Маркеры риска сердечно-сосудистого заболевания

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения наличия у пациента повышенного риска обладания сердечно-сосудистым заболеванием или нарушением по полиморфным вариантам генов. Предложен способ идентификации пациента, который нуждается в ранней и/или агрессивной или профилактической терапии сердечно-сосудистого заболевания и способ лечения такого пациента. Предложенная группа изобретений обеспечивает эффективные способы и наборы для определения риска обладания сердечно-сосудистым заболеванием, что позволяет идентифицировать пациента, который нуждается в терапии сердечно-сосудистого заболевания. 4 н. и 6 з.п. ф-лы, 4 ил., 18 табл., 1 пр.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к области сердечно-сосудистых заболеваний или нарушений. Более конкретно, оно относится к маркерам и способам для определения того, подвержен ли пациент, в частности, человек, риску развития сердечно-сосудистого заболевания, обладает ли сердечно-сосудистым заболеванием или испытывает ли осложнение сердечно-сосудистого заболевания. Настоящее изобретение также относится к применению таких маркеров и способов для мониторинга состояния сердечно-сосудистого риска и/или заболевания у пациента или эффекта профилактических и/или терапевтических мер/средств у пациентов с сердечно-сосудистым риском или сердечно-сосудистым заболеванием.

ТЕХНИЧЕСКИЕ ПРЕДПОСЫЛКИ

Сердечно-сосудистое заболевание (CVD) представляет собой термин, обозначающий заболевания сердца и кровеносных сосудов, включая, среди прочего, ишемическую болезнь сердца (которая является наиболее распространенным типом CVD в промышленно развитых странах; это нарушение относится к проблемам циркуляции крови в сердечной мышце), церебро-васкулярное заболевание (относится к проблеме циркуляции крови в кровеносных сосудах мозга), заболевание периферических сосудов (поражает циркуляцию, прежде всего, в нижних конечностях). У пациентов с CVD может происходить развитие многих осложнений (далее в настоящем документе обозначаемых как осложнения CVD), включая в качестве неограничивающих примеров инфаркт миокарда, инсульт, стенокардию, транзиторные ишемические атаки, застойную сердечную недостаточность, аневризму аорты и смерть.

The Framingham Heart Study (Kamel WB et al. Am J Cardiol 1988; 62: 1109-1112, Wilson PWF et al., Circulation 1988; 97: 1837-1847, Grundy S.M. et al. Circulation 1988; 97: 1876-1887) выполнили первое исследование в развитии концепции факторов риска, которое принято на сегодняшний день и широко используется. Выявлено несколько независимых факторов риска, которые являются непосредственной причиной коронарной болезни и представляют собой частые факторы в популяции, а их модификация снижает риск коронарных (т.е. сердечно-сосудистых) приступов (Grundy S.C. et al., Circulation 2000; 101: e3-e11). Основными модифицируемыми факторами риска являются курение, высокое кровяное давление, гиперхолестеринемия (в частности, высокий ЛНП-холестерин) и сахарный диабет (Circulation 2000; 101: e3-e11).

Важна адаптация всех действий в соответствии с абсолютным риском (вероятностью того, что у пациента разовьется коронарная болезнь в определенный период времени), поскольку это позволяет достичь подходящего баланса между эффективностью, безопасностью и стоимостью терапии. Для оценки абсолютного риска нужно прибавлять вклад каждого фактора риска, а результат представляет собой «определение глобального риска». В Framingham Heart Study, как указано выше, осуществляли количественную оценку глобального риска на основе вклада каждого фактора риска, которые служили другим Обществам для развития других алгоритмов для других популяций. Заболеваемость и возникновение сердечно-сосудистых заболеваний в Европе значительно отличается от США, и сообщалось, что фрамингемская шкала переоценивает сердечно-сосудистый риск в европейской популяции (Moreno J et al., Rev Med Univ Navarra 2005; 49: 109-115). По этой причине разработаны две шкалы для оценки сердечно-сосудистого риска в Европе: шкала PROCAM, по которой оценивают риск сердечно-сосудистых осложнений (Assman G et al., Circulation 2002;105:310-315) и SCORE Project (Conroy R.M. et al., Eur Heart J 2003;24:987-1003), по которой оценивают риск сердечно-сосудистой смерти.

Однако, несмотря на все попытки, предпринятые для оценки риска, и вопреки рекомендациям по оценке глобального сердечно-сосудистого риска у всех пациентов, значительное число сердечно-сосудистых приступов возникает у бессимптомных пациентов с промежуточным риском согласно инструментам для оценки риска (Circulation 2001; 104: 1863-1867).

Пациенты с промежуточным риском получат значительную пользу от использования дополнительных тестов, которые позволяют осуществлять более точную стратификацию их риска (Circulation 2001; 104: 1863-1867, Am J Cardiol 2006; 97 [Suppl]: 28A-32A).

В нескольких исследованиях выявлены генетические маркеры, которые ассоциированы с риском заболевания CVD. В частности, опубликованы три исследования, в которых проводили анализ улучшения предсказательных и дискриминационных способностей классических функций риска при включении генетической информации. В первом исследовании, опубликованном исследователями Morrison et al. (Am J Epidemiol. 1 июля 2007 года; 166(1): 28-35), с последующим наблюдением более чем 15000 участников исследования ARIC, в этой когорте сконструировали шкалу генетического риска, которая включает 11 полиморфизмов. Однако эта функция не улучшает способность к дискриминации классических факторов риска (происходило лишь небольшое увеличение площади под кривой ROC от 0,764 до 0,766).

Во втором исследовании, опубликованном исследователями Kathiresan et al. (N Engl J Med. 20 марта 2008 года; 358(12): 1240-9), также использовали функцию генетического риска, включающую 9 полиморфизмов, связанных с липидным метаболизмом, также на основе числа аллелей риска у каждого пациента. Эту функцию генетического риска независимо связывали с появлением сердечно-сосудистых приступов в когорте Malmo. Хотя такая расстановка не улучшала способность к дискриминации классических факторов риска (площадь под кривой ROC составляла 0,8 с использованием генетической информации и без нее), она улучшала переклассификацию.

В третьей и самой новой публикации проводили исследование в когорте американских медицинских сестер. Включение генетической изменчивости в хромосоме 9p21.3 не улучшала ни способность к дискриминации (площадь под кривой ROC от 0,807 до 0,809) ни переклассификацию индивидуумов по отношению к тому, что получено с использованием классических факторов риска (Ann Intern Med. 20 января 2009 года; 150(2): 65-72). Следовательно, вопреки нескольким попыткам, предпринятым для улучшения предсказательной мощности CVRF, эта цель все еще не достигнута.

Таким образом, существует необходимость новых маркеров, включая новые генетические маркеры и их сочетания, которые позволяют успешно и эффективно предсказывать, кто имеет более высокий риск развития классических сердечно-сосудистых факторов риска таким образом, чтобы можно было реализовать профилактические меры для удержания сердечно-сосудистого риска на наиболее низком возможном уровне.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

В первом аспекте изобретение относится к способу определения наличия у пациента повышенного риска обладания нежелательного сердечно-сосудистого заболевания или нарушения или определения ответа на терапию сердечно-сосудистого заболевания у пациента, включающему в себя стадии определения в образце, выделенном у указанного пациента, присутствия полиморфизмов в положениях 27 в последовательностях нуклеиновой кислоты SEQ ID NO:1-11, где присутствие C в SEQ ID NO:1, A в SEQ ID NO:2, C в SEQ ID NO:3, T в SEQ ID NO:4, C в SEQ ID NO:5, A в SEQ ID NO:6, T в SEQ ID NO:7, C в SEQ ID NO:8, C в SEQ ID NO:9, T в SEQ ID NO:10 и T в SEQ ID NO:11 в положении 27 указывает на повышенный риск обладания нежелательным сердечно-сосудистым заболеванием или нарушением или на слабый ответ на терапию сердечно-сосудистого заболевания.

Изобретение дополнительно относится к способу идентификации пациента, который нуждается в ранней и/или агрессивной терапии сердечно-сосудистого заболевания или в профилактической терапии сердечно-сосудистого заболевания, включающему в себя стадии определения в образце, выделенном у указанного пациента, присутствия по меньшей мере в одном аллеле полиморфизмов в положениях 27 в последовательностях нуклеиновой кислоты SEQ ID NO:1-11, где присутствие C в SEQ ID NO:1, A в SEQ ID NO:2, C в SEQ ID NO:3, T в SEQ ID NO:4, C в SEQ ID NO:5, A в SEQ ID NO:6, T в SEQ ID NO:7, C в SEQ ID NO:8, C в SEQ ID NO:9, T в SEQ ID NO:10 и T в SEQ ID NO:11 в положении 27 указывает на обладание пониженным ответом на терапию сердечно-сосудистого заболевания или на потребность в ранней и агрессивной терапии сердечно-сосудистого заболевания или потребность в профилактическом лечении сердечно-сосудистого заболевания.

В другом аспекте изобретение относится к способу лечения пациента, страдающего сердечно-сосудистым заболеванием, с использованием терапии сердечно-сосудистого заболевания, где пациента выбирают для указанной терапии на основе присутствия в образце, выделенном у указанного пациента, полиморфизма в положении 27 в нуклеотидных последовательностях SEQ ID NO:1-11, где указанный полиморфизм в указанном положении 27 соответствует C в SEQ ID NO:1, A в SEQ ID NO:2, C в SEQ ID NO:3, T в SEQ ID NO:4, C в SEQ ID NO:5, A в SEQ ID NO:6, T в SEQ ID NO:7, C в SEQ ID NO:8, C в SEQ ID NO:9, T в SEQ ID NO:10 и T в SEQ ID NO:11. В дополнительных аспектах изобретение относится к способам определения вероятности присутствия у индивидуума фатального или нефатального инфаркта миокарда или стенокардии в течение 10 лет на основе присутствия одного или нескольких указанных выше полиморфизмов в сочетании с одним или несколькими стандартными факторами риска, где относительный вклад каждого полиморфизма или фактора риска в вероятность корректируют с использованием отношений рисков.

В дополнительном аспекте изобретение относится к компьютерной программе или машиночитаемому носителю, который содержит средство для осуществления любого из способов по изобретению.

В еще одном дополнительном аспекте изобретение относится к набору, содержащему реактивы для определения идентичности нуклеотида в положении 27 и последовательности нуклеиновой кислоты, выбранной из группы из SEQ ID NO:1-11.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Авторы настоящего изобретения идентифицировали ряд маркеров однонуклеотидного полиморфизма (SNP), которые при использовании в сочетании ассоциированы с риском CVD и/или с риском осложнений CVD, включая в качестве неограничивающих примеров инфаркт миокарда, инсульт, стенокардию, транзиторные ишемические атаки, застойную сердечную недостаточность, аневризму аорты и смерть. По-видимому, эти полиморфные маркеры показывают предсказательное значение независимо классических факторов риска, таких как высокие уровни ЛНП и ЛОНП, привычка к курению, низкие уровни ЛВП, высокие уровни липопротеина A, гипертензия, диабет, высокие уровни гомоцистеина, высокие уровни гемостатических факторов, метаболический синдром, резистентность к инсулину, семейный анамнез и т.п. и превосходят полиморфизмы, используемые по отдельности, или стандартные факторы сердечно-сосудистого риска.

СПОСОБ ОПРЕДЕЛЕНИЯ У ПАЦИЕНТА ИЗМЕНЕННОГО РИСКА ОБЛАДАНИЯ НЕЖЕЛАТЕЛЬНЫМ СЕРДЕЧНО-СОСУДИСТЫМ ЗАБОЛЕВАНИЕМ

В первом аспекте изобретение относится к способу (далее в настоящем документе первый способ по изобретению) определения у пациента измененного риска обладания нежелательным сердечно-сосудистым заболеванием или нарушением или определения ответа на терапию сердечно-сосудистого заболевания у пациента, включающему в себя стадии определения в образце, выделенном у указанного пациента, идентичности нуклеотида в положении 27 и последовательности нуклеиновой кислоты, выбранной из группы SEQ ID NO:1-11 (смотрите таблицу 1), где присутствие C в SEQ ID NO:1, A в SEQ ID NO:2, C в SEQ ID NO:3, T в SEQ ID NO:4, C в SEQ ID NO:5, A в SEQ ID NO:6, T в SEQ ID NO:7, C в SEQ ID NO:8, C в SEQ ID NO:9, T в SEQ ID NO:10 и/или T в SEQ ID NO:11 в положении 27 указывает на повышенный риск обладания нежелательным сердечно-сосудистым заболеванием или нарушением или на слабый ответ на терапию сердечно-сосудистого заболевания.

Термины «полиморфизм» и «однонуклеотидный полиморфизм» (SNP) используют в настоящем документе взаимозаменяемо и относятся к изменчивости нуклеотидной последовательности, которая возникает, когда один нуклеотид в геноме или другой родственной последовательности различается между членами вида или между спаренными хромосомами у индивидуума. SNP также можно обозначать как мутацию с низкой аллельной частотой, превышающей приблизительно 1% в определенной популяции. Однонуклеотидные полиморфизмы по настоящей заявке могут попадать в кодирующие последовательности генов, некодирующие участки генов или интронные участки между генами.

Список полиморфизмов, которые используют в способе по настоящему изобретению, приведен в таблице 1.

Таблица 1
Полиморфизмы, используемые в способе по изобретению, включая SEQ ID NO: последовательности, фланкирующие полиморфизм, и полиморфные положения (подчеркнуты), номер доступа в dbSNP, хромосому и положение в хромосоме, где обнаружен полиморфизм и сборка и номер доступа базы данных для последовательности хромосомного фрагмента
SEQ ID NO: Последовательность, содержащая полиморфизм Номер доступа dbSNP Аллель риска Хромосома Положение в хромосоме Цепь Номер доступа/сборка
1 rs1333049 С 9 22063860 + АС_000052/03.03.2008
2 rs599839 А 1 109623689 + NС_000001/03.03.2008
3 rs17465637 С 1 196042601 + АС_000044/03.03.2008
4 rs501120 Т 10 40757334 + АС_000053/03.03.2008
5 rs2943634 С 2 220837297 + АС_000045/03.03.2008
6 rs6922269 А 6 151294678 + NС_000006/03.03.2008
7 rs9982601 Т 21 20798690 + АС_000064/03.03.2008
8 rs12526453 С 6 14155621 + АС_000049/03.03.2008
9 rs6725887 С 2 197498571 + АС_000045/03.03.2008
10 rs9818870 Т 3 136547031 + АС_000046/03.03.2008
11 rs3184504 Т 12 111511042 АС_000055/03.03.2008

Следующий вариант осуществления таблицы 1A является особенно предпочтительным.

Термин «определение у пациента измененного риска» в настоящем документе относится к оценке вероятности, в соответствии с которой пациент будет страдать заболеванием. Термин «определение ответа на терапию сердечно-сосудистого заболевания» в настоящем документе относится к оценке вероятности ответа пациента на терапию. Специалисты в данной области поймут, что такая оценка, несмотря на то, что она предпочтительна, в целом может быть не корректной для 100% пациентов, подлежащих диагностированию или оценке. Однако термин подразумевает, что у статистически значимой части пациентов можно идентифицировать повышенный риск или способность к ответу на терапию. Специалист в данной области без дополнительных усилий может определить, является ли часть статистически значимой, используя различные хорошо известные инструменты статистической оценки, например, определение доверительных областей, определение значения p, критерий Стьюдента, критерий Манна-Уитни и т.д. Подробности можно найти в Dowdy and Wearden, Statistics for Research, John Wiley & Sons, New York 1983. Предпочтительные доверительные области составляют по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 80%, по меньшей мере 90%, по меньшей мере 95%. Значения p предпочтительно составляют 0,2, 0,1 или 0,05.

Термин «сердечно-сосудистое заболевание или нарушение» в настоящем документе включает заболевания, поражающие сердце или кровеносные сосуды, или и то и другое, или связанные с кардиопульмонарной и кровеносной системой, включая в качестве неограничивающих примеров ишемию, стенокардию, отечные состояния, атеросклероз, коронарное заболевание сердца, окисление ЛНП, адгезию моноцитов к клеткам эндотелия, формирование пенистых клеток, развитие жировых прожилок, прилипание и агрегация тромбоцитов, пролиферацию гладкомышечных клеток, реперфузионное повреждение, высокое кровяное давление, тромбоз, аритмию (предсердную и/или желудочковую); нарушения сердечного ритма; ишемию миокарда; инфаркт миокарда; аневризму сердца или сосуда; васкулит, инсульт; периферическую обструктивную артериопатию конечности, органа или ткани; реперфузионное повреждение после ишемии мозга, сердца или другого органа или ткани, эндотоксический, хирургический или травматический шок; гипертензию, порок клапана сердца, сердечную недостаточность, атипичное кровяное давление; шок; вазоконстрикцию (включая связанную с мигренями); сосудистые аномалии, воспаление, недостаточно ограниченные одним органом или тканью. В предпочтительном варианте осуществления сердечно-сосудистое заболевание, риск которого подлежит определению, выбирают из группы инфаркта миокарда, инсульта, стенокардии, транзиторных ишемических атак, застойной сердечной недостаточность, аневризмы аорты или их сочетания.

Термин «терапия сердечно-сосудистого заболевания» в настоящем документе относится к любому типу лечения, который ведет к улучшению или снижает риск наступления любого указанного выше сердечно-сосудистого заболевания. Терапевтические средства, подходящие для использования в настоящем изобретении, без ограничения включают антикоагулянты, антитромбоцитарные средства, тромболитические средства, антитромботические, антиаритмические средства, средства, которые пролонгируют реполяризацию, антигипертензивные средства, вазодилататоры, антигипертензивные средства, диуретики, инотропные средства, антиангинальные средства и т.п.

Неограничивающие примеры антикоагулянтов включают аценокумарол, анкрод, анизиндион, броминдион, хлориндион, куметарол, циклокумарол, декстрансульфат натрия, дикумарол, дифенадион, этилбискумацетат, этилиден дикумарол, флуиндион, гепарин, гирудин, лиаполат натрия, оксазидион, пентозан полисульфат, фениндион, фенпрокумон, фосвитин, пикотамид, тиокломарол и варфарин. Неограничивающие примеры антитромбоцитарных средств включают аспирин, декстран, дипиридамол (персантин), гепарин, фульфинпиранон (антуран), кропидрогел и тиклопидин (тиклид). Неограничивающие примеры тромболитических средств включают тканевой активатор плазминогена (активазу), плазмин, проурокиназу, урокиназу (аббокиназу) стрептокиназу (стрептазу), антистреплазу/APSAC (эминазу).

В некоторых вариантах осуществления, где пациент страдает кровотечением или повышенной вероятностью кровотечения, можно использовать средство, которое может усиливать свертывание крови. Неограничивающие примеры способствующих свертыванию крови средств включают антагонисты тромболитических средств и антагонисты антикоагулянтов. Неограничивающие примеры антагонистов антикоагулянтов включают протамин и витамин K1.

Неограничивающие примеры антагонистов тромболитических средств включают аминокапроновую кислоту (амикар) и транексамовую кислоту (амстат). Неограничивающие примеры антитромботических средств включают анагрелид, аргатробан, цилстазол, далтробан, дефибртид, эноксапарин, фраксипарин, индобуфен, ламопаран, азагрел, пикотамид, плафибрид, детелпарин, тиклопидин и трифлузал. Неограничивающие примеры антиаритмических средств включают антиаритмические средства класса I (блокаторы натриевых каналов), антиаритмические средства класса II (блокаторы β-адренергических рецепторов), антиаритмические средства класса III (лекарственные средства, продлевающие реполяризацию), антиаритмические средства класса IV (блокаторы кальциевых каналов) и смешанные антиаритмические средства.

Неограничивающие примеры блокаторов натриевых каналов включают антиаритмические средства класса IA, класса IB и класса IC. Неограничивающие примеры антиаритмических средств класса IA включают диспирамид (норпейс), прокаинамид (пронестил) и хинидин (хинидекс). Неограничивающие примеры антиаритмических средств класса IB включают лидокаин (ксилокаин), токаинид (тонокард) и мексилетин (мекситил). Неограничивающие примеры антиаритмических средств класса IC включают энкаинид (энкаид) и фиекаинид (тамбокор).

Неограничивающие примеры β-блокаторов, которые иначе известны как блокаторы β-адренергических рецепторов, антагонисты β-адренергических рецепторов или антиаритмические средства класса II, включают ацебутолол (сектрал), алпренодол, амосулалол, аротинолол, атенолол, бефунолол, бетаксолол, бевантолол, биопролол, бопиндолол, букумолол, буфетолол, буфуралол, бунитролол, бупранолол, бутидрин гидрохлорид, бутофилолол, каразолол, картеолол, карведилол, целипролол, цетамолол, клоранолол, дилевалол, эпанолол, эсмолол (бревиблок), инденолол, лабеталол, левобунолол, мепиндолол, метипранолол, метопролол, мопролол, надолол, надоксолол, нифеналол, инпрадилол, окспренолол, пенбутолол, пиндолол, практолол, пронеталол, пропанолол (индерал), соталол (бетапейс), сульфиналол, талинолол, тетратолол, тимолол, толипролол и ксибинолол. В определенных вариантах осуществления β-блокатор содержит производное арилоксипропаноламина. Неограничивающие примеры производных арилоксипропаноламина включают ацебутолол, алпренодол, аротинолол, атенолол, бетаксолол, бевантолол, биопролол, бопиндолол, бунитролол, бутофилолол, каразолол, картеолол, карведилол, целипролол, цетамолол, эпанолол, инденолол, мепиндолол, метипранолол, метопролол, мопролол, надолол, инпрадилол, окспренолол, пенбутолол, пиндолол, пропанолол, талиπолол, тетратолол, тимолол и толипролол.

Неограничивающие примеры средств с гиполипемическими способностями без ограничения включают секвестранты желчных кислот, такие как четверичные амины (например, холестирамин и колестипол); никотиновую кислоту и ее производные; ингибиторы ГМГ-КоА редуктазы, такие как мевастатин, правастатин и симвастатин; гемфиброзил и другие фиброевые кислоты, такие как клофибрат, фенофибрат, бензафибрат и ципофибрат; пробукол; ралоксифен и их производные.

Неограничивающие примеры средств, которые продлевают реполяризацию, также известных как антиаритмические средства класса III, включают амиодарон (кордарон) и соталол (бетапейс).

Неограничивающие примеры блокаторов кальциевых каналов, которые иначе известны как антиаритмические средства класса IV, включают арилалкиламин (например, бепридил, дилтиазем, фендилин, галлопамил, прениламин, теродилин, верапамил), производные дигидропиридина (фелодипин, исрадипин, никардипин, нифедипин, нимодипин, нисолдипин, нитрендипин), производные пиперазинида (например, циннаризин, флунаризин, лидофлазин) или смешанные блокаторы кальциевых каналов, такие как бенциклан, этафенон, магний, мибефрадил или пергексиллин. В определенных вариантах осуществления блокатор кальциевых каналов содержит дигидропиридиновый (нифедипинового типа) антагонист кальция длительного действия.

Неограничивающие примеры смешанных антиаритмических средств включают аденозин (аденокард), дигоксин (ланоксин), ацекаинид, аймалин, амопроксан, априндин, бретилий тозилат, бунафтин, бутобендин, капобеновую кислоту, цифенлин, дизопиранид, гидрохинидин, индекаинид, ипатропий бромид, лидокаин, лораймин, лоркаинид, меобентин, морицизин, пирменол, праймалин, профафенон, пиринолин, хинидин полигалактуронат, хинидин сульфат и виквидил.

Неограничивающие примеры антигипертензивных средств включают симпатолитические средства, α/β-блокаторы, α-блокаторы, средства против ангиотензина II, β-блокаторы, блокаторы кальциевых каналов, сосудорасширяющие средства и смешанные антигипертензивные средства.

Неограничивающие примеры α-блокаторов, также известных как блокаторы α-адренергических рецепторов или антагонисты α-адренергических рецепторов, включают амосулалол, аротинолол, дапипразол, доксазозин, мезилаты эрголоида, фенспирид, индорамин, лабеталол, ницерголин, празозин, теразозин, толазолин, тримазозин и ехимбин. В определенных вариантах осуществления блокатор может содержать производные хиназолина. Неограничивающие примеры производных хиназолина включают альфузозин, буназозин, доксазозин, празозин, теразозин и тримазозин. В определенных вариантах осуществления антигипертензивное средство является антагонистом как α-, так и β-адренергических рецепторов. Неограничивающие примеры α-/β-блокаторов содержат лабеталол (нормодин, трандат).

Неограничивающие примеры средств против ангиотензина II включают ингибиторы ангиотензинпревращающего фермента и антагонисты рецепторов ангиотензина II. Неограничивающие примеры ингибиторов ангиотензинпревращающего фермента (ингибиторов АПФ) включают алацеприл, эналаприл (вазотек), каптоприл, цилазаприл, делаприл, эналаприлат, фозиноприл, лизиноприл, мовелтоприл, периндоприл, хинаприл и рамиприл. Неограничивающие примеры блокаторов рецепторов ангиотензин II, также известных как антагонисты рецепторов ангиотензин II, блокаторы рецепторов ANG или блокаторы рецепторов ANG-II типа 1 (ARBS), включают ангиокандесартан, эпросартан, ирбесартан, лозартан и валсартан. Неограничивающие примеры симпатолитических средств включают симпатолитические средства центрального действия или симпатолитические средства периферического действия. Неограничивающие примеры симпатолитических средств центрального действия, также известных как симпатолитические средства, действующие на центральную нервную систему (ЦНС), включают клонидин (катапрес), гуанабенз (витензин), гуанфацин (тенекс) и метилдопа (альдомет). Неограничивающие примеры симатолитических средств периферического действия включают блокирующие ганглии средства, адренергические блокирующие нейроны средства, блокирующие β-адренергические рецепторы средства или блокирующие α-адренергические рецепторы средства. Неограничивающие примеры блокирующих ганглии средств включают мекамиламин (инверсин) и триметафан (арфонад). Неограничивающие примеры адренергических блокирующих нейроны средств включают гуанетидин (исмелин) и резерпин (серпазил). Неограничивающие примеры блокаторов β-адренергических рецепторов включают аценитолол (сектрал), атенолол (тенормин), бетаксолол (керлон), картеолол (картрол), лабеталол (нормодин, трандат), метопролол (лопрессор), наданол (коргард), пенбутолол (леватол), пиндолол (вискен), пропранолол (индерал) и тимолол (блокадрен). Неограничивающие примеры α-адренергических блокаторов включают празосин (минипресс), доксазоцин (кардура) и теразозин (гитрин).

В определенных вариантах осуществления средство для лечения сердечно-сосудистых заболеваний может содержать вазодилататор (например, церебральный вазодилататор, коронарный вазодилататор или периферический вазодилататор). В определенных предпочтительных вариантах осуществления вазодилататор содержит коронарный вазодилататор. Неограничивающие примеры коронарных вазодилататоров включают амотрифен, бендазол, гемисукцинат бенфуродила, бензиодарон, хлорацизин, хромонар, клобенфурол, клонитрат, дилазеп, дипиридамол, дропрениламин, эфлоксат, эритритилтетранитран, этафенон, фендилин, флоредил, ганглефен, бис-β-диэтиламиноэтиловый эфир герестрола, гексобендин, тозилат итрамина, кхеллин, лидофланин, гексанитрат маннита, медибазин, никорглицерин, тетранитрат пентаэритритола, пентринитрол, пергексилин, пимефиллин, трапидил, трикромил, триметазидин, фосфат тролнитрата и виснадин.

В определенных вариантах осуществления вазодилататор может содержать вазодилататор для продолжительной терапии или гипертензивный вазодилататор для неотложной помощи. Неограничивающие примеры вазодилататоров для продолжительной терапии включают гидралазин (апрезолин) и миноксидил (лонитен). Неограничивающие примеры гипертензивных вазодилататоров для неотложной помощи включают нитропруссид (ниприд), диазоксид (гиперстат IV), гидралазин (апрезолин), миноксидил (лонитен) и верапамил.

Неограничивающие примеры смешанных антигипертензивных средств включают аймалин, γ-аминомасляную кислоту, буфениод, циклетаинин, циклозидомин, таннат криптенамина, фенолдопам, флозехинан, кетансерин, мебутамат, мекамиламин, метилдопа, метил-4-пиридилкетонтиосемикарбазон, музолимин, паргилин, пемпидин, пинацидил, пипероксан, примаперон, протовератрин, раубазин, ресциметол, рилмениден, саралазин, нитроруссид натрия, тикринафен, камзилат триметафана, тирозиназа и урапидил. В определенных вариантах осуществления антигипертензивные средства могут содержать производное арилэтаноламина, производное бензотиадиазина, производное N-карбоксиалкил(пептида/лактама), производное дигидропиридина, производное гуанидина, гидразин/фталазин, производное имидазола, соединение четвертичного аммония, производное резерпина или производное сульфонамида. Неограничивающие примеры производных арилэтаноламина включают амосулалол, буфуралол, дилевалол, лабеталол, пронеталол, соталол и сульфиналол. Неограничивающие примеры производных бензотиадиазина включают алтизид, бендрофлуметиазид, бензтиазид, бензилгидрохлортиазид, бутиазид, хлортиазид, хлорталидон, циклопентиазид, циклотиазид, диазоксид, эпитиазид, этиазид, фенхизон, гидрохлортизид, гидрофлуметизид, метилклотиазид, метикран, метолазон, парафлутизид, политизид, тетрахлорметиазид и трихлорметиазид. Неограничивающие примеры производных N-карбоксиалкил(пептида/лактама) включают алацеприл, каптоприл, цилазаприл, делаприл, эналаприл, эналаприлат, фозиноприл, лизиноприл, мовелтиприл, периндоприл, хинаприл и рамиприл. Неограничивающие примеры производных дигидропиридина включают амлодипин, фелодипин, исрадипин, никардипин, нифедипин, нилвадипин, низолдипин и нитрендипин. Неограничивающие примеры производных гуанидина включают бетанидин, дебризохин, гуанабенз, гуанаклин, гуанадрел, гуаназодин, гуантидин, гуанфацин, гуанохлор, гуаноксабенз и гуаноксан. Неограничивающие примеры гидразинов/фталазинов включают будралазин, кадралазин, дигидралазин, эндралазин, гидракарбазин, гидралазин, фенипразин, пилдралазин и тодралазин. Неограничивающие примеры производных имидазола включают клонидин, лофексидин, фентоламин, тиаменидин и толонидин. Неограничивающие примеры соединений четверичного аммония включают бромид азаметония, хлорид хоризондамина, гексаметоний, бисметилсульфат пентациния, бромид пентаметония, тартрат пентолиния, хлорид фенактропиния и метосульфат триметидиния. Неограничивающие примеры производных резерпина включают биетазерпин, десерпидин, ресциннамин, резерпин и сиросингопин. Неограничивающие примеры производных сульфонамида включают амбузид, клопамид, фуросемид, индапамид, хинетазон, трипамид и ксипамид. Сосудосуживающие средства как правило используют для повышения кровяного давления при шоке, который может произойти во время хирургической операции. Неограничивающие примеры сосудосуживающих средств, также известных как гипертензивные средства, включают метилсульфат амезиния, амид ангиотензина, диметофрин, допамин, этифелмин, этилефрин, гепефрин, метараминол, мидодрин, норэпинефрин, фоледрин и синефрин. Неограничивающие примеры средств для лечения застойной сердечной недостаточности включают средства против ангиотензина II, лекарственные средства, уменьшающие постнагрузку-преднагрузку на сердце, диуретики и инотропные средства.

В определенных вариантах осуществления животное-пациент, например, человек, которое не переносит лечения антагонистом ангиотензина, может быть подвергнуто комбинированной терапии. Такая терапия может объединять введение гидралазина (апресолина) и динитрата изосорбида (изордила, сорбитрата).

Неограничивающие примеры диуретиков включают производное тиазида или бензотиадиазина (например, алтиазид, бендрофлуметазид, бензтиазид, бензилгидрохлортиазид, бутиазид, хлортиазид, хлорталидон, циклопентиазид, эпитиазид, этиазид, фенхизон, гидрохлортиазид, гидрофлуметазид, метилклотиазид, метикран, метолазон, парафлутизид, политизид, тетрахлорметиазид, трихлорметиазид), ртутьорганические соединения (например, хлормеродрин, мераллурид, меркамфамид, натрий меракптомерин, меркумаллиловая кислота, меркуматиллиндодий, хлорид ртути, мерсалил), птеридин (например, фуртерен, триамтерен), пурины (например, ацефиллин, 7-морфолинометилтеофиллин, памобром, протеобромин, теобромин), стероиды, включая антагонисты альдостерона (например, канренон, олеандрин, спиронолактон), производное сульфонамида (например, ацетазоламид, амбузид, азосемид, буметанид, бутазоламид, хлораминофенамид, клофенамид, клопамид, клорексолон, дифенилметан-4,4'-дисульфонамид, дисульфамид, этоксзоламид, фуросемид, индапамид, мефрузид, метазоламид, пиретанид, хинетазон, торасемид, трипамид, ксипамид), производное урацила (например, аминометрадин, амизометрадин), калий-истощающий антагонист (например, амилорид, триамтерен) или смешанные диуретики, такие как аминозин, арбутин, хлоразанил, этакриновая кислота, этозолин, гидракарбазин, изосорбид, маннит, метохалькон, музолимин, пергексилин, тикорнафен и мочевина.

Неограничивающие примеры позитивных ионотропных средств, также известных как кардиотонические средства, включают ацефиллин, ацетилдигитоксин, 2-амино-4-пиколин, амринон, гемисукцинат бенфуродила, букладезин, церберозин, камфотамид, конваллотоксин, цимарин, денопамин, десланозид, дигиталин, алкалоид наперстянки, дигитоксин, дигоксин, добутамин, допамин, допексамин, эноксимон, эритрофлеин, феналкомин, гиталин, гитоксин, гликоциамин, гептаминол, гидрастинин, ибопамин, ланатозид, метамивам, милринон, нерифолин, олеандрин, оубаин, оксифедрин, преналтерол, просцилларидин, резибуфогенин, сцилларен, сцилларенин, строфантин, сулмазол, теобромин и ксамотерол.

В конкретных вариантах осуществления инотропное средство представляет собой сердечный гликозид, β-адренергический агонист или ингибитор фосфодиэстеразы. Неограничивающие примеры сердечных гликозидов включают дигоксин (ланоксин) и дигитоксин (кристодигин). Неограничивающие примеры агонистов β-адренергических рецепторов включают альбутерол, бамбутерол, битолтерол, карбутерол, кленбутерол, клорпреналин, денопамин, диоксетедрин, добутамин (добутрекс), допамин (интропин), допексамин, эфедрин, этафедрин, этилнорэпинефрин, фенотерол, формотерол, гексопреналин, ибопамин, изоэтарин, изопротеренол, мабутерол, метапротеренол, метоксифенамин, оксифедрин, пирбутерол, прокатерол, протокилол, репротерол, римитерол, ритодрин, сотеренол, тербуталин, третохинол, тулобутерол и ксамотерол. Неограничивающие примеры ингибиторов фосфодиэстеразы включают амринон (инокор).

Антиангинальные средства могут содержать органические нитраты, блокаторы кальциевых каналов, β-блокаторы и их сочетания. Неограничивающие примеры органических нитратов, также известных как нитровазодилататоры, включают нитроглицерин (нитробид, нитростат), динитрат изосорбида (изордил, сорбитрат) и амилнитрат (аспирол, вапорол). Эндотелин (ET) представляет собой пептид из 21 аминокислоты, обладающий мощными физиологическими и патофизиологическими эффектами, которые, по-видимому, участвуют в развитии сердечной недостаточности. Эффекты ET опосредованы взаимодействием с двумя классами рецепторов клеточной поверхности. Рецептор типа A (ET-A) связан с сужением сосудов и клеточным ростом, тогда как рецептор типа B (ET-B) связан с опосредованным эндотелиальными клетками расширением сосудов и с высвобождением других нейрогормонов, таких как альдостерон. Фармакологические средства, которые могут ингибировать или образование ET или его способность стимулировать соответствующие клетки, известны в данной области. В ингибирование образования ET вовлечено использование средств, которые блокируют фермент, называемый эндотелин-превращающим ферментом, который участвует в процессинге активного пептида из его предшественника. В ингибирование способности ET стимулировать клетки вовлечено использование средств, которые блокируют взаимодействие ET с его рецепторами. Неограничивающие примеры антагонистов рецепторов эндотелина (ERA) включают босентан, енрасентан, амбрисентан, дарусентан, тезосентан, атрасентан, авосентан, клазосентан, эдонентан, ситаксентан, TBC 3711, BQ 123 и BQ 788.

Термин «образец» в настоящем документе относится к любому образцу из биологического источника и без ограничения включает клеточные культуры или их экстракты, материал биопсии, полученный у млекопитающего, или его экстракты, и кровь, слюну, мочу, фекалии, сперму, слезы или другие жидкости организма или их экстракты.

Специалисты в данной области осознают, что анализ присутствующих нуклеотидов в соответствии со способом по изобретению в нуклеиновой кислоте индивидуума можно осуществить любым способом или методикой, которые допускают определение присутствующих нуклеотидов в полиморфном сайте. В данной области известно, что нуклеотиды, присутствующие в полиморфных маркерах, можно определить по любой цепи нуклеиновой кислоты или по обеим цепям.

После получения биологического образца у пациента (например, жидкости организма, такой как моча, слюна, плазма, сыворотка или образец ткани, такой как образец буккальной ткани или буккальные клетки) типично осуществляют определение изменчивости последовательности или аллельного варианта SNP. Используют фактически любой способ, известный специалистам в данной области. Возможно, наиболее прямой способ состоит в фактическом определении последовательности или геномной ДНК или кДНК и сравнении этих последовательностей с известными SNP аллелями гена. Это может представлять собой достаточной дорогой и долгий процесс. Тем не менее, эта технология вполне распространена и хорошо известна.

Любой из множества способов, которые существуют для определения изменчивости последовательности, можно использовать в способах по изобретению. Конкретный используемый способ не имеет значения для оценки сердечно-сосудистого риска или выбора лечения.

Существуют другие возможные коммерчески доступные способы для высокопроизводительной идентификации SNP, в которых не используют технологии непосредственного секвенирования. Например, технология Illumina's Veracode, реакции для генотипирования SNP Taqman® и реакции для генотипирования SNP KASPar.

Способом прямого определения изменчивости в последовательности является способ Gene Chip™, доступный в Affymetrix. Альтернативно, коммерчески также доступны надежные и менее дорогостоящие пути определения изменчивости последовательности ДНК. Например, в Perkin Elmer адаптировали их TAQman Assay™ для обнаружения изменчивости последовательности. Orchid BioSciences обладает способом, называемым SNP-IT (TM) (SNP-Identification Technology), в котором используют достройку праймера с использованием меченных аналогов нуклеотидов для того, чтобы определить, какой нуклеотид встречается в положении непосредственно ниже олигонуклеотидного зонда по ходу транскрипции, затем достроенное основание идентифицируют с использованием прямой флуоресценции, непрямого колориметрического анализа, масс-спектрометрии или флуоресцентной поляризации. В Sequenom используют технологию захвата гибридизацией плюс MALDI-TOF (времяпролетная масс-спектрометрия с ионизацией лазерной десорбцией с использованием матрицы) для обнаружения генотипов SNP с использованием их системы MassARRAY™. Promega предоставляет систему SNP/генотипирования READIT™ (патент США № 6159693). В этом способе ДНК или РНК зонды гибридизуют с последовательностями нуклеиновой кислоты мишени. Зонды, которые комплементарны каждому основанию последовательности-мишени, деполимеризуют с использованием патентованной смеши ферментов, тогда как зонды, которые отличаются от мишени в опрашиваемом положении, остаются интактными. В способе используют реакцию пирофосфорилирования в сочетании с обнаружением люциферазой для того, чтобы предоставить систему оценки SNP с высокой чувствительностью и адаптируемостью. Third Wave Technologies обладает способом Invader OS™, в котором используют патентованные ферменты Cleavaseg, которые распознают и расщепляют только конкретную структуру, сформированную во время процесса Invader. Invader OS основан на линейной амплификации сигнала, генерируемого процессом Invader, а не на экспоненциальной амплификации мишени. В анализе Invader OS не используют ПЦР ни в одной части анализа. Кроме того, существует множество аналитических лабораторий по тестированию ДНК и исследовательских лабораторий, которые используют геноспецифическую ПЦР с последующим расщеплением рестрикционной эндонуклеазой и электрофорезом в геле (или другой технологией разделения по размеру) для обнаружения полиморфизма длин рестрикционных фрагментов (RFLP).

В различных вариантах осуществления любого указанного выше аспекта, присутствие или отсутствие SNP идентифицируют посредством амплификации или ошибок при амплификации продукта амплификации из образца. Амплификация полинуклеотидов типично зависит от матрицы. Как правило, такая амплификация опирается на существование матричной цепи для создания дополнительных копий матрицы. Праймеры представляют собой короткие нуклеиновые кислоты, которые способны выполнять роль затравки для синтеза образующейся нуклеиновой кислоты в зависимом от матрицы процессе, которые гибридизуются с матричной цепью. Типично праймеры составляют от десяти до тридцати пар оснований в длину, но можно использовать более длинные последовательности. Праймеры можно предоставлять в двухцепочечной и/или одноцепочечной форме, несмотря на то что одноцепочечная форма, как правило, предпочтительна. Часто пары праймеров конструируют для избирательной гибридизации с конкретными участками нуклеиновой кислоты матрицы и приводят их в контакт с матрицей ДНК в условиях, которые допускают избирательную гибридизацию. В зависимости от желаемого применения, можно выбрать очень строгие условия гибридизации, которые допускают только гибридизацию с последовательностями, которые полностью комплементарны праймерам. В других вариантах осуществления гибридизация может происходить при сниженной строгости, чтобы сделать возможной амплификацию нуклеиновых кислот, содержащих одно или несколько нарушений комплементарности последовательностям праймеров. После гибридизации комплекс матрица-праймер приводят в контакт с одним или несколькими ферментами, которые содействуют синтезу нуклеиновой кислоты, зависящему от матрицы. Проводят несколько раундов амплификации, также обозначаемых как «циклы», пока не будет получено достаточное количество продукта амплификации.

Полимеразная цепная реакция

Для амплификации олигонуклеотидных последовательностей, присутствующих в данном образце матрицы доступно множество процессов, зависящих от матрицы. Одним из наиболее известных способов амплификации является полимеразная цепная реакция. В ПЦР пары праймеров, которые избирательно гибридизуются с нуклеиновыми кислотами, используют в условиях, которые допускают избирательную гибридизацию. Термин «праймер» в настоящем документе охватывает любые нуклеиновые кислоты, которые способны быть затравкой для синтеза образующейся нуклеиновой кислоты в процессе, зависящем от матрицы. Праймеры можно предоставлять в двухцепочечной или одноцепочечной форме, несмотря на то что одноцепочечная форма предпочтительна. Праймеры используют в любом из множества процессов, зависящих от матрицы, для амплификации последовательности гена-мишени, присутствующей в данном образце матрицы. Одним из наиболее известных способов амплификации является ПЦР, которая подробно описана в патентах США №№ 4683195, 4683202 и 4800159, каждый включен в настоящий документ в качестве ссылки. Для ПЦР получают две последовательности праймеров, которые комплементарны участкам на противоположных комплементарных цепях последовательности(ях) гена(ов)-мишени(ей). Праймеры будут гибридизоваться с образованием комплекса нуклеиновой кислоты:праймера, если последовательность(и) гена(ов)-мишени(ей) присутствует в образце. В реакционную смесь добавляют избыток дезоксирибонуклеозид трифосфатов вместе с ДНК полимеразой, например, полимеразой Taq, которая содействует синтезу нуклеиновой кислоты, зависящему от матрицы. Если образован комплекс последовательности(ей) гена(ов)-мишени(ей):праймера, полимераза будет достраивать праймеры вдоль последовательности(ей) гена(ов)-мишени(ей) посредством присоединения нуклеотидов. При повышении и понижении температуры реакционной смеси, достроенные праймеры и ген(ы)-мишень(и) будут диссоциировать с образованием продуктов реакции, избыток праймеров будет связываться с геном(ами)-мишенью(ями) и с продуктами реакции, и процесс повторится. Это множество раундов амплификации, обозначаемых как «циклы», проводят до тех пор, пока не будет получено достаточное количество продукта амплификации.

Перед анализом продукт амплификации можно расщеплять рестрикционным ферментом. В других вариантах осуществления любого указанного выше аспекта, присутствие или отсутствие SNP идентифицируют посредством гибридизации образца нуклеиновой кислоты с праймером, меченным поддающимся обнаружению фрагментом. В других вариантах осуществления любого указанного выше аспекта, поддающийся обнаружению фрагмент обнаруживают в ферментативном анализе, радиоизотопном анализе, иммунологическом анализе или посредством обнаружения флуоресценции. В других вариантах осуществления любого указанного выше аспекта, праймер метят поддающимся обнаружению красителем (например, SYBR Green I, YO-PRO-I, тиазол оранжевый, Hex, пико зеленый, эданс, флуоресцеин, FAM или TET). В других вариантах осуществления любого указанного выше аспекта праймеры размещают на чипе. В других вариантах осуществления любого указанного выше аспекта праймеры для амплификации обладают специфичностью к указанным SNP. Другим способом амплификации является лигазная цепная реакция («ЛЦР»). ЛЦР отличается от ПЦР, поскольку она амплифицирует молекулу зонда, а не создает ампликон посредством полимеризации нуклеотидов. Для ЛЦР две пары комплементарных зондов получают, и в присутствие последовательности-мишени каждая пара связывается с противоположными комплементарными цепями мишени так, что они примыкают друг к другу. В присутствие лигазы две пары зондов соединяют с образованием одного блока. При циклическом изменении температуры, как в ПЦР, связанные лигированные блоки и мишень диссоциируют и затем выполняют функцию «последовательностей-мишеней» для лигирования избытка паров зондов. В патенте США № 4883750, включенном в настоящий документ в качестве ссылки, описан способ, схожий с ЛЦР, для связывания пар зондов с последовательностью-мишенью.

Изотермальная амплификация

Способ изотермальной амплификации, в котором рестрикционные эндонуклеазы и лигазы используют для осуществления амплификации молекул-мишеней, которые содержат нуклеотид 5'-[[α]-тио]-трифосфаты, в одной цепи участка рестрикции, также можно использовать в амплификации нуклеиновых кислот в настоящем изобретении. В одном из вариантов осуществления используют способ петлевой изотермальной амплификации (LAMP) для типирования однонуклеотидного полиморфизма (SNP).

Амплификация замещением цепей

Амплификация замещением цепей (SDA) является другим способом осуществления изотермальной амплификации нуклеиновых кислот, в котором используют несколько раундов замещения цепей и синтеза, т.е. ник-трансляцию. Схожий способ, называемый репаративной цепной реакцией (RCR), включает ренатурацию нескольких зондов на всем протяжении участка, на который нацелена амплификация, с последующей реакцией репарации, в которой присутствуют только два из четырех оснований. Другие два основания можно добавить в виде биотинилированных производных для простоты обнаружения.

Амплификация на основе транскрипции

Другие процедуры амплификации нуклеиновых кислот включают системы амплификации на основе транскрипции, включая амплификацию на основе последовательности нуклеиновой кислоты. В амплификации на основе последовательности нуклеиновой кислоты, нуклеиновые кислоты амплификации посредством стандартной экстракции фенолом/хлороформом, тепловой денатурации клинического образца, обработку лизирующим буфером и колонок MiniSpin для выделения ДНК и РНК или экстракцию РНК хлоридом гуанидина. Эти способы амплификации включают ренатурацию праймера, который обладает последовательностью, специфичной к мишени. После полимеризации гибриды ДНК/РНК расщепляют РНКазой H, тогда как молекулы двухцепочечной ДНК снова подвергают тепловой денатурации. В любом случае одноцепочечную ДНК превращают в полностью двухцепочечную посредством добавления второго праймера со специфичностью к мишени с последующей полимеризацией. Затем молекулы двухцепочечной ДНК многократно подвергают транскрипции посредством полимеразы, такой как T7 или SP6. В изотермальной циклической реакции РНК подвергают обратной транскрипции в двухцепочечную ДНК и транскрибируют еще раз с использованием полимеразы, такой как T7 или SP6. Получаемые продукты, усеченные или полноразмерные, показывают последовательности, специфичные для мишени.

Другие способы амплификации можно использовать в соответствии с настоящим изобретением. В одном из вариантов осуществления «модифицированные» праймеры используют в синтезе, зависящем от матрицы и фермента, который похож на ПЦР. Праймеры можно модифицировать мечением с использованием захватываемого фрагмента (например, биотина) и/или обнаруживающего фрагмента (например, фермента). В присутствие последовательности-мишени происходит связывание и каталитическое расщепление зонда. После расщепления происходит высвобождение интактной последовательности-мишени, подлежащей связыванию избытком зонда. Расщепление меченного зонда сообщает о присутствии последовательности-мишени. В другом подходе процесс амплификации нуклеиновой кислоты включает циклический синтез одноцепочечной РНК («оцРНК»), оцДНК и двухцепочечной ДНК (дцДНК), которые можно использовать в соответствии с настоящим изобретением. оцРНК представляет собой первую матрицу для первого олигонуклеотидного праймера, который элонгирует обратная транскриптаза (РНК-зависимая ДНК полимераза). Затем РНК удаляют из получаемого дуплекса ДНК:РНК посредством действия рибонуклеазы H (РНКазы H - РНКазы, которая специфична к РНК в дуплексе или с ДНК или с РНК). Получаемая оцДНК представляет собой вторую матрицу для второго праймера, который также содержит последовательности промотора РНК полимеразы (например, РНК полимеразы T7) выше по ходу транскрипции относительно его гомологии с матрицей. Затем этот праймер достраивают посредством ДНК полимеразы (например, большого фрагмента Кленова ДНК полимеразы I E. coli), в результате чего получают молекулу двухцепочечной ДНК («дцДНК»), которая имеет последовательность, идентичную таковой исходной РНК между праймерами, и дополнительно на одном конце имеет последовательность промотора. Эту последовательность промотора может использовать подходящая РНК полимераза для создания множества РНК-копий ДНК. Затем эти копии могут входить обратно в цикл, что ведет к очень быстрой амплификации. При правильном выборе ферментов, эту амплификацию можно осуществлять изотермически без добавления ферментов в каждом цикле. В силу циклических свойств этого процесса, начальная последовательность может быть выбрана в форме или ДНК или РНК.

Способы отделения нуклеиновых кислот

Может быть желательным отделить продукты нуклеиновых кислот от других веществ, таких как матрица и избыток праймеров. В одном из вариантов осуществления продукты амплификации отделяют посредством электрофореза в агарозном, агарозно-акриламидном или полиакриламидном геле с использованием стандартных способов (Sambrook et al., 1989). Отделенные продукты амплификации можно вырезать и элюировать из геля для дальнейших манипуляций. Используя агарозные гели низкой температурой плавления, отделенную полосу можно удалить посредством нагревания геля с последующей экстракцией нуклеиновой кислоты. Отделение нуклеиновых кислот также можно осуществлять посредством хроматографических способов, известных в данной области. Существует множество видов хроматографии, которые можно использовать при практическом осуществлении настоящего изобретения, включая адсорбционную, распределительную, ионообменную, гидроксиапатитовую, на молекулярных ситах, с обращенной фазой, колоночную, бумажную, тонкослойную и газовую хроматографию, а также ВЭЖХ. В определенных вариантах осуществления визуализируют продукты амплификации. Типичный способ визуализации включает окрашивание геля бромистым этидием и визуализацию полос под УФ светом. Альтернативно, если продукты амплификации целиком мечены с использованием радио- или флуорометрически меченных нуклеотидов, можно подвергнуть рентгеновскую пленку воздействию отделенных продуктов амплификации или визуализировать их с использованием света, содержащего соответствующие возбуждающие спектры.

Альтернативно, присутствие полиморфных положений в соответствии со способом по изобретению можно определить посредством гибридизации или отсутствия гибридизации с подходящим зондом нуклеиновой кислоты, специфичным к полиморфной нуклеиновой кислоте, но не к нуклеиновой кислоте без мутации. Под «гибридизовать» понимают, что пара образует двухцепочечную молекулу между комплементарными полинуклеотидными последовательностями или их частями при условиях различной строгости. Например, строгая концентрация соли, как правило, составляет менее приблизительно 750 мМ NaCl и 75 мМ трицитрата натрия, предпочтительно менее приблизительно 500 мМ NaCl и 50 мМ трицитрата натрия и более предпочтительно менее приблизительно 250 мМ NaCl и 25 мМ трицитрата натрия. Гибридизацию в условиях пониженной строгости можно осуществить в отсутствие органического растворителя, например, формамида, тогда как гибридизацию в условиях повышенной строгости можно осуществить в присутствие по меньшей мере приблизительно 35% формамида, и более предпочтительно по меньшей мере приблизительно 50% формамида. Строгие температурные условия, как правило, включают температуру по меньшей мере приблизительно 30°C, более предпочтительно по меньшей мере приблизительно 37°C и наиболее предпочтительно по меньшей мере приблизительно 42°C. Специалистам в данной области хорошо известно изменение дополнительных параметров, таких как время гибридизации, концентрация детергента, например, додецилсульфата натрия (SDS), и включение или исключение носителя ДНК. При необходимости, различные уровни строгости создают посредством сочетания этих различных условий. В предпочтительном варианте осуществления гибридизация происходит при 30°C в 750 мМ NaCl, 75 мМ трицитрата натрия и 1% SDS. В более предпочтительном варианте осуществления гибридизация происходит при 37°C в 500 мМ NaCl, 50 мМ трицитрата натрия, 1% SDS, 35% формамида и 100 мкг/мл денатурированной ДНК (оцДНК) спермы лосося. В наиболее предпочтительном варианте осуществления гибридизация происходит при 42°C в 250 мМ NaCl, 25 мМ трицитрата натрия, 1% SDS, 50% формамида и 200 мкг/мл оцДНК. Специалисты в данной области с легкостью увидят полезные изменения этих условий.

Для большинства применений также варьирует строгость стадий отмывания, которые следуют за гибридизацией. Строгость условий отмывания можно определить посредством концентрации соли и посредством температуры. Как и выше, строгость отмывания можно повысить посредством снижения концентрации соли или посредством повышения температуры. Например, строгая концентрация соли для стадий отмывания предпочтительно составляет менее приблизительно 30 мМ NaCl и 3 мМ трицитрата натрия, и наиболее предпочтительно менее приблизительно 15 мМ NaCl и 1,5 мМ трицитрата натрия. Строгие температурные условия для стадий отмывания, как правило, включают температуру, равную по меньшей мере приблизительно 25°C, более предпочтительно равную по меньшей мере приблизительно 42°C, и даже более предпочтительно равную по меньшей мере приблизительно 68°C. В предпочтительном варианте осуществления стадии отмывания происходят при 25°C в 30 мМ NaCl, 3 мМ трицитрате натрия и 0,1% SDS. В более предпочтительном варианте осуществления стадии отмывания происходят при 42°C в 15 мМ NaCl, 1,5 мМ трицитрате натрия и 0,1% SDS. В более предпочтительном варианте осуществления стадии отмывания происходят при 68°C в 15 мМ NaCl, 1,5 мМ трицитрате натрия и 0,1% SDS. Специалисты в данной области с легкостью увидят дополнительные изменения этих условий. Способы гибридизации хорошо известны специалистам в данной области и описаны, например, в Benton and Davis (Science 196: 180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); и Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.

Молекулы нуклеиновой кислоты, которые можно использовать для гибридизации в способах по изобретению, включают любые молекулы нуклеиновой кислоты, которые обладают существенной идентичностью, чтобы быть способными к специфической гибридизации с нуклеиновыми кислотами-мишенями. Полинуклеотиды, обладающие «существенной идентичностью» относительно эндогенной последовательности, типично способны к гибридизации по меньшей мере с одной цепью двухцепочечной молекулы нуклеиновой кислоты. Под «по существу идентичным» понимают полипептид или молекулу нуклеиновой кислоты, которая обладает по меньшей мере 50% идентичность относительно эталонной аминокислотной последовательности или последовательности нуклеиновой кислоты. Предпочтительно, такая последовательность по меньшей мере на 60%, более предпочтительно на 80% или 85% и более предпочтительно на 90%, 95% или даже 99% идентична на уровне аминокислоты или нуклеиновой кислоты последовательности, используемой для сравнения. Идентичность последовательность типично измеряют, используя программное обеспечение для анализа последовательностей (например, Sequence Analysis Software Package из Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, программы BLAST, BESTFIT, GAP или PILEUP/PRETTYBOX). Такое программное обеспечение сопоставляет идентичные или схожие последовательности посредством присвоения степеней гомологии различным заменам, делециям и/или другим модификациям. Консервативные замены типично включают замены в пределах следующих групп: глицин, аланин; валин, изолейцин, лейцин; аспарагиновая кислота, глутаминовая кислота, аспарагин, глутамин; серин, треонин; лизин, аргинин; и фенилаланин, тирозин. В образцовом подходе для определения степени идентичности, можно использовать программу BLAST, с вероятностной оценкой между e<"3> и e<"100>, показывающей близко родственную последовательность.

Можно использовать систему обнаружения для измерения отсутствия, присутствия и количества гибридизации для всех отдельных последовательностей одновременно. Предпочтительно, для определения уровней и паттернов флуоресценции используют сканер.

Выражение «повышенный риск обладания нежелательным сердечно-сосудистым заболеванием или нарушением» понимают как указание на предрасположенность к заболеванию таким заболеванием, более высокую, чем среднее в популяции.

Выражение «слабый ответ на терапию сердечно-сосудистого заболевания» обозначает обладание пониженной реакцией на терапию. Когда пациент обладает пониженной восприимчивостью к терапии, необходимо увеличенное количество или число терапевтических средств для достижения заданного терапевтического эффекта. Выше подробно описаны подходящие виды терапии сердечно-сосудистого заболевания, подлежащие применению к пациентам, выбранным в соответствии со способом по настоящему изобретению.

Способ идентификации пациента, который нуждается в ранней и/или агрессивной терапии сердечно-сосудистого заболевания или в профилактической терапии сердечно-сосудистого заболевания

В другом аспекте изобретение относится к способу (далее в настоящем документе второй способ по изобретению) идентификации пациента, который нуждается в ранней и/или агрессивной терапии сердечно-сосудистого заболевания или в профилактической терапии сердечно-сосудистого заболевания, включающему в себя стадии определения в образце, выделенном у указанного пациента, идентичности нуклеотиду в положении 27 в последовательности нуклеиновой кислоты, выбранной из группы SEQ ID NO:1-11, где присутствие C в SEQ ID NO:1, A в SEQ ID NO:2, C в SEQ ID NO:3, T в SEQ ID NO:4, C в SEQ ID NO:5, A в SEQ ID NO:6, T в SEQ ID NO:7, C в SEQ ID NO:8, C в SEQ ID NO:9, T в SEQ ID NO:10 и/или T в SEQ ID NO:11 в положении 27 указывает на обладание пониженным ответом на терапию сердечно-сосудистого заболевания или потребность в ранней и агрессивной терапии сердечно-сосудистого заболевания или в профилактической терапии сердечно-сосудистого заболевания.

Термин «терапия сердечно-сосудистого заболевания» подробно определен в первом способе по изобретению.

Под «ранней и агрессивной терапией сердечно-сосудистого заболевания» понимают лечебный подход, который направлен на быстрый контроль кровяного давления, который у некоторых индивидуумов требует использования нескольких антигипертензивных лекарственных средств. При желании, такая терапия также могут включать в себя контроль глюкозы, контроль липидного метаболизма, контроль потери массы и прекращение курения.

Как описано выше, конкретные способы или композиции, используемые для обнаружения полиморфизма (например, SNPS, RFLP) не имеют значения. Изобретение включает фактически любой способ определения аллельной изменчивости, который известен в данной области.

Ключевой в определении риска и выборе лечения является идентификация конкретных аллельных SNP и корреляция этих SNP последовательности с выбором лечения, терапевтической пользой или риском нежелательного сердечно-сосудистого явления. Эта генетическая информация полезна в отдельности, но может быть еще более полезной при объединении с другими факторами, обладающими клинической значимостью для здоровья сердечно-сосудистой системы. Такие факторы включают возраст, расу, пол, индекс массы тела, кровяное давление, статус курения, анамнез употребления алкоголя, анамнез курения, анамнез тренировок, диету, семейный анамнез сердечно-сосудистых заболеваний, уровень липопротеинов низкой плотности (ЛНП)- или липопротеинов высокой плотности (ЛВП)-холестерина (ЛВП), систолическое кровяное давление, диастолическое кровяное давление, анамнез сердечной недостаточности, диабет, почечную недостаточность или гипертрофию левого желудочка. Таким образом, в другом аспекте первый и второй способ по изобретению может дополнительно содержать определение классических факторов риска.

Подходящие классические факторы риска для использования в способах по настоящему изобретению без ограничения включают возраст, расу, пол, индекс массы тела, кровяное давление, статус курения, анамнез употребления алкоголя, анамнез курения, анамнез тренировок, диету, семейный анамнез сердечно-сосудистых заболеваний, уровень липопротеинов низкой плотности (ЛНП)- или липопротеинов высокой плотности (ЛВП)- холестерина, систолическое кровяное давление, диастолическое кровяное давление, анамнез сердечной недостаточности, диабет, почечную недостаточность или гипертрофию левого желудочка.

Предпочтительные наборы классических маркеров риска включают те, что составляют часть известных моделей для предсказания риска CVD, таких как исходная модель Framingham, а также те, что получены из нее, такие как, но без ограничения, REGICOR, и модели SCORE, PROCAM или QRISK. Классические факторы риска, использованные в модели Framingham и в тех, что получены из нее, включают возраст, общий холестерин, ЛВП-холестерин, кровяное давление, диабет и статус курения. Классические факторы риска, используемые в модели REGICOR, включают возраст, пол, холестерин, ЛВП-холестерин, систолическое артериальное давление, статус диабета и статус курения. Классические факторы риска, используемые в модели SCORE, включают возраст, холестерин, систолическое артериальное давление и статус курения. Классические факторы риска, используемые в модели PROCAM, включают возраст, пол, ЛНП-холестерин, ЛВП-холестерин, триглицериды, артериальное систолическое давление, статус диабета, статус курения, семейный анамнез инфаркта миокарда. Классические факторы риска, используемые в модели QRISK, включают возраст, отношение общий холестерин/ЛВП-холестерин, индекс массы тела, семейный анамнез ранних CVD, статус курильщика, оценка Таунсенда для области вывода, систолическое кровяное давление, лечение гипертензии и взаимодействие с SBP*HTN лечением.

В изобретении можно использовать метрики (например, математические способы) для оценки существования зависимости между генетической информацией и риском нежелательного сердечно-сосудистого исхода. Точность прогноза таких способов, как правило, улучшается, когда учитывают эффект одного или нескольких других факторов на прогноз сердечно-сосудистого заболевания. Можно использовать метрический математический способ, например, для установления корреляции между сердечно-сосудистым заболеванием или вероятностью предрасположенности к развитию сердечно-сосудистого заболевания или нарушения и SNP аллеля (варианта) интересующей молекулы нуклеиновой кислоты, отдельно или в сочетании с другими факторами. В одном из вариантов осуществления метрику (например, алгоритм или математическую формулу) используют для определения существования корреляции между присутствием аллельного варианта SNP и сердечно-сосудистым заболеванием или нежелательным сердечно-сосудистым явлением.

СПОСОБЫ ПЕРСОНАЛИЗИРОВАННОЙ МЕДИЦИНЫ ПО ИЗОБРЕТЕНИЮ

SNP сигнатура, идентифицированная авторами настоящего изобретения, также подходит для отбора пациентов для применения лечения сердечно-сосудистого заболевания к пациенту, где указанный пациент предварительно отобран на основе присутствия фактора риска CVD, вычисленного по указанной SNP сигнатуре. Таким образом, цель настоящего изобретения состоит в том, чтобы предоставить способ лечения пациента, страдающего сердечно-сосудистым заболеванием, с использованием терапии сердечно-сосудистого заболевания, где пациента выбирают для указанной терапии на основе присутствия в образце, выделенном у указанного пациента, полиморфизма в положении 27 в нуклеотидных последовательностях SEQ ID NO:1-11, где указанный полиморфизм в указанном положении 27 представляет собой C в SEQ ID NO:1, A в SEQ ID NO:2, C в SEQ ID NO:3, T в SEQ ID NO:4, C в SEQ ID NO:5, A в SEQ ID NO:6, T в SEQ ID NO:7, C в SEQ ID NO:8, C в SEQ ID NO:9, T в SEQ ID NO:10 и T в SEQ ID NO:11.

Другая цель настоящего изобретения состоит в том, чтобы предоставить использование терапии сердечно-сосудистого заболевания для препарата лекарственного средства для лечения пациента, страдающего сердечно-сосудистым заболеванием, где пациента выбирают для указанной терапии на основе присутствия в образце, выделенном у указанного пациента, полиморфизма в положении 27 в нуклеотидных последовательностях SEQ ID NO:1-11, где указанный полиморфизм в указанном положении 27 представляет собой C в SEQ ID NO:1, A в SEQ ID NO:2, C в SEQ ID NO:3, T в SEQ ID NO:4, C в SEQ ID NO:5, A в SEQ ID NO:6, T в SEQ ID NO:7, C в SEQ ID NO:8, C в SEQ ID NO:9, T в SEQ ID NO:10 и T в SEQ ID NO:11.

Другая цель настоящего изобретения состоит в том, чтобы предоставить терапию сердечно-сосудистого заболевания для использования в лечении пациента от сердечно-сосудистого заболевания, где пациента выбирают для указанной терапии на основе присутствия в образце, выделенном у указанного пациента, полиморфизма в положении 27 в нуклеотидных последовательностях SEQ ID NO:1-11, где указанный полиморфизм в указанном положении 27 представляет собой C в SEQ ID NO:1, A в SEQ ID NO:2, C в SEQ ID NO:3, T в SEQ ID NO:4, C в SEQ ID NO:5, A в SEQ ID NO:6, T в SEQ ID NO:7, C в SEQ ID NO:8, C в SEQ ID NO:9, T в SEQ ID NO:10 и T в SEQ ID NO:11.

Выражения «терапия сердечно-сосудистого заболевания» и «сердечно-сосудистое заболевание» подробно объяснены ранее. В предпочтительном варианте осуществления терапия сердечно-сосудистого заболевания представляет собой терапию β-блокатором или терапию верапамилом. В еще одном другом варианте осуществления сердечно-сосудистое заболевание выбирают из группы из инфаркта миокарда, инсульта, стенокардии, транзиторных ишемических атак, застойной сердечной недостаточности, аневризмы аорты или их сочетания.

Средства, составляющие терапию сердечно-сосудистого заболевания, можно вводить человеку и другим животным посредством любого подходящего пути введения, включая пероральный, назальный, например, посредством спрея, ректальный, интравагинальный, парентеральный, интрацистернальный и местный, как посредством порошков, мазей или капель, включая трансбуккальный и сублингвальный. Фактические уровни дозировки одного или нескольких средств, вводимых в способах по настоящему изобретению, можно менять с тем, чтобы достичь количества активного ингредиента, которое эффективно для достижения ответа у животного. Фактическое эффективное количество может определить специалист в данной области, используя стандартные эксперименты, и его можно менять за счет способа введения. Кроме того, эффективное количество можно менять в соответствии с различными факторами, включая размеры, возраст и пол индивидуума, подлежащего лечению. Дополнительно, тяжесть состояния, подлежащего лечению, а также присутствие или отсутствие других компонентов в схеме лечения индивидуума влияет на фактическую дозировку. Эффективное количество или уровень дозировки зависят от различных факторов, включая активность конкретного одного или нескольких используемых средств, путь введения, время введения, скорость выведения конкретных используемых средств, длительность лечения, другие лекарственные средства, соединения и/или вещества, используемые в сочетании с конкретными используемыми средствами, возраст, пол, масса, состояние, общее состояние здоровья и предшествующий медицинский анамнез животного и подобные факторы, хорошо известные в медицинской области.

Способ персонализированной медицины по изобретению также может включать в себя определение классических факторов риска, таких как возраст, раса, пол, индекс массы тела, кровяное давление, статус курения, уровень липопротеинов низкой плотности (ЛНП)- или липопротеинов высокой плотности (ЛВП)-холестерина, систолическое кровяное давление, диастолическое кровяное давление, анамнез сердечной недостаточности, диабет, почечную недостаточность или гипертрофию левого желудочка, анамнез употребления алкоголя, анамнез курения, анамнез тренировок, диету и семейный анамнез сердечно-сосудистых заболеваний; и устанавливает корреляцию между присутствием SNP и одного или нескольких факторов риска сердечно-сосудистого заболевания с потребностью персонализированной, возможно ранней и агрессивной терапии сердечно-сосудистого заболевания, где положительная корреляция идентифицирует пациента как обладающего измененным, в частности повышенным, риском нежелательного сердечно-сосудистого заболевания или нарушения. В одном из вариантов осуществления способ дополнительно включает выбор соответствующей схемы лечения. В другом варианте осуществления способ дополнительно включает введение схемы лечения пациенту.

СПОСОБЫ ОПРЕДЕЛЕНИЯ СЕРДЕЧНО-СОСУДИСТОГО РИСКА У ПАЦИЕНТА

Другая цель настоящего изобретения состоит в улучшении используемых в настоящее время CVRF посредством введения в функцию риска, даваемую конкретным сочетанием маркеров SNP, как указано в таблице 1, ассоциированных с риском CVD и/или с риском осложнений CVD, включая в качестве неограничивающих примеров инфаркт миокарда, инсульт, стенокардию, транзиторные ишемические атаки, застойную сердечную недостаточность, аневризму аорты и смерть. Используемые в настоящее время CVRF включают в качестве неограничивающих примеров исходную функцию Framingham, адаптированную функцию Framingham (такую как, но без ограничения, функция REGICOR), функцию PROCAM, функцию SCORE и функцию QRISK. Улучшение функций Framingham, PROCAM, REGICOR и QRISK представлено в виде функций 1a и 1b.

Функция 1a

Это общее уравнение можно использовать для вычисления коронарного или сердечно-сосудистого риска с использованием факторов риска и эффектов факторов риска, включенных и определенных в функциях Framingham (исходной и/или адаптированных, таких как, но без ограничения, REGICOR), PROCAM и QRISK:

где

prob(event|CRF,SNP): вероятность присутствия коронарного приступа, заданная комбинацией факторов коронарного риска (CRF) и генетической характеристики (SNP).

eventi: коронарный приступ (фатальный и нефатальный инфаркт миокарда или стенокардия) в 10-летнем периоде для индивидуума «i».

CRFp,i: значение каждого фактора коронарного риска «p», включенное в уравнение для индивидуума «i». Список факторов коронарного риска, включенный в модель, представлен в таблице A.

SNPj,i: число аллелей риска (0, 1, 2) для конкретного генетического варианта «j», включенное в уравнение для индивидуума «i». Варианты, в настоящее время включенные в модель, представлены в таблице B.

: среднее выживание без коронарных приступов в популяции. Это выживание следует адаптировать к региональным или национальным показателям.

exp: возведение в натуральную степень.

: где

: функция суммирования по P классических факторов риска.

: логарифм отношения рисков, соответствующего классическому фактору коронарного риска «p».

Значения β для каждого фактора коронарного риска «p» представлены в таблице A.

CRFp,i: значение каждого фактора коронарного риска «p», включенного в уравнение для индивидуума «i».

: где

: функция суммирования по J генетических вариантов.

: логарифм отношения рисков, соответствующего генетическому варианту «j». Возможный диапазон значений β для каждого генетического варианта «j» представлен в таблице B.

SNPj,i: число аллелей риска (0, 1, 2) для конкретного генетического варианта «j», включенного в уравнение для индивидуума «i».

: среднее значение для классического фактора риска «p» в популяции. Это среднее значение следует адаптировать к региональной или национальной распространенности.

: среднее число копий аллеля риска для генетического варианта «j» в популяции. Это среднее значение следует адаптировать к региональной или национальной распространенности.

Таблица A
Список факторов коронарного риска, включенных в модель, логарифм отношения рисков, , для каждого классического фактора риска по полу, диапазон средних значений для классического фактора риска «p» в популяции и уровень среднего выживания без коронарных приступов в популяции ( ) (диапазон возможных значений).
CRFP для мужчин для женщин
FRAMINGHAM (оригинальная или адаптация) Возраст 0,048 0,338 35-74
Возраст 2 0 -0,003
Общий холестерин (мг/дл)
<160 -0,659 -0,261 0-30
160-<200 0 0 0-30
200-<240 0,177 0,208 0-30
240-<280 0,505 0,244 0-30
≥280 0,657 0,53 0-30
ЛВП холестерин (мг/дл)
<35 0,497 0,843 0-30
35-<45 0,243 0,378 0-30
45-<50 0 0,198 0-30
50-<60 -0,051 0 0-30
≥60 -0,487 -0,430 0-30
Кровяное давление
Оптимальное -0,002 -0,534 0-30
Нормальное 0 0 0-30
Погранично-высокое 0,283 -0,068 0-30
Гипертензия I 0,522 0,263 0-30
Гипертензия II 0,619 0,466 0-30
Диабет 0,428 0,597 0-30
Курение 0,523 0,292 0-60
PROCAM Возраст 0,103 - 35-74
ЛНП-холестерин (мг/дл) 0,013 - 100-250
ЛВП-холестерин (мг/дл) -0,032 - 35-65
Триглицериды (мг/дл) 0,317 - 100-200
Систолическое кровяное давление (мм рт. ст.) 0,010 - 100-160
Семейный анамнез ИМ 0,382 - 1-45
Диабет 0,399 - 0-30
QRISK Log(возраст/10) 4,474 3,925 35-74
Общий холестерин/ЛВП холестерин 0,001 0,001 2-10
Индекс массы тела (кг/м2) 0,015 0,022 22-32
Семейный анамнез ранних CVD 0,206 0,262 1-45
Курение 0,425 0,349 0-60
Оценка Таунсенда для области вывода 0,034 0,017 -3-3
Систолическое кровяное давление (мм рт. ст.) 0,005 0,004 100-160
Лечение гипертензии 0,550 0,614 0-40
Взаимодействие с лечением SBP*HNT -0,004 -0,007 ---
Средняя выживаемость 0,951 (0,01-9,00) 0,978 (0,01-9,00)
Таблица B
Варианты, в настоящее время включенные в модель, логарифм отношения рисков (диапазон возможных значений), , и среднее число копий аллеля риска (диапазон возможных значений), , для каждого генетического варианта
SNPj
rs1333049 0,30010 (0-0,80) 0,94 (0,3-2,8)
rs599839 0,16551 (0-0,60) 1,54 (0,3-2,8)
rs17465637 0,12222 (0-0,60) 1,44 (0,3-2,8)
rs501120 0,17395 (0-0,60) 1,74 (0,3-2,8)
rs2943634 0,19062 (0-0,60) 1,32 (0,3-2,8)
rs6922269 0,20701 (0-0,60) 0,50 (0,3-2,8)
rs9982601 0,1823 (0-0,60) 0,26 (0,3-2,8)
rs12526453 0,1133 (0-0,60) 1,10 (0,3-2,8)
rs6725887 0,1570 (0-0,60) 0,28 (0,3-2,8)
rs9818870 0,1398 (0-0,60) 0,34 (0,3-2,8)
rs3184504 0,1222 (0-0,60) 0,76 (0,3-2,8)
Другие SNP 0,1200 (0-0,60) 0,3-2,8 (0,3-2,8)

Функция 1b

Это общее уравнение можно использовать для вычисления коронарного или сердечно-сосудистого риска с использованием факторов риска и эффектов факторов риска, включенных и определенных в функциях Framingham (исходная и/или адаптированные, такие как, но без ограничения, REGICOR), PROCAM и QRISK:

где prob(event|CRF,GSQ): вероятность присутствия коронарного приступа, заданная комбинацией факторов коронарного риска (CRF) и генетической характеристики (GSQ).

eventi: коронарный приступ (фатальный и нефатальный инфаркт миокарда или стенокардия) в 10-летнем периоде для индивидуума «i».

CRFp,i: значение каждого фактора коронарного риска «p», включенное в уравнение для индивидуума «i». Список факторов коронарного риска, включенный в модель, представлен в таблице C.

GSQq,i: квантиль генетической оценки «q» в соответствии с распределением числа аллелей риска (0, 1, 2) для генетических вариантов, включенных в уравнение при популяционном уровне для индивидуума «i». Варианты, в настоящее время включенные в модель, представлены в таблице D.

: среднее выживание без коронарных приступов в популяции. Это выживание следует адаптировать к региональным или национальным показателям.

exp: возведение в натуральную степень.

: где

: функция суммирования по P классических факторов риска.

: логарифм отношения рисков, соответствующего классическому фактору коронарного риска «p».

Значения β для каждого фактора коронарного риска «p» представлены в таблице C.

CRFp,i: значение каждого фактора коронарного риска «p», включенного в уравнение для индивидуума «i».

: где

: функция суммирования по Q (5) квантилей.

: логарифм отношения рисков, соответствующего другим квантилям генетической оценки (QSQ) «q». Возможный диапазон значений β для каждого квантиля «q» представлен в таблице D.

GSQq,i: квантиль генетической оценки «q», соответствующий распределению числа аллелей риска (0, 1, 2) для генетических вариантов, включенных в уравнение при популяционном уровне для индивидуума «i».

: среднее значение для классического фактора риска «p» в популяции. Это среднее значение следует адаптировать к региональной или национальной распространенности.

: значения от 1 до 5 различных квантилей для квантиля генетической оценки «q» в популяции.

Таблица С
Список факторов коронарного риска, включенных в модель, логарифм отношения рисков, , для каждого классического фактора риска по полу, диапазон средних значений для классического фактора риска «p» в популяции и уровень среднего выживания без коронарных приступов в популяции ( ) (диапазон возможных значений)
CRFP для мужчин для женщин
FRAMINGHAM (оригинальная или адаптация) Возраст 0,048 0,338 35-74
Возраст 2 0 -0,003
Общий холестерин (мг/дл)
<160 -0,659 -0,261 0-30
160-<200 0 0 0-30
200-<240 0,177 0,208 0-30
240-<280 0,505 0,244 0-30
≥280 0,657 0,53 0-30
ЛВП холестерин (мг/дл)
<35 0,497 0,843 0-30
35-<45 0,243 0,378 0-30
45-<50 0 0,198 0-30
50-<60 -0,051 0 0-30
≥60 -0,487 -0,430 0-30
Кровяное давление
Оптимальное -0,002 -0,534 0-30
Нормальное 0 0 0-30
Погранично-высокое 0,283 -0,068 0-30
Гипертензия I 0,522 0,263 0-30
Гипертензия II 0,619 0,466 0-30
Диабет 0,428 0,597 0-30
Курение 0,523 0,292 0-60
PROCAM Возраст 0,103 - 35-74
ЛНП-холестерин (мг/дл) 0,013 - 100-250
ЛВП-холестерин (мг/дл) -0,032 - 35-65
Триглицериды (мг/дл) 0,317 - 100-200
Систолическое кровяное давление (мм рт. ст.) 0,010 - 100-160
Семейный анамнез ИМ 0,382 - 1-45
Диабет 0,399 - 0-30
QRISK Log(возраст/10) 4,474 3,925 35-74
Общий холестерин/ЛВП холестерин 0,001 0,001 2-10
Индекс массы тела (кг/м2) 0,015 0,022 22-32
Семейный анамнез ранних CVD 0,206 0,262 1-45
Курение 0,425 0,349 0-60
Оценка Таунсенда для области вывода 0,034 0,017 -3-3
Систолическое кровяное давление (мм рт. ст.) 0,005 0,004 100-160
Лечение гипертензии 0,550 0,614 0-40
Взаимодействие с лечением SBP*HNT -0,004 -0,007 ---
Средняя выживаемость 0,951 (0,01-9,00) 0,978 (0,01-9,00)
Таблица D
Определение квантилей генетической оценки (GSQq) в соответствии с числом аллелей риска и логарифмом отношения рисков (диапазон возможных значений), , для квантилей генетической оценки
GSQq
1 (0-6/9 аллелей риска) 0
2 (7/10 аллелей риска) 0,2 (0-0,8)
3 (9/11 аллелей риска) 0,4 (0-1,2)
4 (10/12 аллелей риска) 0,6 (0-1,6)
5 (11/12-22 аллелей риска) 0,8 (0-2,0)

Эти квантили следует строить согласно аллельным частотам следующих генетических вариантов (смотрите таблицу 1) (rs1333049, rs599839, rs17465637, rs501120, rs2943634, rs6922269, rs9982601, rs12526453, rs6725887, rs9818870, rs3184504).

Функция 1c

Коронарный или сердечно-сосудистый риск вычисляют с использованием следующих уравнений, использующих функцию риска SCORE:

Первая стадия: вычислить линейную комбинацию факторов риска

где

cholesteroli: уровень холестерина для индивидуума «i» в ммоль/л.

βchol: логарифм отношения рисков, соответствующего холестерину (таблица E).

SBPi: систолическое кровяное давление для индивидуума «i» в мм рт. ст.

βSBP: логарифм отношения рисков, соответствующего систолическому кровяному давлению (таблица E).

currenti: текущий статус курения для индивидуума «i» (1: действительный, 0: бывший/никогда не курил).

βsmoker: логарифм отношения рисков, соответствующего систолическому кровяному давлению (таблица E).

: функция суммирования по J генетических вариантов.

: логарифм отношения рисков, соответствующего генетическому варианту «j». Возможный диапазон значений β для каждого генетического варианта «j» представлен в таблице B.

SNPj,i: число аллелей риска (0, 1, 2) для конкретного генетического варианта «j», включенного в уравнение для индивидуума «i».

: среднее число копий аллеля риска для генетического варианта «j» в популяции. Это среднее значение следует адаптировать к региональной или национальной распространенности.

Вторая стадия: вычислить базовое выживание.

S0(возраст)=exp{-exp(α)*(возраст-20)p}

S0(возраст+10)=exp{-exp(α)*(возраст-10)p}

где

α, p: параметры формы и масштаба распределения Вейбулла. Их значения представлены в таблице F (параметры).

exp: возведение в натуральную степень

Третья стадия: вычислить выживание за 10 лет

S(возраст)={S0(возраст)}exp(w)

S(возраст+10)={S0(возраст+10)}exp(w)

S10(возраст)=S(возраст+10)/S(возраст)

Четвертая стадия: вычислить вероятность наличия приступа во время 10-летнего наблюдения.

Risk10(возраст)=1-S10(возраст)

Пятая стадия: вычислить вероятность наличия сердечно-сосудистого приступа во время 10-летнего наблюдения как сумму коронарного и некоронарного сердечно-сосудистого риска.

CVDRisk10=[CHDRisk10(возраст)]+[Non-CHDRisk10(возраст)]

Таблица E
CHD Non-CHD CVD
Действительный курильщик, βsmoker 0,71 0,63
Холестерин (ммоль/л), βchol 0,24 0,02
Систолическое кровяное давление (мм рт. ст.), βSBP 0,018 0,022
CHD: коронарное заболевание сердца
CVD: сердечно-сосудистое заболевание
Таблица F
CHD Non-CHD CVD
Страна A p α p
Низкий риск Мужчины -22,1 4,71 -26,7 5,62
Женщины -29,8 6,36 -31,0 6,62
Высокий риск Мужчины -21,0 4,62 -25,7 5,47
Женщины -28,7 6,23 -30,0 6,42
CHD: коронарное заболевание сердца
CVD: сердечно-сосудистое заболевание

К удивлению, комбинация маркеров SNP, включенных в настоящее изобретение и приведенных в таблице 1, и использование функций, описанных выше в функциях 1a-1c, доказали достижение высокой достоверности и превосходящую валидацию в предсказании CVD и/или осложнений CVD относительно полученных с использованием классических факторов риска и функций, используемых в настоящее время, или опубликованных функций, содержащих генетическую информацию. Кроме того, классификация также улучшена.

Компьютерная реализация средства по изобретению

Другая цель настоящего изобретения состоит в том, чтобы предоставить компьютерную программу или машиночитаемый носитель, содержащие средство осуществления любого из способов по изобретению. Компьютерную реализацию можно осуществить с использованием компьютерной программы, предоставляющей инструкции в машиночитаемой форме. Компьютер собирает данные, анализирует данные в соответствии со способами, описанными в настоящем документе, и затем предоставляет результат анализа. Таким образом, в другом варианте осуществления изобретение относится к компьютерной программе или машиночитаемому носителю, содержащим средство для осуществления способа по изобретению.

Компьютерные языки различных типов можно использовать для предоставления инструкций в машиночитаемой форме. Например, компьютерную программу можно написать, используя такие языки, как языки C, C++, Microsoft C#, Microsoft Visual Basic, FORTRAN, PERL, HTML, JAVA, S, язык командной оболочки UNIX или LINUX, такие как C shell script, и различные диалекты таких языков. «R», диалект языка S, является примером диалекта со свойствами, облегчающими анализ, подобный приведенному здесь (смотрите http://cran.us.r-project.org).

Можно использовать компьютеры различных типов для запуска программы для осуществления способов анализа, описанных в настоящем документе. Компьютерные программы для осуществления способов анализа, описанных в настоящем документе, можно запускать на компьютере, который имеет достаточно памяти и возможностей по обработке. Примером подходящего компьютера является компьютер, который содержит процессор на базе Intel Pentium (g) 200 МГц или выше, с 64 MB или более основной памяти. Эквивалентные или превосходящие компьютерные системы хорошо известны в данной области. Для компьютеров различных типов можно использовать стандартные операционные системы. Примеры операционных систем для процессора на базе Intel Pentium (2) включают семейство Microsoft Windows™, например, Windows NT, Windows XP и Windows 2000 и LINUX. Примеры операционных систем для компьютеров Apple включают операционные системы OSX, UNIX и LINUX. Другие компьютеры и другие операционные системы хорошо известны в данной области. В различных вариантах осуществления язык R используют на компьютерах на основе Intel с 4 ГБ ОЗУ и двумя процессорами Pentium m 866 МГц с запущенной операционной системой LINUX или на компьютере IBM с запущенной операционной системой AIX с компьютером на базе Intel с запущенной операционной системой Windows NT или XP в качестве терминала x-windows.

Наборы по изобретению

Изобретение дополнительно относится к набору для определения присутствия полиморфных маркеров, используемых в способах по изобретению, который частично или полностью содержит: реактивы для амплификации фрагментов нуклеиновой кислоты, содержащих маркеры SNP, и обнаруживающие реактивы для генотипирования маркеров SNP. Таким образом, в другом аспекте изобретение относится к набору, который содержит реактивы для определения идентичности полиморфизмов в положениях 27 и последовательности нуклеиновой кислоты SEQ ID NO:1-10, как определено выше в таблице 1.

Специалист в данной области учтет, что на основе информации о SNP и ассоциированных последовательностях, описанной в настоящем документе, можно разработать обнаруживающие реактивы и использовать их для анализа любых SNP по настоящему изобретению индивидуально или в комбинации, и такие обнаруживающие реактивы можно легко включить в набор или систему одного из установленных форматов, которые хорошо известны в данной области. Наборы могут дополнительно содержать опросный лист с классическими клиническими факторами.

Термины «наборы» и «системы», как применяют в настоящем документе в контексте обнаруживающих SNP реактивов, предназначены для того, чтобы указывать на объекты или устройства, такие как комбинации нескольких обнаруживающих SNP реактивов или один или несколько обнаруживающих SNP реактивов в сочетании с одним или несколькими другими типами элементов или компонентов (например, другие типы биохимических реактивов, контейнеров, упаковок, таких как упаковка, предназначенная для коммерческой продажи, подложки, к которым прикрепляют обнаруживающие SNP реактивы, электронные аппаратные компоненты и т.д.). Таким образом, настоящее изобретение дополнительно относится к наборам и системам для обнаружения SNP, включая в качестве неограничивающих примеров упакованные наборы зондов и праймеров (например, наборы зондов/праймеров TaqMan), панели/микропанели молекул нуклеиновой кислоты, и бусы, которые содержат один или несколько зондов, праймеров или других обнаруживающих реактивов для определения одного или нескольких SNP по настоящему изобретению. Наборы/системы могут необязательно содержать различные электронные аппаратные компоненты; например, панели («ДНК чипы») и микрожидкостные системы (системы «лаборатория на чипе»), представляемые различными производителями, типично содержат аппаратные компоненты. Другие наборы/системы (например, наборы зондов/праймеров) могут не содержать электронные аппаратные компоненты, но могут состоять, например, из одного или нескольких обнаруживающих SNP реактивов (необязательно наряду с другими биохимическими реактивами), упакованных в один или несколько контейнеров.

В некоторых вариантах осуществления набор для обнаружения SNP типично содержит один или несколько обнаруживающих реактивов и другие компоненты (например, буфер, ферменты, такие как ДНК полимеразы или лигазы, нуклеотиды для достройки цепи, такие как дезоксинуклеотидтрифосфаты, и в случае реакций сиквенирования ДНК по Сэнгеру, нуклеотиды для терминации цепи, последовательности положительного контроля, последовательности отрицательного контроля и т.п.), необходимые для осуществления анализа или реакции, такой как амплификация и/или обнаружение содержащей SNP молекулы нуклеиновой кислоты. Набор может дополнительно содержать средство для определения количества нуклеиновой кислоты-мишени, и средство для сравнения количества со стандартом, и может содержать инструкции по использованию набора для обнаружения содержащей SNP молекулы нуклеиновой кислоты, представляющей интерес. В одном из вариантов осуществления настоящего изобретения предоставлены наборы, которые содержат необходимые реактивы для осуществления одного или нескольких анализов для обнаружения одного или нескольких SNP, описанных в настоящем документе. В предпочтительном варианте осуществления настоящего изобретения наборы/системы для обнаружения SNP представлены в форме панелей нуклеиновых кислот или наборов, разделенных на отсеки, которые включают микрожидкостные системы/системы «лаборатория на чипе».

Наборы/системы для обнаружения SNP могут содержать, например, один или несколько зондов или пару зондов, которые гибридизуются с молекулой нуклеиновой кислоты в каждом положении SNP-мишени или рядом с ним. Несколько пар аллельспецифических зондов могут входить в набор/систему для одновременного анализа большого числа SNP, по меньшей мере один из которых представляет собой SNP по настоящему изобретению. В некоторых набора/системах аллельспецифические зонды иммобилизованы на подложке, такой как панель или бусы. Например, одна подложка может содержать аллельспецифические зонды для определения по меньшей мере 1, 10, 100, 1000, 10000, 100000, 500000 (или любого другого числа между ними) или по существу всех SNP, описанных в настоящем документе.

Предпочтительно набор содержит несколько олигонуклеотидов, которые специфически гибридизуются с последовательностями нуклеиновой кислоты, определенными в таблице 1, или с последовательностями, фланкирующим указанные участки. Эти олигонуклеотиды делают возможной специфическую амплификацию полинуклеотида, где полиморфное положение из матрицы геномной ДНК или кДНК человека подлежит оценке с использованием ПЦР. Наиболее предпочтительно, эти олигонуклеотиды делают возможным специфическое генотипирование этих полиморфных сайтов, выступая в качестве праймеров, зондов или субстратов лигирования, которое позволяет различать полиморфные аллели. Альтернативно, эти олигонуклеотиды можно использовать для использования в способах, которые не зависят от предшествующей амплификации исходной ДНК, таких как анализ Invader и способы обнаружения, основанные на лигировании. Предпочтительно олигонуклеотиды или другие компоненты набора содержат обнаружимую метку, например, флуоресцентную метку, ферментативную метку, светорассеивающую метку, массовую метку или другую метку. Альтернативно, обнаружение можно осуществлять способами RFLP. Кроме того, набор может содержать несколько различных последовательностей нуклеиновых кислот, которые позволяют обнаруживать последовательности нуклеиновых кислот или продукты генов, соответствующие различным полиморфизмам, как определено в таблице 1. Также набор может необязательно содержать инструкции по использованию, которые могут содержать список полиморфизмов, коррелирующих с конкретным лечением или лечениями заболевания или заболеваний и/или форму или список заболеваний, для которых конкретный полиморфизм или полиморфизмы коррелируют с эффективностью и/или безопасностью лечения.

Термины «панели», «микропанели» и «ДНК чипы» используют в настоящем документе взаимозаменяемо для обозначения панели отдельных полинуклеотидов, прикрепленных к субстрату, такому как стекло, пластмасса, бумага, нейлон или другому типу мембраны, фильтра, чипа, или к любой другой подходящей твердом носителе. Полинуклеотиды можно синтезировать непосредственно на подложке или можно синтезировать отдельно от подложки и затем прикреплять к подложке. В одном из вариантов осуществления микропанель получают и используют в соответствии со способами, описанными в патенте США № 5837832, Chee et al., заявке PCT WO95/11995 (Chee et al.), Lockhart, D. J. et al. (1996; Nat. Biotech. 14: 1675- 1680) и Schena, M. et al. (1996; Proc. Natl. Acad. Sci. 93: 10614-10619), все они включены в настоящий документ по ссылке в полном объеме. В других вариантах осуществления такие панели получают способами, которые описали Brown et al., патент США № 5807522.

Обзоры панелей нуклеиновых кислот приведены в следующих источниках: Zammatteo et al., «New chips for molecular biology and diagnostics», Biotechnol Annu Rev. 2002; 8: 85-101; Sosnowski et al., «Active microelectronic array system for DNA hybridization, genotyping and pharmacogenomic applications», Psychiatr Genet. 2002 December; 12(4): 181-92; Heller, «DNA microarray technology: devices, systems, и applications», Annu Rev Biomed Eng. 2002; 4: 129-53. Epub 2002 Mar 22; Kolchinsky et al., «Analysis of SNPs and other genomic variations using gel-based chips», Hum Mutat. 2002 April; 19(4): 343-60; и McGall et al, «High-density genechip oligonucleotide probe arrays», Adv Biochem Eng Biotechnol. 2002; 77: 21-42.

Любое число зондов, таких как аллельспецифические зонды, можно реализовать в панели, и каждый зонд или пара зондов может гибридизоваться с другим положением SNP. В случае полинуклеотидных зондов, их можно синтезировать в обозначенных областях (или синтезировать отдельно и затем прикреплять к обозначенным областям) на подложке с использованием направляемого светом химического процесса. Каждый ДНК чип может содержать, например, от тысяч до миллионов отдельных синтетических полинуклеотидных зондов, расположенных в виде регулярного паттерна, и может быть миниатюрным (например, размером с монету). Предпочтительно, зонды прикрепляют к твердому носителю в виде упорядоченного адресуемого массива. Микропанель может состоять из большого числа уникальных, одноцепочечных полинуклеотидов, прикрепленных к твердому носителю. Типичные полинуклеотиды предпочтительно представляют собой нуклеотиды длиной приблизительно 6-60, более предпочтительно представляют собой нуклеотиды длиной приблизительно 15-30 и наиболее предпочтительно представляют собой нуклеотиды длиной приблизительно 18-25. Для определенных типов микропанелей или других наборов для обнаружения/систем, может быть предпочтительным использовать олигонуклеотиды, которые имеют длину только приблизительно 7-20 нуклеотидов. В других типах панелей, таких как панели, используемые в сочетании хемилюминесцентной технологией обнаружения, предпочтительная длина зондов может составлять, например, приблизительно 15-80 нуклеотидов в длину, предпочтительно приблизительно 50-70 нуклеотидов в длину, более предпочтительно приблизительно 55-65 нуклеотиды в длину и наиболее предпочтительно приблизительно 60 нуклеотидов в длину. Микропанель или набор для обнаружения могут содержать полинуклеотиды, которые покрывают известную 5'- или 3'-последовательность сайта-мишени SNP, последовательные полинуклеотиды, которые покрывают полноразмерную последовательность гена/транскрипта; или уникальные полинуклеотиды, выбранные из конкретных областей вдоль длины последовательности гена/транскрипта-мишени, в частности, из областей, соответствующих одному или нескольким SNP, описанным в настоящем документе. Полинуклеотиды, используемые в микропанели или наборе для обнаружения, могут обладать специфичностью к одному или нескольким интересующим SNP (например, специфичностью к конкретному аллелю SNP в сайте-мишени SNP или специфичностью к конкретным аллелям SNP в нескольких различных сайтах SNP), или специфичностью к полиморфному гену/транскрипту или генам/транскриптам, представляющим интерес.

Анализ гибридизации на основе полинуклеотидных панелей основан на различиях в стабильности гибридизации зондов идеально совпадающими и неточно совпадающими вариантами последовательностей-мишеней. Для генотипирования SNP, как правило, предпочтительно, чтобы строгость условий, используемых в анализе гибридизации, была достаточно высокой, чтобы можно было различать молекулы нуклеиновой кислоты, которые отличают друг от друга только одним положением SNP (например, типичный анализ гибридизации SNP ставят так, что гибридизация возникает, только если в положении SNP присутствует один конкретный нуклеотид, но не возникает, если в этом положении SNP присутствует альтернативный нуклеотид). Такие условия высокой строгости могут быть предпочтительны, когда для обнаружения SNP используют, например, панели нуклеиновых кислот аллельспецифических зондов. Такие условия высокой строгости описаны в предыдущем разделе, хорошо известны специалистам в данной области и могут быть найдены, например, в Current Protocols in Molecular Biology, John Wiley and Sons, N.Y. (1989), 6.3.1-6.3.6.

В других вариантах осуществления панели используют в сочетании с хемилюминесцентной технологией обнаружения. Следующие патенты и патентные заявки, которые полностью включены, таким образом, в качестве ссылки, предоставляют дополнительную информацию, относящуюся к хемилюминесцентному обнаружению: в патентных заявках США с серийными номерам 10/620,332 и 10/620,333 описаны хемилюминесцентные подходы для определения на микропанелях; в патентах США №№ 6124478, 6107024, 5994073, 5981768, 5871938, 5843681, 5800999 и 5773628 описаны способы и композиции диоксетана для осуществления хемилюминесцентного обнаружения; а в опубликованной заявке США US2002/0110828 описаны способы и композиции для контроля на микропанелях.

В одном из вариантов осуществления изобретения панель нуклеиновых кислот может содержать панель зондов длиной приблизительно 15-25 нуклеотидов. В дополнительных вариантах осуществления панель нуклеиновых кислот может содержать любое число зондов, среди которых по меньшей мере один зонд способен обнаруживать один или несколько SNP, раскрытых в таблицах 1-10, и/или по меньшей мере один зонд содержит фрагмент одной из последовательностей, выбранной из группы, состоящей из описанных в настоящем документе, и последовательностей, комплементарных им, указанный фрагмент содержит по меньшей мере приблизительно 8 последовательных нуклеотидов, предпочтительно 10, 12, 15, 16, 18, 20, более предпочтительно 22, 25, 30, 40, 47, 50, 55, 60, 65, 70, 80, 90, 100 или более последовательных нуклеотидов (или любое другое число между ними) и содержит SNP (или комплементарен ему). В некоторых вариантах осуществления нуклеотид, комплементарный сайту SNP, находится в 5, 4, 3, 2 или 1 нуклеотиде(ах) от центра зонда, более предпочтительно в центре указанного зонда.

Полинуклеотидный зонд можно синтезировать на поверхности подложки, используя процедуру химического связывания и устройство струйного нанесения, как описано в заявке PCT WO95/251116 (Baldeschweiler et al.), которая включена в настоящий документ в полном объеме по ссылке. В другом аспекте «регулярную» панель, аналогичную дот- (или слот-) блоттингу, можно использовать для размещения и связывания фрагментов кДНК или олигонуклеотидов с поверхностью подложки, используя вакуумную систему, процедуры теплового, УФ, механического или химического связывания. Панель, такую как описано выше, можно получать вручную или используя доступные устройства (устройство слот-блоттинга или дот-блоттинга), вещества (любой подходящий твердый носитель) и машины (включая роботизированные инструменты), и она может содержать 8, 24, 96, 384, 1536, 6144 или более полинуклеотидов или любое другое число, которое пригодно для эффективного использования коммерчески доступного инструментария.

Использование наборов в соответствии с изобретением типично включает инкубирование тестового образца нуклеиновой кислоты с панелью, содержащей один или несколько зондов, соответствующих по меньшей мере одному положению SNP по настоящему изобретению, и анализ связывания нуклеиновой кислоты из тестового образца с одним или несколькими зондами. Варьируют условия инкубирования обнаруживающего SNP реактива (или набора/системы, в которых используют один или несколько таких обнаруживающих SNP реактивов) с тестовым образцом. Условия инкубирования зависят от таких факторов, как используемый в анализе формат, используемые способы обнаружения, а также тип и свойства обнаруживающих реактивов, используемых в анализе. Специалист в данной области примет во внимание, что любой доступный в настоящее время формат гибридизации, амплификации и анализа на панели можно легко адаптировать для обнаружения SNP, описанных в настоящем документе.

Набор/система для обнаружения SNP по настоящему изобретению может содержать компоненты, которые используют для получения нуклеиновых кислот из тестового образца для последующей амплификации и/или обнаружения содержащей SNP молекулы нуклеиновой кислоты. Такие компоненты для подготовки образца можно использовать для получения нуклеиновой кислоты, содержащей ДНК и/или РНК, экстракты из любой жидкости организма. В предпочтительном варианте осуществления изобретения жидкостью организма является кровь, слюна или буккальные мазки. Тестовые образцы, используемые в описанных выше способах, варьируют на основе таких факторов, как формат анализа, свойства способа обнаружения и конкретные ткани, клетки или экстракты, используемые в качестве тестового образца, подлежащего анализу. Способы получения нуклеиновых кислот хорошо известны в данной области и их можно легко адаптировать для получения образца, который совместим с используемой системой. В еще одной форме набора, в дополнение к реактивам для получения нуклеиновых кислот и реактивам для обнаружения одного из SNP по данному изобретению, набор может содержать опросный лист для проведения опроса о таких негенетических клинических факторах, о которых известно, что они ассоциированы с CVD, например, возраст, раса, пол, индекс массы тела, кровяное давление, статус курения, анамнез употребления алкоголя, анамнез курения, анамнез тренировок, диета, семейный анамнез сердечно-сосудистых заболеваний, общий холестерин, уровни липопротеинов низкой плотности (ЛНП)- или липопротеинов высокой плотности(ЛВП)-холестерина, систолическое кровяное давление, диастолическое кровяное давление, анамнез сердечной недостаточности, диабет, почечная недостаточность, или гипертрофия левого желудочка.

Другая форма набора, предполагаемая настоящим изобретением, представляет собой разделенный на отсеки набор. Разделенный на отсеки набор содержит любой набор, который включает реактивы в отдельных контейнерах. Такие контейнеры включают, например, маленькие стеклянные контейнеры, пластмассовые контейнеры, полоски пластмассы, стекла или бумаги или материала панели, такого как диоксид кремния. Такие контейнеры позволяют пользователю эффективно переносить реактивы из одного отсека в другой отсек так, что не происходит перекрестного загрязнения тестовых образцов и реактивов, или из одного контейнера в другой сосуд, не входящий в набор, и средства или растворы из каждого контейнера можно количественно добавлять из одного отсека в другой или в другой сосуд. Такие контейнеры могут включать, например, один или несколько контейнеров, которые вмещают тестовый образец, один или несколько контейнеров, которые содержат по меньшей мере один зонд или другой обнаруживающий SNP реактив для обнаружения одного или нескольких SNP по настоящему изобретению, один или несколько контейнеров, которые содержат реактивы для отмывания (такие как фосфатно-солевой буфер, Tris-буферы и т.д.), и один или несколько контейнеров, которые содержат реактивы, используемые для выявления присутствия связанного зонда или других обнаруживающих SNP реактивов. Набор может необязательно дополнительно содержать отсеки и/или реактивы, например, для амплификации нуклеиновых кислот или других ферментативных реакций, таких как реакции достройки праймера, гибридизация, лигирование, электрофорез (предпочтительно капиллярный электрофорез), масс-спектрометрия и/или обнаружение возбужденной лазером флуоресценции. Набор также может включать инструкции по использованию набора. Образцовые наборы, разделенные на отсеки, включают микрожидкостные устройства, известные в данной области (смотрите, например, Weigl et al., «Lab-on-chip for drug development», Adv Drug Deliv Rev. февраль 2003 года. 24; 55(3): 349-77). В таких микрожидкостных устройствах контейнеры могут быть обозначены, например, как микрожидкостные «отсеки», «камеры» или «каналы».

Микрожидкостные устройства, которые также могут быть обозначены как системы «лаборатория на чипе», биомедицинские микроэлектромеханические системы (bioMEM) или многокомпонентные интегрированные системы, представляют собой образцовые наборы/системы по настоящему изобретению для анализа SNP. В таких системах миниатюризированы и компартментализированы такие процессы, как реакции гибридизации зонда/мишени, амплификации нуклеиновых кислот и капиллярного электрофореза в одном функциональном устройстве. В таких микрожидкостных устройствах типично используют обнаруживающие реактивы по меньшей мере в одном аспекте системы, и такие обнаруживающие реактивы можно использовать для обнаружения одного или нескольких SNP по настоящему изобретению. Один пример микрожидкостной системы раскрыт в патенте США № 5589136, в котором описана интеграция амплификации ПЦР и капиллярного электрофореза в чипы. Образцовые микрожидкостные системы содержат паттерн микроканалов, сконструированных на стеклянной, кремниевой, кварцевой или пластмассовой пластине, содержащейся на микрочипе. Движением образцов можно управлять посредством электрических, электроосмотических или гидростатических сил, прикладываемых к различным областям микрочипа для создания функциональных микроскопических вентилей и насосов без подвижных деталей. Изменение напряжения можно использовать в качестве средства управления потоком текучего вещества на пересечениях между микроскопическими каналами и для изменения скорости потока текучего вещества для перекачивания через различные части микрочипа. Смотрите, например, патент США № 6153073, Dubrow et al., и патент США № 6156181, Parce et al.

Для генотипирования SNP, в микрожидкостную систему можно интегрировать, например, амплификацию нуклеиновых кислот, достройку праймера, капиллярный электрофорез, и способ обнаружения, такой как обнаружение возбужденной лазером флуоресценции.

Способы и наборы для обнаружения предрасположенности к развитию классических факторов риска CVD

Другая цель настоящего изобретения состоит в конкретной комбинации маркеров однонуклеотидного полиморфизма (SNP), ассоциированных с предрасположенностью к развитию классических факторов риска CVD и/или классических факторов риска осложнений CVD, включая в качестве неограничивающих примеров инфаркт миокарда, инсульт, стенокардию, транзиторные ишемические атаки, застойную сердечную недостаточность, аневризму аорты и смерть. Классические факторы риска CVD и/или осложнений CVD включают в качестве неограничивающих примеров сахарный диабет, высокие уровни общего холестерина, высокие уровни ЛНП-холестерина, низкие уровни ЛВП-холестерина, высокие уровни триглицеридов, ожирение, зависимость от курения, гипертензию и тромбоз.

К удивлению, конкретная комбинация маркеров SNP, включенная в настоящее изобретение, как приведено в таблице 2, доказала достижение высокой способности предсказывать развитие сахарного диабета относительно того, что получают с использованием способов, используемых в настоящее время, и/или посредством рассмотрения любых отдельных SNP, приведенных в таблице 2, и/или рассмотрения поднабора SNP, приведенных в таблице 2.

Таблица 2
SNP ГЕН Аллель риска
rs4506565 TCF7L2 T
rs7903146 TCF7L2 T
rs12255372 TCF7L2 T
rs4132670 TCF7L2 T
rs734312 WFS1 A
rs10811661 CDKN2B C
rs7756992 CDKAL1 G
rs1111875 HHEX A
rs7923837 HHEX A
rs9465871 CDKAL1 C
rs4430796 TCF2 G
rs564398 CDKN2B G
rs5219 KCNJ11 C
rs13266634 SLC30A8 T
rs5215 KCNJ11 C
rs1801282 PPARG G
rs7501939 TCF2 C
rs1801208 WSF1 G
rs2383208 CDKN2B G

Таким образом, в другом аспекте изобретение относится к способу определения наличия у пациента измененного риска обладания сахарным диабетом, который включает обнаружение в биологическом образце от указанного пациента присутствия полиморфизмов, представленных в таблице 2, где присутствие аллелей риска указывает на повышенный риск развития сахарного диабета.

К удивлению, конкретная комбинация маркеров SNP, включенных в настоящее изобретение, как приведено в таблице 3, доказала достижение высокой способности предсказывать развитие высоких уровней общего холестерина относительно того, что получают с использованием способов, используемых в настоящее время, и/или посредством рассмотрения любых отдельных SNP, приведенных в таблице 3, и/или рассмотрения поднабора SNP, приведенных в таблице 3.

Таблица 3
SNP ГЕН Аллель риска
rs12664989 ESR1 C
rs1801177 LPL A
rs268 LPL G
rs328 LPL G

Таким образом, в другом аспекте изобретение относится к способу определения наличия у пациента измененного риска обладания высокими уровнями общего холестерина, который включает обнаружение в биологическом образце от указанного пациента присутствия полиморфизмов, представленных в таблице 3, где присутствие аллелей риска указывает на повышенный риск развития высоких уровней общего холестерина.

К удивлению, конкретная комбинация маркеров SNP, включенных в настоящее изобретение, как приведено в таблице 4, доказала достижение высокой способности предсказывать развитие высоких уровней ЛНП-холестерина относительно того, что получают с использованием способов, используемых в настоящее время, и/или посредством рассмотрения любых отдельных SNP, приведенных в таблице 4, и/или рассмотрения поднабора SNP, приведенных в таблице 4.

Таблица 4
SNP ГЕН Аллель риска
rs4420638 APOC1 G
rs287479 chr13 A
rs11591147 PCSK9 T
rs599839 PSRC1 G
rs780094 GCKR T
rs12664989 ESR1 C
rs9322331 ESR1 T
rs7412 APOE C
rs693 APOB T

Таким образом, в другом аспекте изобретение относится к способу определения наличия у пациента измененного риска обладания высокими уровнями ЛНП-холестерина, который включает обнаружение в биологическом образце от указанного пациента присутствия полиморфизмов, представленных в таблице 4, где присутствие аллелей риска указывает на повышенный риск развития высоких уровней ЛНП-холестерина.

К удивлению, конкретная комбинация маркеров SNP, включенных в настоящее изобретение, как приведено в таблице 5, доказала достижение высокой способности предсказывать развитие низких уровней ЛВП-холестерина относительно того, что получают с использованием способов, используемых в настоящее время, и/или посредством рассмотрения любых отдельных SNP, приведенных в таблице 5, и/или рассмотрения поднабора SNP, приведенных в таблице 5.

Таблица 5
SNP ГЕН Аллель риска
rs2066715 ABCA1 T
rs2066718 ABCA1 A
rs2230808 ABCA1 A
rs505717 ZNF568 G
rs569371 Chr19 G
rs3734678 PDSS2 C
rs5882 CETP G
rs1800775 CETP C
rs708272 CETP T
rs7412 APOE T
rs328 LPL G
rs7007797 LPL G
rs2230806 ABCA1 A

Таким образом, в другом аспекте изобретение относится к способу определения наличия у пациента измененного риска обладания высокими уровнями ЛВП-холестерина, который включает обнаружение в биологическом образце от указанного пациента присутствия полиморфизмов, представленных в таблице 5, где присутствие аллелей риска указывает на повышенный риск развития высоких уровней ЛВП-холестерина.

К удивлению, конкретная комбинация маркеров SNP, включенных в настоящее изобретение, как приведено в таблице 6, доказала достижение высокой способности предсказывать развитие высоких уровней триглицеридов относительно того, что получают с использованием способов, используемых в настоящее время, и/или посредством рассмотрения любых отдельных SNP, приведенных в таблице 6, и/или рассмотрения поднабора SNP, приведенных в таблице 6.

Таблица 6
SNP ГЕН Аллель риска
rs7007075 Chr8 T
rs9322331 ESR1 T
rs780094 GCKR G
rs7007797 LPL G
rs4420638 APOC1 G
rs662799 APOA5 G
rs6589566 APOA5 G
rs651821 APOA5 C
rs2072560 APOA5 T
rs693 APOB T
rs1800775 CETP C
rs328 LPL G
rs1801177 LPL A
rs268 LPL G
rs320 LPL G
rs2230806 ABCA1 A
rs7412 APOE C

Таким образом, в другом аспекте изобретение относится к способу определения наличия у пациента измененного риска обладания высокими уровнями триглицеридов, который включает обнаружение в биологическом образце от указанного пациента присутствия полиморфизмов, представленных в таблице 6, где присутствие аллелей риска указывает на повышенный риск развития высоких уровней триглицеридов.

К удивлению, конкретная комбинация маркеров SNP, включенных в настоящее изобретение, как приведено в таблице 7, доказала достижение высокой способности предсказывать развитие ожирения относительно того, что получают с использованием способов, используемых в настоящее время, и/или посредством рассмотрения любых отдельных SNP, приведенных в таблице 7, и/или рассмотрения поднабора SNP, приведенных в таблице 7.

Таблица 7
SNP ГЕН Аллель риска
rs10510422 PPARG С
rs10510423 PPARG G
rs299629 PPARG G
rs2938392 PPARG Т
rs709157 PPARG А
rs963163 PPARG С
rs6602024 PFKP А
rs2229616 MC4R А
rs52820871 MC4R С
rs1106683 межгенный A
rs7566605 INSIG2 C
rs4471028 GDAP1 G
rs1121980 FTO T
rs1421085 FTO C
rs7193144 FTO C
rs8050136 FTO A
rs9930506 FTO G
rs9939609 FTO А
rs9940128 FTO А
rs10484922 ESR1 Т
rs3778099 ESR1 С
rs3853250 ESR1 С
rs6902771 ESR1 Т
rs851982 ESR1 С
rs9322361 ESR1 G
rs1044498 ENPP1 С
rs10490628 CCDC93 А
rs3771942 CCDC93 С
rs9284719 CCDC93 Т
rs4994 ADRB3 С
rs1042464 ADIPOQ Т

Таким образом, в другом аспекте изобретение относится к способу определения наличия у пациента измененного риска развития ожирения, который включает обнаружение в биологическом образце от указанного пациента присутствия полиморфизмов, представленных в таблице 7, где присутствие аллелей риска указывает на повышенный риск развития ожирения.

К удивлению, конкретная комбинация маркеров SNP, включенных в настоящее изобретение, как приведено в таблице 8, доказала достижение высокой способности предсказывать развитие зависимости от курения относительно того, что получают с использованием способов, используемых в настоящее время, и/или посредством рассмотрения любых отдельных SNP, приведенных в таблице 8, и/или рассмотрения поднабора SNP, приведенных в таблице 8.

Таблица 8
SNP ГЕН Аллель риска
rs4142041 CTNNA3 G
rs6474413 CHRNB3 С
rs1044397 CHRNA4 А

Таким образом, в другом аспекте изобретение относится к способу определения наличия у пациент измененного риска развития зависимости от курения, который включает обнаружение в биологическом образце от указанного пациента присутствия полиморфизмов, представленных в таблице 8, где присутствие аллелей риска указывает на повышенный риск развития зависимости от курения.

К удивлению, конкретная комбинация маркеров SNP, включенных в настоящее изобретение, как приведено в таблице 9, доказала достижение высокой способности предсказывать развитие гипертензии относительно того, что получают с использованием способов, используемых в настоящее время, и/или посредством рассмотрения любых отдельных SNP, приведенных в таблице 9, и/или рассмотрения поднабора SNP, приведенных в таблице 9.

Таблица 9
SNP ГЕН Аллель риска
rs11739136 KCNMB1 Т
rs4762 AGT Т
rs699 AGT С
rs4343 ACE G
rs4961 ADD1 T
rs2484294 ADRB1 G
rs1042711 ADRB2 С
rs17778257 ADRB2 Т
rs1042714 ADRB2 G
rs1800888 ADRB2 Т
rs1801704 ADRB2 С
rs2933249 AGTR1 Т
rs275652 AGTR1 С
rs387967 AGTR1 С
rs5186 AGTR1 С
rs11091046 AGTR2 А
rs1799983 NOS3 Т
rs1800779 NOS3 G
rs1800780 NOS3 G
rs1800782 NOS3 Т
rs1800783 NOS3 А
rs2070744 NOS3 С
rs867225 NOS3 А

Таким образом, в другом аспекте изобретение относится к способу определения наличия у пациента измененного риска развития гипертензии, который включает обнаружение в биологическом образце от указанного пациента присутствия полиморфизмов, представленных в таблице 9, где присутствие аллелей риска указывает на повышенный риск развития гипертензии.

К удивлению, конкретная комбинация маркеров SNP, включенных в настоящее изобретение, как приведено в таблице 10, доказала достижение высокой способности предсказывать развитие тромбоза относительно того, что получают с использованием способов, используемых в настоящее время, и/или посредством рассмотрения любых отдельных SNP, приведенных в таблице 10, и/или рассмотрения поднабора SNP, приведенных в таблице 10.

Таблица 10
SNP inclos ГЕН Аллель риска
rs234706 1 CBS A
rs6025 1 F5 A
rs6064 1 F7 A
rs2070011 1 FGA A
rs1800789 1 FGB A
rs1764391 1 GJA4 T
rs1062535 0 ITGA2 A
rs1126643 1 ITGA2 T
rs5918 1 ITGB3 C
rs1801131 1 MTHFR C
rs1801133 1 MTHFR T
rs11178 1 SERPINE1 C
rs2227631 1 SERPINE1 G
rs2228262 1 THBS1 G
rs1866389 1 THBS4 G
rs7007329 1 PLAT C
rs917859 1 VWF A

Таким образом, в другом аспекте изобретение относится к способу определения наличия у пациента измененного риска развития тромбоза, который включает обнаружение в биологическом образце от указанного пациента присутствия полиморфизмов, представленных в таблице 10, где присутствие аллелей риска указывает на повышенный риск развития тромбоз.

Другая цель настоящего изобретения состоит в способе оценки предрасположенности к развитию классических факторов риска CVD и/или классических факторов риска осложнений CVD, включая в качестве неограничивающих примеров сахарный диабет, высокие уровни общего холестерина, высокие уровни ЛНП-холестерина, низкие уровни ЛВП-холестерина, высокие уровни триглицеридов, ожирение, зависимость от курения, гипертензию и тромбоз, который включает обнаружение присутствия маркеров SNP, приведенных в таблицах 2-10.

Для вычисления генетического риска подсчитывают число аллелей риска, которые несет индивидуум, в различных генетических вариантах, ассоциированных с каждым метаболическим путем или фактором риска. Чем выше число присутствующих аллелей риска, тем выше риск развития каждого фактора риска.

Специалисты в данной области легко учтут то, что анализ нуклеотидов, присутствующих в маркерах SNP, включенных в таблицы 2-10, в нуклеиновой кислоте индивидуума можно выполнить любым способом или приемом, который позволяет определять нуклеотиды, присутствующие в полиморфном сайте. В данной области очевидно, что нуклеотиды, присутствующие в маркерах SNP, можно определить по любой цепи нуклеиновой кислоты или по обеим цепям. Обнаружение присутствия маркеров SNP, включенных в таблицы 2-10, осуществляют по биологическому образцу пациента. Биологический образец может представлять собой любой возможный образец, содержащий нуклеиновую кислоту, предпочтительно кровь, клетки или подфракции клеток (в случае клеток, выделенных из крови), слюну, мочу, биоптат и/или образец ткани.

Изобретение дополнительно относится к набору для определения присутствия маркеров SNP, содержащих целиком или частично: реактивы для амплификации фрагментов нуклеиновых кислот, содержащих маркеры SNP, обнаруживающие реактивы для генотипирования маркеров SNP и интерпретирующее программное обеспечение для анализа данных и оценки риска. Дополнительная цель настоящего изобретения заключается в функциях для вычисления предрасположенности к развитию классических факторов риска CVD и/или классических факторов риска осложнений CVD с учетом конкретной комбинации маркеров однонуклеотидного полиморфизма (SNP), ассоциированных с такой предрасположенностью.

Пример 1

План исследования

Данный случай - контрольное исследование с использованием информации in silico, происходящей из Wellcome Trust Case Control Consortium (WTCCC). Случаи (N=1988) выбирали из первой фазы исследования WTCCC. Как это описано в исходном исследовании, случаи коронарного заболевания сердца представляли прецеденты инфаркта миокарда или коронарной реваскуляризации (включая коронарное шунтирование или коронарную ангиопластику) в возрасте до 66 лет. Контролями являлись 2674 пациентов из доноров крови [UK Blood Services Controls (NBS)], включенные в проект WTCCC.

В этом примере анализировали SNP, перечисленные в таблице 1A. Проанализированные SNP: rs17465637, rs6725887, rs9818870, rs12526453, rs6922269, rs1333049, rs501120 (посредством анализа их LD rs1746048), rs17228212 и rs9982601. Для каждого из вариантов определяли аллель риска, то есть тот нуклеотид, в присутствие которого присваивали основной риск заболевания коронарным приступом.

Для вычисления расстановки генетического риска учитывали накопленное число аллелей риска по тем девяти SNP, присутствующим у каждого индивидуума. Для каждого исследованного варианта каждый индивидуум может иметь 0, 1 или 2 аллеля риска. Вычислив сумму аллелей риска, накопленных в наборе из выбранных вариантов (n=9), каждому индивидууму давали оценку, которая может принимать значения от 0 до 18 (низкая оценка=низкий риск, высокая оценка=высокий риск).

Чтобы учесть аддитивный эффект набора различных генетических вариантов, сначала анализировали распределение накопленного числа аллелей риска в случаях и в контролях, и различие в средних значениях расстановки генетических рисков между случаями и контролями сравнивали посредством критерия Стьюдента.

Затем использовали логистическую регрессию для оценки связи между расстановкой генетического риска и риском инфаркта миокарда и осуществляли несколько анализов:

a) Во-первых, эту переменную генетического риска учитывали в качестве категориальной переменной. В качестве эталонной группы рассматривали ту группу пациентов, несущих 7 аллелей риска, значение которой ближе всего к медиане в контролях и которая является группой с наибольшим числом индивидуумов, которое позволяет получить наиболее точные оценочные функции риска. Оценивали OR (нечеткое отношение) для каждой категории расстановки генетических рисков (группа носителей 8 аллелей против носителей 7 аллелей; носители 9 аллелей против 7; носители 6 аллелей против 7; и так далее);

b) Во-вторых, OR вычисляли посредством увеличения аллеля риска, принимая эту переменную в качестве непрерывной переменной и полагая, что риск является константой для увеличения аллеля в диапазоне наблюдаемых значений, и анализировали линейность связи между числом аллелей и риском инфаркта миокарда.

c) В-третьих, повторяли анализ, изложенный в параграфе a), но группы определяли на основе квантилей расстановки генетического риска, полученных в контрольной группе, и принимая в качестве эталона первый квантиль.

Также анализировали существование взаимодействий между генетическими вариантами, представляющими интерес, чтобы определить, превосходил ли эффект комбинации одинаковых генетических вариантов аддитивный эффект. Для всех этих анализов значения p<0,05 считали статистически значимыми. Анализы осуществляли посредством программы на R.

Результаты

На фиг.1 представлено распределение числа аллелей риска в случаях и контролях (также смотрите таблицу 11).

В обеих группах наблюдали одинаковую форму распределения, однако имеет место смещение вправо для числа аллелей в случаях (среднее аллелей риска [типичное отклонение] 7,9 [1,8] в случаях и 6,8 [1,8] в контролях, значение p=2×10-16). Для определения того, является ли повышение риска постоянным в различных группах, определяемых числом аллелей, вычисляли величину риска для коронарного заболевания сердца в каждой группе, принимая в качестве эталона группу с 7 аллелями риска. На фиг.2 представлены OR и коэффициент регрессии (β) для каждой группы по отношению к эталонной группе, изменение значения коэффициента регрессии (Δβ) между последующими категориями, и значения p, полученные посредством точного критерия Фишера, для различий между случаями и контролями. На фиг.1 приведено графическое представление полученного коэффициента регрессии (β).

Увеличение риска для увеличения аллеля выглядит постоянным в диапазоне наблюдаемых значений. Для количественного определения этого увеличения на аллель переменное число аллелей рассматривали в качестве непрерывной переменной, и установили, что OR на приращение в аллеле составляло 1,18 (доверительная область при 95%: 1,15-1,22; p=2×10-16); эта линейная модель объясняет 92% изменчивости для получаемых значений β.

Когда в этих анализах выполняли взвешивание каждого выбранного варианта по величине его индивидуального эффекта, результаты были почти идентичными (OR для увеличения аллеля=1,18; доверительная область при 95%: 1,14-1,21).

Не наблюдали статистически значимое взаимодействие между генетическими вариантами; этот результат также подтверждает аддитивный эффект анализируемых вариантов.

Результаты анализа, которые определяют 5 групп, соответствующих квантилям числа аллелей риска, и принимают в качестве эталона квантиль с наименьшем числом аллелей, представлены на фиг.3. Приращения риска (Δβ) между последующими квантилями схожи (среднее увеличение β: 0,198), и наблюдаемое OR между концами составляет 2,21 (фиг.4).

Заключение

Авторы настоящего изобретения подтвердили, что связь между числом аллелей риска и риском коронарного заболевания сердца является линейной и прямой, поэтому при более высоком числе аллелей риска вероятность присутствия коронарного заболевания сердца выше. Эту линейную связь наблюдали для других фенотипов, таких как артериальное кровяное давление и диабет.

Значимость наблюдаемой связи, установленная посредством коэффициента регрессии, схожа с таковой, наблюдаемой в некоторых классических факторах сердечно-сосудистого риска, включенных в функции коронарного риска. Например, в функции риска Framingham и ее адаптациях разница у мужчин между коэффициентами регрессии концов для переменной холестерин (<160 и ≥280 мг/дл) составляет 1,32 (что будет соответствовать OR, равному 3,74) и для переменной кровяное давление (идеальное и гипертензия II-III степени) составляет 0,62 (OR=1,86). В анализах в настоящем изобретении разница между коэффициентом регрессии крайних категорий квантилей числа аллелей составляет 0,79 (OR=2,20), подобно значениям артериального кровяного давления; и учитывая число аллелей и принимая группу 4 и 12 в качестве концов аллелей риска, разница в коэффициентах регрессии составляет 1,05 (OR=2,86), немного ниже таковой для холестерина.

В заключение, результаты этого исследования показывают, что этот тип расстановки генетического риска для коронарного заболевания сердца, который основан на аддитивном эффекте числа аллелей риска в различных генетических маркерах, которые независимы от классических факторов сердечно-сосудистого риска, ассоциирован с более высоким риском коронарного заболевания сердца.

Аллели Число контролей Число случаев OR [95%CI] β Δβ значение p
1 0 1 3,13 [0,04-245,35] 1,141 1,603 4Ч10-01
2 2 1 0,63 [0,01-5,62] -0,462 0,192 1Ч10-01
3 24 8 0,52 [0,21-1,13] -0,654 -0,298 1Ч10-01
4 85 38 0,70 [0,47-1,01] -0,356 -0,042 5Ч10-02
5 269 127 0,74 [0,58-0,93] -0,314 -0,231 7Ч10-03
6 430 254 0,92 [0,77-1,11] -0,083 -0,083 4Ч10-01
7 592 379 1 0 0 1 Эталонная группа
8 550 410 1,16 [0,99-1,37] 0,148 0,148 7Ч10-02
9 395 389 1,54 [1,30-1,83] 0,432 0,284 5Ч10-07
10 217 230 1,65 [1,35-2,02] 0,501 0,069 7Ч10-07
11 80 107 2,09 [1,58-2,76] 0,737 0,236 2Ч10-07
12 25 32 2,00 [1,22-3,23] 0,693 -0,044 4Ч10-03
13 4 11 4,30 [1,56-12,41] 1,458 0,765 2Ч10-02
14 0 1 3,13 [0,04-245,35] 1,141 -0,317 4Ч10-01

СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ

<110> Gendiag. Exe, SL

<120> МАРКЕРЫ РИСКА СЕРДЕЧНО-СОСУДИСТОГО ЗАБОЛЕВАНИЯ

<130> 142093

<160> 15

<170> PatentIn version 3.4

<210> 1

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 1

tcatactaac catatgatca acagttcaaa agcagccact cgcagaggta ag 52

<210> 2

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 2

aaagagaaag aaataggagc aggatcaact tccagatata cagagaatat aa 52

<210> 3

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 3

aaccataata gttatgctga gaagttcttt tttgtcatag tgcaagataa ca 52

<210> 4

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 4

ttgaaaaaaa ttaattctca cactcctaag tgcatttaat ttaagctact tt 52

<210> 5

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 5

aaaagcaagc acatctgtgg cattaccaac attaaatatt tatatacata gt 52

<210> 6

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 6

acagttttta ctgtaactgc caataaataa tactcatctt taaaaagaca tc 52

<210> 7

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 7

ggcaagtacc tgggcacagg gctgcttcat ggccttggac ctggacagtg ga 52

<210> 8

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 8

acatctgcct ctctagacta taaactcttt ggggctaggt cttctttgtc tt 52

<210> 9

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 9

gctatcattt aaatttggtt gagacacaat atgctgttgc actttctata aa 52

<210> 10

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 10

ctgtgctgct tggtgcctct ctgatatgaa tacactgaca cgtcaaagta ac 52

<210> 11

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 11

cttgctccag catccaggag gtccggtggt gcacacggct tgagatgcct ga 52

<210> 12

<211> 61

<212> ДНК

<213> Homo sapiens

<400> 12

agatcacact gtctttgccg tcattgaact cgcaacctaa ctgctgagtg aggacacgtc 60

c 61

<210> 13

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 13

gaagggtaaa gggtggtagg attgagtgag tcaggccaga aacctctagt ta 52

<210> 14

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 14

aggacaatgc tcaccctctt tgcaccgcta tcacatcacc tgttcagggc ac 52

<210> 15

<211> 52

<212> ДНК

<213> Homo sapiens

<400> 15

tacaggattc aacaattagt caaaaagtca tgagctaaca aaataggagc tt 52

1. Способ определения наличия у пациента повышенного риска обладания сердечно-сосудистым заболеванием или нарушением, включающий стадии определения в образце, выделенном у указанного пациента, идентичности полиморфизмов SEQ ID NO: 1 (rs1333049, аллель риска: С), SEQ ID NO: 3 (rs17465637, аллель риска: С), SEQ ID NO: 4 (rs501120, аллель риска: Т), SEQ ID NO: 6 (rs6922269, аллель риска: A), SEQ ID NO: 7 (rs9982601, аллель риска: Т), SEQ ID NO: 8 (rs12526453, аллель риска: С), SEQ ID NO: 9 (rs6725887, аллель риска: С), SEQ ID NO: 10 (rs9818870, аллель риска: Т), SEQ ID NO: 12 (rs17228212, аллель риска: С) в качестве указания на повышенный риск обладания сердечно-сосудистым заболеванием или нарушением.

2. Способ по п.1, где сердечно-сосудистое заболевание выбирают из группы: инфаркта миокарда, инсульта, стенокардии, транзиторных ишемических атак, застойной сердечной недостаточности, аневризмы аорты или их сочетания.

3. Способ идентификации пациента, который нуждается в ранней и/или агрессивной терапии сердечно-сосудистого заболевания или в профилактической терапии сердечно-сосудистого заболевания, включающий стадии определения в образце, выделенном у указанного пациента, идентичности полиморфизмов SEQ ID NO: 1 (rs1333049, аллель риска: С), SEQ ID NO: 3 (rs17465637, аллель риска: С), SEQ ID NO: 4 (rs501120, аллель риска: Т), SEQ ID NO: 6 (rs6922269, аллель риска: A), SEQ ID NO: 7 (rs9982601, аллель риска: Т), SEQ ID NO: 8 (rs12526453, аллель риска: С), SEQ ID NO: 9 (rs6725887, аллель риска: С), SEQ ID NO: 10 (rs9818870, аллель риска: Т), SEQ ID NO: 12 (rs17228212, аллель риска: С), которая указывает на обладание пониженным ответом на терапию сердечно-сосудистого заболевания или на потребность ранней и агрессивной терапии сердечно-сосудистого заболевания или потребность профилактического лечения сердечно-сосудистого заболевания.

4. Способ по п.1, который дополнительно включает обнаружение одного или нескольких факторов риска сердечно-сосудистых заболеваний или нарушений, выбранных из группы, состоящей из возраста, расы, пола, индекса массы тела, кровяного давления, статуса курения, уровня липопротеинов низкой плотности (ЛНП)- или липопротеинов высокой плотности (ЛВП)-холестерина, систолического кровяного давления, диастолического кровяного давления, анамнеза сердечной недостаточности, диабета, почечной недостаточности, гипертрофии левого желудочка, анамнеза употребления алкоголя, анамнеза курения, анамнеза тренировок, диеты и семейного анамнеза сердечно-сосудистых заболеваний или нарушений.

5. Способ по п.1, где образец представляет собой образец ткани ротовой полости, соскоб или смыв или образец биологической жидкости, предпочтительно слюны, мочи или крови.

6. Способ по п.1, где присутствие или отсутствие полинуклеотида идентифицируют посредством амплификации или ошибок при амплификации продукта амплификации по образцу, где продукт амплификации предпочтительно расщепляют рестрикционным ферментом перед анализом и/или где SNP идентифицируют посредством гибридизации образца нуклеиновой кислоты с меченым праймером, который представляет собой поддающийся обнаружению фрагмент.

7. Способ лечения пациента, страдающего сердечно-сосудистым заболеванием, с использованием терапии сердечно-сосудистого заболевания, где пациента выбирают для указанной терапии на основе идентичности в образце, выделенном у указанного пациента, полиморфизмов SEQ ID NO: 1 (rs1333049, аллель риска: С), SEQ ID NO: 3 (rs17465637, аллель риска: С), SEQ ID NO: 4 (rs501120, аллель риска: Т), SEQ ID NO: 6 (rs6922269, аллель риска: A), SEQ ID NO: 7 (rs9982601, аллель риска: Т), SEQ ID NO: 8 (rs12526453, аллель риска: С), SEQ ID NO: 9 (rs6725887, аллель риска: С), SEQ ID NO: 10 (rs9818870, аллель риска: Т), SEQ ID NO: 12 (rs17228212, аллель риска: С).

8. Способ по п.7, где сердечно-сосудистое заболевание выбирают из группы: инфаркта миокарда, инсульта, стенокардии, транзиторных ишемических атак, застойной сердечной недостаточности, аневризмы аорты или их сочетания.

9. Набор для определения наличия у пациента повышенного риска обладания сердечно-сосудистым заболеванием или нарушением, содержащий реактивы для определения идентичности полиморфизмов SEQ ID NO: 1 (rs1333049, аллель риска: С), SEQ ID NO: 3 (rs17465637, аллель риска: С), SEQ ID NO: 4 (rs501120, аллель риска: Т), SEQ ID NO: 6 (rs6922269, аллель риска: A), SEQ ID NO: 7 (rs9982601, аллель риска: Т), SEQ ID NO: 8 (rs12526453, аллель риска: С), SEQ ID NO: 9 (rs6725887, аллель риска: С), SEQ ID NO: 10 (rs9818870, аллель риска: Т), SEQ ID NO: 12 (rs17228212, аллель риска: С).

10. Набор по п.9, который содержит один или несколько пар праймеров, обладающих специфичностью к полиморфизмам SEQ ID NO: 1 (rs1333049, аллель риска: С), SEQ ID NO: 3 (rs17465637, аллель риска: С), SEQ ID NO: 4 (rs501120, аллель риска: Т), SEQ ID NO: 6 (rs6922269, аллель риска: A), SEQ ID NO: 7 (rs9982601, аллель риска: Т), SEQ ID NO: 8 (rs12526453, аллель риска: С), SEQ ID NO: 9 (rs6725887, аллель риска: С), SEQ ID NO: 10 (rs9818870, аллель риска: Т), SEQ ID NO: 12 (rs17228212, аллель риска: С).



 

Похожие патенты:

Группа изобретений относится к измерению объема или концентрации биологических веществ. Представлено измерительное устройство с кожухом и по меньшей мере одним дисплеем, интегрированным в кожух, при этом кожух содержит отсек, предназначенный для вставки картриджа в кожух с целью доставки в устройство предназначенного для измерения образца, и при этом отсек имеет отверстие на передней части кожуха, и первая часть кожуха для вставки картриджа выступает под углом ко второй части кожуха.
Изобретение относится к области медицины, а именно к лабораторной диагностике. Способ диагностики AL-амилоидоза заключается в том, что каплю биологической жидкости с кристаллоиндуктором подвергают клиновидной дегидратации и затем полученную фацию анализируют под микроскопом с использованием количественных критериев.

Изобретение относится к медицине, в частности к хирургии, травматологии, трансплантологии, кумбостиологии, и представляет собой способ изготовления дермального матрикса (ДМ).
(57) Способ относится к области медицины и предназначено для ранней диагностики некротизирующего энтероколита у новорожденных. Способ включает определение трансферрина и свободного гемоглобина в кале.
Изобретение относится к медицине, а именно к онкоурологии, и может быть использовано для выбора тактики лечения местно-распространённого рака предстательной железы.
Изобретение относится к медицине, в частности к педиатрии, и описывает способ прогнозирования динамики течения муковисцидоза, выявленного путем неонатального скрининга, основанный на учете пола, возраста, уровня гемоглобина, лейкоцитов, АлАТ, АсАТ, С-реактивного белка, вида бактериальной флоры в мазках из носа и в мазках из зева, уровня хлоридов пота, в котором определяют коэффициент прогноза динамики течения муковисцидоза (Кдм) с использованием регрессионного управления: Кдм=3,21946+0,526873*пол - 0,0488185*возраст - 0,0125638*гемоглобин+0,0302588*лейкоциты - 0,0418016*АлАТ+0,00832224*АсАТ+0,0736644*СРБ+; 0,238719* флора из носа+0,442044* флора из зева - 0,00669528*хлориды пота, где: пол - для мальчиков обозначают цифрой 1, для девочек цифрой 0; возраст - количество полных месяцев на момент обследования; гемоглобин - уровень гемоглобина в периферической крови в граммах на литр, лейкоциты - количество лейкоцитов в кубическом миллиметре периферической крови; АлАТ - уровень аланин-аминотрансферазы в венозной крови в единицах на литр; АсАТ - уровень аспартат-аминотрансферазы в венозной крови в единицах на литр; СРБ - уровень с-реактивного белка в миллиграммах на литр; флора из носа и флора из зева - вид бактериальной флоры в мазках из носа или из зева: 1 стрептококк, 2 синегнойная палочка; 3 стафилококк; 4 грибы; 5 рост флоры отсутствует (мазок стерилен); 6 энтерококк; 7 коринобактерии; 8 нейсерия; 9 ацинетобактер; 10 кишечная палочка; 11 цитробактер; 12 клебсиелла; 13 стернотофомонас; 14 гемофилийная палочка; 15 моракселла; 16 прочие виды флоры; хлориды пота - уровень хлоридов пота в ммоль/л; если величина коэффициента менее 2,3, прогнозируют течение заболевания без отрицательной динамики; если коэффициент 2,3 и более, прогнозируют течение муковисцидоза с ухудшением состояния.

Настоящая группа изобретений относится к медицине, а именно к медицинской диагностике, и касается калибратора для синхронного анализа белков, способных к комплексообразованию друг с другом.
Изобретение относится к медицине, педиатрии, перинатологии, детской неврологии и может быть использован для ранней диагностики нарушения движений у детей с перинатальным поражением нервной системы.

Изобретение относится к медицине, а именно к травматологии и ортопедии, и может быть использовано для прогнозирования риска развития стрессовых переломов костей нижних конечностей.

Изобретение относится к медицине и может быть использовано для электрохимического определения антиоксидантной активности биологических жидкостей, например плазмы или сыворотки крови.
Изобретение относится к области молекулярной биологии и генной инженерии. Предложены способ и набор для детекции малопредставленных фракций РНК в биологическом образце и для детекции микоплазменного загрязнения, для чего используют операции обратной транскрипции РНК в кДНК с использованием обратной транскриптазы Thermus thermophilus (rTth-pol) в условиях "горячего старта", инактивации ОТ обработкой хаотропным средством, детекции представляющей интерес кДНК посредством полимеразной цепной реакции (ПЦР).

Настоящее изобретение относится к области биотехнологии и касается способа амплификации и детекции нуклеотидных последовательностей в реакционной смеси и набору, используемому в этом способе.
Изобретение относится к области биохимии. Проводят количественную оценку эффективности олеиновой кислоты как переносчика РНК через биологические мембраны.

Изобретение относится к области биотехнологии и касается синтетических олигонуклеотидов-праймеров. Представленные праймеры фланкируют участки генов PB2, PB1, PA, NP, MP, NS низкопатогенных вирусов гриппа птиц и не дают перекрестных реакций с родственными видам.

Группа изобретений относится к области биотехнологии. Способ определения уровня экспрессии гена МСР1 (CCL2) предусматривает оценку количества его мРНК методом полимеразной цепной реакции (ОТ-ПЦР) с детекцией сигнала в реальном времени в образцах клеток, тканей и биологических жидкостей человека.

Изобретение относится к области медицины, генетической инженерии и молекулярной биологии. Предложен способ мониторинга рака молочной железы у субъекта.

Изобретение относится к области биохимии, в частности к применению QTL аллеля, ассоциированного с устойчивостью к Bemisia для придания устойчивости к Bemisia растения Capsicum annuum.

Изобретение относится к биотехнологии и представляет собой способ определения у спортсмена состояния утомления и состояния «перетренированности» по повышенной экспрессии гена триптофинил-тРНК-синтетазы (ТРСазы).

Изобретение относится к области микробиологии и паразитологии микроорганизмов. Способ предусматривает рестрикционный анализ бактериальной ДНК бластоцист с использованием комбинации эндонуклеаз рестрикции - Нае III, Pst I и Hind III, позволяющих идентифицировать простейших с различной степенью вирулентности.

Изобретение относится к биотехнологии и представляет собой способ оценки воспаления и/или резистентности к инсулину у животного путем количественного определения присутствия анализируемого вещества в сыворотке или плазме.

Изобретение относится к области биотехнологии и касается набора для выявления Ку-лихорадки методом ПЦР-РВ. Охарактеризованный набор содержит синтетические олигонуклеотиды, ограничивающие фрагмент гена groEL: GroEL F 5′ CTTCTACTGTTATGACGCCTTCTTTGC 3′ GroEL R 5′ CGCAAGTAGGCACCATTTCTGC 3′, и флуоресцентный зонд: GroEL Probe 5′ FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3′. Изобретение может быть использовано в медицине, ветеринарии, клинической лабораторной диагностике для выявления ДНК бактерии Coxiella burnetii в пробах, а также для решения научно-исследовательских задач по изучению данного микроорганизма. 2 табл., 2 пр.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения наличия у пациента повышенного риска обладания сердечно-сосудистым заболеванием или нарушением по полиморфным вариантам генов. Предложен способ идентификации пациента, который нуждается в ранней иили агрессивной или профилактической терапии сердечно-сосудистого заболевания и способ лечения такого пациента. Предложенная группа изобретений обеспечивает эффективные способы и наборы для определения риска обладания сердечно-сосудистым заболеванием, что позволяет идентифицировать пациента, который нуждается в терапии сердечно-сосудистого заболевания. 4 н. и 6 з.п. ф-лы, 4 ил., 18 табл., 1 пр.

Наверх