Флуоресцентно-меченый олигонуклеотидный зонд pr-sow для идентификации возбудителя кокцидиоидомикоза coccidioides posadasii


 


Владельцы патента RU 2539108:

Федеральное казенное учреждение здравоохранения Волгоградский научно-исследовательский противочумный институт Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (RU)

Изобретение относится к области биохимии. Предложен олигонуклеотидный зонд с комплементарными концевыми последовательностями по типу "молекулярного маяка", обеспечивающий флуоресцентную детекцию при идентификации возбудителя кокцидиоидомикоза Coccidioides posadasii методом ПЦР с олигонуклеотидными праймерами CpSOW82s/CpSOWS2as, комплементарными фрагменту гена SOWgp82 С. posadasii. Зонд имеет структуру 5'(ROX)-CGCGGAGATGACTGTCGAGTGGCGCG-(BHQ2)3', где ROX - флуоресцентный краситель карбокси-Х-родамин, BHQ2 - гаситель флуоресценции. Изобретение позволяет в короткий срок с высокой чувствительностью и специфичностью детектировать ДНК С. posadasii в чистой культуре и биологическом материале. 1 ил., 1 табл., 3 пр.

 

Изобретение относится к биотехнологии, молекулярной биологии и может быть использовано в медицине для выявления генетического материала возбудителя кокцидиоидомикоза Coccidioides posadasii как для диагностики в практическом здравоохранении и службе Роспотребнадзора, так и для научных исследований.

Кокцидиоидомикоз относят к особо опасным микозам, возбудителями которого являются диморфные грибы рода Coccidioides spp. С. posadasii имеет значительно более широкое географическое распространение, включая юго-западную часть США, Центральную и Южную Америку, по сравнению С.immitis, который эндемичен для Калифорнии (США). Метод полимеразной цепной реакции является прямым методом выявления ДНК данных микромицетов и обладает высокой специфичностью и чувствительностью. В основе метода ПЦР лежит природный процесс репликации ДНК - комплементарное достраивание ДНК матрицы, осуществляемое с помощью фермента ДНК-полимеразы.

Процесс удвоения нуклеиновых кислот можно использовать для получения копий коротких участков ДНК, специфичных для конкретных микроорганизмов, т.е. осуществлять целенаправленный поиск таких специфических участков, что и является целью генодиагностики для выявления возбудителя кокцидиоидомикоза.

Для эффективного проведения ПЦР необходимы праймеры - синтетические олигонуклеотиды определенного размера, специфические для каждого типа возбудителей. Праймеры комплементарны последовательностям ДНК на левой и правой границах специфического фрагмента и ориентированы таким образом, что достраивание новой цепи ДНК протекает только между ними. В результате ПЦР происходит многократное увеличение числа копий (амплификация) специфического участка гена при помощи фермента ДНК-полимеразы. Выбор специфического фрагмента и подбор праймеров играет важнейшую роль в специфичности проведения амплификации, что сказывается на качестве проведения анализа исследуемых микромицетов.

Использование специальных флуоресцентных меток при детекции результатов позволяет отказаться от стадии электрофореза, что снижает риск перекрестной контаминации продуктами ПЦР и, соответственно, уменьшает число ложноположительных результатов. Поскольку регистрация результатов проводится непосредственно в процессе реакции амплификации, весь анализ можно проводить в одной-двух комнатах лаборатории силами одного сотрудника. Этот подход позволяет проводить автоматическую интерпретацию полученных результатов и снимает проблему субъективной оценки электрофореграмм. Существует несколько флуоресцентных технологий, различающихся по способам генерации репортерной флуоресценции. В данной заявке используются зонды с комплементарными концевыми последовательностями по типу «молекулярных маяков» (molecular beacons).

Наиболее близким аналогом являются олигонуклеотидные зонды, разработанные для выявления продуктов амплификации в режиме реального времени R. Bialek с соавторами в 2004 году. Авторы используют 2 зонда с резонансным переносом энергии (LightCycler assay). Принцип метода основан на переносе энергии с одного флуорофора, находящегося на 3'-конце первого зонда, ко второму флуорофору, находящемуся на 5'-конце второго зонда. Излучение детектируется при одновременном связывании обоих зондов с ДНК-матрицей. В качестве ДНК-мишеней для выявления возбудителя кокцидиоидомикоза был выбран участок гена, кодирующего антиген, обогащенный пролином (Ag2/PPvA) [PCR Assays for Identification of Coccidioides posadasii Based on the Nucleotide Sequence of the Antigen 2/Proline-Rich Antigen/Bialek R., Kern J., Herrmannetall T. et al. // J. Clinical. Microdiol. - 2004. - Vol.42, №2. - Р.778-783.].

Целью настоящего изобретения является разработка олигонуклеотидного зонда для флуоресцентной детекции результатов анализа методом полимеразной цепной реакции при идентификации С.posadasii в режиме реального времени.

Цель достигается конструированием специфичного олигонуклеотида, имеющего структуру «шпильки» с флуорофором и гасителем флуоресценции на концах и обладающего комплементарностью к продукту реакции амплификации с праймерами CpSOW82s/CpSOWS2as (патент №2346045):

PR-SOW 5'(ROX)-CGCGGAGATGACTGTCGAGTGGCGCG-(BHQ2)3',

где ROX - карбокси-Х-родамин, флуоресцентный краситель, длина волны поглощения которого составляет 580 нм, а длина волны флуоресценции - 605 нм. BHQ2 - гаситель флуоресценции с диапазоном гашения 550-650 нм.

Характеристика олигонуклеотидного зонда и ДНК-мишени для его гибридизации.

Основываясь на данных, представленных в базе GenBank NCBI (National Center for Biotechnology Information), был подобран олигонуклеотид, обладающий активностью гибридизационного зонда по типу «молекулярного маяка» к фрагменту генома возбудителя кокцидиоидомикоза, фланкированному праймерами CpSOW82s/CpSOWS2as. Данный зонд обеспечивает флуоресцентную детекцию продукта амплификации фрагмента гена гликопротеина внешней стенки сферул SOWgp82 (spherule outer wall glycoprotein) С. posadasii.

В качестве положительного контроля эксперименты проводили на типовом штамме С. posadasii 36 Silveira, используя для выделения ДНК обеззараженные суспензии микромицета в концентрациях от 1×106 артроспор/мл до 1×101 артроспор/мл. Подсчет клеток проводили в камере Горяева. Апробация гибридизационного зонда была осуществлена на наборе штаммов возбудителя кокцидиоидомикоза коллекционного центра МЖК ФКУЗ Волгоградский научно-исследовательский противочумный институт Роспотребнадзора.

Чувствительность реакции амплификации с флуоресцентно-меченым зондом PR-SOW оценивалась при исследовании проб ДНК, выделенных из десятикратных разведений чистых культур возбудителя кокцидиоидомикоза, и составила - 1×102-1×104 клеток/мл.

Для обнаружения возбудителя кокцидиоидомикоза методом ПЦР оценена возможность использования сконструированного олигонуклеотидного зонда для анализа биологического материала (кровь, искусственно контаминированная клетками С. posadasii). Показано, что использование разработанного зонда при постановке реакции амплификации позволяет выявлять ДНК возбудителей кокцидиоидомикоза с чувствительностью 1×104 клеток/мл.

Примеры конкретного выполнения.

Пример 1. Методика конструирования флуоресцентно-меченого олигонуклеотидного зонда PR-SOW для идентификации ДНК возбудителя кокцидиоидомикоза С. posadasü методом ПЦР с флуоресцентной детекцией.

На основе теоретического изучения нуклеотидной последовательности фрагмента гена SOWgp82 возбудителя кокцидиоидомикоза, фланкированной праймерами CpSOW82s/CpSOWS2as и имеющей длину 300 п.н., сконструирован гибридизационный зонд размером 26 п.н. (таблица 1).

Полученный олигонуклеотид был проанализирован с помощью компьютерной программы Vector NTI Express v. 1.1.2 (Life Technologies, США) на предмет образования вторичных структур с праймерами CpSOW82s/CpSOWS2as, а также с использованием ресурса BLAST на web-сервере Национального Центра Биотехнологической Информации (NCBI) (http://www.ncbi.nlm.nih.gov/BLAST/) для установления гомологии между ним и нуклеотидными последовательностями близкородственных возбудителей особо опасных микозов и гетерологичных микроорганизмов, присутствующих в базах данных (EMBL, GenBank, DDBJ). На момент проведения компьютерного анализа гомологии выявлено не было.

Пример 2. Детекция специфических фрагментов ДНК с помощью разработанного зонда PR-SOW для идентификации ДНК возбудителя кокцидиоидомикоза методом ПЦР в режиме реального времени.

В состав реакционных смесей, помимо анализируемой ДНК, входили комплементарные специфическому фрагменту олигонуклеотидные зонды, меченые флуорофором ROX и гасителем флуоресценции (BHQ2), а также праймеры CpSOW82s/CpSOWS2as, дезоксирибонуклеозидтрифосфаты, буферный раствор и фермент Год-полимераза. Праймеры и зонд для внутреннего контроля использовали при проверке тест-систем на специфичность и при анализе способов выделения ДНК. В качестве отрицательного контроля в пробирку вместо образца вносили такой же объем дистиллированной воды.

Амплификацию продолжительностью 45 циклов проводили в объеме 25 мкл с использованием «горячего старта».

Анализ продуктов ПЦР осуществляли в режиме реального времени на приборе «Rotor-Gene 6000» («Corbett Research», Австралия). Регистрацию результатов проводили в табличной и графической форме с помощью компьютерных программ. Результаты оценивали по наличию или отсутствию пересечения кривой флуоресценции с пороговой линией, что определяется значением порогового цикла «Ct» в соответствующей графе в таблице результатов (рис.1).

Пример 3. Определение чувствительности и специфичности реакции амплификации в режиме реального времени с помощью разработанного флуоресцентно-меченого олигонуклеотидного зонда PR-SOW для идентификации ДНК возбудителя кокцидиоидомикоза.

Чувствительность реакции амплификации с разработанным гибридизационным зондом оценивалась при исследовании проб ДНК, выделенных из десятикратных разведений клеток чистых культур возбудителя кокцидиоидомикоза.

Обеззараживание исследуемых проб производили добавлением раствора мертиолята натрия до конечной концентрации 0,1% и прогреванием в течение 40 мин при температуре 56°С и инкубированием при комнатной температуре 24 ч. Выделение ДНК из чистых культур микромицетов выполняли с помощью метода гуанидинтиоцианат-фенольной экстракции с переосаждением ДНК изопропанолом (Sandhu G.S. et al., 1995). Постановку реакции ПЦР осуществляли как описано в примере 2. При тестировании коллекции грибных культур С. posadasii ФКУЗ Волгоградский научно-исследовательский противочумный институт Роспотребнадзора с использованием разработанного флуоресцентно-меченого олигонуклеотидного зонда PR-SOW продукт амплификации детектировался с ДНК всех штаммов возбудителя кокцидиоидомикоза с чувствительностью 1×102-1×104 клеток/мл. С другими видами близкородственных грибов и гетерологичных микроорганизмов в реакции ПЦР с разработанными праймерами в 100% случаев получен отрицательный результат (рис.1).

В качестве примера на рисунке 1 показана диаграмма результатов реакции амплификации в режиме реального времени при определении чувствительности сконструированных праймеров с ДНК штаммов возбудителя кокцидиоидомикоза С. posadasii 36 Silveira (графики представлены в порядке убывания концентрации слева направо: 1х105 клеток/мл, 1х104 клеток/мл, 1х103 клеток/мл).

Таким образом, разработанный гибридизационный зонд может быть использован для идентификации возбудителя кокцидиоидомикоза и позволяет в короткий срок с высокой чувствительностью и специфичностью детектировать ДНК С.posadasii в чистой культуре и биологическом материале.

Таблица 1
Характеристика сконструированного флуоресцентно-меченого олигонуклеотидного зонда для идентификации возбудителя кокцидиоидомикоза С. posadasii
Название зонда Последовательность праймеров Локализация Флуоресцентный краситель/гаситель флуоресценции
PR-SOW CGCGGAGATGACTGTCGAGTGGCGCG ген SOWgp82 (spherule outer wall glycoprotein) ROX/BHQ2

Олигонуклеотидный зонд с комплементарными концевыми последовательностями по типу «молекулярного маяка», обеспечивающий флуоресцентную детекцию при идентификации возбудителя кокцидиоидомикоза Coccidioides posadasii методом полимеразной цепной реакции с олигонуклеотидными праймерами CpSOW82s/CpSOWS2as (патент №2346045), комплементарными фрагменту гена гликопротеина внешней стенки сферул SOWgp82 (spherule outer wall glycoprotein) С. posadasii имеет следующую структуру:

PR-SOW 5'(ROX)-CGCGGAGATGACTGTCGAGTGGCGCG-(BHQ2)3',

где ROX - карбокси-Х-родамин, флуоресцентный краситель, длина волны поглощения которого сотавляет 580 нм, а длина волны флуоресценции - 605 нм. BHQ2 - гаситель флуоресценции с диапазоном гашения 550-650 нм.

Олигонуклеотидный зонд с комплементарными концевыми последовательностями по типу "молекулярного маяка", обеспечивающий флуоресцентную детекцию при идентификации возбудителя кокцидиоидомикоза Coccidioides posadasii методом полимеразной цепной реакции с олигонуклеотидными праймерами CpSOW82s/CpSOWS2as, комплементарными фрагменту гена гликопротеина внешней стенки сферул SOWgp82 (spherule outer wall glycoprotein) С. posadasii имеет следующую структуру:
PR-SOW 5'(ROX)-CGCGGAGATGACTGTCGAGTGGCGCG-(BHQ2) 3',
где ROX - карбокси-Х-родамин, флуоресцентный краситель, длина волны поглощения которого составляет 580 нм, а длина волны флуоресценции - 605 нм, BHQ2 - гаситель флуоресценции с диапазоном гашения 550-650 нм.



 

Похожие патенты:

Группа изобретений относится к области генной инженерии. Копии секвенируемой молекулы ДНК помещают в четыре раствора, каждый из которых характеризуется сниженной концентрацией одного из нуклеотидов, по сравнению с остальными тремя нуклеотидами, во время проведения полимеризации ДНК в каждом из растворов регистрируют факты выделения ионов с помощью сенсоров на основе МДП-структур.

Изобретение относится к области молекулярной биологии, биохимии, иммунологии и генетической инженерии. Предложена композиция для определения разнообразия CDR3 последовательностей TCRB или IGH в образце.

Изобретение относится к медицине, а именно к биохимическим исследованиям биологических объектов. Набор состоит из лизирующего буфера на основе 3-10 М раствора мочевины, связывающего буфера на основе 2,5-5 М хлористого натрия, элюирующего буфера на основе раствора 10 мМ Трис-HCl и 1 мМ Трилона Б с pH 8 и 80% этилового спирта в качестве отмывочного буфера.

Представлены наборы олигонуклеотидных зондов и праймеров, биологический микрочип и тест-система для идентификации и типирования вируса гриппа А и В. Охарактеризованная тест-система содержит: набор реагентов для выделения РНК вируса гриппа из биологического материала человека; набор реагентов для проведения ПЦР-амплификации, совмещенной с обратной транскрипцией, с образованием флуоресцентно-меченных фрагментов генома вируса гриппа, содержащий описанные олигонуклеотиды-праймеры; набор реагентов для проведения гибридизации фрагментов ДНК, полученных после проведения амплификации на биочипе, содержащем элементы с иммобилизованными описанными олигонуклеотидными зондами; и при необходимости, отрицательный и положительный контрольные образцы.

Изобретение относится к биотехнологии и представляет собой способ спектрального анализа флуоресцентных свойств нуклеотидных последовательностей ДНК. Предложенное изобретение может быть использовано для генетической диагностики, исследования митогенетического излучения клеток, исследования кодирования наследственной и пролиферативной информации.
Изобретение относится к области молекулярной биологии и биохимии. Устройство состоит из источника света, излучение от которого направлено на прозрачную подложку с иммобилизованными на ее поверхности олигонуклеотидами и расположенной под ней системой детекции интенсивности света, прошедшего через подложку.

Группа изобретений относится к области биохимии. Заявлены варианты способа скрининга и мониторинга онкологических заболеваний, включающего забор образца ткани, выделение из образца ткани РНК, синтез кДНК, амплификацию методом множественной обратной транскрипции полимеразой цепной реакции с последующим анализом амплифицированных продуктов.

Изобретение относится к области молекулярной биологии и биотехнологии и касается сухой смеси для амплификации нуклеиновой кислоты и способа ее получения. Охарактеризованная смесь содержит термостабильную ДНК-полимеразу, обратную транскриптазу, первый стабилизатор, выбранный из группы, включающей моносахариды, дисахариды, полиспирты и второй стабилизатор, выбранный из группы, включающей полисахариды, альбумины, поливинилпирролидон.
Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для выявления ДНК пародонтопатогенного микроорганизма Tannerella forsythensis методом полимеразной цепной реакции.

Группа изобретений относится к области биотехнологии и направлена на молекулы нуклеиновых кислот, которые кодируют белок, проявляющий свойства биосенсора для детекции пероксида водорода в живых клетках, обладающий флуоресценцией в красной области спектра.

Изобретение относится к биотехнологии. Описан способ предсказания ответа субъекта на терапевтическое средство для лечения ревматоидного артрита (RA). Также представлен способ предсказания, будет ли субъект с RA отвечать на лечение антагонистом В-клеток. Кроме того, представлен способ предсказания того, будет ли субъект с ревматоидным артритом эффективно отвечать на лечение антагонистом В-клеток, и способ выбора терапии пациента или субпопуляции пациентов с ревматоидным артритом. Все способы включают измерение в биологическом образце, полученном от субъекта, экспрессии одного гена или их комбинации или экспрессии одного белка или их комбинации, кодируемой одним геном или их комбинацией, где один ген или их комбинация выбраны из любого из CXCL13, FcRH5 и sFcRH5. Изобретение расширяет диагностические возможности в отношении RA. 4 н. и 16 з.п. ф-лы, 14 ил., 13 табл.

Группа изобретений относится к области генетики, молекулярной биологии, судебной медицины и криминалистики и касается инструмента для определения гаплогрупп Y-хромосомы человека. Группа изобретений представлена набором дифференцирующих олигонуклеотидных зондов, биочипом, содержащим эти зонды, и способом применения биочипа для анализа. Биочип обеспечивает возможность определения 10 гаплогрупп Y-хромосомы человека. Определение гаплогруппы осуществляется посредством генотипирования Y-хромосомы по 10 маркерам: М130 (С), М145 (DE), P257 (G), Мб9 (Н), U179 (I), M304 (J), М185 (L), M231 (N), M175 (О) и Р224 (R) с использованием биочипа, на котором иммобилизованы олигонуклеотиды, последовательность которых определена в табл.1. Структура дифференцирующих олигонуклеотидов, используемых в каждом изобретении группы, позволяет обеспечить их связывание только с полностью комплементарными мишенями, обеспечивая яркий флуоресцентный сигнал в соответствующих им ячейках биочипа. 3 н.п. ф-лы, 2 ил., 1 табл., 3 пр.

Изобретение относится к биотехнологии, а именно к способу пренатальной и постнатальной ДНК-диагностики синдрома Дауна, Эдвардса и Патау, мутации delF508 в гене муковисцидоза и резус-фактора плода методом количественной флюоресцентной полимеразной цепной реакции. Способ включает выделение ДНК из анализируемого материала сорбентом Nucleos набора DIAtom DNA Prep 100. Проводят элюацию ДНК дистиллированной стерильной водой. Осуществляют две мультиплексные амплификации с использованием набора флюоресцентно-меченых праймеров - первая на 4 локуса 21-й хромосомы, а именно D21S1435, D21S1411, D21S11 и IFNAR, на мутацию delF508 в гене муковисцидоза и на участок 10 экзона гена RhD, вторая - на 4 локуса 13 хромосомы, а именно D13S628, D13S634, D13S742, D13S305, и 4 локуса 18 хромосомы, а именно D18S386, D18S391, D18S535, D18S978. Смешивают полученные ПЦР-продукты в одной лунке. Проводят детекцию методом капиллярного электрофореза в полиакриламидном геле. Изобретение позволяет с высокой точностью диагностировать наличие синдромов Патау, Эдвардса и Дауна, мутации delF508 в гене муковисцидоза и резус принадлежности плода. 1 з.п. ф-лы, 4 ил., 1 табл., 4 пр.

Изобретение относится к ветеринарной вирусологии. Описан способ выявления геномной РНК вируса болезни Ибараки (ВБИ) с помощью ПЦР с детекцией продуктов амплификации в режиме реального времени с использованием олигонуклеотидных праймеров и зонда, комплементарных участку 10 сегмента генома ВБИ, кодирующему неструктурные белки NS3 и NS3a. Способ с помощью ПЦР-РВ проводят при следующем температурном режиме: 1) 5 мин предварительной денатурации кДНК при 94°С; 2) 5 циклов реакции (денатурация при 94°С - 15 сек, отжиг праймеров при 62°С - 15 сек, элонгация при 72°С - 15 сек); 3) 35 циклов реакции с детекцией на стадии отжига праймеров (денатурация при 94°С - 15 сек, отжиг праймеров при 62°С - 15 сек, элонгация при 72°С - 20 сек). Учет результатов реакции проводят, анализируя кривые накопления флуоресцентного сигнала для каждой пробы. Представлен нуклеотидный состав указанных праймеров и зонда: IbarF 5'-GATCAAACCATTTTGCGCTT-3' IbarR5'-CTCATCCTCACCGCCTCATTG-3' IbarZ 5'-[HEX] TCTTGTATGGTCAATCCGCTGGCT [BH2J-3'. Изобретение позволяет сократить время проведения исследования, а также осуществлять не только качественный, но и количественный анализ содержания НК в образцах. 3 н.п. ф-лы, 4 табл., 6 пр.

Изобретение касается способа определения биологической активности эмбрионированных яиц Trichuris. Охарактеризованный способ включает осуществление по меньшей мере 3-х анализов, выбранных из: - оценки и/или подтверждения стадии эмбрионального развития яиц с помощью метода количественной ПЦР с использованием пригодных маркерных последовательностей для определения количества копий геномной ДНК, - оценки метаболической активности эмбрионированных яиц с помощью биохимических и/или молекулярно-биологических методов, - оценки индуцибельности генной экспрессии в эмбрионированных яйцах, - оценки подвижности личинок Trichurs с помощью микроскопа в течение продолжительных периодов наблюдения после предварительной инкубации при повышенных температурах и/или - оценки коэффициента вылупляемости личинок Trichuris в организме лабораторного животного. Представленное изобретение может быть использовано при получении безопасных фармацевтических продуктов, терапевтически эффективных при применении у человека. 14 з.п. ф-лы, 10 ил., 11 табл., 6 пр.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченого зонда для детекции ДНК бокавируса человека. Указанный набор содержит прямой праймер 5'-ATCCWCTTGADAACGGTRAACC-3', обратный праймер 5'-RGGRATAAAGAGMGAGCYCAA-3' и флуоресцентно-меченый ДНК-зонд 5'-Cy5-CGCCGTGGCTCCTGCTC-BHQ2-3'. Изобретение обеспечивает надежную и достоверную детекцию бокавируса человека в клинических образцах и других биологических материалах методом ПЦР. 2 ил., 3 табл.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации РНК респираторно-синцитиального вируса человека. Указанный набор содержит две пары олигонуклеотидных праймеров и два флуоресцентно-меченых ДНК-зонда, а именно внешний прямой праймер 5'-AGRCARCARAGTTAYTCYATYATGTC-3', внешний обратный праймер 5'-AATTTATTATWGGTTYMCCYTTTACATA-3', прямой праймер 5'-GACACHATGAAYAGYTTRACATTACC-3', обратный праймер 5'-AAATGTYTTTATDATYCCRCGATTT-3', зонды 5'-FAM-TCTCTAGGAGCCATTGTGTCATGCTATGG-BHQ1-3' и 5'-FAM-TCTCTWGGAGCYATAGTGTCATGYTATGG-BHQ1-3'. Изобретение обеспечивает надежную и достоверную детекцию респираторно-синцитиального вируса человека в клинических образцах и других биологических материалах методом ПЦР. 1 ил., 5 табл.

Изобретение относится к области молекулярной биологии и биохимии. Предложена димерная наноструктура, способ её конструирования, способ детектирования аналита и набор для детектирования аналита. Изобретение позволяет повысить чувствительность и точность детектирования единичных молекул. 4 н. и 19 з.п. ф-лы, 6 ил., 4 пр.

Изобретение относится к области биохимии, в частности к набору реагентов и способу для выявления ДНК возбудителей чумы, сибирской язвы и туляремии. Набор содержит шесть видоспецифичных олигонуклеотидных праймеров и три зонда, комплементарных фрагментам ДНК генов Yersinia pestis, Bacillus anthracis и Francisella tularensis. ДНК-мишенями для специфической амплификации являются фрагмент хромосомного гена уро2088 метилтрансферазы Yersinia pestis, фрагмент хромосомного гена sspE Bacillus anthracis и фрагмент хромосомной ДНК элемента вставки ISFtu5 Francisella tularensis. Изобретение позволяет быстро и высокоспецифично выявлять штаммы видов Y. pestis, B. anthracis и F. tularensis, независимо от плазмидного профиля штаммов. 2 н.п. ф-лы, 3 ил., 5 табл., 2 пр.

Группа изобретений относится к области биотехнологии, в частности к автоматическому устройству и способу очистки и выделения целевой нуклеиновой кислоты из биологического образца, причем устройство обеспечивает возможность предотвратить загрязнение выделенной целевой нуклеиновой кислоты от аэрозоля и которое может быть применено ко всем видам оборудования выделения и очистки нуклеиновых кислот из множества биологических образцов, использующего магнитный стержень или мультипипеточный блок, движущийся в двух или трех осевых направлениях. Группа изобретений обеспечивает повышение качества очистки выделенных из биологического образца целевых нуклеиновых кислот от загрязнения их аэрозолем, образующимся из биологического образца, содержащего целевую нуклеиновую кислоту в высокой концентрации, для обеспечения более точных результатов последующих исследований выделенных целевых нуклеиновых кислот. 2 н. и 17 з.п. ф-лы, 19 ил.
Наверх