Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения



Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения
Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения
Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения
Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения
Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения
Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения
Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения
Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения
Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения
Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения
Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения
Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения
Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты и способ ее получения

 


Владельцы патента RU 2535995:

Общество с ограниченной ответственностью "ИнтерЛабСервис" (RU)

Изобретение относится к области молекулярной биологии и биотехнологии и касается сухой смеси для амплификации нуклеиновой кислоты и способа ее получения. Охарактеризованная смесь содержит термостабильную ДНК-полимеразу, обратную транскриптазу, первый стабилизатор, выбранный из группы, включающей моносахариды, дисахариды, полиспирты и второй стабилизатор, выбранный из группы, включающей полисахариды, альбумины, поливинилпирролидон. При осуществлении способа получения сухой смеси готовят водный раствор, содержащий указанные выше вещества, и лиофилизируют его. Полученный продукт может храниться до 1 года при температуре выше 0°С с сохранением активностей обратной транскриптазы и ДНК-полимеразы. Представленные изобретения могут быть использованы для амплификации как одновременно ДНК и РНК, так и по отдельности. 2 н. и 24 з.п. ф-лы, 13 ил., 7 табл., 4 пр.

 

Область техники

Настоящее изобретение относится к области молекулярной биологии и биотехнологии, в частности к способу получения сухой смеси для амплификации нуклеиновой кислоты, содержащей обратную транскриптазу и термостабильную ДНК-полимеразу, и может быть использовано в различных областях техники, в которых применяется анализ, основанный на методе полимеразной цепной реакции.

Уровень техники

Метод полимеразной цепной реакции (ПЦР) широко используется в различных областях техники. ПЦР позволяет увеличивать количество специфической нуклеотидной последовательности в миллионы раз. В основе ПЦР лежит способность фермента ДНК-полимеразы, используя в качестве затравки синтетические одноцепочечные олигонуклеотиды (праймеры), ограничивающие амплифицируемый фрагмент с двух сторон, синтезировать из нуклеотидтрифосфатов комплементарную цепь. Благодаря простоте и специфичности метод ПЦР широко используется в научно-исследовательских целях, в пищевой промышленности, в сельском хозяйстве, в медицине, в частности для диагностики различных заболеваний и выявления возбудителей инфекций.

Основными компонентами реакционной смеси для проведения ПЦР являются термостабильный фермент, осуществляющий синтез комплементарной цепи, нуклеотидтрифосфаты, ионы Mg2+, матрица и специфичные праймеры, способные отжигаться на комплементарной последовательности матрицы. Одной из главных сложностей при хранении реагентов для амплификации является сохранение активности ферментов в течение длительного времени. Ферменты обычно хранят в глицериновом растворе при температуре ниже минус 20°С. Оттаивание и нагревание ферментов при транспортировке и приготовлении реакционной смеси может привести к снижению и потере их ферментативной активности. Увеличить срок хранения биологически активных веществ, в частности ферментов, можно посредством высушивания.

Одним из способов сохранения биологически активных веществ, в частности ферментов, является лиофилизация. Лиофилизация (лиофильная сушка, сублимационная сушка) представляет собой процесс удаления воды из замороженного материала при низком атмосферном давлении. В водном растворе ферменты окружены гидратной оболочкой, образованной молекулами воды, связанными с поверхностью белка водородными связями. Такая водная оболочка стабилизирует фермент и обеспечивает поддержание его активности. Стабилизация пространственной структуры происходит за счет того, что молекулы воды фиксируют взаимное расположение отдельных белковых групп, препятствуя их непосредственным взаимодействиям и образованию межмолекулярных связей в макромолекуле. В процессе сушки может происходить изменение трехмерной структуры белка, что приводит к нарушению его активности.

Для предотвращения изменения структуры белка в процессе лиофилизации используют стабилизаторы и криопротекторы. В качестве стабилизаторов для сохранения активности белков и ферментов известно использование таких соединений, как маннитол и лактоза (ЕР 0431882 А2), пентоза и некоторые дисахариды (US 4,451,569), сахароза, мальтоза и трегалоза (Carpenter et al., Stabilization of phosphofructokinase during air-drying with sugars and sugar/transition metal mixtures. Cryobiology 24: 455-464 (1987)). Однако эффективность, приемлемость и преимущества использования тех или иных соединений в качестве добавок для лиофилизации существенно зависят от структуры биологически активного материала, который необходимо стабилизировать.

Для стабилизации ПЦР-смесей, содержащих ДНК-полимеразу, известно использование FICOLL, сорбитола или сахарозы (US 6153412 и US 5861251), целлобиозы, позволяющей поддерживать активность при температуре до 55°C (WO 2010133628 (A1)), сочетания дисахарида и карбопола-940 (ЕР 1498492 (В1)). Также известна сухая смесь реагентов для полимеразной цепной реакции, содержащая ДНК-полимеразу и стабилизатор, в качестве которого использованы 0,16% D-глюкозы, 1,6% инулина, 8% D-маннитола. При этом для проведения ПЦР-анализа сухую смесь реагентов растворяют буферным раствором, в состав которого входят ионы магния, а затем добавляют специфичные праймеры и анализируемую ДНК (патент РФ №2259401).

Другим способом стабилизации Taq-полимеразы является добавление в реакционную смесь перед лиофилизацией стабилизирующего вещества, в качестве которого используют казеин или БСА, и второй стабилизирующей молекулы, в качестве которой используют аптамер. Заявленная сухая смесь сохраняет активностьЮ, достаточную для проведения ПЦР при ее восстановлении после хранения в течение одной недели при комнатной температуре (ЕР 2202302 (A1)).

Также из предшествующего уровня техники известен способ получения стабилизированной композиции, которая может быть использована для амплификации молекул РНК методом NASBA. Лиофилизированная смесь содержит обратную транскриптазу, РНК-полимеразу, и криопротектор, в качестве которого заявлены трегалоза и поливинилпирролидон (ЕР 0726310 (В1)).

Амплификацию молекул РНК с использованием ДНК-полимеразы проводят в две стадии: на первой стадии за счет обратной транскрипции получают кДНК, на второй стадии синтезированную кДНК амплифицируют с помощью ПЦР и детектируют либо в режиме реального времени, либо после окончания реакции амплификации. Совмещение обратной транскрипции и ПЦР в одной пробирке позволяет снизить риск контаминации, а также ускорить и упростить анализ за счет уменьшения количества манипуляций. В то же время требуется подбор условий и состава реакционной смеси для обеспечения и поддержания РНК-зависимой ДНК-полимеразной и ДНК-зависимой ДНК-полимеразной активностей ферментов.

На сегодняшний день существует необходимость предоставления способа получения стабильных сухих смесей для амплификации нуклеиновых кислот, содержащих обратную транскриптазу и термостабильную ДНК-полимеразу, характеризующихся возможностью длительного хранения при температуре выше 0°С.

Раскрытие изобретения

Технической задачей, решаемой авторами настоящего изобретения, является предоставление способа получения стабильной сухой смеси, предназначенной для амплификации нуклеиновых кислот, а именно смеси, содержащей по крайней мере два фермента, представляющих собой термостабильную ДНК-полимеразу и обратную транскриптазу. Технический результат достигается благодаря лиофилизации водного раствора для амплификации нуклеиновой кислоты с использованием как минимум двух стабилизаторов. Заявленный способ позволяет получать гомогенную и в то же время легкорастворимую смесь. Полученные заявленным способом смеси имеют длительный срок хранения при температуре выше 0°С и обладают высокой стабильностью. Настоящее изобретение также упрощает проведение анализа, основанного на исследовании нуклеиновых кислот, и дает возможность варьирования состава смеси в зависимости от целей исследования.

Целью настоящего изобретения является предоставление способа получения сухой смеси для амплификации нуклеиновой кислоты, включающего следующие стадии:

- приготовление водного раствора для амплификации нуклеиновой кислоты, содержащего по крайней мере два фермента, представляющих собой ДНК-полимеразу и обратную транскриптазу, и как минимум два стабилизатора,

- лиофилизацию указанного водного раствора.

Также целью настоящего изобретения является предоставление способа, в котором водный раствор реакционной смеси для амплификации нуклеиновой кислоты содержит термостабильную ДНК-полимеразу и обратную транскриптазу.

Также целью настоящего изобретения является предоставление способа, в котором термостабильная ДНК-полимераза представляет собой Taq-полимеразу из Thermus aquaticus.

Также целью настоящего изобретения является предоставление способа, в котором термостабильная ДНК-полимераза представляет собой hot-start ДНК-полимеразу.

Также целью настоящего изобретения является предоставление способа, в котором обратная транскриптаза представляет собой обратную транскриптазу вируса лейкемии мышей (M-MLV обратную транскриптазу).

Также целью настоящего изобретения является предоставление способа, в котором водный раствор содержит праймеры и олигонуклеотидный зонд для детекции, содержащий флуоресцентную метку.

Также целью настоящего изобретения является предоставление способа, в котором водный раствор содержит буферные компоненты и нуклеотидтрифосфаты.

Также целью настоящего изобретения является предоставление способа, в котором водный раствор содержит буферные компоненты, ионы магния и нуклеотидтрифостфаты

Также целью настоящего изобретения является предоставление способа, в котором водный раствор содержит ионы магния, буферные компоненты, нуклеотидтрифосфаты, праймеры и олигонуклеотидный зонд для детекции.

Также целью настоящего изобретения является предоставление способа, в котором праймеры и олигонуклеотидный зонд для детекции представляют собой праймеры и олигонуклеотидный зонд для выявления вируса гепатита С.

Также целью настоящего изобретения является предоставление способа, в котором водный раствор для амплификации нуклеиновой кислоты представляет собой раствор для осуществления реакции обратной транскрипции, совмещенной с полимеразной цепной реакцией.

Также целью настоящего изобретения является предоставление способа, в котором водный раствор для амплификации нуклеиновой кислоты представляет собой раствор для осуществления реакции обратной транскрипции, совмещенной с полимеразной цепной реакцией в реальном времени.

Также целью настоящего изобретения является предоставление способа, в котором водный раствор для осуществления реакции обратной транскрипции, совмещенной с мультиплексной полимеразной цепной реакцией.

Также целью настоящего изобретения является предоставление способа, в котором в качестве стабилизаторов используют соединения, выбранные из группы, включающей углеводы, полиспирты, полимеры, белки, аминокислоты или их различные комбинации.

Также целью настоящего изобретения является предоставление способа, в котором углевод представляет собой полисахарид, дисахарид или моносахарид.

Также целью настоящего изобретения является предоставление способа, в котором дисахарид представляет собой трегалозу или сахарозу.

Также целью настоящего изобретения является предоставление способа, в котором полимер представляет собой декстран.

Также целью настоящего изобретения является предоставление способа, в котором в качестве стабилизаторов используют углевод и полимер.

Также целью настоящего изобретения является предоставление способа, в котором в качестве стабилизаторов используют дисахарид и декстран.

Также целью настоящего изобретения является предоставление способа, в котором в качестве стабилизаторов используют трегалозу и декстран.

Также целью настоящего изобретения является предоставление способа, в котором в качестве стабилизатора используют 1-25% трегалозу.

Также целью настоящего изобретения является предоставление способа, в котором в качестве стабилизатора используют 0,1-10% декстран с молекулярной массой 50000-200000 Да.

Также целью настоящего изобретения является предоставление способа, в котором лиофилизация включает стадии замораживания, первичной и вторичной сушки.

Также целью настоящего изобретения является предоставление способа, в котором лиофилизацию указанного водного раствора осуществляют в пробирках, стрипах или плашках.

Также целью настоящего изобретения является предоставление сухой смеси для амплификации нуклеиновой кислоты, содержащей по крайней мере два фермента, представляющих собой ДНК-полимеразу и обратную транскриптазу, и как минимум два стабилизатора, полученной по любому из вышеописанных способов.

Осуществление изобретения

Настоящее изобретение предоставляет способ получения сухой смеси для амплификации нуклеиновой кислоты, которая содержит по крайней мере два фермента, представляющих собой ДНК-полимеразу и обратную транскриптазу. Для получения сухой смеси готовят водный раствор, содержащий ДНК-полимеразу и обратную транскриптазу, указанный водный раствор может дополнительно содержать один или несколько компонентов реакционной смеси. Полученный водный раствор может быть обработан с целью удаления воды, в частности с помощью метода лиофилизации. Полученная после удаления воды реакционная смесь может быть названа согласно настоящему изобретению «сухая смесь». Сухая смесь согласно настоящему изобретению может быть названа «лиофилизированная смесь», если она получена методом лиофилизации.

Согласно настоящему изобретению водный раствор для амплификации нуклеиновой кислоты представляет собой раствор, который может содержать один или несколько компонентов, необходимых для проведения реакции амплификации. Перечень компонентов реакционной смеси, которые могут присутствовать в водном растворе, включает ферменты, буферные компоненты, ионы магния, нуклеотидтрифосфаты, олигонуклеоитидные праймеры, олигонуклеотидный зонд для детекции или краситель, ДНК- или РНК-матрицу, но не ограничивается перечисленными компонентами. В зависимости от целей и применения состав смеси для амплификации может варьировать.

Реакционная смесь (водный раствор для амплификации нуклеиновой кислоты) может быть полной, если она содержит все реагенты, необходимые для проведения реакции, и неполной, если она содержит только часть необходимых реагентов. Для специалиста в данной области техники очевидно, что для проведения реакции амплификации сухая смесь может быть восстановлена раствором, содержащим недостающие реагенты, кроме того, недостающие реагенты могут быть добавлены в восстановленную смесь как по отдельности, так и вместе, непосредственно перед началом реакции амплификации.

Водный раствор может содержать дополнительные компоненты реакционной смеси, необходимые для мониторинга накопления реакции амплификации, например, олигонуклеотидные зонды для детекции или интеркалирующие красители, такие как бромистый этидий или SYBR Green.

Согласно настоящему изобретению под реакцией амплификации нуклеиновой кислоты подразумевается любая реакция комплементарного синтеза молекулы нуклеиновой кислоты, в том числе синтез молекулы кДНК с использованием в качестве матрицы РНК и последующая амплификация синтезированных молекул кДНК методом ПЦР или ПЦР в реальном времени. Предлагаемый способ может быть использован для получения сухих смесей, которые предназначены для проведения совмещенной обратной транскрипции и различных модификаций ПЦР, в частности ПЦР с «горячим стартом» (hot-start PCR), мультиплексной ПЦР (multiplex PCR), гнездовой ("вложенная", nested PCR,) количественной ПЦР (Q-PCR), лигазной цепной реакции (ЛЦР, LCR - ligase chain reaction), ПЦР в режиме реального времени (Real-Time PCR), а также методов, основанных на ПЦР, в частности секвенирования. Настоящее изобретение не ограничено какой-либо конкретной модификацией полимеразной цепной реакции. Предлагаемые способы могут быть использованы для получения сухих смесей, предназначенных для проведения различных вариантов ПЦР.

Согласно настоящему изобретению фраза «амплификация нуклеиновой кислоты» может означать специфичную реакцию амплификации для выявления нуклеиновой кислоты-мишени. Предлагаемая сухая смесь предназначена как для амплификации дезоксирибонуклеиновой кислоты (ДНК), так и рибонуклеиновой кислоты (РНК). Понятие нуклеиновой кислоты, согласно настоящему изобретению, не ограничено каким-либо образом.

Согласно настоящему изобретению водный раствор и полученная из него сухая смесь для амплификации нуклеиновой кислоты может содержать нуклеиновую кислоту, которая может быть использована в качестве матрицы для контроля прохождения реакции амплификации. Реакционная смесь может содержать молекулу дезоксирибонуклеиновой кислоты или рибонуклеиновой кислоты. При этом в качестве матрицы для контроля прохождения реакции амплификации могут быть использованы как полногеномные последовательности, так и фрагменты нуклеиновых кислот. Также в качестве контроля могут быть использованы фаги, плазмиды и векторы, в частности РНК-фаг и ДНК-плазмида, содержащие амплифицируемые последовательности.

Настоящее изобретение предоставляет способ получения сухой смеси для амплификации нуклеиновой кислоты, получаемой из водного раствора, который содержит по крайней мере два фермента, участвующих в реакции амплификации, в частности термостабильную ДНК-полимеразу и обратную транскриптазу или фермент/ферменты, обладающие РНК-зависимой ДНК-полимеразной активностью и ДНК-зависимой ДНК-полимеразной активностью, позволяющей проводить реакцию ПЦР.

Предлагаемый способ позволяет получить смесь для амплификации нуклеиновой кислоты, которая содержит фермент, обладающий ДНК-зависимой-ДНК-полимеразной активностью, и согласно настоящему изобретению может быть назван «ДНК-полимераза». ДНК-полимераза представляет собой фермент, обладающий способностью инициировать и катализировать синтез на 3'-конце праймера в направлении к 5'-концу ДНК-матрицы. Предпочтительно использование термостабильных ферментов, которые сохраняют активность в течение длительной инкубации при высокой температуре. Согласно настоящему изобретению, могут быть использованы термостабильные ДНК-полимеразы, полученные из термофильных бактерий, например, таких как Thermus aquaticus (Taq-полимераза), Thermus thermophiles (Tth), Thermus flavis (Tfl), Thermus caldophilus (Tea), Thermotoga maritime (Tma), Thermotoga neapolitana (Tne), Pyrococcus furiosus (Pfu), Pyrococcus woesei (Pwo), Thermococcus litoralis (Tli, известная также как Vent®), Pyrococcus species GB-D (DEEPVENT®), Thermococcus kodakaraensis (Kod). Перечень термостабильных полимераз, которые могут быть использованы согласно настоящему изобретению, не ограничен каким-либо образом.

Согласно настоящему изобретению могут быть использованы как ферменты дикого типа, так и различные мутантные и модифицированные варианты, и их сочетания. Примеры некоторых модифицированных Taq-полимераз описаны в Европейских патентах ЕР 1091002 (В2), ЕР 0902035 (В1), ЕР 0892058 (В1), ЕР 0823479 (В1).

Кроме того, известно, что ДНК-полимеразы помимо основной ДНК-зависимой ДНК-полимеразной активности, могут обладать 5'-3'-экзонуклеазной активностью и 3'-5'-экзонуклеазной (корректирующей) активностью. Например, Taq-полимераза из Thermus aquaticus имеет два домена, С-концевая часть белка обеспечивает полимеразную активность, а N-концевая часть белка отвечает за экзонуклеазную активность. Настоящее изобретение предоставляет способ получения сухой смеси для амплификации нуклеиновой кислоты, в которой обеспечивается поддержание как минимум двух активностей фермента, а именно 5'-3'-полимеразной и 5'-3'-экзонуклеазной. Наличие у ДНК-полимеразы 5'-3'-экзонуклеазной активности позволяет осуществлять детекцию амплификации в реальном времени с использованием гибридизационно-флуоресцентных зондов типа TaqMan.

Термин «hot-start ДНК-полимераза» (или «обратимо инактивированная ДНК-полимераза») относится к ДНК-полимеразе, которая модифицирована таким образом, чтобы предотвратить неспецифический синтез при низких температурах до начала амплификации.

Согласно настоящему изобретению могут быть использованы термостабильные ДНК-полимеразы, инактивированные за счет химической модификации, в результате которой наблюдается полная или практически полная потеря активности фермента при низких температурах. В качестве примеров модифицирующих реагентов известны формальдегид (ЕР 0962526 (В1)), ангидрид дикарбоновой кислоты (патент РФ №2174556), полиэтиленгликоль и пропиленгликоль (патентная заявка ЕР 2075331 (А2)). Для восстановления ферментативной активности химически модифицированной ДНК-полимеразы перед реакцией амплификации проводят инкубацию реакционной смеси при повышенной температуре (так называемая ПЦР с «горячим стартом» - hot start PCR).

Также согласно настоящему изобретению в качестве модификации, предотвращающей неспецифическую амплификацию, могут быть использованы антитела, которые способны связываться с ДНК-полимеразой, образуя комплекс антитело-полимераза (ЕР 0592035 (В1)). Перед проведением реакции амплификации антитела могут быть необратимо инактивированы путем прогревания реакционной смеси при температуре выше 80°С.

В качестве агентов, предотвращающих неспецифический синтез при низких температурах, также известно использование аптамеров, которые представляют собой олигонуклеотиды, обладающие высокой степенью аффинности к полимеразе и способные связываться в растворе с ДНК-полимеразой таким образом, чтобы блокировать ее полимеразную активность. Примеры таких олигонуклеотидных лигандов описаны в заявке WO 1996041010.

Согласно настоящему изобретению получаемая сухая смесь для амплификации нуклеиновой кислоты, кроме ДНК-полимеразы, содержит второй фермент, представляющий собой обратную транскриптазу. Термин «обратная транскриптаза» («транскриптаза» или «ревертаза») относится к ферментам, которые представляют собой РНК-зависимые ДНК-полимеразы и способны осуществлять синтез цепи ДНК на РНК-матрице. Примерами таких ферментов могут быть ретровирусные обратные транскриптазы, такие как обратная транскриптаза вируса лейкемии мышей Молони (М-MLV обратная транскриптаза (Moloney Murine Leukemia Virus)) и обратная транскриптаза вируса миелобластоза птиц (AMV-обратная транскриптаза (Avian Myeloblastosis Virus)), а также Mint-ревертаза, используемая для синтеза полноразмерных библиотек кДНК и клонирования 5'-концов кДНК (5'-RACE). Перечень обратных транскриптаз, которые могут быть использованы согласно настоящему изобретению, не ограничен каким-либо образом.

Ретровирусные обратные транскриптазы (MMLV и AMV), кроме РНК-зависимой ДНК-полимеразной активности, имеют еще ДНК-зависимую ДНК-полимеразную активность и активность РНКазы Н (RNase H activity). Согласно настоящему изобретению, в состав смеси для амплификации нуклеиновой кислоты может входить как транскриптаза дикого типа, обладающая активностью РНКазы Н, так и транскриптаза со сниженной активностью РНКазы Н, например, описанная Gerard и соавт. (Gerard, G.F., et al., FOCUS 11(4):60 (1989); Gerard, G.F, et al, FOCUS 14(3):91 (1992)).

Согласно настоящему изобретению обратная транскриптаза может быть модифицирована за счет введения нуклеотидных замен в последовательность, кодирующую указанную обратную транскриптазу. Примеры таких модификаций, повышающих термостабильность и точность M-MLV обратной транскриптазы, а также снижающих терминальную дезоксинуклеотидил-трансферазную активность, описаны в заявке ЕР 2325303 (A3). В качестве обратной транскриптазы согласно настоящему изобретению может быть использована, например, обратная транскриптаза с увеличенным временем полужизни (Svarovskaia ES et al. Retroviral mutation rates and reverse transcriptase fidelity. Front Biosci. 2003 Jan 1; 8:d117-34), обратная транскриптаза с повышенной точностью транскрипции (Arezi, В. and Hogrefe H. Novel mutations in Moloney Murine Leukemia Virus reverse transcriptase increase thermostability through tighter binding to template-primer. Nucleic Acids Res. 2009 February; 37(2): 473-481). Перечень обратных транскриптаз, которые могут быть использованы согласно настоящему изобретению, не ограничен каким-либо образом.

Известно, что активность Taq-полимеразы может ингибироваться в присутствии обратной транскриптазы, причем это ингибирование вызвано непосредственным взаимодействием обратной транскриптазы с полимеразой (Sellner et al. Reverse transcriptase inhibits Taq polymerase activity. Nucleic Acids Research, Vol.20, №7, 1487-1490). Настоящее изобретение позволяет не только обеспечить стабилизацию ферментов во время лиофилизации, но и сохранить активности полимеразы и обратной транскриптазы, достаточные для прохождения реакций обратной транскрипции и амплификации в одной пробирке.

Согласно настоящему изобретению водный раствор для амплификации нуклеиновой кислоты содержит по крайней мере два фермента, один из которых имеет РНК-зависимую ДНК-полимеразную активность, второй фермент имеет ДНК-зависимую ДНК-полимеразную активность и является термостабильным, в частности, водный раствор и, соответственно, получаемая из него сухая смесь может содержать комбинацию двух ферментов обратной транскриптазы и термостабильной ДНК-полимеразы.

Предлагаемый в настоящем изобретении способ получения сухой смеси для амплификации нуклеиновой кислоты обеспечивает стабильность ферментов в процессах лиофилизации, хранения и транспортировки, замешивания реагентов и непосредственно прохождения реакции амплификации.

Согласно настоящему изобретению водный раствор может содержать различные концентрации термостабильной ДНК-полимеразы и обратной транскриптазы, концентрации и соотношение ферментов могут варьировать и зависят от типа используемых ферментов. Для ферментов, описанных в примерах настоящего изобретения, соотношение единиц активности ферментов может лежать в пределах от 1 (ДНК-полимераза) : 0,2 (обратная транскриптаза) до 1 (ДНК-полимераза) : 10 (обратная транскриптаза), в частности, соотношение единиц активности может быть равным примерно 1 (Taq-полимеразы) : 4 (MMLV). Для обеспечения поддержания активностей обоих ферментов в «полной» реакционной смеси (конечный объем смеси после восстановления и добавления матрицы 50 мкл) могут быть использованы 5 ед. Taq-полимеразы и 20 ед. обратной транскриптазы.

Согласно настоящему изобретению в качестве нуклеотидтрифосфатов водный раствор и сухая смесь для амплификации нуклеиновой кислоты могут содержать дезоксинуклеотидтрифосфаты (dNTPs - dATP, dTTP, dGTP, dCTP, dUTP), рибонуклеотидфосфаты (ATP, GTP, CTP, UTP), дидезоксинуклеотидтрифосфаты (ddNTPs - ddATP, ddTTP, ddGTP, ddCTP), а также их комбинации. Концентрация нуклеотидтрифосфатов в реакционной смеси для амплификации может варьировать, оптимальная концентрация дезоксинуклеотидтрифосфатов составляет по 50-500 мМ каждого dNTP. Кроме того, согласно настоящему изобретению нуклеотидтрифосфаты могут содержать радиоактивную или флуоресцентную метку.

Термин «буферные компоненты» согласно настоящему изобретению означает компоненты реакционной смеси, которые обеспечивают необходимые условия реакции для прохождения реакции обратной транскрипции и амплификации, в частности, поддерживают рН, ионную силу раствора, стабилизируют ферменты. Кроме того, буферный раствор может содержать различные добавки. В качестве примеров буферных компонентов могут быть упомянуты буфер Tris-HCl, ЭДТА, различные соли (KCl, (NH4)2SO4, K2PO4), дитиотриетол, ДМСО, ДМФА, глицерин, бетаин, меркаптоэтанол, неионные детергенты (Tween, Triton), желатин, и др. Перечень буферных компонентов, которые могут быть использованы в настоящем изобретении, не ограничен каким-либо образом.

Необходимым компонентом реакционной смеси для работы полимеразы являются ионы Mg2+. Обычно в качестве источника ионов Mg2+ используют MgCl2 и/или MgSO4, которые согласно настоящему изобретению могут содержаться в водном растворе для амплификации нуклеиновой кислоты перед проведением лиофилизации, либо быть добавленными при восстановлении сухой смеси непосредственно перед постановкой реакции амплификации.

Для специалиста в данной области техники, очевидно, что состав водного раствора зависит от типа проводимой реакции амплификации нуклеиновой кислоты, перечень буферных компонентов, а также их оптимальное сочетание могут быть подобраны экспериментальным путем.

Термин «праймер» согласно настоящему изобретению относится к олигонуклеотиду, который может служить в качестве затравки для инициации синтеза нуклеиновой кислоты. Праймер может представлять собой одноцепочечный олигодезоксирибонуклеотид. Типы используемых праймеров зависят от предполагаемого применения и не ограничены каким-либо образом. Например, для осуществления реакции обратной транскрипции обычно используют случайные гексонуклеотиды (random) или олиго(dT)15-20-праймеры (для синтеза первой цепи с 3' конца поли(А)+ мРНК), также могут быть использованы олигонуклеотиды, специфичные к определенной мишени (для диагностических целей). Для проведения реакции амплификации ДНК обычно используют специфичные праймеры, комплементарные определенной последовательности ДНК-мишени. Длина праймеров может варьировать, но обычно составляет 6-50 нуклеотидов. Термин «специфичные праймеры» обозначает олигонуклеотиды, которые будут гибридизоваться и позволят детектировать амплификацию нуклеиновой кислоты-мишени (последовательности-мишени) вне зависимости от вариаций последовательности, расположенной между участками, к которым подобраны специфичные праймеры.

Кроме того, согласно настоящему изобретению праймеры могут содержать дополнительные элементы, способствующие обнаружению или предотвращению неспецифической амплификации. Праймеры могут содержать флуоресцентную метку на 5'-конце, как, например, праймеры-зонды "скорпионы" (Scorpions).

Согласно настоящему изобретению водный раствор и получаемая из него сухая смесь для амплификации нуклеиновой кислоты могут содержать один или несколько праймеров, в частности, могут быть использованы несколько пар праймеров для амплификации разных фрагментов с целью проведения мультиплексной ПЦР.

Водный раствор и получаемая сухая смесь для амплификации нуклеиновой кислоты, согласно настоящему изобретению, могут дополнительно содержать олигонуклеотидный зонд для детекции. Термин «олигонуклеотидный зонд для детекции» («зонд») означает олигонуклеотидную последовательность, которая может быть использована для мониторинга накопления продукта в процессе амплификации. В качестве примеров зондов, согласно настоящему изобретению, могут быть упомянуты олигонуклеотидные зонды, комплементарные участку ампликона и меченые флуоресцентными красителями (гибридизационно-флуоресцентная детекция). Частными примерами таких зондов могут служить зонды TaqMan® (Европейский патент ЕР 0919565 (В1)), «молекулярные маяки» (Molecular Beacons®, патент US 5118801 (А)), зонды с резонансным переносом энергии (FRET-технология, патенты ЕР 0912760 (В1), ЕР 1033411 (В1), US 7160998), "амплифлюр" (Amplifluor®, Европейский патент ЕР 0912597). Перечень зондов, которые могут быть использованы согласно настоящему изобретению, не ограничен каким-либо образом.

Одним из вариантов настоящего изобретения является способ получения сухой смеси для амплификации нуклеиновой кислоты, в которой присутствует олигонуклеотидный зонд для детекции, содержащий флуоресцентную метку. Термин «олигонуклеотидный зонд для детекции, содержащий флуоресцентную метку», означает олигонуклеотидную последовательность, которая способна гибридизоваться с участком последовательности-мишени (полностью или частично комплементарна) и содержит флуоресцентную метку на 5'- и/или 3'-конце или внутри последовательности. В качестве флуоресцентной метки могут быть использованы такие светоиспускающие соединения, как, например, флуоресцин и его производные карбоксифлуоресцеин (FAM), гексахлорфлуоресцеин (HEX), тетрахлорфлуоресцеин (ТЕТ) и дихлордиметилфлуоресцеин (JOE), родамин и его производные 5(6)-карбокси-Х-родамин (ROX), 6-карбоксиродамин (R6G), тетраметилродамин (TAMRA), цианиновые красители, например, тетраметилиндокарбоцианин (Су3), дибензоиндокарбоцианин (Су3.5), тетраметилиндодикарбоцианин (Су5), бензоиндодикарбоцианин (Су5.5). Перечень флуорофоров и красителей, которые могут быть использованы в качестве флуоресцентной метки в настоящем изобретении, не ограничен каким-либо образом.

Согласно настоящему изобретению, зонд может представлять собой олигонуклеотид, к которому присоединены молекула флуорофора и молекула гасителя флуоресценции. В зависимости от расположения флуоресцентной метки, гаситель может располагаться либо на противоположном конце зонда, либо внутри олигонуклеотдиной цепи. Гаситель флуоресценции подбирается таким образом, чтобы его спектр поглощения лежал в области длин волн спектра испускания флуорофора. В качестве гасителя флуоресценции могут быть использованы, например, гасители BHQ (black hole quenchers) производства компании Biosearch Technologies, США (патент США US 7,019,129) или гасители RTQ (real-time quenchers) производства компании «Синтол» (Россия).

Согласно настоящему изобретению при использовании флуоресцентно меченных зондов или праймеров, а также интеркалирующих красителей детекция амплификации может осуществляться как во время, так и после прохождения реакции амплификации.

Для мониторинга прохождения реакции амплификации в реальном времени с использованием TaqMan зондов ДНК-полимераза должна обладать 5'-3'-экзонуклеазной активностью. 5'-3'-экзонуклеазная активность ДНК-полимеразы обеспечивает разрушение зонда, при условии, что зонд гибридизован с выявляемой последовательностью-мишенью. Разрушение зонда приводит к разделению молекул флуорофора и гасителя и испусканию флуоресценции, уровень которой может регистрироваться в ходе реакции. Предлагаемый в настоящем изобретении способ получения сухой смеси позволяет сохранять 5'-3'-экзонуклеазную активность термостабильной ДНК-полимеразы на уровне, достаточном для обеспечения возможности детекции амплификации в реальном времени.

Согласно настоящему изобретению детекция амплификации может проводиться по окончании амплификации, например, с помощью электрофореза или анализа кривых плавления (Ririe et al. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction", Anal Biochem. 1997 245 (2): 154-60; Lyon, E. 2001. Mutation detection using fluorescent hybridization probes and melting curve analysis. Expert. Rev. Mol. Diagn. 1:92-101), в частности с помощью HMR-анализа (Carl Т. et al. High-Resolution Genotyping by Amplicon Melting Analysis Using LCGreen. Clinical Chemistry, June 2003 vol.49 no.6 853-860; Cameron et al. Amplicon Melting Analysis with Labeled Primers: A Closed-Tube Method for Differentiating Homozygotes and Heterozygotes. Clinical Chemistry March 2003 vol.49 no.3 396-406).

В зависимости от типа используемых красителей для детекции и количества амплифицируемых мишеней сухая смесь может предназначаться для осуществления реакции обратной транскрипции, совмещенной с полимеразной цепной реакцией, реакции обратной транскрипции, совмещенной с полимеразной цепной реакцией в реальном времени, реакции обратной транскрипции, совмещенной с мультиплексной полимеразной цепной реакцией, и др.

Одним из вариантов настоящего изобретения является способ получения смеси для амплификации нуклеиновой кислоты, которая содержит праймер и олигонуклеотидный зонд для детекции вируса гепатита. Термин «вирус гепатита» согласно настоящему изобретению относится к вирусам, способным вызывать специфическое поражение печени, называемое гепатитом. Известно, что вирусы, вызывающие гепатит, относятся к разным таксономическим группам и имеют разные биологические свойства (http://www.hv-info.ru/info/statyi/pechen-diagnostika/156-2011-08-11-09-05-03.html). Гепатит может быть вызван как РНК-, так и ДНК-содержащим вирусом. Частными примерами РНК-содержащих вирусов, вызывающих гепатит, являются вирус гепатита С, вирус гепатита А, вирус гепатита E, вирус гепатита D, вирус гепатита G и другие. Перечень вирусов, праймеры и олигонуклеотидные зонды для выявления которых могут быть использованы согласно настоящему изобретению, не ограничен каким-либо образом.

Одним из вариантов настоящего изобретения является способ получения сухой смеси для амплификации нуклеиновой кислоты, содержащей все компоненты, необходимые для проведения реакции, за исключением матрицы. Матрица может быть добавлена к сухой смеси вместе с восстанавливающим раствором. Уменьшение количества манипуляций при подготовке проб и постановке анализа снижает риск контаминации и упрощает его проведение.

Настоящее изобретение предоставляет способ получения сухой смеси для амплификации нуклеиновой кислоты путем лиофилизации водного раствора. Термин «лиофилизация» (лиофильная сушка, лиофильное высушивание) означает процесс высушивания водных растворов (смесей) различных веществ в замороженном состоянии под вакуумом. Вода удаляется из замороженных объектов путем сублимации льда, т.е. превращения его в пар, минуя жидкую фазу. Согласно настоящему изобретению лиофилизация может быть проведена с использованием лиофильной установки (лиофилизатора), при этом способ получения сухой смеси для амплификации нуклеиновой кислоты может включать стадии замораживания, первичной сушки и вторичной сушки.

Замораживание водного раствора для амплификации нуклеиновой кислоты можно проводить путем понижения температуры до температуры в диапазоне от минус 190°С до минус 20°С, предпочтительно до минус 40°С, и выдерживания водного раствора при указанной температуре в течение времени, достаточного для замораживания используемого объема раствора. Обычно к концу стадии замораживания замороженный материал содержит только около 20% воды (w/w - массовый объем), или менее 1% от общего объема воды в растворе до образования льда.

Стадию первичной сушки обычно проводят в вакууме, который создается за счет откачки воздуха. Согласно настоящему изобретению термин «первичная сушка» означает стадию, при которой происходит удаление воды из замороженного материала (сублимация). В течение первичной сушки давление в камере опускается ниже давления пара льда, и лед выходит из замороженного материала за счет сублимации. Длительность этапа первичной сушки зависит от температуры материала, состава защитной среды и толщины слоя замороженного материала. Обычно первичная сушка является самой длительной стадией. Температура первичной сушки определяется интервалом эвтектических температур. Согласно настоящему изобретению, первичная сушка может проводиться при температуре в диапазоне от минус 40°С до 0°С в течение времени, достаточного для удаления воды, примерно в течение 5-25 часов.

Следующим этапом лиофилизации является вторичная сушка. Термин «вторичная сушка» означает стадию, в течение которой происходит удаление связанной воды, указанная стадия проходит при пониженном давлении. Вторичная сушка проводится при положительных температурах в оптимальном для биоматериала интервале в течение времени, обеспечивающего остаточную влажность в сухом препарате не выше максимально допустимого значения. Наличие некоторого количества связанной воды в сухом препарате необходимо для сохранения структуры и восстановления функции при регидратации. Согласно настоящему изобретению, вторичная сушка может проводиться в два этапа: сначала происходит повышение температуры до +2°С +10°С, при этой температуре материал может выдерживаться в течение 4-15 часов, затем происходит повышение температуры до +20°С +30°С, при которой материал может выдерживаться в течение 2-12 часов.

Одним из частных вариантов настоящего изобретения является способ получения сухой смеси, согласно которому стадию первичной сушки проводят при пониженном давлении при температуре от минус 40°С до 0°С в течение 5-15 часов.

После окончания процесса лиофилизации для запаивания пробирок, стрипов или плашек с лиофилизированной смесью камера лиофильной установки может быть заполнена инертным газом, например азотом или аргоном.

Согласно настоящему изобретению, для лиофилизации ферментов может быть использован водный раствор, содержащий как минимум два стабилизатора. Термин «стабилизатор» или «стабилизирующий агент» может означать агент, который при добавлении к ферменту предотвращает или снижает потерю ферментативной активности указанного фермента по сравнению с хранением без стабилизирующего агента в течение длительного времени. Также согласно настоящему изобретению стабилизатор может выступать в роли криопротектора, который способствует защите фермента во время замораживания, сушки и/или восстановления высушенного фермента, в частности, препятствуя внутримолекулярным и межмолекулярным взаимодействиям ферментов. Кроме того, согласно настоящему изобретению стабилизатор может обеспечивать стабильность ферментов непосредственно в ходе проведения реакции амплификации.

Согласно настоящему изобретению, в качестве стабилизатора водный раствор может содержать, например, углеводы, полимеры, полиспирты, белки или аминокислоты. В качестве углеводов могут быть упомянуты моносахариды, дисахариды или полисахариды. Известно, что для стабилизации ферментов и биологического материала могут быть использованы, например, такие моносахариды, как глюкоза (US 5,861,251), фруктоза, манноза. Частными примерами дисахаридов, которые могут быть использованы для стабилизации биологического материала, являются трегалоза, сахароза, лактоза, галактоза, мальтоза (Carpenter et al., Cryobiology 24: 455-464 (1987)). Полисахариды, пригодные для стабилизации биологического материала, могут быть разветвленными или линейными, например, известно использование декстрана, целлюлозы, целлобиозы (WO 2010133628 (А1)), фиколла (US 615312). Перечень углеводов, которые могут быть использованы в качестве стабилизаторов согласно настоящему изобретению, не ограничен каким-либо образом.

Частными примерами полимеров, которые согласно настоящему изобретению могут быть использованы для стабилизации ферментов, являются декстран, поливинилприрролидон (ЕР 0726310 А1) и карбопол-940 (ЕР 1498492 (В1). Добавление в водный раствор таких стабилизаторов, как полимеры или полисахариды, может способствовать получению более плотной и гомогенной сухой смеси.

Частными примерами полиспиртов, которые могут быть использованы для стабилизации биологического материала при лиофилизации, являются маннитол, сорбитол (US 5,861,251), инозитол.

Кроме того, известно, что в качестве стабилизаторов, в том числе для стабилизации ДНК-полимеразы, могут быть использованы различные белки, например, казеин или бычий сывороточный альбумин (ЕР 2202302 А1). Согласно настоящему изобретению, в качестве стабилизаторов в водном растворе могут содержаться «инертные» натуральные или искусственные белки, которые не влияют на ферментативную активность ДНК-полимеразы и обратной транскриптазы. Частными примерами таких «инертных» белков являются глобулин, альбумины, коллаген и их различные производные.

Также из предшествующего уровня техники известно использование в качестве стабилизаторов при лиофилизации белков различных аминокислот и полимеров аминокислот, в частности, описано использование глицина, лизина, серина, аргинина, бетаина, N,N-диметилглицина, аспарагиновой кислоты, глютаминовой кислоты, полилизина, полиаспарагиновой кислоты, полиглютаминовой кислоты, полиаргинина, полигистидина, полиорнитина и их солей для стабилизации гормона роста (ЕР 0303746 А1).

Согласно настоящему изобретению для стабилизации ферментов могут быть использованы как минимум два стабилизатора, в частности, могут быть использованы различные комбинации углеводов, комбинации углеводов и белков, комбинации углеводов и полимеров, комбинации углеводов и полиспиртов, комбинации углеводов, белков и полимеров, комбинации аминокислот и полимеров, и др.

Перечисленные стабилизаторы могут присутствовать в водном растворе в различных концентрациях, концентрация стабилизаторов может зависеть от состава водного раствора, который подвергается лиофилизации.

Частными вариантами настоящего изобретения является способ получения сухой смеси, содержащей в качестве стабилизаторов углевод и полимер, или дисахарид и декстран, или содержащей в качестве одного из стабилизаторов трегалозу или декстран. При использовании трегалозы предпочтительно ее присутствие в водном растворе в количестве 1-25%, более предпочтительно 5-20%. При использовании в качестве одного из стабилизаторов декстрана предпочтительно его присутствие в водном растворе в количестве 0,1-10%, более предпочтительно 1%-5%. Для лиофилизации может быть использован декстран с различной молекулярной массой, в частности 50000-200000 Да.

Одновременное использование в качестве стабилизаторов углевода и полимера позволяет получить гомогенную и стабильную сухую смесь, обладающую длительным сроком хранения и позволяющую амплифицировать НК-мишень, содержащуюся в исследуемом образце в низкой концентрации.

Согласно настоящему изобретению, водный раствор для амплификации нуклеиновой кислоты может быть лиофилизирован в пробирке подходящего объема, например, объемом 0,2, 0,5, 1,5 или 2 мл, в стрипах (например, 4-, 8- или 12-луночных) или плашках (например, 24- 48-, 96-, 384- или 1536-луночных). Полученная смесь может быть восстановлена перед проведением реакции путем внесения раствора, содержащего матрицу (для полной смеси), или раствора, содержащего недостающие компоненты для проведения реакции амплификации.

Сухие смеси для амплификации нуклеиновой кислоты, полученные любым из описанных выше способов, могут быть включены в состав набора реагентов для проведения реакции амплификации. Набор реагентов может включать как одну сухую смесь, которая в качестве компонента реакционной смеси содержит, например, комбинацию ферментов, так и несколько сухих смесей, содержащих различные компоненты реакционной смеси для амплификации нуклеиновой кислоты. В состав набора могут также входить реагенты, необходимые для восстановления (регидратации) сухих смесей и проведения реакции амплификации. В зависимости от того, какие сухие смеси входят в состав набора реагентов, растворы для восстановления могут содержать недостающие компоненты реакционной смеси, причем перечень таких реагентов не ограничен каким-либо образом и очевиден для специалиста в указанной области техники.

Краткое описание фигур

На Фигуре 1 изображены кривые флуоресценции (канал HCV) для образцов с вирусной нагрузкой 106 МЕ/мл и 103 МЕ/мл, амплифицированных с использованием сухих смесей, хранившихся в течение 2 месяцев при 2-8°C, 18-24°C, 37°C, и контрольных компонентов, хранившихся при минус 20°C.

На Фигуре 2 изображены кривые флуоресценции (канал HCV) для образцов с вирусной нагрузкой 200 МЕ/мл, амплифицированных с использованием сухих смесей, хранившихся в течение 2 месяцев при 2-8°С, 18-24°С, 37°С, и контрольных компонентов, хранившихся при минус 20°C.

На Фигуре 3 изображены кривые флуоресценции (канал HCV) для ДНК-калибраторов КВ1, КВ2, амплифицированных с использованием сухих смесей, хранившихся в течение 2 месяцев при 2-8°C, 18-24°C, 37°C, и контрольных компонентов, хранившихся при минус 20°C.

На Фигуре 4 изображены кривые флуоресценции (канал HCV) для образцов с вирусной нагрузкой 106 МЕ/мл и 103 МЕ/мл, амплифицированных с использованием сухих смесей, хранившихся в течение 9 месяцев при 2-8°C, 18-24°C, и контрольных компонентов, хранившихся при минус 20°C.

На Фигуре 5 изображены кривые флуоресценции (канал HCV) для образцов с вирусной нагрузкой 200 МЕ/мл, амплифицированных с использованием сухих смесей, хранившихся в течение 9 месяцев при 2-8°C, 18-24°C, и контрольных компонентов, хранившихся при минус 20°C.

На Фигуре 6 изображены кривые флуоресценции (канал HCV) для ДНК-калибраторов КВ1, КВ2, амплифицированных с использованием сухих смесей, хранившихся в течение 9 месяцев при 2-8°C, 18-24°C, и контрольных компонентов, хранившихся при минус 20°C.

На Фигуре 7 изображены кривые флуоресценции (канал HCV) для образцов с вирусной нагрузкой 106 и 103 МЕ/мл, амплифицированных с использованием сухих смесей, хранившихся в течение 1 года при 2-8°C, и контрольных компонентов, хранившихся при минус 20°C.

На Фигуре 8 изображены кривые флуоресценции (канал HCV) для образцов с вирусной нагрузкой 200 МЕ/мл, амплифицированных с использованием сухих смесей, хранившихся в течение 1 года при 2-8°C, и контрольных компонентов, хранившихся при минус 20°C.

На Фигуре 9 изображены кривые флуоресценции (канал HCV) для ДНК-калибраторов КВ1, КВ2, амплифицированных с использованием сухих смесей, хранившихся в течение 1 года при 2-8°C, и контрольных компонентов, хранившихся при минус 20°C.

На Фигуре 10 изображены кривые флуоресценции (канал HDV) для образцов с вирусной нагрузкой 106 МЕ/мл и 103 МЕ/мл, амплифицированных с использованием сухих смесей, хранившихся в течение 9 месяцев при 2-8°C, 18-24°C, и контрольных компонентов, хранившихся при минус 20°C.

На Фигуре 11 изображены кривые флуоресценции (канал HDV) для образцов с вирусной нагрузкой 200 МЕ/мл, амплифицированных с использованием сухих смесей, хранившихся в течение 9 месяцев при 2-8°C, 18-24°C, и контрольных компонентов, хранившихся при минус 20°C.

На Фигуре 12 изображены кривые флуоресценции (канал HCV) для лиофилизированной смеси (красный) и контрольных компонентов, хранившихся при минус 20°C, (бирюзовый).

На Фигуре 13 изображены кривые флуоресценции (канал HCV) для лиофилизированной смеси (голубой) и контрольных компонентов, хранившихся при минус 20°C, (зеленый).

Примеры

Пример 1. Получение и применение сухой смеси №1 для амплификации нуклеиновых кислот с помощью ОТ-ПЦР в реальном времени

Для приготовления водного раствора реакционной смеси для проведения обратной транскрипции РНК с последующей амплификацией кДНК с помощью ПЦР в реальном времени (ОТ-ПЦР в реальном времени) использовали наборы «Амплисенс HCV-FL» (ФБУН ЦНИИЭ Роспотребнадзора, Россия, регистрационное удостоверение ФСР 2011/10235 от 05.03.2011).

Предпочтительно, чтобы растворы, содержащие ферменты, были приготовлены без использования глицеринового буфера. Коммерчески доступные ферменты, которые обычно поставляются и хранятся в глицериновом буфере, могут быть очищены от глицерина, например, методом диализа.

Полную реакционную смесь готовили в соответствии с инструкцией производителя, используя входящие в состав набора: ОТ-ПЦР-смесь-1-FL HCV (содержащая праймеры, зонды, dNTP), ОТ-ПЦР-смесь-2-FEP/FRT (содержащая ПЦР-буфер, ионы Mg2+), DTT, полимеразу («TaqF-полимераза», без глицерина) и обратную транскриптазу («ТМ-Ревертаза» MMlv), и дополнительно добавляли 40%-раствор трегалозы (МР Biomedicals) до конечной концентрации в реакционной смеси 10% и 10%-раствор декстрана-100000 (Fluka) до конечной концентрации 2%. Замешивание реагентов проводили на холоду. Полученную смесь тщательно перемешивали и по 25 мкл разносили в пробирки объемом 0.2 мл, затем лиофильно высушивали с использованием установки VirTis Ultra 35L (VirTis, США). Лиофилизацию проводили при следующих параметрах:

1) Заморозка - 1 час при минус 40°C

2) Первичная сушка - 10 часов при минус 20°C, давление 50 мТорр

3) Вторичная сушка - 6 часов при 5°C, давление 50 мТорр

4) Вторичная сушка - 2 часа при 20°C, давление 50 мТорр

После окончания сушки камеру лиофильной установки заполняли аргоном, закрывали крышки, используя механизм подъема полок. Закрытые пробирки с готовой лиофилизированной ОТ-ПЦР-смесью запаивали под вакуумом в цефленовые пакеты с силикагелевым осушителем (5 г). Часть пакетов вскрывали, чтобы отобрать пробирки для контрольных проверок, после чего вскрытые пакеты закрывали на застежку zip-lock и продолжали хранение этих пакетов. Запаянные и закрытые на zip-lock цефленовые пакеты с лиофилизированной ОТ-ПЦР-смесью хранили в течение 1 года при температурах 2-8°C (холодильник), 18-24°C (комнатная температура), 37°C (воздушный термостат).

Стабильность полной ОТ-ПЦР-смеси при хранении проверяли на образцах плазмы крови человека из стандартной панели HCV, аттестованных относительно стандарта NIBSC. Для этого из 100 мкл каждого образца плазмы выделяли РНК с помощью набора реагентов «Амплисенс Рибо-преп» (ФБУН ЦНИИЭ Роспотребнадзора, Россия, регистрационное удостоверение №ФСР 2008/03147 от 15.09.2008) согласно инструкции производителя.

Список образцов стандартной панели с различной вирусной нагрузкой:

106 МЕ/мл - 2 повтора

103 МЕ/мл - 2 повтора

Разведение до 200 МЕ/мл - 4 повтора

Образцы КВ1, КВ2 - ДНК-калибраторы (ДНК-плазмиды, содержащие амплифицируемую область), входят в состав наборов для количественного определения РНК HCV «Амплисенс НСУ-монитор-FL» (ФБУН ЦНИИЭ Роспотребнадзора, Россия), используются на этапе проведения ПЦР для построения калибровочной прямой (зависимость значений пороговых циклов от концентрации кДНК).

В пробирки с лиофилизированной ОТ-ПЦР-смесью вносили по 25 мкл раствора, содержащего выделенную РНК (или образцов КВ1, КВ2). Растворение таблетки происходило в течение 30 секунд. Затем проводили ОТ-ПЦР на приборе МХ3000Р (Stratagene. США). Реакцию проводили при следующих параметрах: 50°C в течение 15 мин, 95°C в течение 15 мин; 5 циклов: 95°C в течение 5 сек, 60°C в течение 20 сек, 72°C в течение 15 сек, затем 40 циклов: 95°C в течение 5 сек, 60°C в течение 30 сек.

В качестве контрольных реагентов использовали компоненты реакционной смеси, хранившиеся по отдельности при минус 20°C. Для каждой температуры хранения и контрольных реагентов ставили реакцию в двух повторностях.

По окончании ОТ-ПЦР сравнивали значения пороговых циклов (Ct) для каналов ВКО и HCV, полученные для пробирок с лиофилизированной ОТ-ПЦР-смесью, хранившихся в различных условиях, со значениями, полученными для контрольных реагентов, хранившихся при минус 20°C. Для контрольных образцов с концентрацией РНК HCV 200 МЕ/мл сравнивали количество повторов, определяемых как положительные.

За время хранения было проверено 9 временных точек: нулевая точка, 7 дней, 14 дней, 1 месяц, 2 месяца, 4 месяца, 6 месяцев, 9 месяцев, 1 год.

Хранение 2 месяца

Результаты исследований для смесей, хранившихся при 2-8°C, 18-24°C и 37°C в течение 2 месяцев, представлены в Таблице 1 и на Фигурах 1-3.

Таблица 1
Сравнение результатов ОТ-ПЦР для лиофилизированной ОТ-ПЦР-смеси, хранившейся в течение 2 месяцев в цефленовых пакетах при температуре 2-8°C, 18-24°C, 37°C и контрольных компонентов, хранившихся при минус 20°C (*s - стандартное отклонение)
Условия хранения Образец СtВКО CtHCV dCtBKO=Ct-20-CtT Среднее dCtBKO±s* dCtHCV=Ct-20-CtT Среднее dCtHCV±s*
2-8°C Закрытые на zip-lock 106 МЕ/мл 28,73 20,42 0,29 0,85±0,65 0,68 0,53±0,35
106 МЕ/ мл 28,44 20,38 1,33 0,95
103 МЕ/ мл 28,94 30,45 1,49 0,23
103 МЕ/ мл 29,46 29,74 0,28 0,26
200 28,36 36,08 1,37 -3,32
200 28,40 34,59 0,77 -1,63
200 28,59 33,82 1,03 0,50
200 28,87 34,32 0,57 -1,53
2-8°C запаянные 106 МЕ/ мл 28,75 20,21 0,27 0,60±0,33 0,89 0,50±0,73
106 МЕ/ мл 28,76 20,32 1,01 1,01
103 МЕ/ мл 29,71 30,01 0,72 0,67
103 МЕ/ мл 29,34 30,57 0,40 -0,57
200 28,78 34,61 0,95 -1,85
200 28,65 34,25 0,52 -1,29
200 28,53 33,80 1,09 0,52
200 28,83 34,02 0,61 -1,23
18-24°C Закрытые на zip-lock 106 МЕ/ мл 28,91 20,41 0,11 0,40±0,50 0,69 0,48±0,38
106 МЕ/ мл 28,88 20,45 0,89 0,88
103 МЕ/ мл 29,67 30,39 0,76 0,29
103 МЕ/ мл 29,89 29,96 -0,15 0,04
200 29,07 35,82 0,66 -3,06
200 28,79 32,05 0,38 0,91
200 29,17 33,68 0,45 0,64
200 28,67 33,71 0,77 -0,92
18-24°C запаянные 106 МЕ/ мл 29,40 20,56 -0,38 0,55±0,70 0,54 0,57±0,33
106 МЕ/ мл 28,88 20,30 0,89 1,03
103 МЕ/ мл 29,19 30,26 1,24 0,42
103 МЕ/ мл 29,28 29,73 0,46 0,27
200 28,98 32,45 0,75 0,31
200 29,04 34,03 0,13 -1,07
200 28,97 34,54 0,65 -0,22
200 28,75 33,97 0,69 -1,18
37°C Закрытые на zip-lock 106 МЕ/ мл 29,91 21,67 -0,89 0,43±0,36 -0,57 -0,61±0,71
106 МЕ/ мл 30,00 21,22 -0,23 0,11
103 МЕ/ мл 30,51 31,06 -0,08 -0,38
103 МЕ/ мл 30,26 31,59 -0,52 -1,59
200 29,95 34,90 -0,22 -2,14
200 29,38 33,94 -0,21 -0,98
200 29,71 33,98 -0,09 0,34
200 30,63 34,00 -1,19 -1,21
37°C запаянные 106 МЕ/ мл 29,51 20,67 -0,49 -0,51±0,31 0,43 -0,04±0,45
106 МЕ/ мл 30,09 21,44 -0,32 -0,11
103 МЕ/ мл 30,71 30,54 -0,28 0,14
103 МЕ/ мл 30,70 30,63 -0,96 -0,63
200 29,81 35,72 -0,08 -2,96
200 29,98 34,20 -0,81 -1,24
200 29,75 36,12 -0,13 -1,80
200 29,28 34,12 0,16 -1,33
Контроль минус 20°C 106 МЕ/ мл 29,02 21,10
106 МЕ/ мл 29,77 21,33
103 МЕ/ мл 30,43 30,68
103 МЕ/ мл 29,74 30,00
200 29,73 32,76
200 29,17 32,96
200 29,62 34,32
200 29,44 32,79
2-8°C Закрытые на zip-lock КВ1 16,33 17,31 0,79 0,10±0,87 1,42 0,52±0,79
КВ1 16,38 17,36 0,30 0,81
КВ2 30,05 30,99 -1,17 0,28
КВ2 29,61 31,52 0,48 -0,45
2-8°C запаянные КВ1 16,94 18,21 0,18 -0,57±0,75 0,52 0,05±0,61
КВ1 16,76 17,75 -0,08 0,42
КВ2 30,33 31,17 -1,45 0,10
КВ2 31 31,89 -0,91 -0,82
18-24°C Закрытые на zip-lock КВ1 16,94 18,1 0,18 -0,61±1,03 0,63 0,31±0,24
КВ1 16,51 18 0,17 0,17
КВ2 30,87 30,95 -1,99 0,32
КВ2 30,88 30,97 -0,79 0,10
18-24°C запаянные КВ1 16,68 17,95 0,44 -0,60±0,96 0,78 -0,03±0,70
КВ1 16,97 18,03 -0,29 0,14
КВ2 29,56 31,43 -0,68 -0,16
КВ2 31,95 31,97 -1,86 -0,90
37°C Закрытые на zip-lock КВ1 16,65 18,1 0,47 -0,35±0,86 0,63 0,25±0,34
КВ1 16,66 18,36 0,02 -0,19
КВ2 29,22 30,93 -0,34 0,34
КВ2 31,62 30,84 -1,53 0,23
37°C запаянные КВ1 16,84 18,05 0,28 0,21±0,94 0,68 0,87±0,36
КВ1 16,47 17,43 0,21 0,74
КВ2 27,57 29,87 1,31 1,40
КВ2 31,07 30,42 -0,98 0,65
Контроль минус 20°C КВ1 17,12 18,73
КВ1 16,68 18,17
КВ2 28,88 31,27
КВ2 30,09 31,07

Как видно из данных, приведенных в Таблице 1, среднее значение dCt для концентраций 106 МЕ/мл и 103 МЕ/мл по каналам ВКО и HCV для лиофилизированных ОТ-ПЦР-смесей, хранившихся в разных условиях, сопоставимо с различиями значений Ct между повторами образцов. Все повторы образца с концентрацией РНК HCV 200 МЕ/мл определялись как положительные. На Фигурах 1, 2 и 3 видно, что одинаковые образцы детектируются в едином пучке для всех вариантов хранения компонентов.

Таким образом, полученные данные свидетельствуют, что полная ОТ-ПЦР-смесь хранится не менее 2 месяцев при температуре 2-8°C (холодильник), 18-24°C (комнатная) и 37°C.

Хранение 9 месяцев

Результаты исследований для смесей, хранившихся при 2-8°C и 18-24°C в течение 9 месяцев, представлены в Таблице 2 и на Фигурах 4-6.

Таблица 2
Сравнение результатов ОТ-ПЦР для лиофилизированной ОТ-ПЦР-смеси, хранившейся в течение 9 месяцев в цефленовых пакетах при температуре 2-8°C (холодильник), 18-24°C (комнатная) и контрольных компонентов, хранившихся при минус 20°C (*s - стандартное отклонение)
Условия хранения Образец CtВКО CtHCV dCtВКО=Ct-20-CtT Среднее dCtBКО±s* dCtHCV=Ct-20-CtT Среднее dCtHCV±s*
2-8°C Закрытые на zip-lock 106 МЕ/ мл 30,15 21,12 -1,71 -1,73±0,10 -1,05 -1,34±0,24
106 МЕ/ мл 30,04 21,09 -1,88 -1,29
103 МЕ/ мл 30,56 30,77 -1,65 -1,41
103 МЕ/ мл 30,50 31,30 -1,68 -1,62
200 29,33 33,04 -0,71 -0,42
200 30,95 35,37 -2,15 -3,34
200 30,75 34,07 -1,88 -2,15
200 30,15 33,99 -1,48 -1,86
2-8°C запаянные 106 МЕ/ мл 30,22 21,04 -1,78 -1,00±0,53 -0,97 -0,04±0,48
106 МЕ/ мл 28,75 19,96 -0,59 -0,16
103 МЕ/ мл 29,80 29,94 -0,89 -0,58
103 МЕ/ мл 29,57 29,56 -0,75 0,12
200 29,36 31,73 -0,74 0,89
200 29,74 34,65 -0,94 -2,62
200 29,67 33,38 -0,80 -1,46
200 30,56 32,48 -1,89 -0,35
18-24°C Закрытые на zip-lock 106 МЕ/ мл 28,64 20,15 -0,20 -0,60±0,47 -0,08 -0,31±0,42
106 МЕ/ мл 28,84 20,05 -0,68 -0,25
103 МЕ/ мл 30,14 30,27 -1,23 -0,91
103 МЕ/ мл 29,09 29,67 -0,27 0,01
200 30,83 36,38 -2,21 -3,76
200 30,12 33,16 -1,32 -1,13
200 29,79 32,87 -0,92 -0,95
200 29,69 32,96 -1,02 -0,83
18-24°C запаянные 106 МЕ/ мл 29,48 20,56 -1,04 -1,08±0,10 -0,49 -0,63±0,14
106 МЕ/ мл 29,34 20,41 -1,18 -0,61
103 МЕ/ мл 29,86 30,19 -0,95 -0,83
103 МЕ/ мл 29,96 30,27 -1,14 -0,59
200 29,78 33,32 -1,16 -0,70
200 30,44 35,28 -1,64 -3,25
200 29,81 32,20 -0,94 -0,28
200 29,94 34,96 -1,27 -2,83
Контроль минус 20°C 106 МЕ/ мл 28,44 20,07
106 МЕ/ мл 28,16 19,80
103 МЕ/ мл 28,91 29,36
103 МЕ/ мл 28,82 29,68
200 28,62 32,62
200 28,80 32,03
200 28,87 31,92
200 28,67 32,13
2-8°C Закрытые на zip-lock КВ1 18,46 17,03 0,73 0,63±0,93 1,92 3,20±2,839
КВ1 18,17 17,64 1,44 1,5
КВ2 31,87 29,28 -0,7 1,94
КВ2 31,36 29,42 1,05 7,43
2-8°C запаянные КВ1 17,33 16,34 1,86 1,81±0,76 2,61 3,40±2,40
КВ1 17,58 17 2,03 2,14
КВ2 30,4 29,35 0,77 1,87
КВ2 29,83 29,88 2,58 6,97
18-24°C Закрытые на zip-lock КВ1 18,25 17,35 0,94 1,30±0,27 1,6 2,62±1,77
КВ1 18,06 17,42 1,55 1,72
КВ2 29,94 29,34 1,23 1,88
КВ2 30,94 31,58 1,47 5,27
18-24°C запаянные КВ1 18,28 18,46 0,91 1,23±0,65 0,49 1,25±1,19
КВ1 18,33 18,83 1,28 0,31
КВ2 30,55 29,94 0,62 1,28
КВ2 30,29 33,94 2,12 2,91
Контроль минус 20°C КВ1 19,19 18,95
КВ1 19,61 19,14
КВ2 31,17 31,22
КВ2 32,41 36,85

Как видно из данных, приведенных в Таблице 2, среднее значение dCt для концентраций 106 МЕ/мл и 103 МЕ/мл по каналам ВКО и HCV для лиофилизированных ОТ-ПЦР-смесей, хранившихся в разных условиях, сопоставимо с различиями значений Ct между повторами образцов. Все повторы образца с концентрацией РНК HCV 200 МЕ/мл определялись как положительные. На Фигурах 4 и 5 видно, что одинаковые образцы детектируются в едином пучке для всех вариантов хранения компонентов. А на фигуре 6 даже заметно отставание контрольной смеси (-20°C) от лиофилизированных смесей.

Таким образом, полученные данные свидетельствуют, что полная ОТ-ПЦР-смесь хранится не менее 9 месяцев при температуре 2-8°C (холодильник) и 18-24°C (комнатная).

Хранение 1 год

Результаты исследований для смесей, хранившихся при 2-8°C в течение 1 года, представлены в Таблице 3 и на Фигурах 7-9.

Таблица 3
Сравнение результатов ОТ-ПЦР для лиофилизированной ОТ-ПЦР-смеси, хранившейся в течение 1 года в цефленовых пакетах при температуре 2-8°C (холодильник), и контрольных компонентов, хранившихся при минус 20°C (*s - стандартное отклонение).
Условия хранения Образец CtВКО CtHCV dCtВКО=Ct-20-CtT Среднее dCtВКО±s* dCtHCV=Ct-20-CtT Среднее dCtHCV±s*
2-8°C Закрытые на zip-lock 106 МЕ/ мл 30,84 20,87 0,80 0,19±0,53 0,30 -0,10±0,56
106 МЕ/ мл 31,46 21,48 -0,49 -0,58
103 МЕ/ мл 30,64 31,13 0,13 -0,73
103 МЕ/ мл 30,60 30,71 0,33 0,63
200 29,26 33,25 -0,72 -2,15
200 30,77 33,50 -2,24 -1,48
200 29,70 33,44 -1,15 -1,78
200 29,52 31,14 -0,80 0,57
2-8°C запаянные 106 МЕ/ мл 32,78 21,60 -1,14 -0,70±0,45 -0,43 -0,39±0,85
106 МЕ/ мл 31,99 21,33 -1,02 -0,43
103 МЕ/ мл 31,03 31,78 -0,26 -1,38
103 МЕ/ мл 31,30 30,64 -0,37 0,70
200 29,71 32,84 -1,17 -1,74
200 29,85 32,70 -1,32 -0,68
200 29,50 32,85 -0,95 -1,19
200 29,92 33,75 -1,20 -2,04
Контроль минус 20°C 106 МЕ/ мл 31,64 21,17
106 МЕ/ мл 30,97 20,90
103 МЕ/ мл 30,77 30,40
103 МЕ/ мл 30,93 31,34
200 28,54 31,10
200 28,53 32,02
200 28,55 31,66
200 28,72 31,71
2-8°C Закрытые на zip-lock КВ1 17,24 16,7 1,95 2,25±0,26 3,15 3,29±0,22
КВ1 17,29 16,7 2,22 3,59
КВ2 29,78 29,71 2,22 3,10
КВ2 29,41 29,51 2,59 3,30
2-8°C запаянные КВ1 17,44 16,93 1,75 1,87±0,50 2,92 2,94±0,56
КВ1 17,1 16,91 2,41 3,38
КВ2 29,92 29,5 2,08 3,31
КВ2 30,77 30,65 1,23 2,16
Контроль минус 20°C КВ1 19,19 19,85
КВ1 19,51 20,29
КВ2 32 32,81
КВ2 No Ct No Ct

Как видно из данных, приведенных в Таблице 3, среднее значение dCt для концентраций 106 МЕ/мл и 103 МЕ/мл по каналам ВКО и HCV для лиофилизированных ОТ-ПЦР-смесей, хранившихся при температуре 2-8°C, сопоставимо с различиями значений Ct между повторами образцов. Все повторы образца с концентрацией РНК HCV 200 МЕ/мл определялись как положительные. На Фигурах 7 и 8 видно, что одинаковые образцы детектируются в едином пучке. А на фигуре 9 видно уже значительное отставание контрольной смеси (-20°C) от лиофилизированной смеси, вплоть до отсутствия сигнала в одном из повторов КВ2.

Таким образом, полученные данные свидетельствуют, что полная ОТ-ПЦР-смесь хранится не менее 1 года при температуре 2-8°C (холодильник).

Пример 2. Получение и применение сухой смеси №2 для амплификации нуклеиновых кислот с помощью ОТ-ПЦР в реальном времени

Для лиофилизации полной ОТ-ПЦР-смеси была выбрана система праймеров (Hd-s4 и Hd-a) и зонда (PHD1_JOE) для амплификации РНК вируса гепатита дельта HDV с помощью ОТ-ПЦР в реальном времени. Также смесь содержит праймеры (ICZ-s3 и ICZ-as2) и зонд (ICZ-FB2) для амплификации РНК неконкурентного внутреннего контроля. Нуклеотидные последовательности представлены в Таблице 4.

Таблица 4
Последовательности используемых праймеров и зондов для амплификации РНК вируса HDV и внутреннего контроля
Название праймера Последовательность
Hd-s4 GCTCTCCCTTAGCCATCCGAGT
Hd-a CTTCTTTCCTCTTCGGGTCGGCA
PHD1_JOE (R6G)CGGATGCCCAGGTCGGACCGC(BHQ1)
ICZ-s3 GTGCCCACAACCTGACTTGA
ICZ-as2 CAGGCTGAACGGTAATCCAAGT
ICZ-FB2 (Fam)CGTCTCTGGTGGCTTGTAACCCACCA(BHQ1)

Для приготовления сухой смеси для обратной транскрипции РНК с последующей амплификацией кДНК с помощью ПЦР в реальном времени (ОТ-ПЦР в реальном времени) использовали реакционную смесь следующего состава: 0,75 пмоль/мкл праймеров и 0,25 пмоль/мкл флуоресцентно меченых олигонуклеотидных зондов, по 200 мкМ каждого dNTP, 1-кратный ПЦР-буфер (Tris-HCl 50 мМ pH 8.4, KCl 50 мМ, MgCl2 2 мМ, Tween 20 0.1%, DTT), 5 ед. Taq-полимеразы («TaqF-полимераза», производства ФБУН ЦНИИЭ Роспотребнадзора, Россия, без глицерина), 20 ед. обратной транскриптазы MMLV («ТМ-ревертаза», производства ФБУН ЦНИИЭ Роспотребнадзора, Россия), 5% трегалозы (МР Biomedicals), 5% декстрана-100000 (Fluka) в объеме 25 мкл.

Замешивание реагентов проводили на холоду. После приготовления по 25 мкл полученной смеси разносили в пробирки объемом 0.2 мл и лиофильно высушивали с использованием установки VirTis Ultra 35L (VirTis, США). Лиофилизацию проводили при следующих параметрах:

1) Заморозка - 1 час при минус 40°C

2) Первичная сушка - 10 часов при минус 20°C, давление 50 мТорр

3) Вторичная сушка - 6 часов при 5°C, давление 50 мТорр

4) Вторичная сушка - 2 часа при 20°C, давление 50 мТорр

После окончания сушки камеру лиофильной установки заполняли аргоном, закрывали крышки, используя механизм подъема полок. Закрытые пробирки с готовой лиофилизированной ОТ-ПЦР-смесью запаивали под вакуумом в цефленовые пакеты с силикагелевым осушителем (5 г). Часть пакетов вскрывали, чтобы отобрать пробирки для контрольных проверок, после чего вскрытые пакеты закрывали на застежку zip-lock и продолжали хранение этих пакетов. Запаянные и закрытые на zip-lock цефленовые пакеты с лиофилизированной ОТ-ПЦР-смесью хранили в течение 1 года при температурах 2-8°C (холодильник), 18-24°C (комнатная температура).

Стабильность полной ОТ-ПЦР-смеси при хранении проверяли на образцах плазмы крови человека из стандартной панели HDV, аттестованных относительно стандарта NIBSC. Для этого из 100 мкл каждого образца плазмы выделяли РНК с помощью набора реагентов «Амплисенс Рибо-преп» (ФБУН ЦНИИЭ Роспотребнадзора, Россия, регистрационное удостоверение №ФСР 2008/03147 от 15.09.2008) согласно инструкции производителя.

Список образцов стандартной панели с различной вирусной нагрузкой:

106 МЕ/мл - 2 повтора

103 МЕ/мл - 2 повтора

Разведение до 200 МЕ/мл - 4 повтора

В пробирки с лиофилизированной ОТ-ПЦР-смесью вносили по 25 мкл раствора, содержащего выделенную РНК. Растворение таблетки происходило в течение 30 секунд. Затем проводили ОТ-ПЦР на приборе МХ3000Р (Stratagene. США). Реакцию проводили при следующих параметрах: 50°C в течение 15 мин, 95°C в течение 15 мин; 5 циклов: 95°C в течение 5 сек, 60°C в течение 20 сек, 72°C в течение 15 сек, затем 40 циклов: 95°C в течение 5 сек, 60°C в течение 30 сек.

В качестве контрольных реагентов использовали компоненты реакционной смеси, хранившиеся по отдельности при минус 20°C. Для каждой температуры хранения и контрольных реагентов ставили реакцию в двух повторностях.

По окончании ОТ-ПЦР сравнивали значения пороговых циклов (Ct) для каналов ВКО и HDV, полученные для пробирок с лиофилизированной ОТ-ПЦР-смесью, хранившихся в различных условиях, со значениями, полученными для контрольных реагентов, хранившихся при минус 20°C. Для контрольных образцов с концентрацией РНК HDV 200 МЕ/мл сравнивали количество повторов, определяемых как положительные.

За время хранения было проверено 9 временных точек: нулевая точка, 7 дней, 14 дней, 1 месяц, 2 месяца, 4 месяца, 6 месяцев, 9 месяцев, 1 год.

Хранение 9 месяцев

Результаты исследований для смесей, хранившихся при 2-8°C и 18-24°C в течение 9 месяцев, представлены в Таблице 5 и на Фигурах 10 и 11.

Таблица 5
Сравнение результатов ОТ-ПЦР для лиофилизированной ОТ-ПЦР-смеси, хранившейся в течение 9 месяцев в цефленовых пакетах при температуре 2-8°C (холодильник), 18-24°C (комнатная) и контрольных компонентов, хранившихся при минус 20°C (*s - стандартное отклонение).
Условия хранения Образец CtВКО CtHDV dCtВКО-Ct-20-CtТ Среднее dCtВКО±s* dCtHDV=Ct-20-CtT Среднее dCtHDV±s*
2-8°C Закрытые на zip-lock 106 МЕ/ мл 30,26 20,78 -2.08 -1,18±0,78 -1.00 -0,19±0,60
106 МЕ/ мл 29,86 20,72 -1.97 -1.22
103 МЕ/ мл 30,68 30,38 -1.98 -1.34
103 МЕ/ мл 30,36 30,88 -1.79 -1.53
200 29,06 32,79 -0.69 -0.44
200 30,87 33,57 -2.31 -1.78
200 30,75 33,2 -2.13 -1.53
200 29,97 33,74 -1.52 -1.79
2-8°C запаянные 106 МЕ/ мл 31,01 20,72 -2.83 -1,26±1,05 -0.94 -0,38±0,47
106 МЕ/ мл 28,49 19,66 -0.60 -0.16
103 МЕ/ мл 29,56 29,58 -0.86 -0.54
103 МЕ/ мл 29,32 29,21 -0.75 0.14
200 29,1 31,42 -0.73 0.93
200 29,48 32,42 -0.92 -0.63
200 29,44 32,21 -0.82 -0.54
200 30,35 31,71 -1.90 0.24
18-24°C Закрытые на zip-lock 106 МЕ/ мл 28,78 19,8 -0.60 -0,69±0,4 -0.02 -0,27±0,4
106 МЕ/ мл 28,58 19,73 -0.69 -0.23
103 МЕ/ мл 29,93 29,88 -1.23 -0.84
103 МЕ/ мл 28,82 29,33 -0.25 0.02
200 30,69 34,29 -2.32 -1.94
200 29,9 32,9 -1.34 -1.11
200 29,55 32,59 -0.93 -0.92
200 29,45 32,67 -1.00 -0.72
18-24°C запаянные 106 МЕ/ мл 29,26 20,19 -1.08 -1,09±0,14 -0.41 -0,6±0,16
106 МЕ/ мл 29,12 20,03 -1.23 -0.53
103 МЕ/ мл 29,6 29,84 -0.90 -0.80
103 МЕ/ мл 29,71 29,91 -1.14 -0.56
200 29,52 32,97 -1.15 -0.62
200 30,17 33,01 -1.61 -1.22
200 29,56 31,85 -0.94 -0.18
200 29,7 34,76 -1.25 -2.81
Контроль минус 20°C 106 МЕ/ мл 28,18 19,78
106 МЕ/ мл 27,89 19,5
103 МЕ/ мл 28,7 29,04
103 МЕ/ мл 28,57 29,35
200 28,37 32,35
200 28,56 31,79
200 28,62 31,67
200 28,45 31,95

Как видно из данных, приведенных в Таблице 5, среднее значение dCt для концентраций 106 МЕ/мл и 103 МЕ/мл по каналам ВКО и HDV для лиофилизированных ОТ-ПЦР-смесей, хранившихся в разных условиях, сопоставимо с различиями значений Ct между повторами образцов. Все повторы образца с концентрацией РНК HDV 200 МЕ/мл определялись как положительные. На Фигурах 10 и 11 видно, что одинаковые образцы детектируются в едином пучке для всех вариантов хранения компонентов.

Таким образом, полученные данные свидетельствуют, что полная ОТ-ПЦР-смесь хранится не менее 9 месяцев при температуре 2-8°C (холодильник) и 18-24°C (комнатная).

Пример 3. Получение и применение сухой смеси №3 для амплификации нуклеиновых кислот с помощью ОТ-ПЦР в реальном времени

Для приготовления водного раствора реакционной смеси для проведения обратной транскрипции РНК с последующей амплификацией кДНК с помощью ПЦР в реальном времени (ОТ-ПЦР в реальном времени) использовали наборы «Амплисенс HCV-FL» (ФБУН ЦНИИЭ Роспотребнадзора, Россия, регистрационное удостоверение ФСР 2011/10235 от 05.03.2011).

Предпочтительно, чтобы растворы, содержащие ферменты, были приготовлены без использования глицеринового буфера. Коммерчески доступные ферменты, которые обычно поставляются и хранятся в глицериновом буфере, могут быть очищены от глицерина, например, методом диализа.

Полную реакционную смесь готовили в соответствии с инструкцией производителя, используя входящие в состав набора: ОТ-ПЦР-смесь-1-FL HCV (содержащая праймеры, зонды, dNTP), ОТ-ПЦР-смесь-2-FEP/FRT (содержащая ПЦР-буфер, ионы Mg2+), DTT, полимеразу («TaqF-полимераза», без глицерина) и обратную транскриптазу («ТМ-Ревертаза» MMlv), и дополнительно добавляли 40%-раствор трегалозы (МР Biomedicals) до конечной концентрации в реакционной смеси 10% и 10%-раствор поливинилпирролидона (Sigma-Aldrich) до конечной концентрации 2%. Замешивание реагентов проводили на холоду. Полученную смесь тщательно перемешивали и по 25 мкл разносили в пробирки объемом 0.2 мл, затем лиофильно высушивали с использованием установки VirTis Ultra 35L (VirTis, США). Лиофилизацию проводили при следующих параметрах:

1) Заморозка - 1 час при минус 40°C

2) Первичная сушка - 10 часов при минус 20°C, давление 50 мТорр

3) Вторичная сушка - 6 часов при 5°C, давление 50 мТорр

4) Вторичная сушка - 2 часа при 20°C, давление 50 мТорр

После окончания сушки камеру лиофильной установки заполняли аргоном, закрывали крышки, используя механизм подъема полок.

Работу лиофилизированной смеси проверяли на образцах плазмы крови человека из стандартной панели HCV, аттестованных относительно стандарта NIBSC. Для этого из 100 мкл каждого образца плазмы выделяли РНК с помощью набора реагентов «Амплисенс Рибо-преп» (ФБУН ЦНИИЭ Роспотребнадзора, Россия, регистрационное удостоверение №ФСР 2008/03147 от 15.09.2008) согласно инструкции производителя.

Список образцов стандартной панели с различной вирусной нагрузкой:

103 МЕ/мл - 2 повтора

Образцы КВ1, КВ2 - ДНК-калибраторы (ДНК-плазмиды, содержащие амплифицируемую область), входят в состав наборов для количественного определения РНК HCV «Амплисенс HCV-монитор-FL» (ФБУН ЦНИИЭ Роспотребнадзора, Россия), используются на этапе проведения ПЦР для построения калибровочной прямой (зависимость значений пороговых циклов от концентрации кДНК).

В пробирки с лиофилизированной ОТ-ПЦР-смесью вносили по 25 мкл раствора, содержащего выделенную РНК (или образцов КВ1, КВ2). Растворение таблетки происходило в течение 30 секунд. Затем проводили ОТ-ПЦР на приборе Rotor-Gene Q (QIAGEN, Германия). Реакцию проводили при следующих параметрах: 50°C в течение 15 мин, 95°C в течение 15 мин; 5 циклов: 95°C в течение 5 сек, 60°C в течение 20 сек, 72°C в течение 15 сек, затем 40 циклов: 95°C в течение 5 сек, 60°C в течение 30 сек.

Результаты исследований представлены в Таблице 6 и на Фигуре 12.

Таблица 6
Сравнение результатов ОТ-ПЦР для лиофилизированной ОТ-ПЦР-смеси и контрольных компонентов, хранившихся при минус 20°C (*s - стандартное отклонение)
Условия хранения Образец CtHCV dCt=Ctлиофилизат-Ctконтроль Среднее dCtHCV±s*
Контроль минус 20°C 103 МЕ/мл 25,2
103 МЕ/мл 25,23
КВ1 14,26
КВ2 26,91
лиофилизат (сухая смесь) 103 МЕ/мл 25,36 0,16 0,33±0,41
103 МЕ/мл 26,38 1,15
КВ1 14,28 0,02
КВ2 26,9 -0,01

Пример 4. Получение и применение сухой смеси №4 для амплификации нуклеиновых кислот с помощью ОТ-ПЦР в реальном времени

Для приготовления водного раствора реакционной смеси для проведения обратной транскрипции РНК с последующей амплификацией кДНК с помощью ПЦР в реальном времени (ОТ-ПЦР в реальном времени) использовали наборы «Амплисенс HCV-FL» (ФБУН ЦНИИЭ Роспотребнадзора, Россия, регистрационное удостоверение ФСР 2011/10235 от 05.03.2011).

Предпочтительно, чтобы растворы, содержащие ферменты, были приготовлены без использования глицеринового буфера. Коммерчески доступные ферменты, которые обычно поставляются и хранятся в глицериновом буфере, могут быть очищены от глицерина, например, методом диализа.

Полную реакционную смесь готовили в соответствии с инструкцией производителя, используя входящие в состав набора: ОТ-ПЦР-смесь-1-FL HCV (содержащая праймеры, зонды, dNTP), ОТ-ПЦР-смесь-2-FEP/FRT (содержащая ПЦР-буфер, ионы Mg2+), DTT, полимеразу («TaqF-полимераза», без глицерина) и обратную транскриптазу («ТМ-Ревертаза» MMlv), и дополнительно добавляли 40%-раствор трегалозы (МР Biomedicals) до конечной концентрации в реакционной смеси 10% и раствор бычьего сывороточного альбумина 100 мг/мл (Miltenyi Biotec) до конечной концентрации 20 мг/мл. Замешивание реагентов проводили на холоду. Полученную смесь тщательно перемешивали и по 25 мкл разносили в пробирки объемом 0.2 мл, затем лиофильно высушивали с использованием установки VirTis Ultra 35L (VirTis, США). Лиофилизацию проводили при следующих параметрах:

1) Заморозка - 1 час при минус 40°C

2) Первичная сушка - 10 часов при минус 20°C, давление 50 мТорр

3) Вторичная сушка - 6 часов при 5°C, давление 50 мТорр

4) Вторичная сушка - 2 часа при 20°C, давление 50 мТорр

После окончания сушки камеру лиофильной установки заполняли аргоном, закрывали крышки, используя механизм подъема полок.

Работу лиофилизированной смеси проверяли на образцах плазмы крови человека из стандартной панели HCV, аттестованных относительно стандарта NIBSC. Для этого из 100 мкл каждого образца плазмы выделяли РНК с помощью набора реагентов «Амплисенс Рибо-преп» (ФБУН ЦНИИЭ Роспотребнадзора, Россия, регистрационное удостоверение № ФСР 2008/03147 от 15.09.2008) согласно инструкции производителя.

Список образцов стандартной панели с различной вирусной нагрузкой:

103 МЕ/мл - 2 повтора

Образцы КВ1, КВ2 - ДНК-калибраторы (ДНК-плазмиды, содержащие амплифицируемую область), входят в состав наборов для количественного определения РНК HCV «Амплисенс HCV-монитор-FL» (ФБУН ЦНИИЭ Роспотребнадзора, Россия), используются на этапе проведения ПНР для построения калибровочной прямой (зависимость значений пороговых циклов от концентрации кДНК).

В пробирки с лиофилизированной ОТ-ПЦР-смесью вносили по 25 мкл раствора, содержащего выделенную РНК (или образцов КВ1, КВ2). Растворение таблетки происходило в течение 30 секунд. Затем проводили ОТ-ПЦР на приборе Rotor-Gene Q (QIAGEN, Германия). Реакцию проводили при следующих параметрах: 50°C в течение 15 мин, 95°C в течение 15 мин; 5 циклов: 95°C в течение 5 сек, 60°C в течение 20 сек, 72°C в течение 15 сек, затем 40 циклов: 95°C в течение 5 сек, 60°C в течение 30 сек.

Результаты исследований представлены в Таблице 7 и на Фигуре 13.

Таблица 7
Сравнение результатов ОТ-ПЦР для лиофилизированной ОТ-ПЦР-смеси и контрольных компонентов, хранившихся при минус 20°C (*s - стандартное отклонение)
Условия хранения Образец CtHCV dCt=Ctлиофилизат-Ctкoнтpoль Среднее dCtHCV±s*
Контроль минус 20°С Панель HCV 24,84
Панель HCV 25,87
КВ1 12,97
КВ2 25,68
лиофилизат (сухая смесь) Панель HCV 26,51 1,67 0,80±0,44
Панель HCV 26,62 0,75
КВ1 13,27 0,3
КВ2 26,15 0,47

Хотя указанное изобретение описано в деталях со ссылкой на примеры, для специалиста в указанной области техники очевидно, что могут быть совершены различные изменения и произведены эквивалентные замены, и такие изменения и замены не выходят за рамки настоящего изобретения.

1. Сухая смесь для приготовления реакционной смеси для амплификации нуклеиновой кислоты, полученная лиофилизацией водного раствора, содержащего по меньшей мере:
термостабильную ДНК-полимеразу, обратную транскриптазу, первый стабилизатор, выбранный из группы, включающей моносахариды, дисахариды, полиспирты, второй стабилизатор, выбранный из группы, включающей полисахариды, альбумины, поливинилпирролидон.

2. Сухая смесь по п.1, характеризующаяся тем, что лиофилизация включает стадии замораживания и сушки.

3. Сухая смесь по п.2, характеризующаяся тем, что замораживание осуществляют при температуре от минус 190°С до минус 20°С в течение 1 ч.

4. Сухая смесь по п.2, характеризующаяся тем, что сушку осуществляют путем первичной сушки при температуре от минус 40°С до 0°С и давлении в камере не выше 100 мТорр не менее 10 часов, и вторичной сушки в два этапа и при давлении в камере не выше 200 мТорр не менее 8 часов: сначала при температуре от 2°С до 10°С, при этой температуре материал выдерживается в течение 4-15 часов, затем при температуре от 20°С до 30°С, при которой материал выдерживается в течение 2-12 часов.

5. Сухая смесь по п.1, характеризующаяся тем, что термостабильная ДНК-полимераза представляет собой Taq-полимеразу из Thermus aquaticus.

6. Сухая смесь по п.1, характеризующаяся тем, что термостабильная ДНК-полимераза представляет собой hot-start ДНК-полимеразу.

7. Сухая смесь по п.1, характеризующаяся тем, что обратная транскриптаза представляет собой обратную транскриптазу вируса лейкемии мышей (M-MLV обратную транскриптазу).

8. Сухая смесь по п.1, характеризующаяся тем, что указанный водный раствор дополнительно содержит по меньшей мере два праймера и по меньшей мере один олигонуклеотидный зонд для детекции, содержащий флуоресцентную метку.

9. Сухая смесь по п.1, характеризующаяся тем, что указанный водный раствор дополнительно содержит буферные компоненты и нуклеотидтрифосфаты.

10. Сухая смесь по п.1, характеризующаяся тем, что указанный водный раствор дополнительно содержит буферные компоненты, ионы магния и нуклеотидтрифосфаты.

11. Сухая смесь по п.1, характеризующаяся тем, что указанный водный раствор дополнительно содержит буферные компоненты, ионы магния, нуклеотидтрифосфаты, по меньшей мере два праймера и по меньшей мере один олигонуклеотидный зонд для детекции.

12. Сухая смесь по п.8, характеризующаяся тем, что праймеры и олигонуклеотидный зонд для детекции представляют собой праймеры и олигонуклеотидный зонд для выявления вируса гепатита, выбранного из группы, включающей вирус гепатита А, вирус гепатита С, вирус гепатита D, вирус гепатита Е, вирус гепатита G.

13. Сухая смесь по п.1, характеризующаяся тем, что указанный водный раствор представляет собой раствор для осуществления реакции обратной транскрипции, совмещенной с полимеразной цепной реакцией в реальном времени.

14. Сухая смесь по п.13, характеризующаяся тем, что полимеразная цепная реакция представляет собой мультиплексную полимеразную цепную реакцию.

15. Сухая смесь по п.1, характеризующаяся тем, что моносахарид представляет собой глюкозу, фруктозу или маннозу.

16. Сухая смесь по п.1, характеризующаяся тем, что дисахарид представляет собой трегалозу, сахарозу, лактозу, галактозу или мальтозу.

17. Сухая смесь по п.1, характеризующаяся тем, что полиспирт представляет собой маннитол, сорбитол или инозитол.

18. Сухая смесь по п.1, характеризующаяся тем, что полисахарид представляет собой декстран, целлюлозу, целлобиозу или фиколл.

19. Сухая смесь по п.1, характеризующаяся тем, что первый стабилизатор представляет собой трегалозу, второй стабилизатор представляет собой декстран.

20. Сухая смесь по п.19, характеризующаяся тем, что концентрация трегалозы в водном растворе до лиофилизации составляла 1-25%.

21. Сухая смесь по п.19, характеризующаяся тем, что декстран имеет молекулярную массу 50000-200000 Да.

22. Сухая смесь по п.19, характеризующаяся тем, что концентрация декстрана в водном растворе до лиофилизации составляла 0,1-10%.

23. Сухая смесь по п.1, характеризующаяся тем, что первый стабилизатор представляет собой трегалозу, второй стабилизатор представляет собой поливинилпирролидон.

24. Сухая смесь по п.1, характеризующаяся тем, что первый стабилизатор представляет собой трегалозу, второй стабилизатор представляет собой бычий сывороточный альбумин.

25. Сухая смесь по п.1, характеризующаяся тем, что лиофилизацию указанного водного раствора осуществляют в пробирках, стрипах или плашках.

26. Способ получения сухой смеси по п.1, включающий следующие стадии:
- приготовление водного раствора, содержащего по меньшей мере:
термостабильную ДНК-полимеразу, обратную транскриптазу, первый стабилизатор, выбранный из группы, включающей моносахариды, дисахариды, полиспирты, второй стабилизатор, выбранный из группы, включающей полисахариды, альбумины, поливинилпирролидон,
- лиофилизацию указанного водного раствора.



 

Похожие патенты:
Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для выявления ДНК пародонтопатогенного микроорганизма Tannerella forsythensis методом полимеразной цепной реакции.

Группа изобретений относится к области биотехнологии и направлена на молекулы нуклеиновых кислот, которые кодируют белок, проявляющий свойства биосенсора для детекции пероксида водорода в живых клетках, обладающий флуоресценцией в красной области спектра.

Изобретение относится к медицине и биологии и предназначено для использования при проведении ПЦР-исследований. Устройство для полимеразной цепной реакции содержит, по крайней мере, четыре части, каждая из которых имеет две плоские, параллельные поверхности, перпендикулярные общей оси, и отверстия.

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности свободноягодника колючего, элеутерококка (Eleutherococcus senticocus (Rupr.

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности сушеницы болотной (Filaginella uliginosa (L.) Opiz).

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности аралии высокой (Aralia elata (Miq.) Seem.).

Изобретение относится к области радиобиологии и экспериментальной медицины. Способ оценки фармакологических и токсикологических свойств веществ заключается в том, что исследуемое вещество вносят в питательную среду личинок и мух Drosophila melanogaster, сочетающих в своем геноме гипоморфные мутации ss- и СG5017-генов.

Группа изобретений относится к области медицины и молекулярной биологии. Способ предусматривает измерение экспрессии следующих кислородчувствительных генов: Pdk4, Nid2, Golph2, Actr1a, Api5, Mrp13, Scn7a, Асох3, Lamr1, Sv2b, Stmn2, Тrрс3, Crebzf, Herс1, Ssc1, Snrpb, Zfhx1b, sc125b, Rn.

Изобретение относится к биотехнологии, генетической инженерии и ветеринарной вирусологии. Предложены синтетические олигонуклеотидные праймеры, комплементарные участкам вариабельного 2-го сегмента генома вируса блютанга серотипов, входящих в состав нуклеотипа А (4, 10, 11, 17, 20 и 24 серотипы) для выявления РНК вируса блютанга нуклеотипа А, имеющие следующий нуклеотидный состав (5′-3′): прямой TATTGGCATAGRCAGTGG; обратный GTAAGYGTAAGAGGCCA.

Изобретение относится к биотехнологии и представляет собой способ прогнозирования эффективности лечения пациентов с неходжкинскими злокачественными лимфомами высокой степени злокачественности.

Группа изобретений относится к области биохимии. Заявлены варианты способа скрининга и мониторинга онкологических заболеваний, включающего забор образца ткани, выделение из образца ткани РНК, синтез кДНК, амплификацию методом множественной обратной транскрипции полимеразой цепной реакции с последующим анализом амплифицированных продуктов. При этом ПЦР проводят с использованием композиции праймеров с последовательностями SEQ ID NO: 1-24 и 26-29, специфических к мРНК генов MAGEA1-6, GAGE1-8, NY-ESO-1, SSX1, 2, 4, XAGE1, TRAG3 и MAGEC1. Анализ амплифицированных продуктов проводят в том числе с использованием зондов, представленных последовательностями SEQ ID NO: 30-35 и 37. Также заявлены варианты набора для осуществления скрининга и мониторинга онкологических заболеваний. Набор включает праймеры с последовательностями SEQ ID NO: 1-24 и 26-29, а также может дополнительно включать зонды с последовательностями SEQ ID NO: 30-35 и 37. Изобретение позволяет повысить точность диагностики онкологических заболеваний различных органов. 4 н. и 3 з.п. ф-лы, 3 ил., 2 табл.
Изобретение относится к области молекулярной биологии и биохимии. Устройство состоит из источника света, излучение от которого направлено на прозрачную подложку с иммобилизованными на ее поверхности олигонуклеотидами и расположенной под ней системой детекции интенсивности света, прошедшего через подложку. Подложка содержит не менее двух зон, на поверхности одной из которых иммобилизован слой олигонуклеотидов, неспецифических к исследуемой последовательности нуклеотидов, а на поверхности другой зоны иммобилизован слой олигонуклеотидов, специфических к исследуемой последовательности нуклеотидов. Причем система детекции содержит не менее двух фоточувствительных независимых секций, каждая из которых освещена излучением, прошедшим только через одну зону. Устройство позволяет проводить качественный и количественный анализ последовательностей нуклеотидов, повышает точность идентификации последовательностей нуклеотидов. 2 з.п. ф-лы, 5 пр.

Изобретение относится к биотехнологии и представляет собой способ спектрального анализа флуоресцентных свойств нуклеотидных последовательностей ДНК. Предложенное изобретение может быть использовано для генетической диагностики, исследования митогенетического излучения клеток, исследования кодирования наследственной и пролиферативной информации. Способ включает приготовление водных растворов красителей основных цветов флуоресценции. Измеряют фоновую флуоресценцию растворов красителей в соответствующих каналах детекции с помощью флуоресцентного детектора FDG-001. Добавляют к раствору красителей образец ДНК в количестве 150-200 нг. Измеряют флуоресценцию растворов красителей. Регистрируют результаты анализа в виде представления значений в условных единицах положительного или отрицательного прироста флуоресценции красителей по отношению к их исходному фону до добавления образца ДНК в форме построения столбчатых диаграмм или кривых динамики роста сигнала во времени. Интерпретируют результаты прироста флуоресценции красителей. Предложенное изобретение позволяет определить нуклеотидные перестройки окончаний теломерной ДНК, точечные мутации, полиморфизмы генов, хромосомные перестройки, изменение кариотипа или генома клеток. 14 з.п. ф-лы, 16 ил., 1 табл., 6 пр.

Представлены наборы олигонуклеотидных зондов и праймеров, биологический микрочип и тест-система для идентификации и типирования вируса гриппа А и В. Охарактеризованная тест-система содержит: набор реагентов для выделения РНК вируса гриппа из биологического материала человека; набор реагентов для проведения ПЦР-амплификации, совмещенной с обратной транскрипцией, с образованием флуоресцентно-меченных фрагментов генома вируса гриппа, содержащий описанные олигонуклеотиды-праймеры; набор реагентов для проведения гибридизации фрагментов ДНК, полученных после проведения амплификации на биочипе, содержащем элементы с иммобилизованными описанными олигонуклеотидными зондами; и при необходимости, отрицательный и положительный контрольные образцы. Представленные изобретения обеспечивают более доступный и простой метод анализа с высокой специфичностью и низкой стоимостью. 4 н.п. ф-лы, 2 ил., 2 табл., 4 пр.

Изобретение относится к медицине, а именно к биохимическим исследованиям биологических объектов. Набор состоит из лизирующего буфера на основе 3-10 М раствора мочевины, связывающего буфера на основе 2,5-5 М хлористого натрия, элюирующего буфера на основе раствора 10 мМ Трис-HCl и 1 мМ Трилона Б с pH 8 и 80% этилового спирта в качестве отмывочного буфера. При этом в качестве сорбента набор включает кварцевый песок с размером частиц 10-50 мкм. Набор позволяет выделять ДНК из биологических объектов с высоким выходом, высокой степенью чистоты и высокой молекулярной массой выделяемой ДНК. 2 ил., 1 пр.

Изобретение относится к области молекулярной биологии, биохимии, иммунологии и генетической инженерии. Предложена композиция для определения разнообразия CDR3 последовательностей TCRB или IGH в образце. Изобретение может быть использовано для оценки адаптивной иммунной системы пациентов в медицине. 35 з.п. ф-лы, 14 табл., 14 пр.

Группа изобретений относится к области генной инженерии. Копии секвенируемой молекулы ДНК помещают в четыре раствора, каждый из которых характеризуется сниженной концентрацией одного из нуклеотидов, по сравнению с остальными тремя нуклеотидами, во время проведения полимеризации ДНК в каждом из растворов регистрируют факты выделения ионов с помощью сенсоров на основе МДП-структур. Измеряют промежутки времени между моментами выделения ионов и по наличию большего промежутка времени делают вывод о присоединении нуклеотида с пониженной концентрацией и далее определяют расположение данного нуклеотида в секвенируемой ДНК. Определение момента присоединения нуклеотида к растущей цепи ДНК за счет измерения сигнала от каждого сенсора проводят в режиме стохастического резонанса. Режим стохастического резонанса обеспечивают за счет выбора рабочей точки МДП-структуры посередине участка бистабильности, а также за счет ввода сигнала шума от дополнительного генератора шума на катод МДП-структуры. Использование изобретений позволяет повысить точность регистрации момента присоединения очередного нуклеотида при полимеризации ДНК. 4 н.п. ф-лы, 9 ил.

Изобретение относится к области биохимии. Предложен олигонуклеотидный зонд с комплементарными концевыми последовательностями по типу "молекулярного маяка", обеспечивающий флуоресцентную детекцию при идентификации возбудителя кокцидиоидомикоза Coccidioides posadasii методом ПЦР с олигонуклеотидными праймерами CpSOW82s/CpSOWS2as, комплементарными фрагменту гена SOWgp82 С. posadasii. Зонд имеет структуру 5'(ROX)-CGCGGAGATGACTGTCGAGTGGCGCG-(BHQ2)3', где ROX - флуоресцентный краситель карбокси-Х-родамин, BHQ2 - гаситель флуоресценции. Изобретение позволяет в короткий срок с высокой чувствительностью и специфичностью детектировать ДНК С. posadasii в чистой культуре и биологическом материале. 1 ил., 1 табл., 3 пр.

Изобретение относится к биотехнологии. Описан способ предсказания ответа субъекта на терапевтическое средство для лечения ревматоидного артрита (RA). Также представлен способ предсказания, будет ли субъект с RA отвечать на лечение антагонистом В-клеток. Кроме того, представлен способ предсказания того, будет ли субъект с ревматоидным артритом эффективно отвечать на лечение антагонистом В-клеток, и способ выбора терапии пациента или субпопуляции пациентов с ревматоидным артритом. Все способы включают измерение в биологическом образце, полученном от субъекта, экспрессии одного гена или их комбинации или экспрессии одного белка или их комбинации, кодируемой одним геном или их комбинацией, где один ген или их комбинация выбраны из любого из CXCL13, FcRH5 и sFcRH5. Изобретение расширяет диагностические возможности в отношении RA. 4 н. и 16 з.п. ф-лы, 14 ил., 13 табл.

Группа изобретений относится к области генетики, молекулярной биологии, судебной медицины и криминалистики и касается инструмента для определения гаплогрупп Y-хромосомы человека. Группа изобретений представлена набором дифференцирующих олигонуклеотидных зондов, биочипом, содержащим эти зонды, и способом применения биочипа для анализа. Биочип обеспечивает возможность определения 10 гаплогрупп Y-хромосомы человека. Определение гаплогруппы осуществляется посредством генотипирования Y-хромосомы по 10 маркерам: М130 (С), М145 (DE), P257 (G), Мб9 (Н), U179 (I), M304 (J), М185 (L), M231 (N), M175 (О) и Р224 (R) с использованием биочипа, на котором иммобилизованы олигонуклеотиды, последовательность которых определена в табл.1. Структура дифференцирующих олигонуклеотидов, используемых в каждом изобретении группы, позволяет обеспечить их связывание только с полностью комплементарными мишенями, обеспечивая яркий флуоресцентный сигнал в соответствующих им ячейках биочипа. 3 н.п. ф-лы, 2 ил., 1 табл., 3 пр.
Наверх