Способ прогнозирования риска возникновения переломов


 

G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2526189:

Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Башкирский государственный университет" (RU)
Общество с ограниченной ответственностью "Академические инновационные технологии" (RU)
Федеральное государственное бюджетное учреждение науки "Институт биохимии и генетики Уфимского научного центра Российской академии наук (RU)

Изобретение относится к медицине. Способ прогнозирования риска возникновения переломов заключается в том, что выделяют ДНК из лейкоцитов периферической венозной крови, методом полимеразной цепной реакции с флуоресцентной детекцией, генотипируют 3 полиморфных варианта -1997G>T (g.3011T>G, rs1107946), -1663IndelT (g.3344_3345delTT, rs2412298) и +1245G>T (c.104-441G>T (rs1800012), расположенных в регуляторном регионе гена COLIA1. При идентификации сочетания генотипов: 1997∗G∗T/-1663∗I∗D/ +1245∗G∗T прогнозируют категорию лиц с повышенным риском развития возникновения переломов. Использование заявленного способа позволяет получить критерии оценки риска возникновения переломов с высокой прогностической значимостью. 1 табл., 3 пр.

 

Изобретение относится к медицине и биологии и может быть использовано для прогнозирования риска возникновения переломов.

Переломы вследствие нарушения костного метаболизма являются тяжелой медицинской и социальной проблемой и приводят к значительному снижению качества жизни. Основной причиной переломов являются нарушения в функции коллагена I типа - основного структурного белка костной ткани. Коллаген I типа состоит из 3-х полипептидных α-цепей: 2-х α 1 (I) и одной α 2 (I) и кодируется генами COLIA1 и COLIA2 [Barnes A.M., Chang W., Morello R., Cabral W.A., Weis M., Eyre D.R., Leikin S. et al. Deficiency of Cartilage-Associated Protein in Recessive Lethal Osteogenesis Imperfecta // N Engl J Med. - 2006. - Vol.355. - P.2757-64; Witecka J., Auguoeciak-Duma A.M., Kruczek A., Szydlo A. Two novel COLIA1 mutations in patients with osteogenesis imperfecta (OI) affect the stability of the collagen type I triple-helix // J Appl Genet. - 2008. - Vol.49(3). - P.283-295].

Мутации в генах коллагена 1 типа вызывают тяжелое наследственное заболевание - несовершенный остеогенез (HO), основным клиническим признаком которого являются множественные переломы костей у детей с раннего возраста, а полиморфные варианты этого гена ассоциированы с развитием остеопороза, который также сопровождается переломами у взрослых и пожилых людей. HO встречается с частотой от 1:10000 до 1:30000 новорожденных в различных странах мира, тяжесть заболевания варьирует от легкой (HO 1 тип) до внутриутробной летальной (НО 2 тип) и приводит к инвалидности детей с раннего возраста [Bodian D.L., Chan T-F., Poon A., Schwarze U., Yang K., Byers P.H., Kwok P-Y., Klein Т.Е. Mutation and Polymorphism spectrum in OI type II: implication for genotype-phenotype relatioships // HMG. - 2009. - Vol.18. - P.463-471; Zhang Y.Y., Lei S.F., Mo X.Y., Wang Y.B., Li M.X., Deng H.W. The - 1997 G/T polymorphism in the COLIA1 upstream regulatory region is associated with hip bone mineral density (BMD) in Chinese nuclear families // Calcif. Tissue Int. -2005. - Vol.76. - P.107-112; Swinnen F.K., De Leenheer E.M., Coucke P.J. et al. Audiometric, surgical, and genetic findings in 15 ears of patients with osteogenesis imperfect // Laryngoscope. - 2009. - V.119(6). - P.1171-1179]. Остеопороз по данным Всемирной Организации Здравоохранения (ВОЗ) по частоте и причинам инвалидности и смертности больных занимает четвертое место после таких заболеваний, как сердечно-сосудистые, онкологические и сахарный диабет. Показано, что риск возникновения остеопоретических переломов - на 50-60% обусловлен генетическими факторами [Ralston SH, Uitterlinden AG, Brandi ML, Balcells S, Langdahl BL, et al. Large-scale evidence for the effect of the COLIA1 SpI polymorphism on osteoporosis outcomes: The GENOMOS Study // PloS Med. 2006. Vol.3. №4. P.515-523; Ralston, S.H. Genetic determinants of susceptibility to osteoporosis / S.H. Ralston // Curr. Opin. Pharmacol. - 2003. - Vol.3, №3. - P.286-290].

Ввиду высокой распространенности переломов, значительной смертности от осложнений болезни и инвалидности при остеопорозе и несовершенном остеогенезе прогнозирование возникновения переломов, а также пресимптоматическая и пренатальная диагностика с целью предотвращения рождения больных детей в отягощенных семьях с НО является важной социальной и медицинской задачей.

Научная новизна предлагаемой разработки заключается в создании новой технологии тест-системы, позволяющей с высокой точностью прогнозировать риск возникновения переломов, доступной для всех слоев населения, вне зависимости от возраста. Основными характеристиками разработки являются высокая эффективность метода и экономическая выгода для населения. Преимущества перед существующими аналогами заключаются в оптимальности разрабатываемых подходов ДНК-диагностики заболеваний, основанных на выявлении существующих структурных особенностей генофонда народов Волго-Уральского региона, а также в высоко чувствительном, надежном и быстром методе, позволяющем прогнозировать риск возникновения переломов у индивидуумов с наследственной предрасположенностью к остеопорозу и семейной отягощенностью по HO.

Существуют аналоги определения риска развития остеопороза, которые основаны на диагностике и терапевтическом лечении остеопороза, а также на определении носителей гаплотипа и генотипа гена интерлейкина 1 (IL-1) [патент US 20090023147, опубл. 22.01.2009; патент US 20100255475, опубл. 07.10.2010; патент US 20050084882, опубл. 21.04.2005].

Известны методы диагностики с наборами реагентов (праймеры, киты и биочипы), направленные на определение предрасположенности к остеопорозу, основанные на анализе ассоциаций полиморфных вариантов нуклеиновой кислоты, изложенные в SEQ ID NO:1 [патент US 20050221306, опубл.06.10.2005].

Получен американский патент на диагностику остеопороза или предрасположенность к остеопорозу, основанный на использовании определенных генетических маркеров, ассоциированных с геномным регионом, локализованном на 20 хромосоме, который определяет экспрессию морфогенетического белка кости человека - BMP2. Генетические маркеры могут быть определены на уровне нуклеиновых кислот, например, прямым секвенированием или аминокислотном уровне с использованием иммунологического анализа, основанного на антителах, которые узнают белок BMP2, если генетические маркеры затрагивают кодирующую последовательность BMP2 [патент US 20060057612, опубл. 16.03.2006].

Известен способ диагностики развития системного остеопороза у мужчин, основанный на выявлении фенотипических признаков. Изобретение относится к области медицины и предлагается для быстрого выявления лиц мужского пола старше 50 лет с высоким риском развития системного остеопороза или с его наличием, для их дальнейшего обследования и лечения [патент РФ №2398509, кл. A61B 5/107, A61B 10/00, опубл. 10.09.2010].

Существует способ диагностики развития остеопороза у женщин с первичным гипотериозом, включающий выявление факторов риска развития остеопороза на основе определения тиреотропных гормонов [патент РФ №2270612, кл. A61B 10/00, опубл. 27.02.2006].

Известен способ прогнозирования остеопороза у женщин постменопаузального возраста путем вычисления прогностического индекса F1 на основании возраста, длительности менопаузы, наличия резекции яичников и значения индекса массы тела [патент РФ №2381751, кл. A61B 10/00, опубл. 20.02.2010].

Все эти методы позволяют повысить эффективность и целенаправленность профилактических и лечебных мероприятий в группах с высоким риском развития переломов.

Существует набор для диагностики, предотвращения развития остеопороза, основанный на ассоциации локуса CNR2, кодирующего белок каннабиноидного рецептора 2, с остеопорозом. Изобретение предлагает методы и наборы для определения предрасположенности к остеопорозу, улучшает диагностику заболевания у индивидуумов с подозрением на остеопороз [патент US 20050260608, опубл. 24.11.2005].

Разработан отечественный диагностический набор «ОстеоГЕН-М» производства группы компаний Алкор Био, предназначенный для диагностики генетической предрасположенности к остеопорозу, получивший регистрационное удостоверение Росздравнадзора, который основан на определении полиморфного варианта +1245G>T гена COLIA1 и TagI полиморфного варианта гена VDR методом мультиплексной полимеразной цепной реакции (№ ФСР 2010/09538).

Таким образом, патенты, которые направлены на диагностику риска развития возникновения переломов на основе генетических технологий на российском и зарубежных рынках, единичны и основаны на трудоемких методах диагностики и, как правило, ориентированы на определенную категорию населения (к примеру, на группу лиц, старше 50 лет или только на определенную гендерную принадлежность). Кроме того, следует отметить, что существующие патенты основаны на исследовании лишь одного локуса кандидатного гена, не учитывающие сочетания генотипов сразу по нескольким полиморфным вариантам одного гена, которые имеют большее прогностическое значение для определения риска развития переломов.

Технической задачей предлагаемого изобретения является разработка способа прогнозирования риска возникновения переломов с помощью прогностической модели, основанной на результатах исследования трех локусов кандидатного гена - COLIA1.

Технический результат изобретения - получение критериев оценки риска возникновения переломов с высокой прогностической значимостью.

Указанный технический результат достигается тем, что выделяют ДНК из лейкоцитов периферической венозной крови, методом полимеразной цепной реакции с флуоресцентной детекцией, генотипируют 3 полиморфных варианта -1997G>T (g.3011T>G, rs1107946), -1663IndelT (g.3344_3345delTT, rs2412298) и +1245G>T (c.104-441G>T (rs1800012), расположенных в регуляторном регионе гена COLIA1 и при идентификации сочетания генотипов: -1997∗G∗T/-1663∗I∗D/+1245∗G∗T прогнозируют категорию лиц с повышенным риском развития возникновения переломов.

Способ реализуется следующим образом: выделяют ДНК методом последовательной фенольно-хлороформной экстракции по Мэтью из цельной венозной крови [Mathew С.С. The isolation of high molecular weight eucariotic DNA // methods in molecular biology / ED. Walker J.M. - N.Y.: Haman press. - 1984. - P.31-34]. В пробирку с предварительно добавленными 2 мл консерванта (глюгицир) набирали 8 мл крови (соотношение консерванта и крови 1:4) и хорошо перемешивали. Хранение осуществляли при 4°C не более двух недель. Для выделения геномной ДНК к 8-10 мл крови добавляли 50 мл лизирующего буфера, содержащего 320 мМ сахарозы, 1% тритон X-100, 5 мМ MgCl2, 10 мМ трис-HCl, pH 7,6. Полученную смесь перемешивали и центрифугировали при 4°C, 4000 об/мин в течение 20 минут. Надосадочную жидкость сливали, к осадку добавляли 8 мл раствора, содержащего 25 мМ ЭДТА, pH 8,0 и 75 мМ NaCl, ресуспензировали, добавляли 0,8 мл 10% SDS, 50 мкл протеиназы K (10 мг/мл) и инкубировали образец при 37°C в течение 16 часов. Экстракцию ДНК проводили равными объемами фенола, фенол-хлороформа (1:1) и хлороформа с центрифугированием при 4000 об/мин в течение 10 минут и отбором водной фазы после каждого этапа. ДНК осаждали из раствора 2-3 мл охлажденного 96% этанола (преципитация). Осажденную ДНК растворяли в деионизированной воде и хранили при -20°C.

Исследование полиморфных вариантов -1997G>T, -1663indelT и +1245G>T гена COLIA1 может осуществляться с помощью разнообразных молекулярно-генетических подходов: анализа полиморфного варианта длин рестрикционных фрагментов после полимеразной цепной реакции (ПЦР-ПДРФ), ПЦР с использованием аллель-специфичных праймеров, ПЦР в реальном времени, анализ конформации одноцепочечных фрагментов ДНК (SSCP), с применением биочипов и секвенирования.

Предлагается метод определения маркеров повышенного риска развития переломов с помощью метода ПЦР в режиме реального времени, который считается существенно более чувствительным и качественным по чистоте работы. Преимущества флуоресцентной детекции по сравнению с обычными методами: сокращение времени анализа до 1-2 часов; меньшая стоимость в расчете на одну пробу; более высокая воспроизводимость и надежность результатов; удобный формат поставки "в одной пробирке".

Наборы с флуоресцентной детекцией результатов ПЦР позволяют обходиться без этапов рестрикции и электрофореза и регистрировать результаты амплификации с помощью амплификатора в реальном времени, не открывая пробирку с амплификационной смесью, сводя к минимуму риск контаминации и резко сокращая время и трудоемкость проведения анализа.

Интерпретация результатов проводится с помощью программных средств реал-тайм амплификатора (Allelic Discrimination) в автоматическом режиме.

Для проведения амплификации и флуоресцентной детекции требуется амплификатор с возможностью проведения анализа флуоресценции по конечной точке (Endpoint Analysis, Allelic Discrimation и т.д.) - «Rotor-Gene» 3000/6000 («Corbett Research)), Австралия); «iQ iCycler», «iQ5», «CFX96» («BioRad», США), ABI 7300/7500/7900 («Applied Biosystems», США) или аналогичные. Прибор должен позволять использование красителей со следующими длинами волн поглощения/испускания (нм):

FAM/GreenEx495 Em520

VIC/HEX/JOE/R6G/Yellow Ex535Em556

После перемешивания смесь разливается по амплификационным пробиркам/плашкам, после чего в них добавляются исследуемые образцы ДНК и проводится амплификация согласно программе:

первая денатурация 95°C - 2:00

40 циклов 94°C - 0:10

отжиг - 1:00

При необходимости проведения ПЦР в реальном времени измерение сигнала флуоресценции следует проводить на втором этапе реакции.

После проведения амплификации необходимо провести детекцию флуоресценции «по конечной точке» согласно протоколу используемого прибора.

Диагностическую чувствительность и специфичность тест-системы определяли на выборке заранее охарактеризованных методом секвенирования образцов, как минимум по 100 образцов на тест-систему (но с обнаружением не менее одного генотипа каждого вида). Показана 100% диагностическая чувствительность и специфичность (все генотипы, определенные при помощи ПЦР-тест-системы, совпали с генотипами, определенными при помощи секвенирования и ПЦР-ПДРФ анализа).

Критерии предлагаемого способа оценки риска развития переломов были разработаны на основании анализа данных молекулярно-генетических исследований больных с переломами, среди которых 41 больных с установленным клиническим диагнозом «несовершенный остеогенез» из 33 семей из Республики Башкортостан и 70 их родственников (в качестве контроля для больных НО была использована выборка, состоящая из 50 здоровых индивидов с нормальным уровнем минеральной плотности костной ткани (МПКТ), а также 447 женщин в возрасте от 48 до 77 лет, среди них: русские - 372 женщины (175 с переломами, 197 без переломов), татары - 105 (42 с переломами и 63 без переломов). В группу с переломами вошли женщины с наличием низкотравматичных переломов (возникающих при падении с высоты собственного тела, при незначительной нагрузке или без видимых причин), произошедших в постменопаузе. Все переломы были подтверждены рентгенологически. Для популяционных исследований использованы выборки, состоящие из неродственных жителей Волго-Уральского региона русской (106 человек), татарской (80 человек) и башкирской этнической принадлежности (113 человек).

Генотипирование образцов проводилось с помощью полимеразной цепной реакции (ПЦР) в реальном времени с флуоресцентной детекцией. Нами сконструированы праймеры и зонды, последовательность которых представлена в таблице 1. Математическую обработку результатов проводили с использованием пакета программ: MS Office Excel 2003 (Microsoft). При попарном сравнении частот аллелей и генотипов в группах больных и контроля использовали критерий χ2 (p) для таблиц сопряженности 2×2 с поправкой Иэйтса на непрерывность [http://www.biometrica.tomsk.ru/]. Силу ассоциаций оценивали в значениях показателя соотношения шансов Odds Ratio (OR).

Был проведен анализ распределения частот аллелей и генотипов полиморфных локусов -1997G>T, -1663indelT и +1245G>T гена COLIA1 в трех этнических группах Волго-Уральского региона. Преобладающим в изученных популяциях был генотип -1997∗G∗G, частота которого варьировала от 52,2% у татар до 68,5% у русских. Генотип -1997∗T∗T встречался с частотой 3,7% у башкир, 2,7% у русских и 2,2% у татар, различия в распределении частот генотипов статистически незначимы (χ2=3,93; p=0,41). В европейских популяциях частота генотипа -1997∗G∗G составила 76% у испанцев и 75,9% у голландцев, тогда как у китайцев отмечается снижение частоты генотипа -1997∗G∗G до 38,9%. Частота генотипа -1997∗T∗T составила 2% у испанцев, 1,6% у голландцев и 11,2% у китайцев. По распределению частот генотипов -1997G>T полиморфного варианта татары и башкиры отличались от испанцев (χ2=10,59; p=0,005 и χ2=7,1; p=0,028, соответственно), голландцев (χ2=11,97; p=0,002 и χ2=8,63; p=0,01, соответственно), китайцев (χ2=6,S; p=0,033 и χ2=8,7; p=0,013, соответственно), тогда как русские отличались только от китайцев (p<0,001).

В изученных этнических группах преобладающим был генотип -1663∗I∗I, частота которого составила 68,3% у русских, 84,8% у татар и 79,6% у башкир. Генотип -1663∗D∗D встретился с частотой 2,7% у русских и не был обнаружен у татар и башкир, различия в распределении частот генотипов -1663indelT полиморфного варианта не были статистически значимыми (χ2=4,74; p=0,314). В европейских популяциях отмечается снижение частоты генотипа -1663∗I∗I и повышение частот генотипов -1663∗I∗D и -1663∗D∗D по сравнению с этническими группами Волго-Уральского региона. На сегодняшний день не опубликованы данные о распределении частот аллелей и генотипов -1663indelT полиморфного варианта в азиатских популяциях. По распределению частот генотипов популяции русских, татар и башкир статистически значимо отличались от популяций Западной Европы (p<0,05).

Преобладающим в исследованных группах был генотип +1245∗G∗G, частота которого варьировала от 79% у татар до 85% у башкир. Частота гетерозиготного генотипа +1245∗G∗T составила 15% у башкир, 17,9% у русских и 21% у татар. Генотип +1245∗Т∗T встречался с частотой 0,9% у русских и не был выявлен у татар и башкир, различия в распределении частот генотипов в исследованных нами этнических группах не были статистически значимыми (χ2=3,55; p=0,47). В европейских популяциях отмечается повышение частоты генотипа +1245∗G∗T (30% у испанцев, 29,8% у голландцев), а также повышение частоты генотипа +1245∗T∗T (3,6% у англичан, 7% у испанцев). По распределению частот генотипов обнаружены статистически значимые отличия трех этнических групп Волго-Уральского региона от азиатских и европейских популяций (p<0,05).

Таким образом, при изучении полиморфных локусов -1997G>T, -1663indelT и +1245G>T гена COLIA1 не выявлено статистически значимых различий по распределению частот аллелей и генотипов изученных локусов между популяционными выборками башкир, татар и русских, проживающих на территории Волго-Уральского региона, и обнаружены отличия исследованных этнических групп от популяций Западной Европы и Восточной Азии.

При анализе частот распределения аллелей и генотипов полиморфного варианта +1245G>T в группе больных НО гомозиготный генотип ∗TT встречался у одного больного НО, гетерозиготный генотип ∗GT выявлен у 21,2% пациентов, тогда как в контрольной выборке аллель ∗T не встречался в гомозиготном состоянии и обнаружен у 10% индивидов в гетерозиготном состоянии, не достигая статистически значимых различий из-за малочисленности выборки больных НО.

Было показано, что гаплотипы в промоторном регионе -1997G>T, -1663indelT имеют высокую транскрипционную активность. Эти исследования подкрепляют гипотезу о том, что механизмы, лежащие в основе ассоциаций гаплотипов гена COLIA1 с переломами, связаны с повышенной транскрипцией гена COLIA1. Это приводит к аномальному соотношению α1 и α2 цепей, которые поражают минерализацию кости и прочность костной ткани [Scheer U., Hinssen Н., Franke W.W., Jockusch В.М. Microinjection of actin-binding proteins and actin antibodies demonstrates involvement of nuclear actin in transcription of lampbrush chromosomes // Cell. - 1984. - Vol.39. - P.111-122; Stewart TL, Roschger P, Misof BM, Mann V et al. Association of COLIA1 Sp1 alleles with defective bone nodule formation in vitro and abnormal bone mineralization in vivo // Calcif Tissue Int. 2005. Vol.77. P.113-118; Jin H., Stewart T.L., Hof R.V., Reid D.M., Aspden R.M., Ralston S. A rare haplotype in the upstream regulatory region of COLIA1 is associated with reduced bone quality and hip fracture // J. Bone Miner. Res. - 2009. - Vol.24. - P.448-454; Garcia-Giralt N, Enjuanes A, Bustamante M et al. In vitro functional assay of alleles and haplotypes of two COLIA1- promoter SNPs // Bone. 2005. Vol.36. №5. P.902-908].

Был проведен анализ распределения частот аллелей полиморфного варианта -1997G>T гена COLIA1 в выборке больных НО и в группе контроля. Так, частота аллеля ∗T у больных НО составила 0,35, тогда как в группе контроля она была несколько выше (0,38). При этом наблюдается повышение частоты гомозиготного генотипа ∗TT у больных НО (0,1), по сравнению с контролем (0,08), однако различия не достигают статистических значений.

Анализ распределения частот аллелей и генотипов полиморфного варианта -1663indelT у больных НО показал, что тенденцию повышения частоты делеции T до 12%, по сравнению с контролем. У больных НО делеция ∗T в гомозиготном состоянии была выявлена у одного больного (3%), в то время как в группе здоровых индивидов она совсем не встречалась.

Полногеномные исследования ассоциаций подтвердили роль -1997G>T, -1663indelT и +1245G>T полиморфных вариантов в регуляторном регионе гена COLIA1 на уровень МПКТ и развитие переломов [Richards J.B., Rivadeneira F., Inouye M., Pastinen T.M., Soranzo N., Wilson S.G., Andrew Т., Falchi M., Gwilliam R., Ahmadi K.R., et al. Bone mineral density, osteoporosis, and osteoporotic fractures: a genome-wide association study // Lancet - 2008. - Vol.371. - P.1505-1512; Styrkarsdottir U., Halldorsson B.V., Gretarsdottir S., Gudbjartsson D.F., Walters G.B., Ingvarsson Т., Jonsdottir Т., Saemundsdottir J., Snorradottir S., Center J.R., et al. New sequence variants associated with bone mineral density // Nat. Genet. - 2009. - Vol.41. - P.15-17; Styrkarsdottir U., Halldorsson B.V., Gretarsdottir S., Gudbjartsson D.F., Walters G.B., Ingvarsson Т., Jonsdottir Т., Saemundsdottir J., Center J.R., Nguyen T.V., et al. Multiple genetic loci for bone mineral density and fractures // N. Engl. J. Med. - 2008. - Vol.358. - P.2355-2365]. Так, анализ гаплотипов по трем полиморфным вариантам регуляторного региона гена COLIA1 у больных НО и в группе контроля показал, что гаплотип ∗T∗del∗T, ассоциированный с низким значением МПКТ и повышенным количеством переломов, был обнаружен у 5 пациентов с НО (15%) и отсутствовал в группе контроля. Значения достигают статистически значимых различий χ2=4,99 p=0,025 (OR=3,53 (1,23-10,11).

Наши результаты согласуются с результатами других исследований, где показано, что транскрипция гаплотипа ∗T∗del∗T полиморфных локусов -1997G>T, -1663indelT и +1245G>T, ассоциированного с повышенным риском переломов, в два раза выше, чем гаплотипа ∗G∗I∗G; и гаплотип ∗T∗D∗T встречается в группе пациентов, имеющих большое количество переломов [Huilin Jin, Rob J. van′t Hof, Omar M.E. Albagha and Stuart H. Ralston. Promoter and intron 1 polymorphisms of COLIA1 interact to regulate transcription and susceptibility to osteoporosis // Human Molecular Genetics. - 2009. - Vol.15. - P.2729-2738; Jin H., Stewart T.L., Hof R.V., Reid D.M., Aspden R.M., Ralston S. A rare haplotype in the upstream regulatory region of COLIA1 is associated with reduced bone quality and hip fracture // J. Bone Miner. Res. - 2009. - Vol.24. - P.448-454].

Было проведено исследование -1997G>T, -1663indelT и +1245G>T полиморфных локусов и гаплотипов гена COLIA1 в выборках женщин с остеопоретическими переломами и без переломов русской и татарской этнической принадлежности. Анализ распределения частот аллелей и генотипов -1997G>T полиморфного варианта гена COLIA1 у женщин с переломами и без переломов русской этнической принадлежности не выявил статистически значимых различий. Преобладающим был аллель -1997∗G, частота которого составила 81,43% у женщин с переломами и 81,72% в контрольной группе. Генотип -1997∗G∗G встречался с частотой 66,9% в группе с переломами и 65,9% в контроле, частота генотипа -1997∗G∗T составила 29,1% и 31,5%, соответственно.

У женщин татарской этнической принадлежности в группе с переломами частота аллеля -1997∗G составила 72,6%, в контроле - 75,39%. У женщин с переломами отмечалось повышение частоты генотипа -1997∗T∗T (7,14%) и снижение частоты генотипа -1997∗G∗T (40,5%) по сравнению с контрольной группой (1,59% и 46,03%, соответственно). Различия в распределении частот аллелей и генотипов -1997G>T полиморфного варианта гена COLIA1 у женщин татарской этнической принадлежности статистически незначимы.

В группе с переломами отмечается повышение частоты аллеля -1663∗D до 23,1% по сравнению с контролем (15,7%; χ2=6,08; p=0,014). Величина относительного риска для носителей аллеля -1663∗D составила 1,61 (95% Cl 1,12-2,33). В группе с переломами отмечается повышение частоты генотипа -1663∗I∗D (38,3%) по сравнению с контролем (27,4%; χ2=4,51; p=0,034), и снижение частоты генотипа -1663∗I∗I (57,7% и 79,6%, соответственно; χ2=6,13; p=0,013). Генотип -1663∗I∗D является маркером повышенного риска развития переломов (OR=l,64; 95% Cl 1,06-2,54), генотип -1663∗I∗I можно рассматривать как протективный (OR=0,56; 95% Cl 0,371-0,874).

У женщин татарской этнической принадлежности выявлена сходная тенденция к повышению частот аллеля -1663∗D и генотипа -1663∗I∗D в группе с переломами по сравнению с контролем, однако различия не достигли уровня статистической значимости. Так, частота аллеля -1663∗D у женщин с переломами составила 14,3%, в группе без переломов - 9,5% (χ2=0,71; p=0,4). Частота генотипа -1663∗I∗I в контрольной группе была 82,5%, у женщин с переломами - 71,43%, генотип -1663∗I∗D встречался с частотой 28,6% и 15,9%, соответственно.

Таким образом, проведенное нами исследование -1663indelT полиморфного варианта гена COLIA1 показало, что генотип -1663∗I∗D (OR=l,64) и аллель -1663∗D (OR=l,61) являются маркерами повышенного риска, а генотип -1663∗I∗I - протективным (OR=0,56) в отношении риска развития переломов у женщин русской этнической принадлежности.

Распределение частот аллелей и генотипов полиморфного варианта +1245G>Тгена COLIA1 у женщин русской и татарской этнической принадлежности было следующим. У женщин с переломами русской этнической принадлежности выявлено повышение частоты аллеля +1245∗T (20,43%) по сравнению с контрольной группой (14,21%; χ2=4,01; p=0,045), показатель относительного риска для носителей аллеля +1245∗T составил 1,5 (95% Cl 1,03-2,22). При сравнении частот генотипов в исследуемых выборках женщин русской этнической принадлежности в группе с переломами обнаружено повышение частоты генотипа +1245∗G∗T (33,14%) и снижение частоты генотипа +1245∗G∗G (64,43%) по сравнению с контролем (24,4% и 73,6%, соответственно), различия не были статистически значимыми. У женщин татарской этнической принадлежности также выявлено повышение частоты аллеля +1245∗T (14,28%) и генотипа +1245∗G∗T (28,57%) в группе с переломами по сравнению с контролем (9,52% и 15,87%, соответственно). Генотип +1245∗T∗T не встречался у женщин татарской этнической принадлежности. Различия в распределении частот аллелей и генотипов в исследуемых группах татарской этнической принадлежности не были статистически значимыми.

Таким образом, проведенное исследование +1245G>T полиморфного варианта гена COLIA1 показало, что среди женщин русской этнической принадлежности носители аллеля +1245∗T подвержены большей вероятности развития переломов (OR=1,5). Полученные данные согласуются с результатами других работ. Ассоциация аллеля +1245∗T с повышенным риском переломов была показана у женщин из Испании [Bandres E, Pombo I, Gonzalez-Huarriz М, Rebollo A et al. Association between bone mineral density and polymorphisms of the VDR, ER alpha, COLIA1 and CTR genes in Spanish postmenopausal women // J Endocrinol Invest. 2005. Vol.28. №4.P.312-321; Navarro M.C., Sosa M., del Pino-Montes J. Collagen type 1 (COLIA1) Sp1 binding site polymorphism is associated with osteoporotic fractures but not with bone density in post-menopausal women from the Canary Islands: a preliminary study // Aging. Clin. Exp. Res. - 2007. - Vol.19, №1. - P.4-9; Bandres, 2005; Navarro, 2007], Великобритании [Grant S.F., David M. Reid, Glen Blake et al. Reduced bone density and osteoporosis associated with a polymorphic Sp1 binding site in the collagen type I α 1 gene // Nature genetics. 1996. Vol.l4. P.203-205; McGuigan FE, Reid DM, Ralston SH. Susceptibility to osteoporotic fracture is determined by allelic variation at the Sp1 site, rather than other polymorphic sites at the COLIA1 locus // Osteoporos Int. 2000. Vol.11. №4. P.338-343Grant, 1996; McGuigan, 2000], Голландии [Yazdanpanah N., Rivadeneira F., van Meurs J.B., Zillikens M.C., Arp P., Hofman A., van Duijn C.M., Pols H.A., Uitterlinden A.G. The - 1997 G/T and Sp1 polymorphisms in the collagen type I alphal (COLIA1) gene in relation to changes in femoral neck bone mineral density and the risk of fracture in the elderly: the Rotterdam study // Calcif. Tissue Int. - 2007. - Vol.81. - P.18-25; Uittelinden AG, van Meurs JB, Rivadeneira F, Pols HA. Identifying genetic risk factors for osteoporosis // J Musculoskelet Neuranal Interact. 2006. Vol.6. №1. P.16-26], Греции [Weichetova M, Bohuslavova R, Skodova Z, J J, Adamkova V. No association between genetic polymorphisms of TGFss, PAI-1, and COLIA1, and bone mineral density in Caucasian females. // Endocr Regul. 2006. Vol.40. №4. P.107-112]. Однако не было обнаружено влияние +1245G>T полиморфного варианта на риск развития переломов в у женщин из Ирландии [McClean Е, Archbold GP, Taggart HM. Do the COLIA1 and Taq 1 vitamin D receptor polymorphisms have a role in identifying individuals at risk of developing osteoporosis? // Ulster Med J. 2003. Vol.72. №1. P.26-33] и Бельгии [Aerssens J., J. Dequeker, J. Peeters. Polymorphisms of the VDR, ER and COLIA1 genes and osteoporotic hip fracture in elderly postmenopausal women // Osteoporos. Int. - 2000. - Vol.11, №7. - P.583-591]. Самое масштабное на сегодняшний день многоцентровое исследование, проведенное в ряде европейских стран, показало, что риск развития переломов позвоночника у женщин с генотипом +1245∗G∗T или +1245∗T∗T в 1,4 раза выше по сравнению с носителями генотипа +1245∗G∗G [Ralston SH, Uitterlinden AG, Brandi ML, Balcells S, Langdahl BL, et al. Large-scale evidence for the effect of the COLIA1 SpI polymorphism on osteoporosis outcomes: The GENOMOS Study // PloS Med. 2006. Vol.3. №4. P.515-523].

Был проведен анализ гаплотипов -1997G>T, -1663indelT и +1245G>T полиморфных локусов гена COLIA1 в выборках женщин с переломами и без переломов русской и татарской этнической принадлежности. Наиболее частыми были гаплотипы -1997∗G/-1663∗I/+1245∗G, -1997∗T/-1663∗I/+1245∗G и -1997∗G/-1663∗D/+1245∗. Сравнительный анализ групп женщин без переломов показал, что гаплотип -1997∗T/-1663∗I/+1245∗G встречается чаще (23,7%), а гаплотип -1997∗G/-1663∗D/+1245∗T - реже (7,4%) у татар по сравнению с русскими (18,3% и 13,9%, соответственно), однако различия не являются статистически значимыми (χ2=4,31; p=0,366; df=4). Кроме того, у женщин татарской этнической принадлежности выявлены гаплотипы -1997∗T/-1663∗D/+1245∗G и -1997∗T/-1663∗D/+1245∗T, которые не встретились у женщин русской этнической принадлежности.

Анализ распределения частот гаплотипов у женщин русской этнической принадлежности показал, что гаплотип -1997∗G/-1663∗I/+1245∗G чаще встречался в контроле (65,2%) по сравнению с группой с переломами (57,9%; p=0,043), однако различия не были статистически значимы после применения поправки на множественность сравнений (p=0,21). Также у женщин с переломами отмечается повышение частоты гаплотипа -1997∗G/-1663∗D/+1245∗T по сравнению с контрольной группой (19,1% и 13,9%, p=0,057).

При сравнении частот гаплотипов у лиц татарской этнической принадлежности выявлено, что у женщин с переломами гаплотип -1997∗G/-1663∗D/+1245∗T встречается чаще по сравнению с контролем (14,3% и 7,4%, соответственно), а гаплотип -1997∗G/-1663∗I/+1245∗G - реже (58,3% и 66,8%, соответственно), различия не были статистически значимы.

Согласно полученным данным, гаплотипы -1997G>T, -1663indelT и +1245G>T полиморфных локусов гена COLIA1 не ассоциированы с риском развития переломов у женщин русской и татарской этнической принадлежности. Показано, что гаплотип -1997∗G/+1245∗G ассоциирован с пониженным, а гаплотип -1997∗G/+1245∗T - с повышенным риском развития переломов у женщин из Голландии [Yazdanpanah N., Rivadeneira F., van Meurs J.B., Zillikens M.C., Arp P., Hofrman A., van Duijn СМ., Pols H.A., Uitterlinden A.G. The - 1997 G/T and Spl polymorphisms in the collagen type I alphal (COLIA1) gene in relation to changes in femoral neck bone mineral density and the risk of fracture in the elderly: the Rotterdam study // Calcif. Tissue Int. - 2007. - Vol.81. - P.18-25].

Таким образом, в результате проведенного исследования -1997G>T, -1663indelT и +1245G>T полиморфных локусов и гаплотипов гена COLIA1 выявлена ассоциация -1663indelT и +1245G>T полиморфизмов с риском развития переломов у женщин русской этнической принадлежности. Аллели +1245∗T, -1663∗D и генотип -1663∗I∗D являются маркерами повышенного риска развития переломов.

На основании полученных результатов можно сделать вывод о том, что сочетание генотипов или гаплотипов всех трех полиморфных вариантов -1997G>T, -1663indelT и +1245G>T, расположенных в регуляторном регионе гена COLIA1, позволяет с большей вероятностью прогнозировать риск развития переломов у индивидуумов с предрасположенностью к переломам.

Примеры прогнозирования риска развития переломов.

Пример 1. Пациент 1992 года рождения.

Клинический диагноз: несовершенный остеогенез. За 5 лет жизни у пробанда зарегистрировано 19 переломов, которые привели к деформации конечностей и инвалидизации пациента. Пациент характеризуется голубыми склерами, деформациями конечностей, грудной клетки, гиперобильностью суставов кистей и стоп.

Для проведения анализа полиморфных вариантов -1997G>T, -1663indelT и +1245G>T у больного было взято 5 мл венозной крови с последующим выделением ДНК и амплификацией в режиме реального времени с флуоресцентной детекцией по конечной точке. В результате было выявлено, что пациент является носителем сочетания генотипов -1997∗G∗T/-1663∗I∗D/+1245∗G∗T и гаплотипа ∗T∗del∗T, являющегося маркером повышенного риска развития переломов.

Пример 2. Пациентка 54 лет.

Диагноз: первичный постменопаузальный остеопороз. Пациент 54 лет без сопутствующих заболеваний и состояний, которые могут привести к потере костной массы (инсулинзависимый сахарный диабет, ревматоидный артрит, системная красная волчанка, хроническая почечная недостаточность, удаление яичников, резекция желудка, длительный прием глюкокортикоидов, иммунодепрессантов). В анамнезе переломы XI и XI ребер слева, лучевой кости правой руки, возникших при падении с высоты собственного тела, при незначительной нагрузке или без видимых причин (низкотравматичные переломы) произошедшие в постменопаузальном возрасте.

В целях проведения анализа трех полимофрных вариантов -1997G>T, -1663indelT и +1245G>T гена COLIA1 у пациентки было взято 5 мл венозной крови, из которой была выделена ДНК методом фенольно-хлороформной экстракции. Амплификация полиморфных вариантов проводилась с помощью ПЦР в реальном времени с флуоресцентной детекцией по конечной точке. Таким образом, было определено, что пациент является носителем сочетания рисковых генотипов -1997∗G∗T/-1663∗I∗D/+1245∗G∗T.

Пример 3. Пациентка 64 лет.

Диагноз: первичный постменопаузальный остеопороз, без сопутствующих заболеваний и состояний, которые могут привести к потере костной массы (инсулинзависимый сахарный диабет, ревматоидный артрит, системная красная волчанка, хроническая почечная недостаточность, удаление яичников, резекция желудка, длительный прием глюкокортикоидов, иммунодепрессантов). В анамнезе переломы позвонков (L1, L2), возникших при падении с высоты собственного тела, при незначительной нагрузке или без видимых причин (низкотравматичные переломы), произошедшие в постменопаузальном возрасте.

В целях проведения анализа трех полиморфных вариантов -1997G>T, -1663indelT и +1245G>T гена COLIA1 у больного было взято 5 мл венозной крови, из которой была выделена ДНК методом фенольно-хлороформной экстракции. Амплификация полиморфных вариантов проводилась с помощью ПЦР в реальном времени с флуоресцентной детекцией по конечной точке. В результате проведенных исследований у пациентов выявлено сочетание рисковых генотипов -1997∗G∗T/-1663∗I∗D/+1245∗G∗T, являющееся генетическим маркером риска развития переломов.

Предлагаемый способ позволяет с высокой точностью прогнозировать риск развития возникновения переломов, т.к. именно сочетание генотипов по трем локусам, расположенным в регуляторном регионе гена коллагена I типа альфа 1 цепи (COLIA1), влияет на экспрессию данного гена и дает полную картину развития возникновения переломов у пациентов с повышенным риском развития переломов. Данный метод может быть использован для прогностических и предиктивных целей, позволяющих проводить профилактическое лечение у индивидуумов со склонностью к переломам до развития остеопоретических переломов.

Таблица 1
Праймеры, зонды и условия проведения полимеразной цепной реакции
Ген Полиморфный маркер/мутация dbSNP Частота Праймеры и зонды
G/T rs1800012 34% GG 49% GT 17% TT COLIA1-rs1800012-FJ, GAGGGAGGAGAGAAGGGA, 65.1C COLIA1-rs1800012-RJ, CTAGGTGCTGGAGGTTAGG, 64.8C COLIA1-rs1800012-FAM, FAM-cccgcccCcaTtccc-BHQ-1, 71.9C COLIA1-rs1800012-VIC, VIC-cccgCccAcattccc-BHQ-2,69.1C Длина 168, 65C
COLIA1 G/T rs1107946 12% GG 52% GT 36% TT COLIA1-rs1107946-FJ, GAACCCACCAAAGTCCTG, 63.8C COLIA1-rs1107946-RJ, CCTAGACCACCACTCTAAATG, 63.3C COLIA1-rs1107946-FAM, FAM-ccaagAgaAccCctcc-BHQ-1, 71.9C COLIA1-rs1107946-VIC, VIC-ccaagAgaCccCctcc-BHQ-2, 69.1С Длина 114, 61C
ID rs2412298 15% II 47% ID 38% DD COLIA1-rs2412298-FJ, CAGCTGGTTTTGTGCAAC, 63.7C COLIA1-rs2412298-RJ, TGCCTCTCTGGAAACTCTA, 63.3C COLIA1-rs2412298-FAM, FAM-aggcaaaGgggAaaaAaaaGga-BHQ-1, 75.9C COLIA1-rs2412298-VIC, VIC-aggcaaaGgggAaaAaaaGga-BHQ-2, 74.4C Длина 174, 63C

Способ прогнозирования риска возникновения переломов, заключающийся в том, что выделяют ДНК из лейкоцитов периферической венозной крови, методом полимеразной цепной реакции с флуоресцентной детекцией, генотипируют 3 полиморфных варианта -1997G>T (g.3011T>G, rs1107946), -1663IndelT (g.3344_345delTT, rs2412298) и +1245G>T (c.104-441G>T (rs1800012), расположенных в регуляторном регионе гена COLIA1 и при идентификации сочетания генотипов: -1997∗G∗T/-1663∗I∗D/ +1245∗G∗T прогнозируют категорию лиц с повышенным риском возникновения переломов.



 

Похожие патенты:

Группа изобретений относится к области биотехнологии и касается способа получения белков, выделенных при лизисе клеток Vero, включающего следующие стадии: культивирование и сбор клеток Vero; разрушение и лизис клеток Vero; очистку выделенных при лизисе клеток Vero белков путем гидрофобной хроматографии на фенилсефарозе 6FF, эксклюзивную хроматографию на сефарозе, элюцию, концентрирование, выделенные белки представляют собой смесь белков с молекулярными массами 11 кДа, 17-34 кДа, 55 кДа и 72-170 кДа.
Изобретение относится к области медицинской диагностики и предназначено для персонифицированного прогнозирования эффективности терапии хронического гепатита С пегилированным интерфероном-альфа и рибавирином.

Изобретение относится к медицине и касается способа выделения спермаспецифического ингибитора трипсина человека из семенной плазмы, заключающегося в том, что выделение проводят сочетая преципитацию сульфатом аммония и аффинную хроматографию на иммобилизованном лектине бодяги речной.

Изобретение относится к медицине. Сущность способа оценки детоксикационной функции организма у работающих в условиях химического комплекса включает определение активности супероксиддисмутазы и глутатионпероксидазы в лизатах эритроцитов, глутатионредуктазы в эритроцитах, рассчитывают показатель детоксикационной функции организма (ПD) по формуле.

Изобретение относится к способу ранней детекции мышечных дегенеративных заболеваний и к способу прогнозирования и/или определения терапевтической эффективности терапевтического средства и/или способа терапии заболеваний посредством измерения тетранор-PGDM (11,15-диоксо-9α-гидрокси-2,3,4,5-тетранорпростан-1,20-диовой кислоты) в образце мочи субъекта и сравнения его содержания относительно образца, выделенного у здорового индивидуума.

Изобретение относится к области фармацевтики и представляет собой способ идентификации соединения, пригодного для лечения гингивита, включающий: взаимодействие первого гингивального образца, полученного от млекопитающего, страдающего от гингивита, с исследуемым соединением; взаимодействие второго гингивального образца из ротовой полости млекопитающего с положительным контролем - соединением, подавляющим экспрессию одной или более матриксных металлопротеиназ (галогенированный дифениловый эфир); измерение степени, с которой экспрессия одной или более матриксных металлопротеиназ подавляется с помощью исследуемого соединения; измерение степени, с которой экспрессия одной или более из матриксных металлопротеиназ подавляется с помощью положительного контроля; и сравнение степени, с которой экспрессия одной или более из матриксных металлопротеиназ подавляется с помощью исследуемого соединения, со степенью, с которой экспрессия одной или более из матриксных металлопротеиназ подавляется с помощью положительного контроля; в котором исследуемое соединение, которое подавляет экспрессию одной или более из матриксных металлопротеиназ в равной или большей степени, чем положительный контроль, является соединением, пригодным для лечения гингивита; где одна или более матриксных металлопротеиназ, для которых измеряют экспрессию, включают, по меньшей мере, ММР-9 и ММР-13.

Изобретение относиться к области микробиологии. Сущность способа обнаружения и идентификации микроорганизма на твердой и полутвердой среде состоит в том, что осуществляют a) сканирование твердой или полутвердой ростовой среды, о которой известно, что она содержит или может содержать одну или более чем одну колонию микроорганизма, для локализации любых колоний, присутствующих на среде; b) непосредственное исследование на указанной ростовой среде одной или более чем одной колонии, локализованной на стадии (а) с диаметром возбуждающего пучка менее чем приблизительно 1000 мкм, с получением измерений собственной флуоресценции (СФ), характеристических для микроорганизма в колонии; c) идентификацию микроорганизма в колонии на основании измерений СФ, где микроорганизмы характеризуют на уровне семейства, рода, вида или на уровне штамма.
Изобретение относится к медицине, а именно к кардиологии, и может быть использовано для выявления высокого риска развития нарушения толерантности к глюкозе у больных стабильной стенокардией напряжения на фоне приёма бета-адреноблокаторов (ББ) без дополнительных вазодилатирующих свойств.

Группа изобретений относится к медицине, а именно к гепатологии, и может быть использована в диагностике заболеваний печени при формулировке предварительного диагноза.
Изобретение относится к области фармацевтики и представляет собой способ диагностики гигиенического состояния полости рта у субъекта, в соответствии с которым у субъекта берут пробу жидкости десневой борозды и определяют в указанной пробе содержание одного или нескольких метаболитов.
Изобретение относится к области медицины, а именно к способу определения биологического возраста у беременных женщин. Сущность способа состоит в том, что используют данные общего и биохимического анализов крови, показателей коагулограммы крови, массы тела, окружности живота (ОЖ) по формуле для I, II, III триместра беременности, затем определяют должный биологический возраст по формуле для I, II, III триместра беременности. Из величины биологического возраста вычитают величину должного биологического возраста и при значении разницы от -15,00 до -5,00 лет определяют замедленное старение, от -4,99 до +4,99 лет - физиологическое старение, от +5,00 до +15,00 лет - ускоренное старение. Использование заявленного способа позволяет точно определить биологический возраст у беременной женщины. 9 пр.
Изобретение относится к области медицины, а именно к гинекологии, и представляет собой способ диагностики наружного генитального эндометриоза, включающий исследование сыворотки крови, отличающийся тем, что в сыворотке крови определяют уровень липопротеинов высокой плотности и при величине 0,77 ммоль/л и выше диагностируют наружный генитальный эндометриоз. Изобретение позволяет повысить точность и упростить процедуру диагностики наружного генитального эндометриоза. 3 пр.

Изобретение относится к области офтальмологии и представляет собой способ прогнозирования развития пороговой стадии ретинопатии недоношенных у детей без офтальмоскопических признаков заболевания, отличающийся тем, что на сроке по 33 неделю гестационного возраста в сыворотке крови определяют содержание фактора роста эндотелия сосудов (VEGF) и при уровне VEGF, равном или превышающем 1300 пг/мл, прогнозируют развитие пороговой стадии ретинопатии недоношенных. Изобретение обеспечивает возможность коррекции тактики ведения недоношенных детей на этапах выхаживания. 2 ил., 1 табл., 5 пр.

Изобретение относится к области медицины, а именно к лабораторной диагностике, и описывает способ оценки эффективности тромболитической терапии у больных острым инфарктом миокарда с подъемом сегмента ST. Способ включает контроль состояния пациента, при котором пациенту исходно и каждые 60 минут после начала тромболизиса в течение до 4-х часов определяют концентрацию тропонина I в крови, и при увеличении концентрации тропонина I в 10 и более раз по сравнению с предыдущим показателем судят об эффективности тромболитической терапии. Изобретение может быть использовано в неотложной кардиологии для оценки эффективности тромболитической терапии у больных острым инфарктом миокарда с подъемом сегмента ST и позволяет оценить эффективность тромболитической терапии в короткие сроки и с высокой точностью, при этом на результаты исследования не влияют повторные инфаркты в анамнезе, интервенционные процедуры на сердце и кардиохирургические операции. 3 ил., 2 табл., 3 пр.
Изобретение относится к медицине, а именно к терапии, и может быть использовано для лечения некротического энтероколита у новорожденных и детей младшего грудного возраста. Для этого проводят антибактериальную, инфузионную, посиндромную, иммунозаместительную терапии, хирургическое лечение с учетом тяжести состояния ребенка и стадии процесса. При этом дополнительно определяют наличие внутриутробной инфекции. Определяют наличие и выраженность гнойно-септических показателей: прокальцитонина, С-реактивного белка, лейкоцитарного индекса интоксикации Кальф-Калифа и иммуноглобулина А. При наличии не менее одной внутриутробной инфекции и повышении гнойно-септических показателей более чем в 1,5 раза выше нормы назначают лимфотропную терапию один раз в сутки в течение 7-10 дней в виде разовой подкожной инъекции антибактериального препарата широкого спектра действия в правую паховую область на 1 см выше пупартовой связки и два внутривенных введения другого антибиотика. Изобретение позволяет сократить лекарственную нагрузку на пациентов, снизить риск развития осложнений и уменьшить летальность у новорожденных и детей младшего грудного возраста. 1 табл., 1 пр.

Изобретение относится к медицине, а именно к гастроэнтерологии, и может быть использовано для исследования всасывания аминокислот из пищеварительного тракта. Для этого проводят исследование крови утром натощак и после приема аминокислотной смеси. При этом сначала утром натощак определяют объем циркулирующей крови, гематокрит и суммарное расчетное содержание азота аминокислот в крови. После этого перорально вводят 100,0 мл раствора аминокислот, транспортируемых по одному из вариантов всасывания с известной концентрацией раствора и содержания в нем азота аминокислот. Через 30, 40, 50, 60 и 70 минут после введения аминокислотной смеси повторно определяют объем циркулирующей крови, гематокрит и суммарное расчетное содержание азота аминокислот. Рассчитывают в пробах крови коэффициент всасывания аминокислот по формуле: К = N n × О Ц К n × ( 100 − H t n / 100 ) − N 1 × О Ц К 1 × ( 100 − H t 1 / 100 ) N , где К - коэффициент всасывания аминокислот, N - содержание азота в аминокислотной смеси, N1 - показатели азота аминокислот в крови до приема аминокислот, Nn - показатели азота аминокислот в крови после приема аминокислот, ОЦК1 - объем циркулирующей крови до приема аминокислот, ОЦКn - объем циркулирующей крови после приема аминокислот, Ht1 - гематокрит до приема аминокислот, Htn - гематокрит после приема аминокислот, n - время после перорального введения аминокислот. После этого с учетом результатов показателя коэффициента К и времени, прошедшего после приема раствора аминокислот, строят график, отражающий скорость всасывания аминокислот в пищеварительном тракте. Способ позволяет оценить скорость суммарного всасывания аминокислот из пищеварительного тракта с учетом особенностей транспортной системы. 1 пр.
Изобретение относится к медицине и касается диагностики острого токсического повреждения печени крыс. Способ заключается в выделении липидов, а именно в том, что добавляют 25 мкг 10% раствора тезита при одновременном перемешивании смеси с помощью шейкера при 20°C и частоте колебаний 120 в минуту в течение 30 минут с последующим определением в растворе общих фосфолипидов и триглицеридов. При их соотношении, равном 1,01-1,19, при росте активности в крови аланинаминотрансферазы 0,50-0,62 ммоль/л и более диагностируют острое токсическое повреждение печени крыс. Использование способа позволяет повысить эффективность и точность диагностики острого токсического повреждения печени крыс. 2 табл.
Изобретение относится к медицине, а именно к гастроэнтерологии, и может быть использовано для повышения эффективности лечения пациентов с синдромом диспепсии в сочетании с избыточной массой тела. Способ включает определение уровня тревоги (HARS) и депрессии (HDRS) по шкалам Гамильтона, оценку пищевого статуса с использованием биоимпедасметрии, степень выраженности нарушений сна, оценку уровня глюкозы, теста толерантности к глюкозе, иммунореактивного инсулина, холестерина, липопротеидов высокой плотности (ЛПВП), триглицеридов в венозной крови. Если у больного выявляют дислипидемию и нарушение толерантности к глюкозе или изменение уровня иммунореактивного инсулина, то вводят препарат дибикор в дозе 500 мг в сутки в течение трех месяцев. Если у больного выявляют дислипидемию и оба указанных нарушения, то вводят дибикор в дозе 1000 мг в сутки в течение трех месяцев. Если у больного имеется избыточная масса тела с ИМТ в диапазоне от 27 до 29,9 условных единиц и по данным биоимпедансметрии процент активной клеточной массы (АКМ) составляет от 45 до 55 процентов, то вводят препарат диетресса в дозе 1 таблетке 3-4 раза в день в течение трех-шести месяцев. Если у больного имеется избыточная масса тела с ИМТ от 27 до 29,9 условных единиц и АКМ составляет менее 45 процентов или более 55 процентов, то вводят препарат диетресса в дозе по 2 таблетки 3-4 раза в день в течение трех-шести месяцев. Если у больного имеются нарушения сна легкой и средней степени выраженности, эмоциогенный тип пищевого поведения в сочетании с аффективными расстройствами легкой степени выраженности, то вводят антидепрессант вальдоксан по 25 мг в сутки однократно на ночь в течение двух недель. Отслеживают динамику по уровню тревоги и депрессии через две недели после начала лечения, если динамика положительная, то дозу вальдоксана в 25 мг сохраняют до конца курса терапии в течение от трех до шести месяцев. Если динамика отсутствует, то дозу увеличивают до 50 мг в сутки и продолжают лечение в течение от четырех до восьми месяцев. Если у больного имеются нарушения сна высокой степени выраженности, эмоциогенный тип пищевого поведения в сочетании с аффективными расстройствами средней степени выраженности, то вводят антидепрессант вальдоксан по 50 мг однократно на ночь в течение двух-трех месяцев. Способ позволяет в каждом конкретном случае ускорить купирование клинических симптомов, в т.ч. снизить массу жировой ткани и нормализовать содержание активной клеточной массы и воды, нормализовать суточные ритмы вегетативного баланса, а также удлинить период ремиссии. 3 табл., 2 пр.
Изобретение относится к медицине, а именно к хирургии, и может быть использовано при лечении больных с разлитым перитонитом. Сущность изобретения заключается в том, что выполняют лапаротомию при перитоните, берут экссудат из брюшной полости, определяют pH этого экссудата. При значении pH экссудата 6,5 и менее констатируют, что в экссудате присутствует анаэробная флора, и на основании этого ставят показания к программированной санационной релапаротомии. Заявленный способ позволяет быстро, точно и объективно ставить показания к программированной санационной релапаротомии. 1 пр.
Изобретение относится к медицине, в частности к биохимии. Способ осуществляют следующим образом. Из пробы крови эритроциты отмывают физиологическим раствором, после чего центрифугируют, затем экстрагируют смесью хлороформ-метанол, взятых в соотношении 1:2, при этом периодически встряхивают, а соотношение проба:экстрагент составляет 0,1:2,0. Далее экстракт эритроцитов и стандарты фосфатидилхолина и фосфатидилэтаноламина наносят на хроматографическую пластинку с сорбентом сорбфил ПТСХ-АФ-А-УФ, которую помещают в хроматографическую камеру с элюентом состава - хлороформ:метанол:ледяная уксусная кислота:вода, взятых в соотношении 60:50:1:4. Через 10-15 минут хроматографическую пластинку извлекают, высушивают и затем проявляют в парах йода. По длине пробега пятен пробы в сравнении с длиной пробега пятен стандартов идентифицируют фосфатидилхолин и фосфатидилэтаноламин в пробе. При превышении размера пятна фосфатидилэтаноламина по сравнению с пятном фосфатидилхолина устанавливают нарушение структуры мембраны эритроцитов. Способ позволяет установить нарушение структуры мембраны эритроцита, что дает возможность улучшить диагностику заболевания на клеточном уровне и осуществлять контроль за эффективностью проводимого лечения. 3 пр., 1 табл.
Наверх