаляторами, в том числе гибридными фотонуклеазами/интеркаляторами; сшивающими агентами (например, фотоактивными, окислительно-восстановительными) и их комбинациями и производными. Многочисленные подходящие конъюгированные группировки, их получение и связь с олигомерными соединениями приведены, например, в WO 93/07883 и в патенте США №6395492, каждый из которых включен в данный документ посредством ссылки в полном объеме. Олигонуклеотидные конъюгаты и их синтез также приведены в подробных обзорах Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S.T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001; и Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, каждый из которых включен в данный документ посредством ссылки в полном объеме.

Конъюгация (с конъюгационной группировкой) может повысить активность, клеточное распределение или клеточное поглощение олигомера согласно изобретению. Такие группировки включают, но не ограничиваясь ими, антитела, полипептиды, липидные группировки, такие как холестериновая группировка, холевая кислота, тиоэфир, например гексил-S-тритилтиол, тиохолестерин, алифатические цепи, например, додекандиол- или ундецил-остатки, фосфолипиды, например, ди-гексадецил-рац-глицерин или триэтиламмония 1,2-ди-О-гексадецил-рац-глицеро-3-Н-фосфонат, полиаминовые или полиэтиленгликолевые цепи, адамантановую уксусную кислоту, пальмитиновую группировку, октадециламин или гексиламино-карбонил-оксихолестериновую группировку.

Олигомеры согласно изобретению могут быть также конъюгированы с активными лекарственными веществами, например, аспирином, ибупрофеном, серосодержащим лекарственным препаратом, антидиабетическим, антибактериальным препаратом или антибиотиком.

В некоторых воплощениях конъюгационная группировка представляет собой стерин, такой как холестерин.

В различных воплощениях конъюгационная группировка содержит или состоит из положительно заряженного полимера, такого как положительно заряженные пептиды, например, длиной 1-50, например, 2-20, например, 3-10 аминокислотных остатков, и/или полиалкиленоксид, такой как полиэтиленгликоль (polyethylglycol, PEG) или полипропиленгликоль - см. WO 2008/034123, включенный в данный документ посредством ссылки.

Применение конъюгата часто ассоциируется с улучшенными фармакокинетическими или фармакодинамическими свойствами. Тем не менее, наличие конъюгационной группы может влиять на активность олигонуклеотида в отношении его намеченной цели, например, за счет стерических препятствий, которые предотвращают гибридизацию или привлечение нуклеаз (например, привлечение РНКазы Н или RISC). Применение ДНК- и/или РНК-фосфодиэфирной области (области В) между олигонуклеотидом (область А) и конъюгационной группировкой (X) в соответствии с данным изобретением позволяет улучшать свойства благодаря наличию конъюгационной группы, обеспечивая при этом в ткани-мишени то, что конъюгационная группа не мешает эффективной активности олигонуклеотида.

В некоторых воплощениях олигонуклеотид согласно данному изобретению ковалентно связан с одной или более чем одной конъюгационной группой, возможно, через один или более чем один линкер. Полученное конъюгированное соединение может иметь, например, модифицированные улучшенные свойства, например, фармакокинетические, фармакодинамические и другие свойства, модифицированные или улучшенные по сравнению с неконъюгированными олигомерными соединениями. Конъюгационная группировка, которая может изменять или улучшать фармакокинетические свойства олигомерного соединения, может улучшать клеточное распределение, биодоступность, метаболизм, выведение, проницаемость и/или клеточное поглощение олигомерного соединения. Конъюгационная группировка, которая может изменять или улучшать фармакодинамические свойства олигомерного соединения, может повышать активность, стойкость к деградации, специфическую к последовательности гибридизацию, поглощение и т.п. В некоторых воплощениях конъюгационная группа может уменьшать или предотвращать соответствующую активность олигонуклеотида, например, нецелевую активность ("off target", "вне мишени") или активность в нецелевых тканях или органах. Это может быть достигнуто путем применения блокирующей группировки, которая может быть, например, конъюгатом; наличие блокирующей группой, ковалентно связанной с олигонуклеотидом (возможно, через линкер), может предотвратить или затруднить олигонуклеотидную гибридизацию и/или активность. Расщепление ДНК/РНК-фосфодиэфирной области (например, намеченного сайта-мишени) удаляет блокирующую группу, что делает возможной доставку активного олигонуклеотида к намеченному участку.

В некоторых воплощениях соединение согласно изобретению содержит конъюгационную группу.

Следует понимать, что одна конъюгационная группа может быть использована, например, для направления в определенную ткань, например, липофильная группа для направления в печень, и вторая конъюгационная группа может быть использована для обеспечения дополнительного преимущества, например, блокирующая группа или дополнительная терапевтическая единица. Подходящие конъюгаты/группировки могут быть связаны с олигонуклеотидом через ДНК/РНК-фосфодиэфирную область в соответствии с данным изобретением. В некоторых воплощениях конъюгат ковалентно связан с олигонуклеотидом, возможно, через линкер, на 5'- и/или 3'-конце олигонуклеотида. В этом отношении, если используются два конъюгата/группировки, один из них может быть связан с 5'-концом, а другой с 3'-концом.

Углеводные конъюгаты

В некоторых воплощениях конъюгационная группа выбрана из группы, состоящей из углевода, липофильной группировки, полимера, белка или пептида, метки или красителя, малой молекулы, такой как низкомолекулярная терапевтическая молекула, лиганда рецептора клеточной поверхности.

В некоторых воплощениях конъюгат представляет собой или может содержать углевод или содержит углеводную группу. В некоторых воплощениях углевод выбран из группы, состоящей из галактозы, лактозы, н-ацетилгалактозамина, маннозы и маннозо-6-фосфата. В некоторых воплощениях конъюгационная группа представляет собой или может содержать маннозу или маннозо-6-фосфат. Углеводные конъюгаты могут быть использованы для усиления доставки или активности в диапазоне тканей, таких как печень и/или мышцы. См., например, ЕР 1495769, WO 99/65925, Yang et al., Bioconjug Chem (2009) 20(2): 213-21. Zatsepin & Oretskaya Chem Biodivers. (2004) 1(10): 1401-17.

В некоторых воплощениях конъюгационная группа представляет собой углеводную группировку. Кроме того, олигомер может также содержать одну или более чем одну дополнительную конъюгационную группировку, из которых особенно интересны липофильные или гидрофобные группировки. Они могут выступать, например, в качестве фармакокинетических модуляторов и могут быть ковалентно связаны с любым углеводным конъюгатом, линкером, соединяющим углеводный конъюгат с олигомером, или линкером, соединяющим ряд углеводных конъюгатов (поливалентным), или олигомером, возможно через линкер, такой как биологически расщепляемый линкер.

В некоторых воплощениях конъюгат представляет собой или может содержать углевод или содержит углеводную группу. В некоторых воплощениях углевод выбран из группы, состоящей из галактозы, лактозы, н-ацетилгалактозамина, маннозы и маннозо-6-фосфата. В некоторых воплощениях конъюгационная группа представляет собой или может содержать маннозу или маннозо-6-фосфат. Углеводные конъюгаты могут быть использованы для усиления доставки или активности в диапазоне тканей, таких как печень и/или мышцы. См., например, ЕР 1495769, WO 99/65925, Yang et al., Bioconjug Chem (2009) 20(2): 213-21. Zatsepin & Oretskaya Chem Biodivers. (2004) 1(10): 1401-17.

GalNAc-конъюгаты

Изобретение также предусматривает олигонуклеотиды, такие как антисмысловые LNA-олигомеры, которые конъюгированы с группировкой, нацеленной на асиалогликопротеиновый рецептор. В некоторых воплощениях конъюгационная группировка (например, третья область или область С) содержит группировку, нацеленную на асиалогликопротеиновый рецептор, например, галактозу, галактозамин, N-формил-галактозамин, N-ацетилгалактозамин, N-пропионил-галактозамин, N,н-бутаноил-галактозамин и N-изобутаноилгалактозамин. В некоторых воплощениях конъюгат включает галактозный кластер, такой как N-ацетилгалактозаминовый тример. В некоторых воплощениях конъюгационная группировка включает GalNAc (N-ацетилгалактозамин), такой как моновалентный, двухвалентный, трехвалентный или четырехвалентный GalNAc. Конъюгаты трехвалентного GalNac могут быть использованы для направления соединения в печень. GalNAc-конъюгаты были использованы с метилфосфонатом и антисмысловыми PNA-олигонуклеотидами (например, US 5994517 и Hangeland et al., Bioconjug Chem. 1995 Nov-Dec; 6(6): 695-701) и siРНК (например, WO 2009/126933, WO 2012/089352 & WO 2012/083046). Ссылки на GalNac и конкретные конъюгаты, используемые в данном документе, включены в него посредством ссылки. WO 2012/083046 раскрывает siРНК с GalNAc-конъюгационными группировками, которые содержат расщепляемые фармакокинетические модуляторы, подходящие для применения в данном изобретении, при этом предпочтительными фармакокинетическими модуляторами являются С16-гидрофобные группы, такие как пальмитоил, гексадек-8-еноил, олеил, (9Е,12Е)-октадека-9,12-диеноил, диоктаноил и С16-С20-ацил. Расщепляемые фармакокинетические модуляторы '046 также могут представлять собой холестерин.

Направляющие группировки (конъюгационные группировка) могут быть выбраны из группы, состоящей из: галактозы, галактозамина, N-формил-галактозамина, N-ацетилгалактозамина, N-пропионил-галактозамина, N-н-бутаноил-галактозамина, N-изо-бутаноилгалактозамина, галактозного кластера и N-ацетилгалактозаминового тримера, и могут иметь фармакокинетический модулятор, выбранный из группы, состоящей из: гидрофобной группы с 16 или более атомами углерода, гидрофобной группы с 16-20 атомами углерода, пальмитоила, гексадек-8-еноила, олеила, (9Е,12Е)-октадека-9,12-диеноила, диоктаноила и С16-С20-ацила и холестерина. Некоторые GalNac-кластеры, раскрытые в '046, включают: (Е)-гексадек-8-еноил (С16), олеил (С18), (9Е,12Е)-октадека-9,12-диеноил (С18), октаноил (С8), додеканоил (С12), С20-ацил, С24-ацил, диоктаноил (2×С8). Направляющая группировка - фармакокинетическая модуляторная направляющая группировка - может быть связана с полинуклеотидом через физиологически лабильную связь или, например, дисульфидный мостик или PEG-линкер. Изобретение также относится к применению фосфодиэфирных линкеров между олигомером и конъюгационной группой (в данном документе они называются областью В и соответствующим образом расположены между LNA-олигомером и углеводной конъюгационной группой).

Для направления в гепатоциты печени предпочтительным направляющим лигандом является галактозный кластер.

Галактозный кластер включает молекулу, включающую, например, от двух до четырех производных с концевой галактозой. Используемый в данном документе термин "производное галактозы" включает как галактозу, так и производные галактозы, имеющие аффинность к асиалогликопротеиновому рецептору, равную или большую, чем у галактозы. Производное с концевой галактозой присоединено к молекуле через ее C-I-углерод. Асиалогликопротеиновый рецептор (asialoglycoprotein receptor, ASGPr) является уникальным для гепатоцитов и связывается с разветвленными галактозо-концевыми гликопротеинами. Предпочтительный галактозный кластер имеет три концевых галактозамина или производных галактозамина, каждый из которых имеет аффинность к асиалогликопротеиновому рецептору. Более предпочтительный галактозный кластер имеет три концевых N-ацетилгалактозамина. Другие термины, применяемые в данной области, включают трехантенную галактозу, трехвалентную галактозу и галактозный тример. Известно, что кластеры трехантенных производных галактозы связываются с ASGPr с большей аффинностью, чем двухантенные или одноантенные структуры производных галактозы (Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, 1. Biol. Chern., 257, 939-945). Мультивалентность требуется для достижения нМ аффинности. Согласно заявке WO 2012/083046 присоединение одного производного галактозы, имеющего аффинность к асиалогликопротеиновому рецептору, не позволяет функциональную доставку РНКi-полинуклеотида в гепатоциты in vivo при совместном введении с полимером для доставки.

Галактозный кластер может содержать два или предпочтительно три производных галактозы, связанных с центральной точкой ветвления. Производные галактозы присоединены к центральной точке ветвления через C-I-атомы углерода сахаридов. Производные галактозы предпочтительно связаны с точки ветвления через линкеры или спейсеры (которые могут быть областью Y). Предпочтительным спейсером является гибкий гидрофильный спейсер (патент США 5885968; Biessen et al. J. Med. Chern. 1995 Vol. 39 p. 1538-1546). Предпочтительным гибким гидрофильным спейсером является PEG-спейсер. Предпочтительным PEG-спейсером является РЕG3-спейсер. Точкой ветвления может быть любая малая молекула, которая позволяет присоединять три производных галактозы и далее позволяет присоединять точки ветвления к олигомеру. Иллюстративной группой с точкой ветвления является дилизин. Молекула дилизина содержит три аминогруппы, через которые могут быть присоединены три производных галактозы, и карбоксильную реакционноспособную группу, через которую дилизин может быть присоединен к олигомеру. Присоединение к точке ветвления олигомера может происходить через линкер или спейсер. Предпочтительным спейсером является гибкий гидрофильный спейсер. Предпочтительным гибким гидрофильным спейсером является PEG-спейсер. Предпочтительным PEG-спейсером является PEG3-спейсер (три этиленовых звена). Галактозный кластер может быть присоединен к 3'- или 5'-концу олигомера с использованием способов, известных в данной области.

Предпочтительным производным галактозы является N-ацетил-галактозамин (GalNAc). Другие сахариды, имеющие аффинность к асиалогликопротеиновому рецептору, могут быть выбраны из списка, включающего: галактозамин, N-н-бутаноилгалактозамин и N-изо-бутаноилгалактозамин. Аффинность многочисленных производных галактозы к асиалогликопротеиновому рецептору были изучены (см, например: Jobst, S.T. and Drickamer, K. JB.C. 1996, 271, 6686) или могут быть легко определены с использованием способов, обычных в данной области.

Одно воплощение галактозного кластера

Галактозный кластер с ПЭГ-спейсером между точкой разветвления и нуклеиновой кислотой

GalNac-конъюгат проиллюстрирован на фиг. 1. Другие примеры конъюгата согласно изобретению проиллюстрированы ниже:

Область А может, например, представлять собой антисмысловой LNA-олигонуклеотид.

Следовательно, как описано в данном документе, углеводный конъюгат (например, GalNAc) может быть связан с олигомером через биорасщепляемый линкер, такой как область В, описанная в данном документе, и, возможно, область Y, которая в вышеуказанных схемах проиллюстрирована как дилизин.

Возможной является гидрофобная или липофильная (или другая конъюгационная) группировка (т.е. фармакокинетический модулятор) в приведенных выше GalNac-кластерных конъюгатах при использовании BNA- или LNA-олигомеров, таких как антисмысловые LNA-олигонуклеотиды.

Для конкретных GalNac-кластеров, используемых в настоящем исследовании, см. фигуры Conj 1, 2, 3, 4 и Conj1а, 2а, 3а и 4а (которые показаны с дополнительным С6-линкером, который соединяет GalNac-кластер с олигомером - см. фиг. 12 и 17).

Следовательно, каждая углеводная группировка из GalNac-кластера (например, GalNAc) может быть присоединена к олигомеру через спейсер, такой как полиэтиленгликолевый линкер (PEG), например, ди-, три-, тетра-, пента-, гексаэтиленгликолевый линкер. Как показано выше, PEG-группировка образует спейсер между галактозной сахарной группировкой и пептидным (показан трилизин)линкером.

В некоторых воплощениях GalNac-кластер включает пептидный линкер, например, трипептид Tyr-Asp(Asp) или дипептид Asp(Asp), который присоединен к олигомеру (или к области Y или области В) с помощью бирадикального линкера, например, GalNac-кластер может содержать следующие бирадикальные линкеры:

R1 представляет собой бирадикал, предпочтительно выбранный среди -С2Н4-, -С3Н6-, -С4Н8-, -С5Н10-, -С6Н12-, 1,4-циклогексил (-С6Н10-), 1,4-фенил(-С6Н4-), -С2Н4ОС2Н4-, -С2Н4(ОС2Н4)2- или -С2Н4(ОС2Н4)3-.

Кроме того, углеводный конъюгат (например, GalNAc) или углевод-линкерная группировка (например, углевод-РЕG-группировка) могут быть ковалентно присоединены (связаны) к олигомеру (или области В) через группу с точкой разветвления, такую как аминокислота, или через пептид, который преимущественно содержит две или более двух аминогрупп (например, 3, 4 или 5), например, лизин, дилизин, трилизин или тетрализин. Молекула трилизина содержит четыре аминогруппы, через которые могут быть присоединены три углеводные конъюгационные группы, такие как галактоза и производные (например, GalNAc), и другие конъюгаты, такие как гидрофобная или липофильная группировка/группа, а также содержит карбоксильную реакционноспособную группу, через которую трилизин может быть присоединен к олигомеру. Другой конъюгат, такой как липофильная/гидрофобная группировка, может быть присоединен к остатку лизина, который присоединен к олигомеру. В некоторых воплощениях конъюгат (С) не является одновалентным GalNac.

Изобретение также предусматривает антисмысловые LNA-олигонуклеотиды, которые конъюгированы с группировкой, нацеленной на асиалогликопротеиновый рецептор. В некоторых воплощениях конъюгационная группировка (например, третья область или область С) включает группировку, нацеленную на асиалогликопротеиновый рецептор, такую как галактоза, галактозамин, N-формилгалактозамин, N-ацетилгалактозамин, N-пропионилгалактозамин, N-н-бутаноилгалактозамин и N-изобутаноилгалактозамин. В некоторых воплощениях конъюгат включает галактозный кластер, такой как N-ацетилгалактозаминовый тример. В некоторых воплощениях конъюгационная группировка включает GalNac (N-ацетилгалактозамин), такой как одновалентный, двухвалентный, трехвалентный или четырехвалентный GalNac. Трехвалентные GalNac-конъюгаты могут быть использованы для направления соединения в печень. GalNac-конъюгаты были использованы с метилфосфонатом и антисмысловыми PNA-олигонуклеотидами (например, US 5994517 и Hangeland et al., Bioconjug Chem. 1995 Nov-Dec; 6(6): 695-701) и siРНК (например, WO 2009/126933, WO 2012/089352 и WO 2012/083046). Ссылки на GalNac и конкретные конъюгаты, используемые в данном документе, включены в данное описание посредством ссылки. WO 2012/083046 раскрывает GalNac-конъюгационные группировки, которые содержат расщепляемые фармакокинетические модуляторы, при этом предпочтительными фармакокинетическими модуляторами являются гидрофобные группы С16, такие как пальмитоил, гексадек-8-еноил, олеил, (9Е, 12Е)-октадека-9,12-диеноил, диоктаноил и С16-С20-ацил. Расщепляемые фармакокинетические модуляторы '046 также могут быть холестерином. Направляющие группировки '046 могут быть выбраны из группы, состоящей из: галактозы, галактозамина, N-формил-галактозамина, N-ацетилгалактозамина, N-пропионилгалактозамина, N-н-бутаноилгалактозамина, N-изобутаноилгалактозамина, галактозного кластера и N-ацетилгалактозаминового тримера, и могут иметь фармакокинетический модулятор, выбранный из группы, состоящей из: гидрофобной группы с 16 или более атомами углерода, гидрофобной группы с 16-20 атомами углерода, пальмитоила, гексадек-8-еноила, олеила, (9Е,12Е)-октадека-9,12-диеноила, диоктаноила и С16-С20-ацила и холестерина. Конкретные GalNac-кластеры, раскрытые в '046, включают: (Е)-гексадек-8-еноил (С16), олеил (С18), (9Е,12Е)-октадека-9,12-диеноил (С18), октаноил (С8), додеканоил (С12), С20-ацил, С24-ацил, диоктаноил (2×С8). В соответствии с '046 направляющая группировка - фармакокинетическая модуляторная направляющая группировка - может быть связана с полинуклеотидом через физиологически лабильную связь или, например, дисульфидный мостик или PEG-линкер.

Другие конъюгационные группировки могут включать, например, олигосахариды и углеводные кластеры, такие как Tyr-Glu-Glu-аминогексил (GalNAc)3 (YEE(ahGalNAc)3; гликотрипептид, который связывается с Gal/GalNAc-рецепторами на гепатоцитах, см., например, Duff, et al., Methods Enzymol, 2000, 313, 297); галактозные кластеры на основе лизина (например, L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); галактозные кластеры на основе холана (например, мотивы распознавания углеводов асиалогликопротеинового рецептора). Другие подходящие конъюгаты могут включать олигосахариды, которые могут связываться с доменами распознавания углеводов (carbohydrate recognition domains, CRD), найденными в асиалогликопротеиновом рецепторе (ASGPr). Примеры конъюгационных группировок, содержащих олигосахариды и/или углеводные комплексы, приведены в патенте США №6525031, который включен в данный документ посредством ссылки в полном объеме.

Фармакокинетические модуляторы

Соединение согласно данному изобретению может также содержать одну или более чем одну дополнительную конъюгационную группировку, из которых особенно интересны липофильные или гидрофобные группировки, например, когда конъюгационной группой является углеводная группировка. Такие липофильные или гидрофобные группировки могут выступать в качестве фармакокинетических модуляторов и могут быть ковалентно связаны с любым углеводным конъюгатом, линкером, соединяющим углеводный конъюгат с олигомером, или линкером, соединяющим множественные углеводные конъюгаты (поливалентным), или олигомером, возможно через линкер, такой как биологически расщепляемый линкер.

Таким образом, олигомер или конъюгационная группировка может содержать фармакокинетический модулятор, например, липофильные или гидрофобные группировки. Такие группировки раскрыты в контексте siРНК-конъюгатов в WO 2012/082046. Гидрофобная группировка может содержать жирные С8-С36-кислоты, которые могут быть насыщенными или ненасыщенными. В некоторых воплощениях могут быть использованы жирные кислоты С10, С12, С14, С16, С18, С20, С22, С24, С26, С28, С30, С32 и С34. Гидрофобная группа может содержать 16 или более атомов углерода. Примеры подходящих гидрофобных групп могут быть выбраны из группы, включающей: стерин, холестерин, пальмитоил, гексадек-8-еноил, олеил, (9Е,12Е)-октадека-9,12-диеноил, диоктаноил и С16-С20-ацил. В соответствии с WO '346 гидрофобные группы, содержащие менее 16 атомов углерода, менее эффективны в усилении направления полинуклеотида на мишень, но они могут быть использованы в нескольких повторах (например, 2×, например, 2× С8 или С10, С12 или С14) для повышения эффективности. Фармакокинетические модуляторы, используемые в качестве полинуклеотидных направляющих группировок, могут быть выбраны из группы, состоящей из: холестерина, алкильной группы, алкенильной группы, алкинильной группы, арильной группы, аралкильной группы, аралкенильной группы и аралкинильной группы, каждая из которых может быть линейной, разветвленной или циклической. Фармакокинетические модуляторы предпочтительно представляют собой углеводороды, содержащие только атомы углерода и водорода. Тем не менее, могут быть разрешены замены или гетероатомы, которые поддерживают гидрофобность, например, фтор.

Авторы данного изобретения неожиданно обнаружили, что GalNac-конъюгаты для применения с LNA-олигомерами не требуют фармакокинетического модулятора, и, таким образом, в некоторых воплощениях GalNac-конъюгат не связан ковалентно с липофильной или гидрофобной группировкой, такой как описаны в данном документе, например, не содержит жирные С8-С36-кислоты или стерин. Таким образом, изобретение также предусматривает GalNac-конъюгаты LNA-олигомера, которые не содержат липофильный или гидрофобный фармакокинетический модулятор или конъюгационную группировку/группу.

Липофильные конъюгаты

Соединения согласно данному изобретению могут быть конъюгатами, содержащими олигомер (А) и липофильный конъюгат (С). Установлено, что биорасщепляемый линкер (В) особенно эффективен в сохранении или повышении активности таких олигомерных конъюгатов. В некоторых воплощениях конъюгационная группа (С) и/или линкерная группа (Y) содержит липофильную группу.

Иллюстративные конъюгационные группировки могут включать липофильные молекулы (ароматические и неароматические), включая стерин и стероидные молекулы. Липофильные конъюгационные группировки могут быть использованы, например, для борьбы с гидрофильной природой олигомерного соединения и для повышения проникновения в клетку. Липофильные группировки включают, например, стероиды и родственные соединения, такие как холестерин (патент США №4958013 и Letsinger et al., Рrос. Natl. Acad. Sci. USA, 1989, 86, 6553), тиохелостерина (Oberhauser et al, Nucl Acids Res., 1992, 20, 533), ланостерин, копростанол, стигмастерин, эргостерин, кальциферол, холевую кислоту, дезоксихолевую кислоту, эстрон, эстрадиол, эстратирол, прогестерон, стильбэстрол, тестостерон, андростерон, дезоксикортикостерон, кортизон, 17-гидроксикортикостерон их производные и т.п.

Другие липофильные конъюгационные группировки включают алифатические группы, такие как, например, прямые, разветвленные и циклические алкилы, алкенилы и алкинилы. Алифатические группы могут содержать, например, от 5 до примерно 50, от 6 до примерно 50, от 8 до примерно 50 или от 10 до примерно 50 атомов углерода. Иллюстративные алифатические группы включают ундецил, додецил, гексадецил, гептадецил, октадецил, нонадецил, терпены, борнил, адамантил, их производные и т.п. В некоторых воплощениях один или более чем один атом углерода в алифатической группе может быть заменен гетероатомом, таким как О, S или N (например, геранилоксигексил). Другие подходящие липофильные конъюгационные группировки включают алифатические производные глицеринов, такие как алкилглицерины, бис(алкил)глицерины, трис(алкил)глицерины, моноглицериды, диглицериды и триглицериды. В некоторых воплощениях липофильный конъюгат представляет собой дигексилдецил-рац-глицерин или 1,2-ди-О-гексилдецил-рац-глицерин (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea, et al., Nuc. Acids Res., 1990, 18, 3777) или их фосфонаты. Насыщенные и ненасыщенные жирные функциональные группы, такие как, например, жирные кислоты, жирные спирты, эфиры жирных кислот и жирные амины, могут также служить в качестве липофильных конъюгационных группировок. В некоторых воплощениях жирные функциональные группы могут содержать от примерно 6 до примерно 30 атомов углерода или от примерно 8 до примерно 22 атомов углерода. Примеры жирных кислот включают каприновую, каприловую, лауриновую, пальмитиновую, миристиновую, стеариновую, олеиновую, линолевую, линоленовую, арахидоновую, эйкозеновую кислоты и т.п.

В других воплощениях липофильные конъюгационные группы могут быть полициклическими ароматическими группами, содержащими от 6 до примерно 50, от 10 до примерно 50 или от 14 до примерно 40 атомов углерода. Примеры полициклических ароматических групп включают пирены, пурины, акридины, ксантены, флуорены, фенантрены, антрацены, хинолины, изохинолины, нафталины, их производные и т.п. Другие подходящие липофильные конъюгационные группировки включают ментолы, тритилы (например, диметокситритил (DMT)), феноксазины, липоевую кислоту, фосфолипиды, эфиры, тиоэфиры (например, гексил-S-тритилтиол), их производные и т.п. Получение липофильных конъюгатов олигомерных соединений хорошо описано в данной области, например, в Saison-Behmoaras et al, EMBO J., 1991, 10, 1111; Kabanov et al., FEBSLett., 1990, 259, 327; Svinarchuk et al, Biochimie, 1993, 75, 49; (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229; и Manoharan et al., Tetrahedron Lett., 1995, 36, 3651.

Олигомерные соединения, содержащие конъюгационные группировки с аффинностью к липопротеинам низкой плотности (LDL), могут обеспечить эффективную систему целевой доставки. Высокие уровни экспрессии рецепторов к LDL на опухолевых клетках делает LDL привлекательным носителем для селективной доставки лекарственных агентов в эти клетки (Rump, et al., Bioconjugate Chem., 1998, 9, 341; Firestone, Bioconjugate Chem., 1994, 5, 105; Mishra, et al., Biochim. Biophys. Acta, 1995, 1264, 229). Группировки, имеющие аффинность к LDL, включают множество липофильных групп, таких как стероиды (например, холестерин), жирные кислоты, их производные и их комбинации. В некоторых воплощениях конъюгационные группировки, имеющие аффинность к LDL, могут представлять собой диолеиловые эфиры желчных кислот, таких как хенодезоксихолевая кислота и литохолевая кислота.

В некоторых воплощениях конъюгационная группа представляет собой или может содержать липофильную группировку, такую как стерин (например, холестерин, холестерил, холестанол, стигмастерин, холановую кислоту и эргостерин). В некоторых воплощениях конъюгат представляет собой или может содержать холестерин. См., например, Soutschek et al., Nature (2004) 432, 173; Nature 2005, NAR 2007.

В некоторых воплощениях конъюгат представляет собой или может содержать липид, фосфолипид или липофильный спирт, например катионные липиды, нейтральные липиды, сфинголипиды и жирные кислоты, такие как стеариновая, олеиновая, элаидиновая, линолевая, линоленовая, линолэлаидиновая и миристиновая кислоты. В некоторых воплощениях жирная кислота содержит насыщенную или ненасыщенную С4-С30-алкильную цепь. Алкильная цепь может быть линейной или разветвленной.

В некоторых воплощениях липофильные конъюгаты могут представлять собой или могут содержать биотин. В некоторых воплощениях липофильный конъюгат может представлять собой или может содержать глицерид или глицеридный эфир.

Липофильные конъюгаты, такие как холестерин или описанные в данном документе, могут быть использованы для улучшения доставки олигонуклеотида, например, в печень (как правило, в гепатоциты).

Следующие ссылки относятся к применению липофильных конъюгатов: Kobylanska et al., Acta Biochim Pol. (1999); 46(3): 679-91. Felber et al,. Biomaterials (2012) 33(25): 599-65); Grijalvo et al., J Org Chem (2010) 75(20): 6806-13. Koufaki et al., Curr Med Chem (2009) 16(35): 4728-42; Godeau et al J. Med. Chem. (2008) 51(15): 4374-6.

Полимерные конъюгаты

Конъюгационные группировки также могут включать полимеры. Полимеры могут обеспечить дополнительный объем и различные функциональные группы, чтобы влиять на проникновение, клеточный транспорт и локализацию конъюгированного олигомерного соединения. Например, увеличение гидродинамического радиуса, вызванное конъюгацией олигомерного соединения с полимером, может помочь предотвратить вход в ядро и стимулировать локализацию в цитоплазме. В некоторых воплощениях полимер существенно не уменьшает клеточное поглощение или не мешает гибридизации с комплементарной нитью или другой мишенью. В других воплощениях конъюгационная полимерная группировка имеет, например, молекулярную массу менее примерно 40, менее примерно 30 или менее примерно 20 кДа. Кроме того, полимерные конъюгационные группировки могут быть водорастворимыми и, возможно, дополнительно включают другие конъюгационные группировки, такие как пептиды, углеводы, лекарственные препараты, репортерные группы или другие конъюгационные группировки.

В некоторых воплощениях полимерные конъюгаты включают полиэтиленгликоль (PEG) и сополимеры и их производные. Было показано, что конъюгация с PEG повышает устойчивость олигомерного соединения к действию нуклеаз. Конъюгационные PEG-группировки могут иметь любой молекулярный вес, в том числе, например, примерно 100, примерно 500, примерно 1000, примерно 2000, примерно 5000, примерно 10000 и выше. В некоторых воплощениях конъюгационные PEG-группировки содержат по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 15, по меньшей мере 20 или по меньшей мере 25 остатков этиленгликоля. В других воплощениях конъюгационная PEG-группировка содержит от примерно 4 до примерно 10, от примерно 4 до примерно 8, от примерно 5 до примерно 7 или примерно 6 остатков этиленгликоля. Конъюгационная PEG-группировка также может быть модифицирована таким образом, что концевой гидроксил заменяется алкокси, карбокси, ацил, амидо или другой функциональной группой. К конъюгационной PEG-группировке также могут быть присоединены другие конъюгационные группировки, такие как репортерные группы, включая, например, биотин или флуоресцеин. Сополимеры PEG также пригодны в качестве конъюгационных группировок.

Получение и биологическая активность полиэтиленгликолевых конъюгатов олигонуклеотидов описаны, например, в Bonora, et al., Nucleosides Nucleotides, 1999, 18, 1723; Bonora, et al., Farmaco, 1998, 53, 634; Efimov, Bioorg. Khim. 1993, 19, 800; и Jaschke, et al, Nucleic Acids Res., 1994, 22, 4810. Еще один пример конъюгационных PEG-группировок и получение соответствующих конъюгационных олигомерных соединений описаны, например, в патентах США №№4904582 и 5672662, каждый из которых включен в данный документ посредством ссылки в полном объеме. Олигомерные соединения, конъюгированные с одной или более чем одной PEG-группировкой, являются коммерчески доступными.

Другие полимеры, пригодные в качестве конъюгационных группировок, включают полиамины, полипептиды, полиметакрилаты (например, гидроксипропила метакрилат (НРМА)), поли(L-лактид), поли(DL-лактид-со-гликолид (PGLA), полиакриловые кислоты, полиэтиленимины (PEI), полиалкилакриловые кислоты, полиуретаны, полиакриламиды, N-алкилакриламиды, полиспермин (PSP), простые полиэфиры, циклодекстрины, их производные и их сополимеры. Многие полимеры, такие как PEG и полиамины, имеют рецепторы, присутствующие в определенных клетках, тем самым облегчая клеточное поглощение. Полиамины и другие аминосодержащие полимеры могут существовать в протонированной форме при физиологическом значении рН, эффективно противодействуя анионному остову некоторых олигомерных соединений, эффективно повышая клеточное проникновение. Некоторые примеры полиаминов включают полипептиды (например, полилизин, полиорнитин, полигистидин, полиаргинин и их сополимеры), триэтилентетраамин, спермин, полиспермин, спермидин, syn-норспермидин, С-разветвленный спермидин и их производные. Получение и биологическая активность конъюгатов полиаминов описаны, например, в Guzaev, et at, Bioorg. Med. Chem. Lett., 1998, 8, 3671; Corey, et al, J Am. Chem. Soc, 1995, 117, 9373; и Prakash, et al, Bioorg. Med. Chem. Lett. 1994, 4, 1733. Примеры полипептидных конъюгатов олигонуклеотидов приведены, например, в Wei, et al., Nucleic Acids Res., 1996, 24, 655; и Zhu, et al., Antisense Res. Dev., 1993, 3, 265. В качестве конъюгационных группировок также могут быть использованы дендритные полимеры, такие как описаны в патенте США №5714166, который включен в данный документ посредством ссылки в полном объеме.

Как обсуждалось выше для полиаминов и родственных полимеров, другие аминосодержащие группировки также могут служить в качестве подходящих конъюгационных группировок, например, благодаря образованию катионных частиц в физиологических условиях. Примеры аминосодержащих группировок включают 3-аминопропил, 3-(N,N-диметиламино)пропил, 2-(2-(N,N-диметиламино)этокси)этил, 2-(N-(2-аминоэтил)-N-метиламиноокси)этил, 2-(I-имидазолил)этил и т.п. Группировка G-застежки также может служить в качестве аминосодержащей конъюгационной группировки (Lin, et al., J. Am. Chem. Soc, 1998, 120, 8531).

В некоторых воплощениях конъюгат может быть или может содержать полимер, такой как полимер, выбранный из группы, состоящей из полиэтиленгликоля (PEG), полиамидоамина (РАА), полиэтиленоксида и полиэтиленимина (PEI), галактозы, лактозы, N-ацетилгалактозамина, маннозы, маннозо-6-фосфата. В некоторых воплощениях полимер является поликатионным полимером. В некоторых воплощениях конъюгационные группировки могут представлять собой (включать) или быть основаны на катионных полимерах. Многочисленные исследования показали, что катионные полимеры, такие как катионный альбумин, могут значительно повышать доставку к определенным типам клеток и/или тканей (например, доставку к головному мозгу, см. Lu, W. et. al. (2005) J of Control Release 107: 428-448). Учитывая преимущества этих молекул, конъюгационные группировки могут быть катионными полимерами, такими как полиэтиленимин, дендримерами, солями полиалкилпиридиния или катионным альбумином. В некоторых воплощениях они являются гидрофильными полимерами. В некоторых воплощениях полимер представляет собой поливинилпирролидон (PVP). В некоторых воплощениях полимер представляет собой полиамин или полиамид (например, US 7816337 и US 5525465). Про полимерные конъюгаты см., например, в Zhao et al., Bioconjugate Chem 2005, 16, 758-766); Kim et al., J. Control Release (2006) 116; 123. Pettit et al., Ther. Deliv. (2011) 2(7): 907-17. Yang et al., Bioconjug Chem (2009) 20(2): 213-21. Winkler et al (2009) Eur J Med Chem 44(2): 670-7. Zelikin et al, Biomacromolecules (2007) 8(9): 2950-3. См. также WO 12092373, который относится к ферментативно расщепляемым конъюгатам доставки полинуклеотида.

Белковые и пептидные конъюгаты

Другие конъюгационные группировки могут включать белки, субъединицы или их фрагменты. Белки включают, например, ферменты, репортерные ферменты, антитела, рецепторы и т.п. В некоторых воплощениях белковые конъюгационные группировки могут представлять собой антитела или их фрагменты (Kuijpers, et al, Bioconjugate Chem., 1993, 4, 94). Антитела могут быть предназначены для связывания с желаемой мишенью, такой как опухолевые и другие антигены, связанные с заболеваниями. В других воплощениях белковые конъюгационные группировки могут представлять собой сывороточные белки, такие как HAS, или гликопротеины, такие как асиалогликопротеин (Rajur, et al., Bioconjugate Chem., 1997, 6, 935). В других воплощениях олигомерные соединения могут быть конъюгированы с РНКi-связанными белками, РНКi-связанными белковыми комплексами, субъединицами и их фрагментами. Например, олигомерные соединения могут быть конъюгированы с Dicer или RISC.

Интеркаляторы и агенты, связывающиеся с малой бороздкой (minor groove binder, MGB), также могут быть пригодны в качестве конъюгационных группировок. В некоторых воплощениях MGB может содержать повторяющиеся DPI (L,2-дигидро-3Н-пирроло-(2,3-е)-индол-7-карбоксилат) субъединицы или их производные (Lukhtanov, et al., Bioconjugate Chem., 1996, 7, 564; и Afonina, et al., Proc. Natl. Acad. Sci. USA, 1996, 93, 3199). Подходящие интеркаляторы включают, например, полициклические ароматические углеводороды, такие как нафталин, перилен, фенантридин, бензофенантридин, феназин, антрахинон, акридин и их производные. Гибридные интеркаляторы/лиганды включают фотонуклеазу/интеркалятор лиганд 6-[[[9-[[6-(4-нитробензамидо)гексил]амино]-акридин-4-ил]карбонил]амино]гексаноилпентафторфениловый эфир. Это соединение содержит одновременно акридиновую группировку, которая является интеркалятором, и р-нитро-бензамидо-группу, которая является фотонуклеазой.

В других воплощениях расщепляющие агенты могут выступать в качестве конъюгационных группировок. Расщепляющие агенты могут облегчить разрушение мишени, такой как нуклеиновая кислота-мишень, путем гидролиза или окислительно-восстановительных механизмов расщепления. Расщепляющие группы, которые могут быть пригодны в качестве конъюгационных группировок, включают, например, металлокомплексы, пептиды, амины, ферменты и конструкции, содержащие компоненты активных центров нуклеаз, такие как имидазол, гуанидин, карбоксил, аминогруппы и т.д.). Примеры металлокомплексов включают, например, Cu-терпиридил-комплексы, Fe-порфирин-комплексы, Ru-комплексы и комплексы лантанидов, например, различные комплексы Eu (III) (Hall, et al., Chem. Biol, 1994, 1, 185; Huang, et al., J. Biol. Inorg. Chem., 2000, 5, 85; и Baker, et al, Nucleic Acids Res., 1999, 27, 1547). Другие металлокомплексы с расщепляющими свойствами включают металлопорфирины и их производные. Примеры пептидов со свойствами расщепления мишеней включают цинковые пальцы (патент США №6,365,379; Lima, et al., Proc. Natl. Acad. Sci. USA, 1999, 96, 10010). Примеры конструкций, содержащих компоненты активных центров нуклеаз, включают бис-имидазол и гистамин.

Конъюгационные группировки также могут включать пептиды. Подходящие пептиды могут иметь от 2 до примерно 30, от 2 до 20, от 2 до примерно 15 или от 2 до примерно 10 аминокислотных остатков. Аминокислотные остатки могут быть природными или неприродными, в том числе и D- и L-изомерами. В некоторых воплощениях пептидные конъюгационные группировки являются рН-чувствительными пептидами, такими как фузогенные пептиды. Фузогенные пептиды могут облегчить эндосомальное высвобождение агентов, таких как олигомерные соединения, в цитоплазму. Считается, что фузогенные пептиды изменяют конформацию при кислом рН, эффективно дестабилизируя эндосомальную мембрану и тем самым повышая цитоплазматическую доставку содержимого эндосом. Примеры фузогенных пептидов включают пептиды, полученные из полимиксина В, вируса гриппа НА2, GALA, KALA, EALA, пептида, полученного из мелиттина, а-спирального пептида или бета-амилоидного пептида болезни Альцгеймера и т.п. Получение и биологическая активность олигонуклеотидов, конъюгированных с фузогенными пептидами, описаны, например, в Bongartz, et al., Nucleic Acids Res., 1994, 22, 4681, и в патентах США №№6559279 и 6344436. Другие пептиды, которые могут выступать в качестве конъюгационных группировок, включают пептиды доставки, которые способны транспортировать относительно большие полярные молекулы (в том числе пептиды, олигонуклеотиды и белки) через клеточные мембраны. Примеры пептидов доставки включают Tat-пептид из Tat-белка HIV и Ant-пептид из белка антенны Drosophila. Конъюгация Tat и Ant с олигонуклеотидами описана, например, в Astriab-Fisher, et al., Biochem. Pharmacol, 2000, 60, 83. Эти и другие пептиды доставки, которые могут быть использованы в качестве конъюгационных группировок, представлены ниже в таблице I.

Конъюгированные пептиды доставки могут помочь в контроле локализации олигомерных соединений в конкретных областях клетки, в том числе, например, в цитоплазме, ядре, ядрышке и эндоплазматическом ретикулуме (ER). Ядерная локализация может быть осуществлена путем конъюгации с сигналом ядерной локализации (nuclear localization signal, NLS). Напротив, цитоплазматической локализации может способствовать конъюгация с сигналом ядерного экспорта (nuclear export signal, NES).

Пептиды, подходящие для локализации конъюгированных олигомерных соединений в ядре, включают, например, пептид N,N-дипальмитоилглицил-апоЕ или пептид N,N-дипальмитоилглицил-аполипопротеин Е (dpGapoE) (Liu, et al, Arterioscler. Thromb. Vasc. Biol, 1999, 19, 2207; Chaloin, et al., Biochem. Biophys. Res. Commun., 1998, 243, 601). Локализация в ядре или ядрышке также может быть облегчена с помощью пептидов, содержащих мотивы, богатые аргинином и/или лизином, такие как Tat от HIV-1, FXR2P и пептиды, полученные из ангиогенина (Lixin, et al, Biochem. Biophys. Res. Commun., 2001, 284, 185). Кроме того, пептидный сигнал ядерной локализации (NLS), полученный из антигена Т SV40 (Branden, et al., Nature Biotech, 1999, 17, 784), может быть использован для доставки конъюгированных олигомерных соединений в ядро клетки. Другие подходящие пептиды со свойствами локализации в ядре или ядрышке, описаны, например, в Antopolsky, et al., Bioconjugate Chem., 1999, 10, 598; Zanta, et al., Proc. Natl. Acad. Sci. USA, 1999 (большой опухолевый антиген обезьяньего вируса 40); Hum. Mol. Genetics, 2000, 9, 1487; и FEBSLett., 2002, 532, 36).

В некоторых воплощениях пептид доставки для локализации в ядре или ядрышке содержит по меньшей мере три последовательных остатка аргинина или по меньшей мере четыре последовательных остатка аргинина. Ядерной локализации также могут способствовать пептидные конъюгаты, содержащие повторные мотивы RS, RE или RD (Cazalla, et al., Mol Cell. Biol, 2002, 22, 6871). В некоторых воплощениях конъюгат пептида содержит по меньшей мере два RS-, RE- или RD-мотива.

Локализация олигомерных соединений в ER может быть осуществлена, например, путем конъюгации с сигнальным пептидом KDEL (SEQ ID №18) (Arar, et al., Bioconjugate Chem., 1995, 6, 573; Pichon, et al., Mol. Pharmacol. 1997, 57, 431).

Цитоплазматическая локализация олигомерных соединений может быть облегчена путем конъюгации с пептидами, имеющими, например, сигнал ядерного экспорта (NES) (Meunier, et al., Nucleic Acids Res., 1999, 27, 2730). NES-пептиды включают лейцин-богатые NES-пептиды, полученные из Rev HIV-1 (Henderson, et al., Exp. Cell Res., 2000, 256, 213), транскрипционного фактора III, MAPKK, PKI-альфа, циклина BL и актина (Wada, et al., EMBO J., 1998, 17, 1635) и родственных белков. Антимикробные пептиды, такие как производные дермацептина, также могут способствовать цитоплазматической локализации (Hariton-Gazal, et al., Biochemistry, 2002, 41, 9208). Пептиды, содержащие повторные мотивы RG и/или KS, также могут быть пригодны для направления олигомерных соединений в цитоплазму. В некоторых воплощениях пептидные конъюгационные группировки содержат по меньшей мере два RG-мотива, по меньшей мере два KS-мотива или по меньшей мере один RG- и один KS-мотив.

Используемый в данном документе термин "пептид" включает не только специфическую молекулу или последовательность, указанную в данном документе (если она присутствует), но также включает ее фрагменты и молекулы, включающие все или часть указанной последовательности, где сохраняется нужная функциональность. В некоторых воплощениях пептидные фрагменты содержат не менее 6 аминокислот. Пептиды также могут содержать консервативные аминокислотные замены, которые существенно не изменяют их функциональные характеристики. Консервативная замена может быть сделана среди следующего набора функционально аналогичных аминокислот: нейтральные - слабо гидрофобные (A, G, Р, S, Т), гидрофильно-кислотные с амином (N, D, Q, R), гидрофильно-основные (I, М, L, V) и гидрофобно-ароматические (F, W, Y). Пептиды также включают гомологичные пептиды. Гомология может быть измерена в соответствии с процентом, который определяют, например, с помощью алгоритма BLAST (параметры по умолчанию для коротких последовательностей). Например, гомологичные пептиды могут иметь больше 50, 60, 70, 80, 90, 95 или 99 процентов идентичности. Способы конъюгации пептидов с олигомерными соединениями, такими как олигонуклеотиды, описаны, например, в патенте США №6559279, который включен в данный документ в полном объеме посредством ссылки.

В некоторых воплощениях конъюгационная группировка представляет собой или включает белок или пептид. В некоторых воплощениях пептид представляет собой пептид, проникающий в клетку, например пенетратин, транспортан, пептаибол (например, трихоровин-ХIIа (TV-XIIa)), пептид TAT (HIV). В некоторых воплощениях этот пептид представляет собой полиаргинин (например, стеарил-(RxR)(4)). В некоторых воплощениях пептид представляет собой N-(2-гидроксипропил)метакриламид (НРМА), содержащий тетрапептид Gly-Phe-Leu-Gly (GFLG). В некоторых воплощениях пептид представляет собой бета-амилоидный пептид. В некоторых воплощениях белок или пептид представляет собой антитело или его фрагмент, содержащий его антигенсвязывающий сайт (сайт связывания эпитопа). В некоторых воплощениях конъюгат представляет собой или включает M6P-HPMA-GFLG (см. Yang et al 2009). В некоторых воплощениях конъюгат представляет собой или включает аргинин-богатые пептиды (WO 2005/115479) - см. также пептиды RGD в WO 09005793. В некоторых воплощениях конъюгат представляет собой или содержит белковый носитель (например, альбумин, конъюгат альбумин-PEG - RGD-PEG-альбумин) (Kang et al.), см. также WO 09045536. В некоторых воплощениях конъюгат представляет собой или включает гистидинилированный олиголизин (например, WO 0032764). В некоторых воплощениях конъюгат представляет собой или содержит гликопротеины: трансферрин-поликатион (например, US 5354844, WO 9217210, WO 9213570). В некоторых воплощениях конъюгат представляет собой или включает асиалогликопротеин (US 5346696). В некоторых воплощениях конъюгат представляет собой или содержит поликатионный белок (например, US 603095). В некоторых воплощениях конъюгат представляет собой или включает полипсевдолизиновые конъюгаты (например, WO 07113531).

Репортерные и меченые конъюгационные группировки

Репортерные группы, которые пригодны в качестве конъюгационных группировок, включают любую группировку, которая может быть обнаружена, например, спектроскопическими средствами. Примеры репортерных групп включают красители, флуорофоры, люминофоры, радиоактивные метки и т.п. В некоторых воплощениях репортерная группа представляет собой биотин, флуоресцеин, родамин, кумарин или родственные соединения. Репортерные группы также могут быть присоединены к другим конъюгационным группировкам. В некоторых воплощениях конъюгат представляет собой или содержит метку или краситель, такой как флуорофор, например FAM (карбоксифлуоресцеин).

Сшивающие агенты также могут выступать в качестве конъюгационных группировок. Сшивающие агенты способствуют ковалентному связыванию конъюгированных олигомерных соединений с другими соединениями. В некоторых воплощениях сшивающие агенты могут ковалентно связывать двухцепочечные нуклеиновые кислоты, эффективно увеличивая стабильность дуплекса и модулируя фармакокинетические свойства. В некоторых воплощениях сшивающие агенты могут обладать фотоактивной или окислительно-восстановительной активностью. Примеры сшивающих агентов включают псоралены, которые могут способствовать внутринитевому сшиванию нуклеиновых кислот путем фотоактивации (Lin, et al, Faseb J, 1995, 9, 1371). Другие сшивающие агенты включают, например, митомицин С и его аналоги (Maruenda, et al., Bioconjugate Chem., 1996, 7, 541; Maruenda, et al., Anti-Cancer Drug Des., 1997, 12, 473; и Huh, et al, Bioconjugate Chem., 1996, 7, 659). Сшивание, опосредованное митомицином С, может быть осуществлено путем восстановительной активации, например, с помощью биологических восстановителей (например, NADPH-цитохром С системы редуктазы C/NADPH). Другие фотосшивающие агенты включают арилазиды, такие как, например, N-гидроксисукцинимидил-4-азидобензоат (HSAB) и N-сукцинимидил-6-(4'-азидо-2'-нитрофенил-амино)гексаноат (SANPAH). Арилазиды, конъюгированные с олигонуклеотидами, обеспечивают сшивание с нуклеиновыми кислотами и белками при облучении. Они также могут обеспечивать сшивание с полученными белками (такими как KLH или BSA).

Различные функциональные группы

Другие подходящие конъюгационные группировки включают, например, полибораны, карбораны, металлополибораны, металлокарбораны, их производные и т.п. (см., например, патент США. №5272250, который включен в данный документ посредством ссылки в полном объеме).

Многие лекарственные препараты, лиганды рецепторов, токсины, репортерные молекулы и другие малые молекулы могут выступать в качестве конъюгационных группировок. Низкомолекулярные конъюгационные группировки часто специфически взаимодействуют с определенными рецепторами или другими биомолекулами, тем самым направляя конъюгированные олигомерные соединения в специфические клетки или ткани. Примеры низкомолекулярных конъюгационных группировок включают микофеноловую кислоту (ингибитор дигидрогеназы инозин-5'-монофосфата; используется для лечения псориаза и других заболеваний кожи), куркумин (имеет терапевтическое применение при псориазе, раке, бактериальных и вирусных заболеваниях). В других воплощениях низкомолекулярные конъюгационные группировки могут быть лигандами сывороточных белков, таких как сывороточный альбумин человека (HSA). Многочисленные лиганды HSA известны и включают, например, арилпропионовые кислоты, ибупрофен, варфарин, фенилбутазон, супрофен, карпрофен, фенбуфен, кетопрофен, аспирин, индометацин, (S)-(+)-пранопрофен, дансилсаркозин, 2,3,5-трийодобензойную кислоту, флуфенамовую кислоту, фолиевую кислоту, бензотиадиазид, хлоротиазид, диазепин, индометацин, барбитураты, цефалоспорины, серосодержащие препараты, антибактериальные препараты, антибиотики (например, пуромицин и памамицин) и т.п. Конъюгаты олигонуклеотидов с лекарственными препаратами и их получение описаны, например, в WO 00/76554, который включен в данный документ в полном объеме посредством ссылки.

В некоторых воплощениях конъюгат может представлять собой или содержать небольшую молекулу, например в виде низкомолекулярного лекарственного препарата или пролекарства. Некоторые препараты высоко эффективны в нацеливании на конкретную целевую ткань или клетки, и как таковые, они могут быть использованы для направления олигонуклеотида в его предназначенное место действия. Кроме того, малая молекула сама по себе может иметь терапевтическую активность, как правило, сразу после отщепления от олигонуклеотидного компонента конъюгата. Примеры включают бисфосфонаты (широко используемые в лечении остеопороза и эффективные в нацеливании на костную ткань), противоопухолевые лекарственные препараты и химиотерапевтические агенты (например, доксорубицин или митомицин С - см. US 5776907). В некоторых воплощениях препарат может быть нуклеозидным аналогом, таким как нуклеозидный ингибитор полимеразы.

В других воплощениях низкомолекулярные конъюгаты могут нацеливаться или связываться с определенными рецепторами или клетками. Т-клетки, как известно, имеют незащищенные аминогруппы, которые могут образовывать комплексы оснований Шиффа с соответствующими молекулами. Таким образом, малые молекулы, содержащие функциональные группы, такие как альдегиды, которые могут взаимодействовать или реагировать с незащищенными аминогруппами, также могут быть подходящими конъюгационными группировками. Тукаресол и родственные соединения могут быть конъюгированы с олигомерными соединениями таким образом, чтобы альдегид оставался свободным для взаимодействия с Т-клеточными мишенями. Взаимодействие тукаресола с Т-клетками, по-видимому, приводит к терапевтическому потенцированию иммунной системы за счет формирования оснований Шиффа (Rhodes, et al., Nature, 1995, 377, 6544).

В некоторых воплощениях конъюгат представляет собой или содержит (например, на поверхности клеток) рецепторный лиганд. В некоторых воплощениях конъюгат представляет собой или содержит фолатный рецепторный лиганд, такой как группа фолиевой кислоты - см., например, ЕР 1572067 или WO 2005/069994, WO 2010/045584). Другие лиганды рецепторов клеточной поверхности включают антитела и их фрагменты, простатический специфический мембранный антиген, поверхностные антигены нейронов (см. WO 2011/131693).

В некоторых воплощениях конъюгационные группировки представляют собой лиганды рецепторов или могут ассоциировать с молекулами, которые (в свою очередь) ассоциируют с рецепторами. В этот класс входят желчные кислоты, низкомолекулярные лекарственные лиганды, витамины, аптамеры, углеводы, пептиды (включая, но не ограничиваясь ими, гормоны, белки, фрагменты белков, антитела или фрагменты антител), вирусные белки (например, капсиды), токсины (например, бактериальные токсины) и др. Кроме того, в этот класс входят конъюгаты, которые являются стероидными в природе, например, холестерин, холестанол, холановая кислота, стигмастерины, прегненолоны, прогестероны, кортикостероиды, альдостероны, тестостероны, эстрадиолы, эргостерины и др.). Предпочтительными раскрытыми конъюгационными группировками являются холестерин (CHOL), холестанол (CHLN), холановая кислота (CHLA), стигмастерин (STIG) и эргостерин (ERGO). В некоторых предпочтительных воплощениях конъюгационная группировка представляет собой холестерин.

В некоторых воплощениях конъюгат содержит стерин, такой как холестерин или токоферол, возможно, включающий линкер, например, жирно-кислотный линкер, например, С6-линкер. В некоторых воплощениях конъюгаты включают Conj5a или CONJ 6а.

Конъюгационные группировки также могут включать витамины. Витамины, как известно, транспортируются в клетки с помощью многих клеточных транспортных систем. Как правило, витамины могут быть классифицированы как водорастворимые или жирорастворимые. Водорастворимые витамины включают тиамин, рибофлавин, никотиновую кислоту или ниацин, пиридоксальную группу витамина В6, пантотеновую кислоту, биотин, фолиевую кислоту, кофермент В12 кобамид, инозит, холин и аскорбиновую кислоту. Жирорастворимые витамины включают витамины семейства А, витамин D, витамины семейства Е (токоферола) и витамин K (и фитолы). Родственные соединения включают ретиноидные производные, такие как тазаротен и этретинат.

В некоторых воплощениях конъюгационная группировка включает фолиевую кислоту (фолат) и/или одну или более чем одну из ее различных форм, таких как дигидрофолиевая кислота, тетрагидрофолиевая кислота, фолиновая кислота, птерополиглутаминовая кислота, дигидрофолаты, тетрагидрофолаты, тетрагидроптерины, 1-деаза-, 3-деаза-, 5-деаза-, 8-деаза-, 10-деаза-, 1,5-дидеаза-, 5,10-дидеаза-, 8,10-дидеаза- и 5,8-дидеазафолатные аналоги и антифолаты. Фолат участвует в биосинтезе нуклеиновых кислот и, следовательно, воздействует на выживание и пролиферацию клеток. Фолатные кофакторы играют роль в переносе одноуглеродных фрагментов, который необходим для биосинтеза пиримидиновых нуклеозидов. Таким образом, клетки имеют систему транспортировки фолатов в цитоплазму. Фолатные рецепторы также имеют тенденцию к избыточной экспрессии на многих человеческих раковых клетках, и сообщалось о фолат-опосредованном направлении олигонуклеотидов в клетки рака яичников (Li, et al, Pharm. Res. 1998, 15, 1540, которая включена в данный документ в полном объеме посредством ссылки). Получение конъюгатов фолиевой кислоты и нуклеиновых кислот описано, например, в патенте US №6528631, который включен в данный документ посредством ссылки в полном объеме.

Витаминсодержащие конъюгационные группировки включают, например, витамин А (ретинол) и/или родственные соединения. Витамины семейства А (ретиноиды), включая ретиноевую кислоту и ретинол, как правило, поглощаются и транспортируются в ткань-мишень посредством их взаимодействия со специфическими белками, такими как цитозольный ретинол-связывающий белок типа II (CRBP-II), ретинол-связывающий белок (RBP) и клеточный ретинол-связывающий белок (CRBP). Соединения витаминов семейства А могут быть присоединены к элигомерным соединениям через кислотные или спиртовые функциональные группы, найденные в различных членах семейства. Например, конъюгация N-гидроксисукцинимидного эфира кислотной группировки ретиноевой кислоты с аминной функциональной группой на линкере, прикрепленном к олигонуклеотиду, может привести к связыванию соединения витамина А с олигомерным соединением через амидную связь. Кроме того, ретинол может быть преобразован в его фосфорамидит, который используется для 5'-конъюгации. Альфа-токоферол (витамин Е) и другие токоферолы (бета через дзета) могут быть конъюгированы с олигомерными соединениями для повышения поглощения благодаря их липофильному характеру. Кроме того, витамин D и его эргостериновые предшественники могут быть конъюгированы с олигомерными соединениями через их гидроксильные группы сначала путем активации гидроксильных групп, например, с гемисукцинатными эфирами. Затем конъюгация может быть осуществлена непосредственно с олигомерным соединением или с аминолинкером, прикрепленным к олигомерному соединению. Другие витамины, которые могут быть аналогичным образом конъюгированы с олигомерными соединениями, включают тиамин, рибофлавин, пиридоксин, пиридоксамин, пиридоксаль, дезоксипиридоксин. Жирорастворимый витамин К и родственные хинон-содержащие соединения могут быть конъюгированы через карбонильные группы на хиноновом кольце. Фитоловые группировки витамина К также могут служить для улучшения связывания олигомерных соединений с клетками.

Другие функциональные группы, которые могут быть использованы в качестве конъюгатов в соединениях согласно изобретению, включают конъюгат имидазола, который имитирует каталитический центр РНКазы А (конъюгаты полиамина-имидазола) - см. Guerniou et al Nucleic Acids Res (2007); 35 (20): 6778-87.

Конъюгаты, как правило, являются ненуклеотидными группировками. Тем не менее, в контексте блокирующих групп или направляющих групп или нуклеотидных аналоговых низкомолекулярных терапевтических средств, следует знать, что олигонуклеотид может быть ковалентно связан с нуклеотидной группировкой через ДНК/РНК-фосфодиэфирную область согласно изобретению. Соответственно, нуклеиновокислотная группа, используемая в контексте данного изобретения, в некоторых воплощениях может не иметь комплементарности к мишени олигонуклеотида (области А).

В некоторых воплощениях блокирующая или направляющая группировка представляет собой аптамер (см., например, Meng et al., PLoS One (2012) 7(4): e33434, WO 2005/111238 и WO 12078637).

Блокирующая группа также может представлять собой или содержать олигонуклеотидную область, которая комплементарна, например, части антисмыслового олигонуклеотида. В связи с этим блокирующий олигонуклеотид ковалентно связан с антисмысловым олигонуклеотидом через ДНК/РНК-фосфодиэфирную область (область В) и, возможно, линкер. Таким образом, в некоторых воплощениях блокирующий олигонуклеотид способен образовывать дуплекс с антисмысловым олигонуклеотидом. Соответственно, блокирующая нуклеотидная последовательность (в виде третьей области или области С) представляет собой короткую олигонуклеотидную последовательность, например 3-10 нуклеотидов в длину, которая формирует дуплекс (т.е. комплементарна) с эквивалентной длиной первой области. В некоторых воплощениях линкер используется между второй областью и блокирующей областью.

Как и пептиды доставки, нуклеиновые кислоты также могут выступать в качестве конъюгационных группировок, которые могут влиять на локализацию конъюгированных олигомерных соединений в клетке. Например, нуклеиновокислотные конъюгационные группировки могут содержать поли-А-мотив, распознаваемый поли-А-связывающим белком (polyA binding protein, РАВР), который может локализовать молекулы, содержащие полиА, в цитоплазме (Gorlach, et al., Exp. Cell Res., 1994, 211, 400.). В некоторых воплощениях нуклеиновокислотная конъюгационная группировка содержит по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 15, по меньшей мере 20, по меньшей мере 25 последовательных оснований А. Нуклеиновокислотная конъюгационная группировка также может содержать один или более чем один элемент AU-богатой последовательности (AU-rich sequence element, ARE). ARE распознаются белками семейства ELAV, которые могут способствовать локализации в цитоплазме (Bollig, et al, Biochem. Bioophys. Res. Commun., 2003, 301, 665). Примеры ARE включают UUAUUUAUU и последовательности, содержащие множественные повторы этого мотива. В других воплощениях нуклеиновокислотная конъюгационная группировка содержит два или более двух AU- или AUU-мотивов. Аналогично, нуклеиновокислотная конъюгационная группировка может также содержать один или более чем один элемент CU-богатой последовательности (CU-rich sequence element, CRE) (Wein, et al, Eur. J. Biochem., 2003, 270, 350), который может связываться с белками HuD и/или HuR из семейства белков ELAV. Как и ARE, CRE могут помочь в локализации конъюгированных олигомерных соединений в цитоплазме. В некоторых воплощениях нуклеиновокислотная конъюгационная группировка содержит мотив (CUUU)n, где n, например, может составлять от 1 до примерно 20, от 1 до примерно 15 или от 1 до примерно 11. Мотиву (CUUU)n, возможно, может предшествовать (или следовать за ним) один или более чем один U. В некоторых воплощениях n составляет от примерно 9 до примерно 12 или примерно 11. Нуклеиновокислотная конъюгационная группировка также может включать субстраты hnRNP-белков (гетерогенный ядерный рибонуклеопротеин), некоторые из которых участвуют в переносе нуклеиновых кислот между ядром и цитоплазмой (например, nhRNP Al и nhRNP K; см., например, Mili, et al, Mol. Cell Biol, 2001, 21, 7307). Некоторые примеры hnRNP-субстратов включают нуклеиновые кислоты, содержащие последовательность UAGGA/U или (GG)ACUAGC(A). Другие нуклеиновокислотные конъюгационные группировки могут включать нити Y или другие участки, которые могут связываться, например, с linRNP I. В некоторых воплощениях нуклеиновокислотный конъюгат может содержать по меньшей мере 3, по меньшей мере 4, по меньшей мере 5, по меньшей мере 6, по меньшей мере 7, по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 15, по меньшей мере 20 и по меньшей мере 25 последовательных пиримидиновых оснований. В других воплощениях нуклеиновокислотный конъюгат может содержать более 50, более 60, более 70, более 80, более 90 или более 95 процентов пиримидиновых оснований.

Другие нуклеиновокислотные конъюгат-подобные группировки могут включать последовательности распознавания Pumilio (белок puf), описанные в Wang, et al., Cell, 2002, 110, 501. Примеры последовательностей распознавания Pumilio могут включать UGUANAUR, где N может быть любым основанием, a R может быть пуриновым основанием. Локализация в цитоплазме может быть облегчена с помощью нуклеиновокислотных конъюгационных группировок, содержащих ARE и/или CRE. Нуклеиновокислотные конъюгационные группировки, служащие в качестве субстратов hnRNP, могут способствовать локализации конъюгированных олигомерных соединений в цитоплазме (например, hnRNP Al или K) или ядре (например, hnRNP I). Кроме того, локализации в ядре могут способствовать нуклеиновокислотные конъюгационные группировки, содержащие полипиримидиновые области.

Реакционноспособная группа

Реакционноспособная группа представляет собой группу, которая используется в химическом синтезе и для которой в контексте данного изобретения может быть использован термин "конъюгационный" олигонуклеотид или олигонуклеотид, иным образом ковалентно связанный с третьей областью (X), например, конъюгат, блокирующая группа или направляющая группа или, возможно, линкер (Y). Примером реакционноспособной группы является фосфорамидит, который широко используется в олигонуклеотидном синтезе.

Активационная группа

Активационная группа представляет собой группу, которая может быть активирована для формирования реакционноспособной группы. В этом отношении активационную группу можно рассматривать как защищенную реакционноспособную группу, с которой защита может быть удалена перед возможным использованием реакционноспособной группы, например, в способах синтеза/изготовления, описанных в данном документе.

Связывающая группа

Нуклеозидная связь либо представляет собой связывающую группу между нуклеозидами в олигонуклеотиде, либо, при наличии, это понятие также может описывать группу, которая присоединяет третью область (X или С) или линкер (Y) к области В - например, этот линкер может быть фосфатной (фосфатсодержащей) связывающей группой или триазоловой группой.

Блокирующая группа (также упоминается как блокирующая группировка/блокатор)

В некоторых аспектах третья область является блокирующей областью. Блокатор, как правило, представляет собой конъюгат или олигонуклеотид (как правило, некомплементарный области-мишени), который, например, (но не ограничиваясь этим) либо за счет стерических затруднений, либо за счет гибридизации с первой областью (или первой и второй областями) предотвращает или снижает активность олигомера. (Блокирующая) активность может быть направлена либо против намеченной цели (мишени), либо, в некоторых воплощениях, против случайных мишеней (вне мишени).

Таким образом, олигомерные соединения согласно изобретению могут содержать первую область, например, гэпмер или LNA-гэпмерный олигонуклеотид (например, гэпмер формулы X'Y'Z), вторую область, которая является биорасщепляемым линкером, таким как область В, описанная в данном документе, и третью область, область С, которая содержит область по меньшей мере из двух последовательных нуклеозидов, например 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 нуклеотидов, комплементарных соответствующей части первой области. В некоторых воплощениях по меньшей мере два нуклеозида из области С, например, 3, 4, 5, 6, 7, 8, 9 или 10 нуклеозидов, являются высокоаффинными нуклеозидными аналогами, такими как LNA (BNA) - в некоторых воплощениях они могут формировать дистальную часть области С. Высокоаффинные нуклеозидные аналоги области С могут формировать непрерывную последовательность высокоаффинных нуклеозидных аналогов, которые могут быть фланкированы другими нуклеозидами, такими как ДНК-нуклеозиды (также части области С, которые называют проксимальной частью области С). В некоторых воплощениях область С содержит от 2 до 8 (например, 3, 4, 5, 6 и 7 LNA (ВNА)-нуклеотидов, и в том же или в другом воплощении область из 2-16 ДНК-нуклеотидов (например, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15). В некоторых воплощениях дистальная часть области В содержит непрерывную область высокоаффинных нуклеотидных аналогов, например непрерывную область из 2, 3, 4, 5, 6, 7 или 8 LNA-нуклеотидов. Проксимальная область может содержать непрерывную область из не-LNA-нуклеотидов, таких как описанные в данном документе, например, ДНК-нуклеотидов, например, область из 2-16 не-LNA-нуклеотидов. Тем не менее, также нужно понимать, что проксимальная область может содержать высокоаффинные нуклеотидные аналоги, в том числе LNA, но поскольку непрерывные области LNA могут ограничивать конформационную гибкость проксимальной области (которая, по-видимому, образует петлю), то в некоторых воплощениях может применяться ограничение длины отрезков LNA в проксимальной части (или части, формирующей петлю), например, не более 4 последовательных LNA, например, не более 3 последовательных LNA или не более 2 последовательных LNA.

В некоторых воплощениях область других нуклеотидов в области С (таких как ДНК-нуклеотиды) образует непрерывную последовательность с областью В, т.е. является проксимальной к концевому нуклеотиду области В), так что область высокоаффинных нуклеотидов расположена дистально к области В. В таком воплощении область В и проксимальная часть области С (например, область, содержащая ДНК-нуклеотиды) могут образовывать гибкую петлю, которая позволяет дистальной части области С гибридизоваться с первой областью. Проксимальная часть области С может быть комплементарной или некомплементарной соответствующей части области А. В некоторых воплощениях дистальная часть области С комплементарна нуклеотидам, которые формируют область, способную привлекать РНКазу Н, например, область разрыва в гэпмере (называемую в данном документе областью Y'). В таком воплощении блокирующая область (область С) образует дуплекс с гэпмерной областью или ее частью, тем самым блокируя способность центральной части гэпмера взаимодействовать с другими молекулами или мишенями или вне мишеней. Таким образом, изобретение предусматривает решение для присущей токсичности ДНК-фосфоротиоатных олигонуклеотидов (которые обычно используются для области разрыва в гэпмерах), так как оно позволяет контролировать активацию гэпмерных олигомеров (области А) в целевой ткани или клетках. В этой связи применение блокирующей области может действовать как пролекарство. Известно, что блокирующая область (область С или ее дистальная часть) также может быть направлена на другие области олигомера, в том числе миксмерного или тоталмерного олигомера, или на фланкирующие области гэпмера, или в область крыла и область разрыва в гэпмере. В таком воплощении гибридизация области С (или ее дистальной части) с областью А (или частью области А) предотвращает гибридизацию соответствующей части области А с биомолекулами, и, следовательно, может также быть использована для предотвращения непреднамеренного взаимодействия с другими биомолекулами, что повышает специфичность, тканеспецифическую активность и снижает риск токсичности. Межнуклеозидные связи между нуклеотидами в области С могут отличаться от фосфодиэфирных, например, могут быть фосфоротиоатными.

Направляющая группа (также называемая направляющей группировкой)

Направляющая группировка представляет собой группу, присутствие которой в олигомерном соединении вызывает дифференциальный паттерн биораспределения и/или клеточного поглощения олигомерного соединения. Направляющие группы могут представлять собой, например, лиганды рецепторов, антитела, гормоны или аналоги гормонов, аптамеры и т.д. Примеры показывают применение холестерина в качестве направляющей группы - холестерин распознается рецептором LDL на поверхности гепатоцитов, что приводит к предпочтительному поглощению олигонуклеотидов, конъюгированных с холестерином, в печени. Примеры также иллюстрируют использование GalNac, токоферола и фолиевой кислоты в качестве направляющих групп.

Связанные с олигомерами биорасщепляемые конъюгаты

Олигомерное соединение, возможно, может содержать вторую область (область В), которая расположена между олигомером (упоминаемым как область А) и конъюгатом (упоминаемым как область С). Область В может быть линкером, таким как расщепляемый линкер (также упоминаемый как физиологически лабильная связь).

В некоторых воплощениях соединение согласно изобретению содержит биорасщепляемый линкер (также упоминаемый как физиологически лабильный линкер, чувствительные к нуклеазе физиологически лабильные связи или чувствительный к нуклеазе линкер), например, фосфатный нуклеотидный линкер (такой как область В) или пептидный линкер, который соединяет олигомер (или непрерывную нуклеотидную последовательность или область А) с конъюгационной группировкой (или областью С).

Биорасщепляемые линкеры согласно данному изобретению относятся к линкерам, которые чувствительны к расщеплению в ткани-мишени (т.е. физиологически лабильны), например в печени и/или почках. Предпочтительно, чтобы скорость расщепления, наблюдаемая в ткани-мишени, была выше, чем обнаруживается в сыворотке крови. Подходящие способы определения уровня (%) расщепления в ткани (например, в печени или почках) и в сыворотке приведены в примере 6. В некоторых воплощениях биорасщепляемый линкер (также упоминаемый как физиологически лабильный линкер или чувствительный к нуклеазе линкер), такой как область В, в соединении согласно изобретению является по меньшей мере примерно на 20% расщепленным, например, по меньшей мере примерно на 30% расщепленным, например, по меньшей мере примерно на 40% расщепленным, например, по меньшей мере примерно на 50% расщепленным, например, по меньшей мере примерно на 60% расщепленным, например, по меньшей мере примерно на 70% расщепленным, например, по меньшей мере примерно на 75% расщепленным при анализе гомогената печени или почек из примера 6. В некоторых воплощениях расщепление (%) в сыворотке, используемое в анализе в примере 6, составляет менее чем примерно 20%, например, менее чем примерно 10%, например, менее 5%, например, менее чем примерно 1%.

Биорасщепляемые линкеры согласно данному изобретению относятся к линкерам, которые чувствительны к расщеплению в ткани-мишени (т.е. физиологически лабильны), например, в печени и/или почках. Предпочтительно, чтобы скорость расщепления, наблюдаемая в ткани-мишени, была выше, чем обнаруживаемая в сыворотке крови. Подходящие способы определения уровня (%) расщепления в ткани (например, в печени или почках) и в сыворотке приведены в примере 6. В некоторых воплощениях биорасщепляемый линкер в соединении согласно изобретению (также упоминаемый как физиологически лабильный линкер или чувствительный к нуклеазе линкер), такой как область В, является по меньшей мере примерно на 20% расщепленным, например, по меньшей мере примерно на 30% расщепленным, например, по меньшей мере примерно на 40% расщепленным, например, по меньшей мере примерно на 50% расщепленным, например, по меньшей мере примерно на 60% расщепленным, например, по меньшей мере примерно на 70% расщепленным, например, по меньшей мере примерно на 75% расщепленным при анализе гомогената печени или почек из примера 6. В некоторых воплощениях расщепление (%) в сыворотке, используемое в анализе в примере 6, составляет менее чем примерно 30%, например, менее чем примерно 20%, например, менее примерно 10%, например, менее 5%, например, менее примерно 1%.

В некоторых воплощениях, которые могут быть одинаковыми или различными, биорасщепляемый линкер в соединении согласно изобретению (также упоминаемый как физиологически лабильный линкер или чувствительный к нуклеазе линкер), такой как область В, является чувствительным к расщеплению нуклеазой S1. Восприимчивость к расщеплению S1 может быть оценена с помощью S1-нуклеазного анализа, показанного в примере 6. В некоторых воплощениях биорасщепляемый линкер в соединении согласно изобретению (также упоминаемый как физиологически лабильный линкер или чувствительный к нуклеазе линкер), такой как область В, является по меньшей мере примерно на 30% расщепленным, например, по меньшей мере примерно на 40% расщепленным, например, по меньшей мере примерно на 50% расщепленным, например, по меньшей мере примерно на 60% расщепленным, например, по меньшей мере примерно на 70% расщепленным, например, по меньшей мере примерно на 80% расщепленным, например, по меньшей мере примерно на 90% расщепленным, например, по меньшей мере примерно на 95% расщепленным после инкубации с нуклеазой S1 в течение 120 мин при анализе, используемом в примере 6.

Чувствительные к нуклеазе физиологически лабильные связи: в некоторых воплощениях олигомер (также называемый олигомерным соединением) согласно данному изобретению (или конъюгату) содержит три области:

i) первую область (область А), которая состоит из 10-18 последовательных нуклеотидов;

ii) вторую область (область В), которая содержит биорасщепляемый линкер,

iii) третью область (С), которая содержит конъюгационную группировку, направляющую группировку, активационную группировку, причем третья область ковалентно связана с второй областью.

В некоторых воплощениях участок В может быть фосфатным нуклеотидным линкером. Например, такие линкеры могут быть использованы, когда конъюгат является липофильным конъюгатом, таким как липид, жирная кислота, стерол, такой как холестерин или токоферол. Фосфатные нуклеотидные линкеры также могут быть использованы для других конъюгатов, например, углеводных конъюгатов, таких как GalNac.

Пептид и другие линкеры

В некоторых воплощениях биорасщепляемый линкер (область В) представляет собой пептид, такой как трилизиновый пептидный линкер, который может быть использован в конъюгате полиGalNac, например, триGalNac-конъюгат.

Другие линкеры, известные в данной области, которые могут быть использованы, включают дисульфидные линкеры (также называемые в данном документе "дитио" или "дисульфид"). Другие пептидные линкеры включают, например, трипептид Tyr-Asp(Asp) или дипептид Asp(Asp).

Фосфатные нуклеотидные линкеры

В некоторых воплощениях область В содержит 1-6 нуклеотидов, которые ковалентно связаны с 5'- или 3'-нуклеотидом первой области, например, через межнуклеозидную связывающую группу, такую как фосфодиэфирная связь, где либо

a. межнуклеозидная связь между первой и второй областью является фосфодиэфирной связью, а нуклеозид второй области, который примыкает (например, непосредственно) к первой области, является либо ДНК, либо РНК; и/или

b. по меньшей мере один нуклеозид второй области является связанным фосфодиэфирной связью ДНК- или РНК-нуклеозидом;

В некоторых воплощениях область А и область В образуют одну непрерывную нуклеотидную последовательность длиной 10-22, например, 12-20 нуклеотидов.

В некоторых аспектах межнуклеозидная связь между первой и второй областями может рассматриваться как часть второй области.

Линкеры

Связь или линкер представляет собой связь между двумя атомами, которая связывает одну химическую группу или сегмент, представляющий интерес, с другой химической группой или сегментом, представляющим интерес, с помощью одной или более чем одной ковалентной связи. Конъюгационные группировки (или направляющие или блокирующие группировки) могут быть присоединены к олигомерному соединению непосредственно или через соединительную группировку (линкерную или связывающую) - линкер. Линкеры представляют собой бифункциональные группировки, которые служат для ковалентного связывания третьей области, например, конъюгационной группировки, с олигомерным соединением (таким как область В). В некоторых воплощениях линкер содержит цепочечную структуру или олигомер с повторяющимися звеньями, такими как этиленгликолевые или аминокислотные звенья. Линкер может содержать по меньшей мере две функциональные группы, одну для присоединения к олигомерному соединению, а другую для присоединения к конъюгационной группировке. Иллюстративные линкерные функциональные группы могут быть электрофильными для взаимодействия с нуклеофильными группами на олигомере или конъюгационной группировке, или нуклеофильными для взаимодействия с электрофильными группами. В некоторых воплощениях линкерные функциональные группы включают амино, гидроксил, карбоновую кислоту, тиол, фосфорамидат, фосфат, фосфит, ненасыщенные (например, двойные или тройные) связи и т.п. Некоторые примеры линкеров включают 8-амино-3,6-диоксаоктановую кислоту (ADO), сукцинимидил-4-(N-малеимидометил)-циклогексан-1-карбоксилат (SMCC), 6-аминокапроновую кислоту (АНЕХ или AHA), 6-аминогексилокси, 4-аминомасляную кислоту, 4-аминоциклогексилкарбоновую кислоту, сукцинимидил 4-(N-малеимидометил)циклогексан-1-карбокси-(6-амидо-капроат) (LCSMCC), сукцинимидил-m-малеимидобензоилат (MBS), сукцинимидил-N-e-малеимидокапроилат (EMCS), сукцинимидил-6-(бета-малеимидопропионамидо)гексаноат (SMPH), сукцинимидил-N-(а-малеимидо-ацетат) (AMAS), сукцинимидил-4-(р-малеимидофенил)бутират (SMPB), бета-аланин (бета-ALA), фенилглицин (PHG), 4-аминоциклогексановую кислоту (АСНС), бета-циклопропил-аланин (бета-CYPR), аминододекановую кислоту (ADC), алкилендиолы, полиэтиленгликоли, аминокислоты и т.п.

В данной области известно широкое разнообразие других линкерных групп, которые могут быть использованы в присоединении конъюгационных группировок к олигомерным соединениям. Обзор многих используемых линкерных групп можно найти, например, в Antisense Research and Applications, S.Т. Crooke and B. Lebleu, Eds., CRC Press, Boca Raton, Fla., 1993, p. 303-350. Дисульфидная связь была использована для связывания 3'-конца олигонуклеотида с пептидом (Corey, et al., Science 1987, 238, 1401; Zuckermann, et al, J Am. Chem. Soc. 1988, 110, 1614; и Corey, et al., J Am. Chem. Soc. 1989, 111, 8524). Nelson, et al., Nuc. Acids Res. 1989, 17, 7187 описывают связывающий реагент для присоединения биотина к 3'-концу олигонуклеотида. Этот реагент, N-Fmос-O-DМТ-3-амино-1,2-пропандиол, коммерчески доступен от Clontech Laboratories (Пало-Альто, Калифорния) под названием 3'-Амин (3'-Amine). Также он коммерчески доступен под названием 3'-амино-модифицирующий реагент (3'-Amino-Modifier) от Glen Research Corporation (Стерлинг, Вирджиния). Этот реагент также был использован для связывания пептида с олигонуклеотидом, как сообщалось в Judy, et al., Tetrahedron Letters 1991, 32, 879. Подобный коммерческий реагент для связывания с 5'-концом олигонуклеотида представляет собой 5'-аминомодификатор С6 (5'-Amino-Modifier С6). Эти реагенты доступны от Glen Research Corporation (Стерлинг, Вирджиния). Эти соединения или подобные им были использованы в Krieg, et al, Antisense Research and Development 1991, 1, 161, для связывания флуоресцеина с 5'-концом олигонуклеотида. Другие соединения, такие как акридин, были присоединены к 3'-концевой фосфатной группе в олигонуклеотиде через полиметиленовую связь (Asseline, et al., Proc. Natl. Acad. Sci. USA 1984, 81, 3297).

Любая из вышеуказанных групп может быть использована в виде одного линкера или в комбинации с одним или более чем одним дополнительным линкером.

Линкеры и их применение в получении конъюгатов олигомерных соединений описаны в данной области, например, в WO 96/11205 и WO 98/52614 и в патентах США №№4948882; 5525465; 5541313; 5545730; 5552538; 5580731; 5486603; 5608046; 4587044; 4667025; 5254469; 5245022; 5112963; 5391723; 5,510475; 5512667; 5574142; 5684142; 5770716; 6096875; 6335432; и 6335437, каждый из которых включен в данный документ посредством ссылки во всей их полноте.

Используемая в данном документе физиологически лабильная связь является лабильной связью, которая расщепляется в условиях, которые обычно встречаются или аналогичных тем, которые встречаются в организме млекопитающих (также упоминается как расщепляемый линкер). Физиологически лабильные связывающие группы выбирают таким образом, что они претерпевают химические превращения (например, расщепление), когда находятся в определенных физиологических условиях. Внутриклеточные условия у млекопитающих включают химические условия, такие как рН, температуру, окислительные или восстановительные условия или агенты, и концентрацию солей, встречающихся или аналогичны тем, которые встречаются в клетках млекопитающих. Внутриклеточные условия у млекопитающих также включают наличие ферментативной активности, обычно присутствующей в клетке млекопитающего, например, протеолитических или гидролитических ферментов. В некоторых воплощениях расщепляемый линкер подвержен воздействию нуклеаз(ы), которые могут, например, быть экспрессированы в клетке-мишени - и таким образом, как подробно описано в данном документе, линкер может быть короткой областью (например, 1-10) связанных фосфодиэфирными связями нуклеозидов, таких как ДНК-нуклеозиды.

Химическая трансформация (расщепление лабильной связи) может быть инициирована добавлением к клетке фармацевтически приемлемого агента или может происходить спонтанно, когда молекула, содержащая лабильную связь, достигает соответствующей внутри- -и/или внеклеточной среды. Например, рН-лабильная связь может быть расщеплена, когда молекула входит в закисленную эндосому. Таким образом, рН-лабильная связь может считаться связью, расщепляемой эндосомальным путем. Связи, расщепляемые ферментативным путем, могут быть расщеплены при воздействии ферментов, таких как те, которые присутствуют в эндосомах или лизосомах или в цитоплазме. Дисульфидная связь может быть расщеплена, когда молекула входит в более восстановительную среду клеточной цитоплазмы. Таким образом, дисульфид может считаться связью, расщепляемой цитоплазматическим путем. Упоминаемая в данном документе рН-лабильная связь является лабильной связью, которая избирательно разрушается в кислых условиях (рН<7). Такие связи могут быть названы эндосомально-лабильными связями, так как клеточные эндосомы и лизосомы имеют рН менее 7.

Активированные олигомеры

В некоторых воплощениях данное изобретение предусматривает активированный олигомер - т.е. промежуточный продукт, используемый в синтезе олигомера согласно изобретению - например, конъюгированный олигомер. В этом отношении олигомер согласно изобретению в некоторых воплощениях может включать область А и область В, описанные в данном документе, и область В ковалентно связана с активационной (или реакционноспособной) группой, подходящей для применения в конъюгации олигомера.

Термин "активированный олигомер", используемый в данном документе, относится к олигомеру согласно изобретению, который ковалентно связан (т.е. функционализирован) по меньшей мере с одной функциональной группировкой, которая позволяет ковалентно связывать олигомер с одной или более чем одной конъюгированной группировкой, т.е. группировкой, которая сама по себе не является нуклеиновой кислотой или мономером, с образованием конъюгатов, описанных в данном документе. Как правило, функциональная группировка будет содержать химическую группу, которая способна ковалентного связываться с олигомером, например, через 3'-гидроксильную группу или экзоциклическую NH2-группу аденинового основания, спейсер, который предпочтительно является гидрофильным, и концевую группу, которая способна связываться с конъюгированной группировкой (например, амино-, сульфгидрильной или гидроксильной группой). В некоторых воплощениях эта концевая группа не защищена, например, представляет собой NH2-группу. В других воплощениях концевая группа защищена, например, любой подходящей защитной группой, такой как описанные в "Protective Groups in Organic Synthesis" Theodora W Greene and Peter G M Wuts, 3rd edition (John Wiley & Sons, 1999). Примеры подходящих гидроксил-защитных групп включают сложные эфиры, такие как ацетатный эфир, аралкильные группы, такие как бензил, дифенилметил или трифенилметил, и тетрагидропиранил. Примеры подходящих амино-защитных групп включают бензил, альфа-метилбензил, дифенилметил, трифенилметил, бензилоксикарбонил, трет-бутоксикарбонил и ацильные группы, такие как трихлорацетил или трифторацетил. В некоторых воплощениях функциональная группировка является саморасщепляющейся. В других воплощениях функциональная группировка является биорасщепляемой, например, см. патент США №7087229, который включен в данный документ во всей его полноте посредством ссылки.

В некоторых воплощениях олигомеры согласно изобретению функционализированы на 5'-конце, что позволяет ковалентно присоединять конъюгированную группировку к 5'-концу олигомера. В других воплощениях олигомеры согласно изобретению могут быть функционализированы на 3'-конце. В других воплощениях олигомеры согласно изобретению могут быть функционализированы вдоль остова или на гетероциклической основной группировке. В других воплощениях олигомеры согласно изобретению могут быть функционализированы более чем в одной позиции, которые независимо выбраны среди 5'-конца, 3'-конца, остова и основания.

В некоторых воплощениях активированные олигомеры согласно изобретению синтезируются путем включения в процессе синтеза одного или более чем одного мономера, который ковалентно присоединен к функциональной группировке. В других воплощениях активированные олигомеры согласно изобретению синтезируют с помощью мономеров, которые не были функционализированы, и олигомер функционализируют по завершении синтеза. В некоторых воплощениях олигомеры функционализируют с помощью блокированного эфира, содержащего аминоалкильный линкер, где алкильная часть имеет формулу (CH2)w, где w представляет собой целое число в диапазоне от 1 до 10, предпочтительно примерно 6, где алкильная часть алкиламино-группы может быть линейной или разветвленной цепью, и где функциональная группа присоединена к олигомеру с помощью эфирной группы (-O-C(O)-(CH2)wNH).

В других воплощениях олигомеры функционализированы с помощью блокированного эфира, содержащего (СН2)w-сульфгидрильный (SH) линкер, где w представляет собой целое число в диапазоне от 1 до 10, предпочтительно примерно 6, где алкильная часть алкиламино-группы может быть линейной или разветвленной цепью, и где функциональная группа присоединена к олигомеру с помощью эфирной группы (-O-C(O)-(CH2)wSH).

В некоторых воплощениях сульфгидрил-активированные олигонуклеотиды конъюгированы с полимерными группировками, такими как полиэтиленгликоль или пептиды (через образование дисульфидной связи).

Активированные олигомеры, содержащие блокированные эфиры, описанные выше, могут быть синтезированы любым способом, известным в данной области, и, в частности, с помощью способов, описанных в публикации РСТ № WO 2008/034122, которая включена в данный документ во всей ее полноте посредством ссылки, а также в примерах этой публикации.

В других воплощениях олигомеры согласно изобретению функционализированы за счет введения в олигомер сульфгидрильных, амино- или гидроксильных групп с помощью функционализирующего реагента, по существу описанного в патентах США №№4962029 и 4914210, т.е. по существу линейного реагента с фосфорамидитом на одном конце, соединенным через гидрофильную спейсерную цепь с противоположным концом, который содержит защищенную или незащищенную сульфгидрильную, амино- или гидроксильную группу. Такие реагенты, прежде всего, реагируют с гидроксильными группами олигомера. В некоторых воплощениях такие активированные олигомеры имеют функционализирующий реагент, соединенный с 5'-гидроксильной группой олигомера. В других воплощениях активированные олигомеры имеют функционализирующий реагент, соединенный с 3'-гидроксильной группой. В других воплощениях активированные олигомеры согласно изобретению имеют функционализирующий реагент, соединенный с гидроксильной группой на остове олигомера. В других воплощениях олигомер согласно изобретению функционализирован более чем одним из функционализующих реагентов, описанных в патентах США №№4962029 и 4914210, которые включены в данный документ посредством ссылки во всей их полноте. Способы синтеза таких функционализирующих реагентов и включения их в мономеры или олигомеры описаны в патентах США №№4962029 и 4914210.

В некоторых воплощениях 5'-конец твердофазного связанного олигомера функционализирован диенил-фосфорамидатным производным с последующей конъюгацией олигомера с удаленной защитной группой, например, аминокислоты или пептида, посредством реакции циклоприсоединения Дильса-Альдера.

В различных воплощениях включение в олигомер мономеров, содержащих 2'-сахарные модификации, такие как 2'-карбамат-замещенный сахар или 2'-(O-пентил-N-фталимидо)-дезоксирибозный сахар, облегчает ковалентное присоединение конъюгированных группировок к сахарам олигомера. В других воплощениях олигомер с аминосодержащим линкером в 2'-положении одного или более чем одного мономера получают с использованием такого реагента, как, например, 5'-диметокситритил-2'-O-(е-фталимидиламинопентил)-2'-дезоксиаденозин-3'-N,N-диизопропил-цианоэтокси-фосфорамидит. См., например, Manoharan, et al., Tetrahedron Letters, 1991, 34, 7171.

В других воплощениях олигомеры согласно изобретению могут иметь аминосодержащие функциональные группировки на нуклеиновом основании, в том числе на пуриновых N6-аминогруппах, на экзоциклическом N2 гуанина или на N4 или 5 цитозина. В различных воплощениях такая функционализация может быть достигнута путем применения коммерческого реагента, который уже функционализирован, в олигомерном синтезе.

Некоторые функциональные группировки коммерчески доступны, например, гетеробифункциональные и гомобифункциональные связывающие группировки предоставляются компанией Pierce Со. (Рокфорд, Иллинойс). Другими коммерчески доступными связывающими группами являются реагенты 5'-амино-модификатор С6 и 3'-амино-модификатор, доступные от компании Glen Research Corporation (Стерлинг, Вирджиния), 6'-амино-модификатор С6 также доступен от ABI (Applied Biosystems Inc., Фостер-Сити, Калифорния) как Aminolink-2, а 3'-амино-модификатор также доступен от Clontech Laboratories Inc. (Пало-Альто, Калифорния).

Способы синтеза и производства

Данное изобретение также относится к способам синтеза или производства олигомера согласно изобретению. Олигомер может быть сделан с помощью стандартного олигонуклеотидного синтеза, который обычно выполняется на твердой подложке, такой как универсальная подложка. Как показано на фиг. 5-10, олигомер согласно изобретению может быть синтезирован, например, путем последовательного синтеза первой области и второй области с последующим добавлением (например, конъюгацией) третьей области (X), возможно, с помощью линкера (Y). Область Y, если она присутствует, может быть присоединена к области В, а область X впоследствии добавлена к области Y, либо области Y и X могут быть добавлены к области В в одноэтапной реакции.

Альтернативно, синтез олигомеров может происходить посредством первоначального связывания области X или областей X и Y с колонкой, содержащей подложку для олигонуклеотидного синтеза, а затем последовательного олигонуклеотидного синтеза области В, и затем области А.

Альтернативно, применение расщепляемой двунаправленной группы, присоединенной к подложке для синтеза олигонуклеотидов (на начальном или предварительном этапе) делает возможным способ, при котором олигонуклеотидные области В и А синтезируются на одной реакционноспособной группе бифункциональной группы, а область X или области X и Y синтезируются на второй реакционноспособной группе бифункциональной группы, где олигонуклеотидный синтез или добавление X (или X и Y) к подложке может происходить в любом порядке или даже одновременно. Затем отщепление бифункциональной группы от подложки образует олигомер согласно изобретению. Бифункциональная группа может представлять собой, например, нуклеозид, где одно звено (например, область В или X, или X-Y-) прикреплено к фосфатсодержащей группе на нуклеозиде (например, 5'- или 3'-группе), а другое (например, область В или X или X-Y-) прикреплено, например, к реакционноспособной группе, присутствующей на нуклеиновом основании.

Альтернативно, область X или X-Y может быть присоединена к олигомеру (области В) после олигонуклеотидного синтеза, например, после этапа отщепления. Таким образом, изобретение также относится к промежуточному олигомеру, который включает области А и В и реакционноспособную или активационную группу, присоединенную к области В, которая затем используется для соединения области X или областей X и Y с областью В.

Область Y или область X может быть связана с областью В как фосфорамидит, например, что позволяет формировать олигомер в едином олигонуклеотидном синтезе с последующим отщеплением олигомера от подложки для олигонуклеотидного синтеза (US). В связи с этим в некоторых воплощениях связывающая группа между областью В и областью X или Y может быть фосфатсодержащей группой, такой как нуклеозидная связь, такая как фосфодиэфирная, фосфортиоатная, фосфородитиоатная, боранофосфатная, метилфосфонатная или другие, такие как описаны в данном документе. Альтернативно, могут быть использованы другие химические связи, такие как триазоловая группа.

В некоторых воплощениях третья область (X) или X-Y- может быть связана с с областью В через группу, отличающуюся от 5'- или 3'-фосфата, например, через реакционноспособную группу в другом положении, например, такую реакционноспособную группу как амин на основе нуклеозида в области В.

Олигонуклеотидный синтез может происходить в 5'-3'-направлении или, что характерно для большинства олигонуклеотидных синтезов, в 3'-5'-направлении.

В некоторых неограничивающих примерах конструкция "олигонуклеотид-конъюгат" может быть собрана различными способами, например,

A) Часть конструкции В-А может быть получена на машине для олигонуклеотидного синтеза, которая способна синтезировать и фосфоротиоатные, и фосфордиэфирные связи. Затем В-А, возможно, может быть удлинена путем стандартной фосфорамидитной химической реакции с помощью структурного звена Х-А-Р (конъюгационная группировка с прикрепленным линкером) для получения Х-А-В-А или со звеном Х-Р (конъюгационная группировка без линкера) для получения Х-В-А

B) Часть конструкции В-А может быть получена на машине для олигонуклеотидного синтеза, которая способна синтезировать и фосфоротиоатные, и фосфордиэфирные связи. Затем В-А, возможно, может быть удлинена путем стандартной фосфорамидитной химической реакции с помощью структурного звена DMTrO-A-P, а затем структурного звена Х-Р для получения Х-А-В-А с РО- или PS-связью между частями X и А.

Часть конструкции В-А может быть получена на машине для олигонуклеотидного синтеза, которая способна синтезировать и фосфоротиоатные, и фосфордиэфирные связи. В-А, возможно, может быть удлинена путем стандартной фосфорамидитной химической реакции с помощью структурного звена PGN-A-P для получения H2N-A-B-A. После расщепления и удаления защитной группы с олигонуклеотида свободный амин олигонуклеотида может быть конъюгирован с группировкой X, в которой функциональная группа X была активирована, чтобы взаимодействовать с концевым первичным амином олигонуклеотида.

Композиции

Олигомер согласно изобретению может быть использован в фармацевтических составах и композициях. Соответственно, такие композиции содержат фармацевтически приемлемый разбавитель, носитель, соль или адъювант. WO 2007/031091 предусматривает подходящий и предпочтительный фармацевтически приемлемый разбавитель, носитель и адъюванты - и он включен в данный документ посредством ссылки. Подходящие дозы, составы, пути введения, композиции, дозированные формы, комбинации с другими терапевтическими агентами, составы пролекарств также предложены в WO 2007/031091, который также включен в данный документ посредством ссылки.

Антисмысловые олигонуклеотиды могут быть смешаны с фармацевтически приемлемыми активными или инертными веществами для изготовления фармацевтических композиций или составов. Композиции и способы сборки фармацевтических композиций зависят от ряда критериев, включая, но не ограничиваясь ими, путь введения, степень заболевания или вводимую дозу.

Антисмысловое соединение может быть использовано в фармацевтических композициях путем комбинации антисмыслового соединения с фармацевтически приемлемым разбавителем или носителем. Фармацевтически приемлемый разбавитель включает фосфатно-солевой буфер (phosphate buffered saline, PBS). PBS является разбавителем, пригодным для применения в композициях для парентеральной доставки.

Фармацевтические композиции, содержащие антисмысловые соединения, включают любые фармацевтически приемлемые соли, сложные эфиры или соли таких эфиров или любые другие олигонуклеотиды, которые при введении в организм животного, включая человека, способны образовать (прямо или косвенно) биологически активный метаболит или его остаток. Соответственно, например, описание также обращается к фармацевтически приемлемым солям антисмысловых соединений, пролекарствам, фармацевтически приемлемым солям таких пролекарств и другим биологическим эквивалентам. Подходящие фармацевтически приемлемые соли включают, но не ограничиваясь ими, соли натрия и калия. Пролекарство может включать введение дополнительных нуклеозидов на один или на оба конца антисмыслового соединения, которые расщепляются эндогенными нуклеазами в организме, формируя активное антисмысловое соединение. В связи с этим пролекарство может включать область В и конъюгационную, направляющую или блокирующую группировку согласно данному изобретению. В некоторых воплощениях олигомер согласно изобретению является пролекарством.

Применение липофильных конъюгатов согласно изобретению позволяет включать олигомер согласно изобретению в липидосомы или липосомы, например катионные липосомы (например, катионные липосомы SNALP (stable nucleic acid lipid particle, стабильные липидные частицы, содержащие нуклеиновую кислоту)), которые особенно полезны для доставки олигомеров, например, в печень, например siРНК.

Применения

Олигомеры согласно данному изобретению могут быть использованы в качестве реагентов для исследований, например, для диагностики, лечения и профилактики.

В исследовании в некоторых воплощениях такие олигомеры могут быть использованы для специфического ингибирования синтеза белка (как правило, путем разрушения или ингибирования mРНК и тем самым предотвращения образования белка) в клетках и у экспериментальных животных, и тем самым они облегчают функциональный анализ мишени или оценку ее пригодности в качестве мишени для терапевтического вмешательства.

Что касается терапевтических целей, животное или человека с подозрением на заболевание или нарушение, у которого может быть проведена модуляция экспрессии мишени, лечат введением олигомерных соединений согласно данному изобретению. Кроме того, предложены способы лечения млекопитающего, например, человека, с подозрением или с риском развития заболевания или нарушения, ассоциированного с экспрессией мишени, путем введения терапевтически или профилактически эффективного количества одного или более олигомеров или композиций согласно изобретению. Олигомер, конъюгат или фармацевтическую композицию согласно изобретению, как правило, вводят в эффективном количестве.

Данное изобретение также относится к применению описанного соединения или конъюгата согласно изобретению для изготовления лекарственного средства для лечения нарушения, используемого в данном документе, или к способу лечения такого нарушения, описанного в данном документе.

Данное изобретение также относится к способу лечения нарушения, описанного в данном документе, где указанный способ включает введение пациенту, нуждающемуся в этом, описанного в данном документе соединения согласно изобретению и/или конъюгата согласно изобретению и/или фармацевтической композиции согласно изобретению.

Медицинские показания

В некоторых воплощениях заболевание представляет собой рак. В некоторых воплощениях заболевание представляет собой воспалительное заболевание. В некоторых воплощениях заболевание представляет собой сердечно-сосудистое заболевание, например:

В некоторых воплощениях заболевание или нарушение представляет собой инфаркт миокарда (myocardial infarction, MI).

В некоторых воплощениях заболевание или нарушение представляет собой или приводит к или связано с фиброзом, таким как печеночный фиброз, фиброз сердца или локальный фиброз.

В некоторых воплощениях заболевание или нарушение представляет собой нарушение свертываемости крови.

В некоторых воплощениях заболевание или нарушение представляет собой или включает остеопороз (приводит к нему или связано с ним).

В некоторых воплощениях заболевание или нарушение представляет собой заболевание или нарушение печени.

В некоторых воплощениях заболевание или нарушение представляет собой метаболическое нарушение, которое может быть, например, заболеванием или нарушением печени и/или, в некоторых аспектах, сердечно-сосудистым заболеванием или нарушением.

Сердечно-сосудистые/метаболические нарушения включают, например, метаболический синдром, ожирение, гиперлипидемию, нарушение баланса HDL/LDL, дислипидемий, например, семейную комбинированную гиперлипидемию (FCHL), приобретенную гиперлипидемию, устойчивую к лечению статинами гиперхолестеринемию, болезнь коронарных артерий (CAD), ишемическую болезнь сердца (CHD), атеросклероз, заболевания сердца, сахарный диабет (I и/или II), NASH, острый коронарный синдром (ACS), хроническую сердечную недостаточность, сердечно-сосудистое заболевание, кардиометаболическое заболевание, гиперлипидемию и связанные нарушения, метаболический синдром, атеросклероз, хроническую сердечную недостаточность, заболевание сосудов, заболевание периферических артерий, заболевание сердца, ишемию, диабет 2 типа, диабет 1 типа.

В некоторых воплощениях заболевание или нарушение выбрано из группы, включающей метаболический синдром, ожирение, гиперлипидемию, атеросклероз, нарушение баланса HDL/LDL, дислипидемию, например, семейную комбинированную гиперлипидемию (FCHL), приобретенную гиперлипидемию, устойчивую к лечению статинами гиперхолестеринемию, болезнь коронарных артерий (CAD) и ишемическую болезнь сердца (CHD).

В некоторых воплощениях заболевание или нарушение выбрано из группы, состоящей из хронической сердечной недостаточности, сердечнососудистого заболевания, сердечно-метаболического заболевания, сосудистого заболевания, заболевания периферических артерий, заболевания сердца, ишемии, острого коронарного синдрома (ACS).

В некоторых воплощениях заболевание или нарушение представляет собой сахарный диабет 2 типа, сахарный диабет 1 типа.

В некоторых воплощениях заболевание или нарушение представляет собой вирусное заболевание, такое как полицитемия, гепатит С, гепатит В, BKV, HIV.

В некоторых воплощениях заболевание или нарушение представляет собой тяжелое и редкое заболевание (или генетическое нарушение).

Кроме того, изобретение относится к применению соединения согласно изобретению в изготовлении лекарственного средства для лечения заболевания, нарушения или состояния, упоминаемого в данном документе.

Говоря в целом, некоторые аспекты данного изобретения относятся к способу лечения млекопитающего, страдающего или восприимчивого к состоянию, связанному с аномальными уровнями мишени, который включает введение млекопитающему терапевтически эффективного количества олигомера, нацеленного на мишень, который содержит одно или более чем одно LNA-звено. Олигомер, конъюгат или фармацевтическую композицию согласно изобретению обычно вводят в эффективном количестве.

Интересующий аспект данного изобретения относится к применению соединения, описанного в данном документе, для получения лекарственного средства для лечения заболевания, нарушения или состояния, упоминаемого в данном документе.

Кроме того, изобретение относится к способу лечения субъекта, страдающего от заболевания или состояния, такого как упоминается в данном документе.

Пациентом, который нуждается в лечении, является пациент, который страдает или, по-видимому, страдает от заболевания или нарушения.

В некоторых воплощениях термин "лечение", используемый в данном документе, относится как к лечению существующего заболевания (например, заболевания или нарушения, упоминаемого в данном документе) или к предотвращению заболевания, т.е. к профилактике. Поэтому следует знать, что лечение, описанное в данном документе, в некоторых воплощениях может быть профилактическим.

Примеры

Список олигонуклеотидов

В следующем списке заглавные буквы представляют LNA-нуклеозиды, такие как бета-D-окси-LNA, строчные буквы представляют ДНК-нуклеозиды. Заглавная L представляет LNA, например, бета-D-окси, а строчная d представляет ДНК-нуклеозид. LNA-цитозины, возможно, являются 5'-метилцитозинами. Межнуклеозидные связи в области А являются фосфоротиоатными, а в области В являются фосфодиэфирными (как показано). Межнуклеозидная связь между областями А и В является фосфодиэфирной, но если область В содержит более 1 ДНК-нуклеотида, то связь, возможно, может отличаться от фосфодиэфирной (например, может быть фосфоротиоатной). Возможно, между областью В и областью С также может присутствовать линкер (Y), такой как С6-линкер. № относится к SEQ ID №:

Соединения, нацеленные на АроВ

PCSK9 - Мышиные специфические соединения

FVII (мышиный FVII)

Соединения, нацеленные на АроВ, с FAM-мечеными конъюгатами

Соединения к мишени X (человеческая терапевтическая мишень)

В указанных выше соединениях область С содержит комплемент к последовательности (области А), так что 3'-нуклеотид области С совпадает (образует пару оснований) с восьмым нуклеотидом области А с 5' конца. Поэтому область С возвращается назад и образует восьмиосновную гибридизацию с областью А по 3'-крылу гэпмера и пятью основаниями гэп-области ДНК, тем самым создавая "пролекарство", которое является неактивным до тех пор, пока линкерная область (В) не отщепится.

Соединения, нацеленные на АроВ

Соединения PCSK9

Исследования соединений АроВ на обезьянах

SEQ ID №53 предложен в качестве исходного соединения SEQ ID №54.

Эксперименты на мышах: Если не указано иное, то эксперименты на мышах могут быть выполнены следующим образом:

Введение дозы и забор образцов:

Использовали мышей C57BL6-N в возрасте 7-10 недель, животные совпадали по возрасту и полу (самки для исследований 1, 2 и 4, самцы для исследования 3). Соединения вводили внутривенно в хвостовую вену. Для отбора промежуточных образцов сыворотки собирали 2-3 капли крови путем пункции лицевой вены, финальные образцы крови брали из нижней полой вены. Сыворотку собирали в содержащие гель пробирки для отделения сыворотки (Greiner) и хранили в замороженном виде до анализа.

Мышам C57BL6 вводили внутривенно однократную дозу 1 мг/кг ASO (или количество указано) в физиологическом растворе или только физиологический раствор в соответствии с указанной информацией. Животных умерщвляли, например, на 4 или 7 день (или время указано) после введения дозы и брали образцы печени и почек.

Выделение РНК и анализ mРНК: анализ mРНК в ткани проводили с использованием набора для количественной оценки mРНК от Qantigene ("bДНК-assay", Panomics/Affimetrix), следуя протоколу производителя. Для тканевых лизатов 50-80 мг ткани лизировали путем обработки ультразвуком в 1 мл лизирующего буфера, содержащего протеиназу К. Лизаты использовали непосредственно для bДНК-анализа без выделения РНК. Комплекты зондов для мишени и GAPDH были сделаны в Panomics по индивидуальному заказу. При анализе единицы люминесценции, полученные для генов-мишеней, нормализовали по гену домашнего хозяйства GAPDH.

Анализ сыворотки на ALT, AST и холестерин проводили на платформе для клинической химии "Cobas INTEGRA 400 plus" (Roche Diagnostics), используя 10 мкл сыворотки.

Для количественного оценки уровней фактора VII в сыворотке крови использовали набор для определения активности фермента BIOPHEN FVII (№221304, Hyphen BioMed) в соответствии с протоколом производителя.

Для количественной оценки олигонуклеотидов флуоресцентно-меченный PNA-зонд гибридизовали с олигонуклеотидом, представляющим интерес, в тканевом лизате. Такие же лизаты использовали для bДНК-анализов, только с точно взвешенными количествами ткани. Гетеродуплекс количественно оценивали с помощью AEX-HPLC и флуоресцентной детекции.

Пример 1: Синтез соединений SEQ ID №1, SEQ ID №2, SEQ ID №3, SEQ ID №4 и SEQ ID №5

Олигонуклеотиды синтезировали на уридиновых универсальных подложках, используя фосфорамидитный подход, на синтезаторе Expedite 8900/MOSS (Multiple Oligonucleotide Synthesis System) или эквивалент в 4 мкмоль масштабе. В конце синтеза олигонуклеотиды отщепляли от твердой подложки с помощью водного аммиака в течение 1-2 часов при комнатной температуре, а затем снимали защиту в течение 16 часов при 65°С. Олигонуклеотиды очищали путем обращенно-фазовой HPLC (reverse phase high-performance liquid chromatography, RP-HPLC; обращенно-фазовая высокоэффективная жидкостная хроматография) и характеризовали с помощью UPLC (ultra performance liquid chromatography; сверхпроизводительная жидкостная хроматография), а молекулярную массу также подтверждали с помощью ESI-MS (electrospray ionisation mass spectrometry; масс-спектрометрия с ионизации электрораспылением). Детали см. ниже.

Удлинение олигонуклеотида

Связывание β-цианоэтил-фосфорамидитов (ДНК-А(Вz), ДНК-G(ibu), ДНК-C(Bz), ДНК-Т, LNA-5-метил-C(Bz), LNA-A(Bz), LNA-G(dmf), LNA-T или C6-S-S линкер) выполняли с помощью 0,1 М раствора 5'-O-DМТ-защищенного амидита в ацетонитриле и DCI (4,5-дицианоимидазола) в ацетонитриле (0,25 М) в качестве активатора. Для заключительного цикла использовали коммерчески доступный С6-связанный фосфорамидит холестерина при 0,1 М в DCM. Тиолирование для введения фосфортиоатных связей осуществляли с использованием гидрида ксантана (0,01 М в смеси ацетонитрила/пиридина 9:1). Фосфордиэфирные связи вводили с помощью 0,02 М йода в смеси THF/пиридина/воды 7:2:1. Остальные реагенты являются такими, которые обычно используются для олигонуклеотидного синтеза.

Очистка с помощью RP-HPLC:

Неочищенные соединения очищали с помощью препаративной RP-HPLC на колонке Phenomenex Jupiter С18 10 мкл 150×10 мм. 0,1 М ацетата аммония с рН 8 и ацетонитрил использовали в качестве буфера со скоростью потока 5 мл/мин. Собранные фракции лиофилизировали, получая очищенное соединение, как правило, в виде белого твердого вещества.

Сокращения:

DCI: 4,5-дицианоимидазол

DCM: дихлорметан

DMF: диметилформамид

DMT: 4,4-диметокситритил

THF: тетрагидрофуран

Bz: бензоил

Ibu: изобутирил

RP-HPLC Высокоэффективная жидкостная хроматография с обращенной фазой

Пример 2: Разработка антисмысловых LNA-олигонуклеотидов

Олигомеры, используемые в примерах и фигурах. "SEQ №" представляет собой идентификатор, используемый во всех примерах и фигурах

Пример 3. Нокдаун mРНК АроВ холестериновыми конъюгатами in vivo

Мышам C57BL6/J вводили однократную дозу физиологического раствора или 1 мг/кг неконъюгированного антисмыслового LNA-олигонуклеотида (SEQ ID №1) или эквимолярные количества антисмысловых LNA-олигонуклеотидов, конъюгированных с холестерином с помощью различных линкеров, и умерщвляли на 1-10 дни в соответствии с табл. 3.

РНК выделяли из печени и почек и подвергали qPCR (количественной ПЦР) с праймерами и зондами, специфическими для АроВ, для анализа нокдауна mРНК ApoB.

Выводы: Холестерин, конъюгированный с антисмысловым LNA-олигонуклеотидом АроВ с помощью линкера, состоящего из 2 или 3 ДНК с фосфодиэфирным остовом (SEQ №4 и 5), показал предпочтительный нокдаун АроВ, специфический для печени (фиг. 11). Это означает увеличение эффективности и продолжительности нокдауна mРНК АроВ в ткани печени по сравнению с неконъюгированным соединением (Seq №1), а также по сравнению с холестериновыми конъюгатами со стабильным линкером (Seq №2) и дисульфидным линкером (Seq №3), и сопутствующая меньшая нокдаун-активность последовательностей №4 и №5 в почечной ткани.

Материалы и методы:

Дизайн эксперимента:

Введение дозы. Животным C57BL/6JBom женского пола, примерно 20 г по прибытии, внутривенно вводили 10 мл на кг массы тела (по весу в 0 день) соединения, находящегося в физиологическом растворе, или только физиологический раствор в соответствии с таблицей 3.

Забор образцов печеночной и почечной ткани. Животных анестезировали с помощью смеси 70% СO2 - 30% O2 и умерщвляли путем цервикальной дислокации в соответствии с таблицей 3. Одну половину большой доли печени и одну почку измельчали и погружали в РНКlater (раствор для стабилизации РНК).

Выделение тотальной РНК и синтез первой цепи. Тотальную РНК экстрагировали максимум из 30 мг ткани, гомогенизированной в шаровой мельнице в присутствии RLT-буфера для лизиса, с использованием набора Qiagen RNeasy (Qiagen, кат. №74106) в соответствии с инструкциями изготовителя. Синтез первой цепи проводили с помощью реагентов для обратной транскрипции от Ambion в соответствии с инструкциями изготовителя.

Для каждого образца 0,5 мкг тотальной РНК доводили до (10,8 мкл) водой без РНКаз и смешивали с 2 мкл случайных декамеров (50 мкм) и 4 мкл смеси dNTP (2,5 мм каждого dNTP) и нагревали до 70°С в течение 3 мин, после чего образцы быстро охлаждали на льду. К каждому образцу добавляли 2 мкл 10× буфера RT, 1 мкл обратной транскриптазы MMLV (100 ед/мкл) и 0,25 мкл ингибитора РНКаз (10 ед/мкл), далее инкубировали при 42°С в течение 60 мин, инактивировали фермент нагреванием при 95°С в течение 10 мин, а затем образец охлаждали до 4°С. Образцы сДНК (complementary ДНК; комплементарная ДНК) разводили 1:5 и подвергали RT-qPCR с помощью Taqman Fast Universal PCR Master Mix 2× (Applied Biosystems кат. №4364103) и анализу экспрессии генов Taqman (mApoB, Mn01545150_m1 и mGAPDH №4352339E) в соответствии с протоколом производителей и обрабатывали в приборе для RT-qPCR от Applied Biosystems (7500/7900 или ViiA7) в быстром режиме.

Пример 4. Нокдаун mРНК АроВ холестериновыми конъюгатами in vivo и распределение LNA в печени и почках

Мышам C57BL6/J вводили однократную дозу физиологического раствора или 1 мг/кг неконъюгированного антисмыслового LNA-олигонуклеотида (SEQ ID №1) или эквимолярные количества антисмысловых LNA-олигонуклеотидов, конъюгированных с холестерином с помощью различных линкеров, и умерщвляли на 1-16 дни в соответствии с табл. 4. РНК выделяли из печени и почек и подвергали qPCR с праймерами и зондами, специфическими для АроВ, для анализа нокдауна mРНК АроВ. Содержание LNA-олигонуклеотидов в печени и почках измеряли с помощью ELISA "сэндвич"-типа на основании LNA.

Выводы: Холестерин, конъюгированный с антисмысловым олигонуклеотидом АроВ LNA с помощью линкера, состоящего из 1, 2 или 3 ДНК с фосфодиэфирным остовом (SEQ №№4, 5 и 6), показал предпочтительный нокдаун АроВ, специфический для печени (фиг. 14). Это означает увеличение эффективности и продолжительности нокдауна mРНК АроВ в ткани печени по сравнению с неконъюгированным соединением (Seq №1) и сопутствующую меньшую нокдаун-активность последовательностей №№4, 5 и 6 в почечной ткани. Конъюгированные с холестерином антисмысловые LNA-олигонуклеотиды имеют гораздо более высокое поглощение в печени и более предпочтительное поглощение в почках по сравнению с неконъюгированным LNA-олигонуклеотидом (фиг. 15).

Материалы и методы:

Дизайн эксперимента:

Введение дозы. Животным C57BL/6JBom женского пола, примерно 20 г по прибытии, внутривенно вводили 10 мл на кг массы тела (по весу в 0 день) соединения, находящегося в физиологическом растворе, или только физиологический раствор в соответствии с таблицей 4.

Забор образцов печеночной и почечной ткани. Животных анестезировали с помощью смеси 70% СO2 - 30% O2 и умерщвляли путем цервикальной дислокации в соответствии с таблицей 4. Одну половину большой доли печени и одну почку измельчали и погружали в РНКlater.

Выделение тотальной РНК и синтез первой цепи. Тотальную РНК экстрагировали максимум из 30 мг ткани, гомогенизированной в шаровой мельнице в присутствии RLT-буфера для лизиса, с использованием набора Qiagen RNeasy (Qiagen, кат. №74106) в соответствии с инструкциями изготовителя. Синтез первой цепи проводили с помощью реагентов для обратной транскрипции от Ambion в соответствии с инструкциями изготовителя.

Для каждого образца 0,5 мкг тотальной РНК доводили до (10,8 мкл) водой без РНКаз и смешивали с 2 мкл случайных декамеров (50 мкм) и 4 мкл смеси dNTP (2,5 мм каждого dNTP) и нагревали до 70°С в течение 3 мин, после чего образцы быстро охлаждали на льду. К каждому образцу добавляли 2 мкл 10× буфера RT, 1 мкл обратной транскриптазы MMLV (100 ед/мкл) и 0,25 мкл ингибитора РНКаз (10 ед/мкл), далее инкубировали при 42°С в течение 60 мин, инактивировали фермент нагреванием при 95°С в течение 10 мин, а затем образцы охлаждали до 4°С. Образцы сДНК разводили 1:5 и подвергали RT-qPCR с помощью Taqman Fast Universal PCR Master Mix 2× (Applied Biosystems кат. №4364103) и анализу экспрессии генов Taqman (mApoB, Mn01545150_m1 и mGAPDH №4352339E) в соответствии с протоколом производителей и обрабатывали на приборе для RT-qPCR от Applied Biosystems (7500/7900 или VNA7) в быстром режиме.

ELISA "сэндвич"-типа на содержание олигонуклеотидов: образцы печени и почек (100 мг) собирали в пробирки в различное время после введения дозы. К образцам добавляли буфер (рН 8,0 100 мМ NaCl, 25 мМ EDTA, 0,25 мМ Tris), протеазу К (1%, Sigma Р4850-5) и 2 шарика из карбида вольфрама (3 мм) (Qiagen), гомогенизировали в течение 8 мин (Retsch ММ300, 25 Гц [л/с]) и инкубировали гомогенат при 37°С в течение ночи. Образцы центрифугировали при 14000 g в течение 15 минут перед использованием.

Стандарты 1-100 мкг/г LNA-олигонуклеотидов в почках и печени получали и обрабатывали, как описано выше. Стандарты и образцы разводили до 100-5000 нг/л в 150 мкл 35 нМ раствора биотинилированного и модифицированного дигоксигенином зонда для захвата и обнаружения (5 × SSCT-буфер [(750 мМ NaCl и 75 мМ цитрата натрия, содержащий 0,05% (об/об) Tween-20, рН 7,0)] и перемешивали в течение часа. Покрытые стрептавидином планшеты (Nunc Immobilizer Streptavidin F96 CLEAR module plate Nunc, кат. №436014) промывали три раза (5 × SSCT-буфер, 300 мкл). Образцы в объеме 100 мкл переносили в покрытые стрептавидином планшеты и инкубировали в течение одного часа в условиях легкого встряхивания. Раствор аспирировали и лунки промывали три раза с помощью 300 мкл 2× SSCT-буфера (300 мМ NaCl + 30 мМ цитрата натрия, содержащего 0,05% (объем/объем) Tween-20, рН 7,0). В лунки вносили 100 мкл анти-DIG-AP Fab-фрагментов (Roche Applied Science, кат №11093274910), разведенных 1:4000 в PBST (фосфатном буферном растворе, рН 7,2), и инкубировали в течение 1 ч при комнатной температуре в условиях легкого перемешивания. Раствор аспирировали и лунки промывали три раза с помощью 300 мкл 2× SSCT-буфера. В каждую лунку добавляли 100 мкл раствора субстрата (KPL BluePhos Microwell Phosphatase substrate system 50-88-00). Интенсивность развития цветного окрашивания измеряли спектрофотометрически при 615 нм каждые 5 минут после встряхивания. Анализируемые образцы соотносили со стандартными образцами.

Пример 5: Нокдаун mРНК PCSK9 холестериновыми конъюгатами in vivo

Мышам NMRI вводили однократную дозу физиологического раствора или 10 мг/кг неконъюгированного антисмыслового LNA-олигонуклеотида (SEQ ID №7) или эквимолярные количества антисмысловых LNA-олигонуклеотидов, конъюгированных с холестерином с помощью различных линкеров, и умерщвляли на 1-10 дни в соответствии с табл. 5.

РНК выделяли из печени и почек и подвергали qPCR с праймерами и зондами, специфическими для PCSK9, для анализа нокдауна mРНК PCSK9.

Выводы: Холестерин, конъюгированный с антисмысловым PCSK9-LNA-олигонуклеотидом с помощью линкера, состоящего из 2 ДНК с фосфодиэфирным остовом (SEQ №9 и 10), показал усиленный в печени нокдаун PCSK9 (фиг. 16) по сравнению с неконъюгированным соединением (Seq №7), а также по сравнению с холестериновыми конъюгатами со стабильным линкером (Seq №8).

Материалы и методы:

Дизайн эксперимента:

Введение дозы. Животным NMRI женского пола, примерно 20 г по прибытии, внутривенно вводили 10 мл на кг массы тела (по весу в 0 день) соединения, находящегося в физиологическом растворе, или только физиологический раствор в соответствии с таблицей 5.

Забор образцов печеночной и почечной ткани. Животных анестезировали с помощью смеси 70% СO2 - 30% O2 и умерщвляли путем цервикальной дислокации в соответствии с таблицей 4. Одну половину большой доли печени и одну почку измельчали и погружали в РНКlater.

Тотальную РНК экстрагировали максимум из 10 мг ткани, гомогенизированной в шаровой мельнице в присутствии буфера MagNA Pure LC РНК Isolation Tissue (Roche кат. №03604721001), с использованием набора MagNa Pure 96 Cellular РНК Large Volume Kit (Roche кат. №5467535001) в соответствии с инструкциями изготовителя. Синтез первой цепи проводили с помощью реагентов для обратной транскрипции от Ambion в соответствии с инструкциями изготовителя.

Для каждого образца 0,5 мкг тотальной РНК доводили до (10,8 мкл) водой без РНКаз и смешивали с 2 мкл случайных декамеров (50 мкм) и 4 мкл смеси dNTP (2,5 мм каждого dNTP) и нагревали до 70°С в течение 3 мин, после чего образцы быстро охлаждали на льду. К каждому образцу добавляли 2 мкл 10× буфера RT, 1 мкл обратной транскриптазы MMLV (100 ед/мкл) и 0,25 мкл ингибитора РНКаз (10 ед/мкл), далее инкубировали при 42°С в течение 60 мин, инактивировали фермент нагреванием при 95°С в течение 10 мин, а затем образцы охлаждали до 4°С. Образцы сДНК разводили 1:5 и подвергали RT-qPCR с помощью Taqman Fast Universal PCR Master Mix 2× (Applied Biosystems, кат. №4364103) и анализу экспрессии генов Taqman (mPCSK9, Mn00463738_m1 и mActin №4352341E) в соответствии с протоколом производителей и обрабатывали на приборе для RT-qPCR от Applied Biosystems (7500/7900 или ViiA7) в быстром режиме.

Пример 6. Расщепление различных ДНК/РО-линкеров in vitro

FAM-меченные ASO с различными ДНК/РО-линкерами (РО-линкерами) подвергали расщеплению in vitro в экстракте нуклеазы S1 (фиг. 6А), гомогенатах печени или почек или сыворотке.

100 мкм FAM-меченных ASO с различными ДНК/РО-линкерами подвергали расщеплению in vitro нуклеазой S1 в нуклеазном буфере (60 ед на 100 мкл) в течение 20 и 120 мин (А). Ферментативную активность останавливали добавлением EDTA в буферный раствор. Затем растворы подвергали анализу AIE HPLC на Dionex Ultimate 3000 с использованием колонки Dionex ДНКрас р-100 и градиента перхлората натрия от 10 мМ до 1 М при рН 7,5. Содержание расщепленного и нерасщепленного олигонуклеотида определяли против стандарта с использованием флуоресцентного детектора при 615 нм и УФ-детектора при 260 нм.

Вывод: РО-линкеры (или область В, упоминаемая в данном документе) приводят к отщеплению конъюгата (или группы С), и длина и/или состав последовательности линкера могут быть использованы для модуляции восприимчивости к нуклеолитическому расщеплению области В. Последовательность ДНК/РО-линкеров может модулировать скорость расщепления, что видно через 20 мин в экстракте нуклеазы S1. Выбор последовательности для области В (например, для области ДНК/РО-линкера), следовательно, также может быть использован для модуляции уровня расщепления в сыворотке и в клетках тканей-мишеней.

В образцы печени, почек и сыворотки (В) вводили олигонуклеотид SEQ ID №16 до концентраций 200 мкг/г ткани. Образцы печени и почек, взятые у мышей NMRI, гомогенизировали в буфере для гомогенизации (0,5% Igepal СА-630, 25 мМ Tris, рН 8,0, 100 мМ NaCl, рН 8,0 (доводили с помощью 1 N NaOH). Гомогенаты инкубировали в течение 24 часов при 37°С и после этого гомогенаты экстрагировали фенолом/хлороформом. Содержание расщепленного и нерасщепленного олигонуклеотида в экстракте из печени и почек и в сыворотке определяли против стандарта, используя описанный выше способ HPLC.

Вывод: РО-линкеры (или область В, упоминаемая в данном документе) приводят к отщеплению конъюгата (или группы С) от олигонуклеотида в гомогенатах печени или почек, но не в сыворотке.

Примечание: расщепление в описанных выше анализах указывает на отщепление расщепляемого линкера, олигомер или область А должны оставаться функционально интактными. Восприимчивость к расщеплению в вышеуказанных анализах можно использовать для того, чтобы определить, является ли линкер биорасщепляемым или физиологически лабильным.

Пример 7а: ингибирование FVII in vivo (1 мг/кг)

Исследования на мышах in vivo проводили с использованием в общей сложности 6 групп мышей (n=3). Каждой мыши внутривенно вводили одну дозу LNA-соединения, нацеленного на mРНК FVII, в дозе 1 мг/кг или эквимолярной по сравнению с SEQ ID №12. Была включена контрольная группа с физиологическим раствором. За 1 день до введения у мышей отбирали образец крови, а последующие заборы крови проводили в 1 и 2 дни после введения. Мышей умерщвляли на 4 день, забирали образцы печень, почек и крови. Параметры исследования см. в таблице 7.

Сывороточные уровни фактора VII, уровни mРНК и тканевое содержание олигонуклеотидов измеряли с использованием стандартных методик анализа.

Выводы: ДНК/РО-линкер (РО) усиливает понижающую регуляцию белка FVII в сыворотке (фиг. 18) для LNA-олигонуклеотидов, нацеленных на mРНК FVII, с конъюгатами холестерина по сравнению с широко используемым дитио-линкером (дисульфидом) (сравните РО-линкер с SEQ ID №15 и SS-линкер с SEQ ID №14). При использовании GalNAc в качестве конъюгата очевидно, что РО-линкер усиливает понижающую регуляцию белка FVII по сравнению с аминосвязанным конъюгированным LNA-олигонуклеотидом (сравните РО-линкер с SEQ ID №13 и аминосвязанный SEQ ID №12). GalNac-конъюгат, как известно, является биорасщепляемым (возможно, благодаря пептидному линкеру), и, таким образом оказалось, что РО-линкер также усиливает высвобождение активного и мощного соединения в клетке-мишени. Эти данные соответствуют данным по экспрессии mРНК (фиг. 19). Тканевое содержание олигонуклеотида в почках и печени показывает, как конъюгаты изменяют распределение (фиг. 20). Видно, что два конъюгированных с холестерином соединения дают аналогичное распределение (сравните SEQ ID №14 и №15), так что при усиленной понижающей регуляции РО-линкерного соединения в отношении mРНК и белка FVII (SEQ ID №15) видно, что РО-линкер повышает активность LNA-олигонуклеотида, нацеленного на фактор VII, по сравнению с SEQ ID №14.

Материалы и методы:

Дизайн эксперимента:

Вводили самкам мышей внутривенно и забирали образцы печени, почек и крови на 4-й день. Дополнительный забор крови делали перед введением дозы, а также в 1 и 2 дни после введения дозы.

Пример 7b: Ингибирование FVII in vivo (0,1 и 0,25 мг/кг)

Исследования на мышах in vivo проводили с использованием в общей сложности 7 групп мышей (n=3). Каждой мыши внутривенно вводили одну дозу LNA-соединения, нацеленного на mРНК FVII, в дозе 0,1 мг/кг или 0,25 мг/кг в эквимолярном количестве по отношению к SEQ ID №12. Была включена контрольная группа с физиологическим раствором. За 1 день до введения у мышей брали образец крови, а последующие заборы крови проводили в 4, 7, 11, 14 и 18 дни после введения. Мышей умерщвляли на 24 день, забирали образцы печени, почек и крови. Параметры исследования см. в таблице 8.

Сывороточные уровни фактора VII, уровни mРНК и тканевое содержание олигонуклеотидов измеряли с использованием стандартных методик анализа.

Выводы: ДНК/РО-линкер (РО) усиливает понижающую регуляцию белка FVII в сыворотке (фиг. 21) для LNA-олигонуклеотидов, нацеленных на mРНК FVII, с конъюгатами холестерина по сравнению с широко используемым дитио-линкером (сравните РО-линкер с SEQ ID №15 и SS-линкер с SEQ ID №14) при обеих дозах, 0,1 мг/кг или 0,25 мг/кг. При использовании GalNAc в качестве конъюгата данные по mРНК (фиг. 22) подтверждают, что РО-линкер усиливает понижающую регуляцию по сравнению с аминосвязанным конъюгированным LNA-олигонуклеотидом (сравните РО-линкер с SEQ ID №13 и аминосвязанный SEQ ID №12). Данные по экспрессии mРНК (фиг. 22) подтверждают повышенную активность РО-линкерного соединения (SEQ ID №15) по сравнению с дитио-связанным конъюгатом (SEQ ID №14). Тканевое содержание олигонуклеотида в почках и печени показывает, как конъюгаты изменяют распределение (фиг. 23). Данные подтверждают, что РО-линкер повышает поглощение как в печени, так и в почках в этих диапазонах доз как для конъюгата с холестерином, так и для конъюгата с GalNAc (сравните SEQ ID №14 и №15 и сравните SEQ ID №13 и №12)

Материалы и методы:

Дизайн эксперимента:

Вводили самцам мышей внутривенно и забирали образцы печени, почек и крови на 24-й день. Дополнительный забор крови делали перед введением дозы, а также в дни 4, 7, 11, 14 и 18 после введения дозы.

Пример 8. Сайленсинг in vivo mРНК АроВ с помощью различных конъюгатов и РО-линкера

Чтобы изучить влияние биорасщепляемого ДНК/РО-линкера на дополнительные конъюгаты мышам C57BL6I внутривенно вводили физиологический раствор в качестве контроля или однократную дозу 1 мг/кг исходного соединения №1 или эквимолярное количество ASO, конъюгированного с Mono-GalNAc, фолиевой кислотой, Fam или токоферолом, без биорасщепляемого линкера, с дитио-линкером (SS) или с ДНК/РО-линкером (РО). Через 7 дней животных умерщвляли, выделяли РНК из образцов печени и почек и анализировали на экспрессию mРНК АроВ (фиг. 24).

Выводы:

Для всех четырех конъюгатов ДНК/РО-линкер повышает нокдаун АроВ в печени по сравнению с широко используемым дитио-линкером (сравните №27 с №26, №30 с №29, №33 с №32 и №36 с №35). Для моно-GalNAc и токоферола ДНК/РО-линкер повышает нокдаун АроВ в печени даже по сравнению с неконъюгированным соединением (сравните №30 и №36 с №1). Токоферол в сочетании с ДНК/РО-линкером показывает способность перенаправлять соединение из почек в печень (сравните А и В, №36 с №1).

Материалы и методы:

Дизайн эксперимента:

Введение дозы и забор образцов. Мышам C57BL6 внутривенно вводили однократную дозу 1 мг/кг ASO, находящегося в физиологическом растворе, или только физиологический раствор в соответствии с приведенной выше таблицей. Животных умерщвляли на 7 день после введения дозы и отбирали образцы печени и почек.

Выделение РНК и анализ mРНК. Тотальную РНК экстрагировали из образцов печени и почек и анализировали уровни mРНК АроВ с помощью разветвленного ДНК-анализа.

Пример 9. Сайленсинг in vivo mРНК мишени X с образующим петлю LNA-ASO с РО-линкером

Блокирующие группы могут быть полезны в отношении переносимости, специфичности или сниженного эффекта ASO "мимо мишени", но они сложны с точки зрения сохранения активности исходного, неблокированного ASO. В качестве примера блокирующей группы мы использовали комплементарную последовательность, которая соединена с олигонуклеотидом через некомплементарный нуклеотидный участок, образующий петлю типа шпильки. Непарные основания в петле, где либо 3 ДНК-нуклеотида с фосфодиэфирным остовом (РО-линкер), либо такие же ДНК-нуклеотиды с фосфотиоатным остовом. Чтобы проверить активность образующей петлю LNA-ASO, клетки Neuro 2а обрабатывали 1 мкМ ASO в гимнозис-анализе, а РНК выделяли и подвергали RT-qPCR для анализа нокдауна mРНК мишени X (фиг. 25).

Вывод: Образующие петлю ASO с РО-линкером (SEQ ID №21 и №23) показали повышенный нокдаун mРНК мишени X по сравнению с аналогичной последовательностью ASO без РО-линкера (SEQ ID №22 и №24).

Материалы и методы:

Гимнозис-анализ на клетках N2a:

Клетки N2a (мышиной нейробластомы) высевали в 24-луночные планшеты с плотностью 1,8×104 клеток/лунка и обрабатывали 1 мкМ образующим петлю LNA-ASO с РО-линкером и без него, соответственно, в среде DMEM + Glutamax (gibco-life, №61965-026), 2 мМ глутамин, 10% FBS, 1 мМ пируват натрия, 25 мкг/мл гентамицина.

Выделение тотальной РНК и синтез первой цепи. Тотальную РНК экстрагировали через 6 дней после гимнозис-анализа с использованием набора Qiagen RNeasy (Qiagen, кат. №74106) в соответствии с инструкциями изготовителя. Синтез первой цепи проводили с помощью реагентов для обратной транскрипции от Ambion в соответствии с инструкциями изготовителя.

Для каждого образца 0,5 мкг тотальной РНК смешивали с 2 мкл случайных декамеров (50 мкм) и 4 мкл смеси dNTP (2,5 мм каждого dNTP) и нагревали до 70°С в течение 3 мин, после чего образцы быстро охлаждали на льду. К каждому образцу добавляли 2 мкл 10× буфера RT, 1 мкл обратной транскриптазы MMLV (100 ед/мкл) и 0,25 мкл ингибитора РНКаз (10 ед/мкл), далее инкубировали при 42°С в течение 60 мин, инактивировали фермент нагреванием при 95°С в течение 10 мин, а затем образцы охлаждали до 4°С. Образцы сДНК разводили 1:5 и подвергали RT-qPCR с помощью Taqman Fast Universal PCR Master Mix 2× (Applied Biosystems кат. №4364103) и анализу экспрессии генов Taqman против мишени X в соответствии с протоколом производителей и обрабатывали на приборе для RT-qPCR от Applied Biosystems (VNA7) в быстром режиме. Экспрессию mРНК мишени X нормализовали по экспрессии mРНК бета-актина (mВАСТ №4352341Е) и сравнивали с контрольными уровнями mРНК.

Пример 10: Исследование на приматах

Основная цель данного исследования состоит в изучении выбранных липидных маркеров в течение 7 недель после однократного медленного болюсного введения анти-PCSK9- и анти-АроВ-LNA-конъюгированных соединений яванским макакам и в оценке потенциальной токсичности соединений у обезьян. Соединения, используемые в данном исследовании, представляют собой SEQ ID №№46 и 49, 5 и 54, которые были получены в стерильном физиологическом растворе (0,9%) с исходной концентрацией 0,625 и 2,5 мг/мл.

Используют обезьян мужского (PCSK9) или женского (АроВ) пола в возрасте по меньшей мере 24 мес, предоставляют им свободный доступ к водопроводной воде, и на каждое животное выделяют 180 г корма MWM(E) (Dietex France, SDS, Санкт Гратьен, Франция) ежедневно. Общее количество пищи, распределяемой в каждую клетку, рассчитывают в зависимости от числа животных в клетке в этот день. Кроме того, каждому животному ежедневно дают фрукты или овощи. Животные привыкают к условиям исследования в течение по меньшей мере 14 дней до начала периода исследования. В течение этого периода выполняют предварительные исследования. Животные получают дозу внутривенно, например, 0,25 мг/кг или 1 мг/кг. Объем дозы составляет 0,4 мл/кг. В каждой группе используют два животных. Через три недели данные анализируют, и может быть образована вторая группа животных с использованием более высокой или более низкой дозировки препарата - предварительно установленная доза составляет 0,5 мг/кг и 1 мг/кг или ниже на основании первого набора данных.

Дозированные составы вводятся один раз в день 1. Животные наблюдаются в течение 7 недель после лечения и выпускаются из исследования в день 51. День 1 соответствует первому дню периода лечения. Клинические наблюдения, масса тела и потребление пищи (в группе) записываются до и во время исследования.

Кровь забирают и анализируют в следующие временные точки:

Биохимия крови

Следующие параметры определяют для всех выживших животных в случаях, указанных ниже:

- полный биохимический анализ (полный список ниже) - в дни 8, 15 и 50,

- безопасность для печени (только ASAT, ALP, ALAT, TBIL и GGT) - в дни 4, 8, 22 и 36,

- липидный профиль (общий холестерин, HDL-C, LDL-C и триглицериды) и только Аро-В - в дни -1, 4, 8, 22, 29, 36 и 43.

Кровь (приблизительно 1,0 мл) помещают в пробирки с гепарином лития (с использованием анализатора биохимических показателей крови ADVIA 1650): Аро-B, натрий, калий, хлорид, кальций, неорганический фосфор, глюкоза, HDL-C, LDL-C, мочевина, креатинин, общий билирубин (TBIL), общий холестерин, триглицериды, щелочная фосфатаза (ALP), аланинаминотрансфераза (ALAT), аспартатаминотрансфераза (ASAT), креатинкиназа, гамма-глутамилтрансфераза (GGT), лактатдегидрогеназа, общий белок, альбумин, соотношение альбумин/глобулин.

Анализ крови: образцы крови для анализа PCSK9 собирают у животных группы 16 только в дни -8, -1, 4, 8, 15, 22, 29, 36, 43 и 50.

Венозную кровь (приблизительно 2 мл) собирают у каждого животного из подходящей вены в пробирку Serum Separating Tube (SST) и дают ей свернуться в течение по меньшей мере 60±30 минут при комнатной температуре. Кровь центрифугируют при 1000 g в течение 10 минут в условиях охлаждения (настройка для поддержания +4°С). Сыворотку переносят в три отдельные пробирки и хранят при -80°С до анализа на CitoxLAB France с использованием способа ELISA (набор Circulex Human PCSK9 ELISA, CY-8079, валидирован для образцов от яванских макак).

Другие анализы: WO 2011009697 и WO 2010142805 предлагают способы последующих анализов: qPCR, анализ mРНК PCSK9/ApoB. Другие анализы включают ELISA на белок PCSK9/ApoB, анализ Lp(a) в сыворотке путем ELISA (Mercodia №10-1106-01), анализ олигонуклеотидов в ткани и плазме (содержание лекарственных препаратов), выделение образцов, стандартного и QC-образцов, определение содержания олигонуклеотидов путем ELISA.

Пример 11: Оценка печеночной и почечной токсичности у крыс

Соединения согласно изобретению могут быть оценены по их профилю токсичности у грызунов, таких как мыши или крысы. В качестве примера могут быть использованы следующие протоколы: Wistar Han Crl : WI(Han) используют в возрасте примерно 8 недель. В этом возрасте самцы должны весить примерно 250 г. Все животные имеют свободный доступ к гранулированному поддерживающему корму SSNIFF R/M-H (SSNIFF R/M-H Зёст, Германия) и водопроводной воде (фильтрованной через фильтр с размером пор 0,22 мкм), содержащейся в бутылках. Используются уровни доз 10 и 40 мг/кг/доза (подкожное введение) и вводятся в дни 1 и 8. Животных умерщвляют на 15 день. Мочу и кровь собирают в день 7 и 14. Оценку клинической патологии производят на 14 день. Массу тела определяют до начала исследования, в первый день введения и за 1 неделю до вскрытия. Потребление продуктов питания на группу оценивают ежедневно. Образцы крови отбирают через хвостовую вену через 6 часов голодания. Проводят следующий анализ сыворотки крови: число эритроцитов, средний объем клетки, гематокрит, гемоглобин, средняя концентрация гемоглобина в клетке, среднее содержание гемоглобина в клетке, число тромбоцитов, число лейкоцитов, дифференцированный подсчет лейкоцитов с клеточной морфологией, число ретикулоцитов, натрий, калий, хлорид, кальций, неорганический фосфор, глюкоза, мочевина, креатинин, общий билирубин, триглицериды, холестерин, щелочная фосфатаза, аланинаминотрансфераза, аспартатаминотрансфераза, общий белок, альбумин, соотношение альбумин/глобулин. Проводят следующий анализ мочи: α-GST, β-2-микроглобулин, кальбиндин, кластерин, цистатин С, KIM-1, остеопонтин, TIMP-1, VEGF и NGAL. Семь анализируемых веществ (кальбиндин, кластерин, GST-α, KIM-1, остеопонтин, TIMP-1, VEGF) количественно оценивают в панели 1 (MILLIPLEX® MAP Rat Kidney Toxicity Magnetic Bead Panel 1, RKTX1MAG-37K). Три анализируемых вещества (β-2-микроглобулин, цистатин С, липокалин-2/NGAL) количественно оценивают в панели 2 (MILLIPLEX® MAP Rat Kidney Toxicity Magnetic Bead Panel 2, RKTX2MAG-37K). Анализ для определения концентрации этих биомаркеров в моче крысы основан на технологии Luminex хМАР®. Микросферы, покрытые антителами к α-GST/β-2-микроглобулину / кальбиндину / кластерину / цистацину С / KIM-1 / остеопонтину / TIMP-1 / VEGF / NGAL, мечены двумя различными флуоресцентными метками. Определяются следующие параметры (в моче при помощи ADVIA 1650): белок в моче, креатинин в моче. Количественные параметры: объем, рН (с помощью тестовых полосок 10-Multistix / анализатора мочи SG Clinitek 500), удельный вес (с помощью рефрактометра). Полуколичественные параметры (с помощью тестовых полосок 10-Multistix / анализатора мочи SG Clinitek 500): белки, глюкоза, кетоны, билирубин, нитриты, кровь, уробилиноген, цитология осадка (путем микроскопии). Качественные параметры: внешний вид, цвет. После умерщвления определяют массу тела и массу почек, печени и селезенки и вычисляют соотношение массы органов к массе тела. Образцы почек и печени отбирают и либо замораживают, либо сохраняют в формалине. Выполняют микроскопический анализ.

1. Олигонуклеотидный конъюгат, улучшающий высвобождение антисмыслового олигомера в клетке, включающий три области:

i) первую область (область А), которая представляет собой антисмысловой олигомер, содержащий 7-26 последовательных нуклеотидов, комплементарных целевой нуклеиновой кислоте, причем эта первая область содержит по меньшей мере четыре нуклеозидных аналога, выбранных из бициклических нуклеозидных аналогов (например, LNA) и(или) 2 '-замещенных нуклеозидных аналогов, и где межнуклеозидные связи указанной первой области являются межнуклеозидными связями, отличными от фосфодиэфирной;

ii) вторую биорасщепляемую область (область В), которая ковалентно связана с 5'- или 3'-нуклеотидом первой области посредством фосфодиэфирной межнуклеозидной связи, где указанная вторая область состоит из 2-10 связанных фосфодиэфирной связью ДНК- или РНК-нуклеозидов;

iii) третью область, которая содержит конъюгационную группировку, которая повышает захват антисмыслового олигомера клетками, где указанная третья область ковалентно связана со второй областью.

2. Конъюгат по п. 1, где конъюгационная группировка третьей области выбрана из кластеров GalNAc, холестерина, токоферола, фолиевой кислоты или FAM.

3. Конъюгат по п. 1, где межнуклеозидные связи, отличные от фосфодиэфирных, выбраны из группы, состоящей из фосфоротиоатной, фосфородитиоатной и боранофосфатной связи.

4. Конъюгат по п. 1, где целевая нуклеиновая кислота выбрана из группы, состоящей из микроРНК, мРНК, IncPHK (длинная некодирующая РНК), snPHK (малая ядерная РНК), snoPHK (малая ядрышковая РНК) и вирусной РНК.

5. Конъюгат по п. 1, где олигомерное соединение, например первая область, содержит гэпмер, миксмер или тоталмер.

6. Конъюгат по п. 1, где олигомерное соединение, например первая область, содержит по меньшей мере один бициклический нуклеотидный аналог (LNA).

7. Конъюгат по п. 1, где первая область и вторая область образуют непрерывную нуклеотидную последовательность.

8. Конъюгат по п. 1, где вторая область расположена с 5'-конца от первой области.

9. Конъюгат по п. 1, где вторая область расположена с 3'-конца от первой области.

10. Конъюгат по п. 1, где вторая область содержит по меньшей мере два, например по меньшей мере три, последовательных нуклеозидных звена, выбранных из группы ДНК- и РНК-звеньев, которые могут быть связаны фосфодиэфирными связями.

11. Конъюгат по п. 1, где вторая область ковалентно связана с третьей областью на концевом нуклеозиде второй области (т.е. 3'- или 5'-конце в зависимости от положения первой области).

12. Конъюгат по п. 1, где третья область содержит ненуклеотидную группировку, например конъюгационную группу, такую как стерин, например холестерин, или углевод, такой как N-ацетилгалактозамин/N-ацетилгалактозамин (GalNac/GalNac)-кластер.

13. Конъюгат по п. 12, где третья область включает группировку, выбранную из группы, состоящей из: липофильной группы (например, липида, жирной кислоты, стерина), белка, пептида, антитела или его фрагмента, полимера, репортерной группы, метки, рецепторного лиганда, низкомолекулярного препарата, пролекарства и витамина.

14. Конъюгат по п. 1, где третья область содержит нуклеиновую кислоту или ее полимер, такой как аптамер, или блокирующую нуклеотидную последовательность.

15. Конъюгат по п. 1, где третья область содержит направляющую группу.

16. Конъюгат по п. 1, где третья область включает активированную группу.

17. Конъюгат по п. 1, где вторая и третья области ковалентно соединены линкерной группой.

18. Конъюгат по п. 17, где линкерная группа между второй и третьей областями включает группу, выбранную среди фосфодиэфирной, фосфоротиоатной и фосфородитиоатной или боранофосфатной групп, например включает фосфодиэфирную группу.

19. Фармацевтическая композиция с антисмысловой активностью, содержащая конъюгат по любому из пп. 1-18 в эффективном количестве и фармацевтически приемлемый разбавитель, носитель, соль или адъювант.

20. Конъюгат по любому из пп. 1-18 для применения в ингибировании целевой нуклеиновой кислоты в клетке.

21. Способ антисмысловой терапии, включающий введение фармацевтической композиции, содержащей конъюгат по любому из пп. 1-18, в терапевтически эффективном количестве.



 

Похожие патенты:

Настоящее изобретение относится к биотехнологии и генетической инженерии, в частности к генетически модифицированным грызунам, таким как мышь и крыса, которые экспрессируют химерный человеческий/не относящийся к человеку полипептид МНС I и/или человеческий полипептид β2 микроглобулина, а также к клеткам таких грызунов.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к генетической конструкции для обеспечения экспрессии целевых гомологичного и гетерологичного генов в клетках реципиентного гриба Penicillium verruculosum.

Изобретение относится к области медицинской вирусологии и касается штамма вируса гриппа. Вакцинный штамм A/17/Нью Йорк/15/5364 (H1N1) pdm09 - реассортант, полученный путем скрещивания «дикого» вируса А/Нью Йорк/61/2015 (H1N1) pdm09 с холодоадаптированным температурочувствительным вирусом А/Ленинград/134/17/57 (H2N2) - донором аттенуации, безвредным для людей.

Изобретение относится к области биохимии. Описан набор олигонуклеотидных проб для определения генотипа митохондриальной ДНК человека, характеризующийся тем, что данный набор позволяет определить генотип митохондриальной ДНК человека в 38 однонуклеотидных сайтах, расположенных в различных участках митохондриального генома и полиморфных в популяциях населения России различного этнического происхождения, с помощью метода ферментативного однонуклеотидного удлинения гибридизированной пробы, причем структура олигонуклеотидных проб учитывает вариабельность ДНК в близлежащих сайтах и группировку генотипируемых сайтов в 3 панели для мультиплексных реакций.

Изобретение относится к области биотехнологии, в частности к гибридомной технологии, и представляет собой штамм гибридных клеток mus musculus α - продуцент моноклональных антител к раково-тестикулярному антигену человека GAGE.

Изобретение относится к биотехнологии, медицине, в частности к применению подкожного ксенографта клеточной линии беспигментной меланомы кожи человека mel Rac с мутацией гена NRAS и с адаптацией к росту со стабильной кинетикой у иммунодефицитных мышей Balb/c nude для доклинического изучения таргетных противоопухолевых средств.

Изобретение относится к области биотехнологии, конкретно к молекуле искусственной нуклеиновой кислоты. Синергетический эффект, обусловленный наличием 3'-UTR гена альбумина и 3’-некодирующей области матричной РНК, уложенной во вторичную структуру типа «стебель-петля», в структуре искусственной нуклеиновой кислоты, позволяет повысить стабильность и продлить экспрессию кодируемого белка.

Настоящее изобретение относится к биохимии, генной инженерии и биотехнологии, в частности к новым полипептидам с антимикробной активностью в отношении энтерогеморрагических бактерий вида Escherichia coli.

Изобретение относится к биохимии. Описан антисмысловой олигомер, который вызывает пропуск 55-го экзона в гене дистрофина человека, состоящий из нуклеотидной последовательности, комплементарной любой из нуклеотидных последовательностей, состоящих из 14-го – 34-го или 15-го – 34-го нуклеотидов, считая от 5'-конца 55-го экзона гена дистрофина человека.

Изобретение относится к области биотехнологии, а именно к получению L-лизина. Изобретение представляет собой способ получения L-лизина с использованием рекомбинантного коринеформного микроорганизма, в котором экспрессию гена-мишени, выбранного из группы, состоящей из гена, кодирующего субъединицу E1 пируватдегидрогеназы, гена, кодирующего гомосериндегидрогеназу, и гена, кодирующего УДФ-N-ацетилмурамоилаланил-D-глутамат-2,6-диаминопимелатлигазу, ослабляют с использованием способа ингибирования транскрипции генов.

Изобретение относится к области биохимии, в частности к одноцепочечному антителу, которое связывается с раково-эмбриональным антигеном (РЭА). Также раскрыты химерный мономолекулярный Т-клеточный рецептор, включающий указанное антитело, вектор для экспрессии указанного рецептора, клетка-хозяин, продуцирующая указанный рецептор.

Изобретение относится к области биохимии и биотехнологии, в частности к способу создания и селекции библиотеки модифицированных аптамеров для различных мишеней, в частности к человеческому клеточному рецептору CD47.

Изобретение относится к области молекулярной иммунологии, биотехнологии и медицины, конкретно к получению антител, специфически блокирующих опухолеассоциированный MUC1, и может быть использовано в медицине.

Изобретение относится к биотехнологии, а именно к генной инженерии. Описан РНК-проводник (направляющих РНК) для подавления экспрессии вируса гепатита B в клетке-хозяине и для элиминации ДНК вируса гепатита В из клетки-хозяина, где указанный РНК-проводник содержит первую нуклеотидную последовательность, выбранную из SEQ ID NO: 1 и SEQ ID NO: 2, и вторую нуклеотидную последовательность SEQ ID NO: 5, фланкирующую первую последовательность с 3´-конца и представляющую собой РНК-шпильку, причём указанная первая последовательность способна связываться с целевым высококонсервативным участком генома вируса гепатита B, а указанная вторая последовательность содержит РАМ-мотив, способный распознаваться РНК-направляемой ДНК-эндонуклеазой Cas9 Streptococcus pyogenes с обеспечением элиминации вируса гепатита B.

Изобретение относится к области биохимии. Описан набор олигонуклеотидных проб для определения генотипа митохондриальной ДНК человека, характеризующийся тем, что данный набор позволяет определить генотип митохондриальной ДНК человека в 38 однонуклеотидных сайтах, расположенных в различных участках митохондриального генома и полиморфных в популяциях населения России различного этнического происхождения, с помощью метода ферментативного однонуклеотидного удлинения гибридизированной пробы, причем структура олигонуклеотидных проб учитывает вариабельность ДНК в близлежащих сайтах и группировку генотипируемых сайтов в 3 панели для мультиплексных реакций.

Изобретение относится к области генной инженерии, конкретно к получению микробных продуцентов, и может быть использовано для получения микробного масла. Сконструирована жирообразующая клетка дрожжей, способная к конверсии источника углерода в жирную кислоту, производное жирной кислоты и/или триацилглицерин.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена SOD1, связанных с оксидативным стрессом, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, слизистой оболочки рта человека или мышечной ткани человека, представляющего собой совокупность биологически активных генно-терапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена SOD1, с кодирующей последовательностью белка супероксиддисмутазы-1, с делециями 5' и 3'-нетранслируемых областей, а именно полученной на основе участка нативной немодифицированной кДНК гена SOD1 SEQ ID No: 1, или модифицированной кДНК гена SOD1, в сочетании с транспортной молекулой или без нее.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена TGFBR2, связанных с количественным снижением белка TGFBR2, где клетки органов и тканей выбраны из фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани, представляющего собой совокупность биологически активных генотерапевтических субстанций, каждая из которых представляет собой генотерапевтическую субстанцию, выбранную из группы генотерапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена TGFBR2, с кодирующей последовательностью белка TGFBR2, с делециями 5' и 3'-нетранслируемых областей, в сочетании с транспортной молекулой или без нее.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена COL1A1, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, хондробластов; органы и ткани выбраны из кожи, хрящевой ткани или мышечной ткани человека, представляющего собой совокупность биологически активных генотерапевтических субстанций, каждая из которых представляет собой генотерапевтическую субстанцию, выбранную из группы генотерапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена COL1A1, с кодирующей последовательностью белка альфа-1 цепи коллагена I типа, с делециями 5' и 3'-нетранслируемых областей, в сочетании с транспортной молекулой или без нее.

Группа изобретений относится к медицине и касается средства для коррекции патологических состояний клеток органов и тканей и/или органов и тканей человека на основе гена CLCA2, связанных с количественным снижением белка хлоридного кальций-активируемого канала-2, где клетки органов и тканей выбраны из клеток фибробластов, кератоцитов и эпителиальных клеток глаза, клеток эпителия слизистой оболочки полости рта; органы и ткани выбраны из кожи, слизистой оболочки полости рта или мышечной ткани человека, представляющего собой совокупность биологически активных генно-терапевтических субстанций, каждая из которых представляет собой генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, при этом каждая представляет собой генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена CLCA2 с кодирующей последовательностью белка хлоридного кальций-активируемого канала-2, с делециями 5' и 3'-нетранслируемых областей, в сочетании с транспортной молекулой или без нее.

Изобретение относится к области биохимии и биотехнологии, в частности к способу создания и селекции библиотеки модифицированных аптамеров для различных мишеней, в частности к человеческому клеточному рецептору CD47.

Настоящее изобретение относится к области биотехнологии, конкретно к конъюгату антисмыслового олигомера, и может быть использовано в медицине. Изобретение направлено на получение конструкции, позволяющей улучшить терапевтический индекс представляющего интерес антисмыслового олигонуклеотида и его высвобождение в клетках вследствие конъюгации олигонуклеотида с расщепляемой фосфодиэфирной областью и направляющей группой, способствующей доставке полученного конструкта в нужное место в клетке и обеспечивающей направленный захват действующего антисмыслового олигомера целевыми клетками. 3 н. и 18 з.п. ф-лы, 25 ил., 19 табл., 11 пр.

Наверх