Способ измерения искусственного иммунитета



Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета
Способ измерения искусственного иммунитета

 


Владельцы патента RU 2539032:

ФРЕД ХАТЧИНСОН КАНСЭР РИСЁЧ СЕНТЕР (US)

Изобретение относится к области молекулярной биологии, биохимии, иммунологии и генетической инженерии. Предложена композиция для определения разнообразия CDR3 последовательностей TCRB или IGH в образце. Изобретение может быть использовано для оценки адаптивной иммунной системы пациентов в медицине. 35 з.п. ф-лы, 14 табл., 14 пр.

 

ПРЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННЫЕ ЗАЯВКИ

[0001] Данная заявка заявляет преимущество предварительной заявки на патент США №61/220,344, поданной 25 июня 2009 г., и тем самым включенной ссылкой во всей ее полноте.

ОБЛАСТЬ ТЕХНИКИ

[0002] Описан способ измерения адаптивного иммунитета пациента путем анализа разнообразия генов рецепторов Т-клеток или генов антител с использованием крупномасштабного секвенирования нуклеиновой кислоты, экстрагированной из клеток адаптивной иммунной системы.

ПРЕДПОСЫЛКИ

[0003] Иммунокомпетентность является способностью организма продуцировать нормальный иммунный ответ (т.е. продуцирование антител и/или опосредованный клетками иммунитет) после воздействия патогена, который может быть живым организмом (таким как бактерия или гриб), вируса или специфических антигенных компонентов, выделенных из патогена и введенных в вакцину. Иммунокомпетентность является противоположностью иммунодефициту, или иммунной некомпетентности, или ослабленному иммунитегу. Несколькими примерами могли бы быть новорожденный, у которого пока нет полностью функционирующей иммунной системы, но у которого могут быть переданное матерью антитело (иммуннодефицный); пациент па поздней стадии СПИДа с разрушенной или разрушающейся иммунной системой (иммунная некомпетентность); реципиент с трансплантатом, принимающий лекарство для того, чтобы его организм не отторгал донорский орган (ослабленный иммунитет); связанное с возрастом ослабление функции Т-клеток у лиц пожилого возраста; или индивидуумы, подвергшиеся радиации или химиотерапевтическим лекарственным средствам. Могут быть случаи совмещения, но эти выражения представляют все показатели дисфункциональной иммунной системы. В отношении лимфоцитов иммунокомпетентность означает, что В-клетка или Т-клетка является зрелой и может распознавать антигены и позволять человеку повышать иммунный ответ.

[0004] Иммунокомпетентность зависит от способности адаптивной иммунной системы повышать иммунный ответ, специфический для любых потенциальных чужеродных антигенов, используя высоко полиморфные рецепторы, закодированные В-клетками (иммуноглобулины, Ig) и Т-клетками (Т-клеточные рецепторы, TCR).

[0005] Ig, экспрессированные В-клетками, представляют собой белки, включающие четыре полипсптидные цепи, две тяжелые цепи (Н цепи) и две легкие цепи (L цепи), формирующих HL структуру. Каждая пара Н и L цепей содержит гипервариабельный домен, включающий VL и VH участок, и константный домен. Н цепи Ig бывают нескольких типов: µ, δ, γ, α и β. Разнообразие Ig у индивидуума в основном определено гипервариабельным доменом. V домен Н цепей создается комбинаторным соединением трех типов сегментов гена «germline», сегментами VH, DH и JH. Разнообразие последовательности гипервариабельного домена, кроме того, увеличивается независимым добавлением и делецией нуклеотидов в соединениях VH-DH, DH-JH и VH-JH во время процесса перестройки гена Ig. В этом отношении иммунокомпетентность отражается в разнообразии Ig.

[0006] TCR, экспрессированные αβ Т-клетками, являются белками, включающими две трансмембранные полипептидные цепи (α и β), экспрсссированные от TCRA и TCRB генов, соответственно. Подобные TCR белки экспрессированы в гамма-дельта Т-клетках, из TCRD и TCRG локусов. Каждый TCR пептид содержит вариабельные определяющие комплементарность участки (CDR), а также каркасные участки (FR) и константный участок. Разнообразие последовательностей αβ Т-клеток в значительной степени определено аминокислотной последовательностью петель третьего определяющего комплементарность участка (CDR3) вариабельных доменов α и β цепей, чье разнообразие является результатом рекомбинации между вариабельным (Vβ), разнообразным (Dβ) и соединяющим (Jβ) генными сегментами в локусе β цепи и между аналогичными Vα и Jα генными сегментами в локусе α цепи, соответственно. Существование множества таких генных сегментов в локусах α и β цепей TCR предоставляет большое число отдельных CDR3 последовательностей, подлежащих кодированию. Разнообразие CDR3 последовательностей, кроме того, увеличивается в зависимости от добавления и делении нуклеотидов на Vβ-Dβ, Dβ-Jβ и Vα-Jα соединениях во время процесса перестройки TCR гена. В этом отношении, иммунокомпетентность отражается в разнообразии TCR.

[0007] Существует назревшая потребность в способах оценки или измерения адаптивной иммунной системы пациентов в различных условиях, будь то иммунокомпетентность при ослабленном иммунитете или разрегулированный адаптивный иммунитет при аутоиммунном заболевании. Существует потребность в способах диагностики состояния заболевания или эффекты старения путем оценки иммунокомпетентности пациента. Таким же образом должны быть проконтролированы результаты лечений, которые модифицируют иммунную систему, путем оценки иммунокомпетентности пациента, в процессе прохождения курса лечения. С другой стороны, существует потребность в способах контроля адаптивной иммунной системы в контексте вспышек аутоиммунного заболевании и ремиссий в целях контроля ответа на лечение или потребность начать профилактическое лечение предсимптоматически.

КРАТКОЕ ОПИСАНИЕ

[0008] Одним аспектом данного изобретения является композиция, включающая:

- многообразие праймеров V сегмента, где каждый праймер включает последовательность, которая комплементарна отдельному функциональному V сегменту или небольшому семейству V сегментов; и

- многообразие праймеров J-сегмента, где каждый праймер включает последовательность, которая комплементарна J сегменту;

где праймеры V сегмента и J-сегмента разрешают амплификацию CDR3 участка TCR путем многократной полимеразной цепной реакции (PCR) с продуцированным многообразием амплифицированных молекул ДНК, достаточных для определения разнообразия TCR генов. Одним вариантом осуществления данного изобретения является композиция, где каждый праймер V сегмента включает последовательность, которая комплементарна отдельному Vβ сегменту, а каждый праймер J сегмента включает последовательность, которая комплементарна Jβ сегменту, и где праймеры V сегмента и J-сегмента разрешают амплификацию CDR3 участка TCRβ. Другим вариантом осуществления является композиция, где каждый праймер V-сегмента включает последовательность, которая комплементарна отдельному функциональному Vα сегменту, а каждый праймер J сегмента включает последовательность, которая комплементарна Jα сегменту, и где праймеры V сегмента и J-сегмента разрешают амплификацию CDR3 участка TCRα.

[0009] Другим вариантом осуществления данного изобретения является композиция, где праймеры V сегмента гибридизируются с консервативным сегментом и имеют подобную прочность отжига. В другом варианте осуществления праймер V сегмента заякорен в положении -43 в Vβ сегменте относительно сигнальной последовательности рекомбинации (RSS). В другом варианте осуществления многообразие праймеров V сегмента включает по меньшей мере из 45 праймеров, специфических к 45 различным Vβ генам. В другом варианте осуществления праймеры V сегмента имеют последовательности, которые выбраны из группы, включающей SEQ ID NOS:1-45. В другом варианте осуществления праймеры V сегмента имеют последовательности, которые выбраны из группы, включающей SEQ ID NOS:58-102. Другой вариант осуществления, где праймер V сегмента для каждого Vβ сегмента.

[0010] Другим вариантом осуществления данного изобретения является композиция, где праймеры J сегмента гибридизируются с элементом консервативного каркасного участка Jβ сегмента и имеют подобную прочность отжига. Композиция по пункту 2, где многообразие праймеров J сегмента состоит по меньшей мере из тринадцати праймеров, специфических к тринадцати различным Jβ генам. Другим вариантом осуществления является композиция по п.2, где праймеры J сегмента имеют последовательности, выбранные из группы, включающей SEQ ID NOS:46-57. В другом варианте осуществления праймеры J сегмента имеют последовательности, выбранные из группы, включающей SEQ ID NOS:102-113. Другим вариантом осуществления является праймер J сегмента для каждого Jβ сегмента. В другом варианте осуществления все праймеры J сегмента отжигаются с одинаковым консервативным мотивом.

[0011] Другим вариантом осуществления данного изобретения является композиция, где амплифицированная молекула ДНК начинается с указанного консервативного мотива и амплифицирует соответствующую последовательность для диагностической идентификации J сегмента, и включает CDR3 соединение, и распространяется в V сегмент. В другом варианте осуществления каждый из амплифицированных сегментов Jβ гена имеет уникальный свободный конец из четырех оснований в положениях от +11 до +14 ниже RSS сайта.

[0012] Другим аспектом данного изобретения является композиция, дополнительно включающая совокупность се квенирующих олигонуклеотидов, где секвепирующие олигопуклеотиды гибридизируются с участками в амплифицированных молекулах ДНК. Вариантом осуществления являются гибридизация секвенирующих олигоиуклеотидов рядом со свободным концом из четырех оснований в амплифицированных сегментах Jβ генов в положениях от +11 до +14 ниже RSS сайта. В другом варианте осуществления секвенирующие олигонуклеотиды выбраны из группы, включающей SEG ID NOS:58-70. В другом варианте осуществления V сегмент или J-сегмент выбран так, чтобы включать коррекция ошибок последовательности путем слияния близко родственных последовательностей. Другим вариантом осуществления является композиция, дополнительно включающая универсальный праймер С сегмента для образования кДНК из мРНК.

[0013] Другим аспектом данного изобретения является композиция, включающая:

- многообразие праймеров V сегмента, где каждый праймер V сегмента включает последовательность, которая комплементарна отдельному функциональному V сегменту или небольшому семейству V сегментов; и

- многообразие праймеров J сегмента, где каждый ираймер J сегмента включает последовательность, которая комплементарна J сегменту;

где праймеры V сегмента и J-сегмента разрешают амплификацию CDR3 участка TCRG путем многократной полимеразной цепной реакции (PCR) с получением многообразия амплифицированных молекул ДНК, достаточных для определения разнообразия генов тяжелых цепей антител.

[0014] Другим аспектом данного изобретения является композиция, включающая:

- многообразие праймеров V сегмента, где каждый праймер V сегмента включает последовательность, которая комплементарна отдельному функциональному V сегменту или небольшому семейству V сегментов; и

- многообразие праймеров J сегмента, где каждый праймер J сегмента включает последовательность, которая комплементарна J сегменту;

где праймеры V сегмента и J сегмента разрешают амплификацию CDR3 участка тяжелой цепи (IGII) антитела путем многократной полимеразной цепной реакции (PCR) с продуцированным многообразием амплифицированных молекул ДНК, достаточных для определения разнообразия генов тяжелой цепи антитела.

[0015] Другим аспектом данного изобретения является композиция, включающая:

- многообразие праймеров V сегмента, где каждый праймер V сегмента включает последовательность, которая комплементарна отдельному функциональному V сегменту или небольшому семейству V сегментов; и

- многообразие праймеров J сегмента, где каждый праймер J сегмента включает последовательность, которая комплементарна J сегменту;

где праймеры V сегмента и J сегмента разрешают амплификацию VL участка легкой цепи (IGL) антитела путем многократной полимеразной цепной реакции (PCR) с продуцированным многообразием амплифицированных молекул ДНК, достаточных для определения разнообразия генов легкой цепи антитела.

[0016] Другим аспектом данного изобретения является способ, включающий:

- отбор многообразия праймеров V сегмента, где каждый праймер V сегмента включает последовательность, которая комплементарна отдельному функциональному V сегменту или небольшому семейству V сегментов; и

- отбор многообразия праймеров J сегмента, где каждый праймер J сегмента включает последовательность, которая комплементарна J сегменту;

- комбинирование праймеров V сегмента и J сегмента с образцом геномной ДНК для разрешения амплификации CDR3 участка путем многократной полимеразной цепной реакции (PCR) с получением многообразия амплифицированных молекул ДНК, достаточных для определения разнообразия TCR генов.

[0017] Одним вариантом осуществления данного изобретения является способ, где каждый праймер V сегмента включает последовательность, которая комплементарна отдельному функциональному Vβ сегменту, а каждый праймер J сегмента включает последовательность, которая комплементарна Jβ сегменту; и где комбинирование праймеров V сегмента и J сегмента с образцом геномной ДНК разрешает амплификацию CDR3 участка TCR путем многократной полимеразной цепной реакции (PCR) и продуцирует многообразие амплифицированных молекул ДНК. В другом варианте осуществления каждый праймер V сегмента включает последовательность, которая комплементарна отдельному функциональному Vα сегменту, а каждый праймер J сегмента включает последовательность, которая комплементарна Jα сегменту; и где комбинирование праймеров V сегмента и J сегмента с образцом геномной ДНК разрешает амплификацию CDR3 участка TCR путем многократной полимеразной цепной реакции (PCR) и продуцирует многообразие амплифицированных молекул ДНК.

[0018] Другим вариантом осуществления данного изобретения является способ, дополнительно включающий этап секвенирования амплифицированных молекул ДНК. В другом варианте осуществления на этапе секвенирования используется совокупность секвенирующих олигонуклеотидов, которые гибридизируются с участками в амплифицированных молекулах ДНК. Другим вариантом осуществления является способ, дополнительно включающий этап расчета общего разнообразия CDR3 последовательностей TCRβ среди амплифицированных молекул ДНК. В другом варианте осуществления способ показывает, что общее разнообразие нормального человека составляет более 1*106 последовательностей, более 2*106 последовательностей или более 3*106 последовательностей.

[0019] Другим аспектом данного изобретения является способ диагностики иммунодефицита у пациента-человека, включающий измерение разнообразия CDR3 последовательностей TCR пациента, и сравнение разнообразия субъекта с разнообразием, полученным от нормального субъекта. Вариантом осуществления данного изобретения является способ, где измерение разнообразия последовательностей TCR включает этапы:

- отбора многообразия праймеров V сегмента, где каждый праймер V сегмента включает последовательность, которая комплементарна отдельному функциональному V сегменту или небольшому семейству V сегментов; и

- отбор многообразия праймеров J сегмента, где каждый праймер J сегмента включает последовательность, которая комплементарна J сегменту;

- комбинирование праймеров V сегмента и J сегмента с образцом геномной ДНК для разрешения амплификации CDR3 участка TCR путем многократной полимеразной цепной реакции (PCR) с продуцированным многообразием амплифицированных молекул ДНК;

- секвенирование амплифицированных молекул ДНК;

- расчет общего разнообразия CDR3 последовательностей TCR среди амплифицированных молекул ДНК.

[0020] Вариантом осуществления данного изобретения является способ, где сравнение разнообразия определяется расчетом с использованием следующего уравнения:

Δ ( t ) = x E ( n x ) и з м е р е н и е 1 + 2 x E ( n x ) и з м е р е н и е 2 = S 0 e λ ( 1 e λ t ) d G ( λ ) ,

где G(λ) является эмпирической функцией распределения параметров λ1, …, λS, nx является числом клонотипов, секвенированных строго x раз, и

E ( n x ) = S 0 ( e λ λ x x ! ) d G ( λ ) .

[0021] Другим вариантом осуществления данного изобретения является способ, где сравнивается разнообразие по меньшей мере двух образцов геномной ДНК. В другом варианте осуществления один образец геномной ДНК является образцом от пациента, а другой образец - от нормального субъекта. В другом варианте осуществления один образец геномной ДНК является образцом от пациента перед терапевтическим курсом лечения, а другой образец - от пациента после курса лечения. В другом варианте осуществления два образца геномной ДНК являются образцами от одного и того же пациента в различные точки времени во время курса лечения. В другом варианте осуществления заболевание диагностируется на основе сравнения разнообразия среди образцов геномной ДНК. В другом варианте осуществления иммунокомпетентность пациента-человека оценивается путем сравнения.

ПОДРОБНОЕ ОПИСАНИЕ ИЛЛЮСТРАТИВНЫХ ВАРИАНТОВ ОСУЩЕСТВЛЕНИЯ

[0022] TCR и гены Ig могут образовывать миллионы отличных белков путем соматической мутации. Вследствие этого создающего разнообразие механизма гипервариабельные определяющие комплементарность участки этих генов могут кодировать последовательности, которые могут взаимодействовать с миллионами лигандов, и эти участки связаны с константным участком, который может передавать сигнал клетке, показывающей связывание родственного лиганда белка.

[0023] Адаптивная иммунная система применяет несколько стратегий для создания спектра антигенных рецепторов Т- и В-клеток с достаточным разнообразием для распознавания группы потенциальных патогенов. В αβ и γβ Т-клетках, которые, прежде всего, распознают пеитидпые антигены, представленные молекулами МНС, большая часть из разнообразия рецепторов содержится в третьем определяющем комплементарность участке (CDR3) α и β цепей (или γ и δ цепей) Т-клеточного рецептора (TCR). Хотя было приблизительно оценено, что адаптивная иммунная система может образовывать до 1018 отличных TCR αβ пар, прямая экспериментальная оценка CDR3 разнообразия TCR не удалась.

[0024] В данном документе описывается новый способ измерения CDR3 разнообразия TCR, который основан на секвенировании отдельной молекулы ДНК, и применение этого подхода к последовательности CDR3 участков в миллионах перестроенных TCRβ генов, выделенных из Т-клеток периферической крови двух здоровых взрослых людей.

[0025] Способность адаптивной иммунной системы повышать иммунный ответ, специфический для любого из большого количества потенциальных чужеродных антигенов, которым индивидуум может быть подвергнут, зависит от высоко полиморфных рецепторов, закодированных В-клетками (иммуноглобулинами) и Т-клетками (Т-клеточными рецепторами; TCR). TCR, экспрессированные αβ Т-клетками, которые, прежде всего, распознают пептидные антигены, представленные молекулами главного комплекса гистосовместимости (МНС) класса I и II, являются гетеродимерными белками, включающими две трансмембранные полипептидные цепи (α и β), причем каждая содержит один вариабельный и один константный домен. Пептидная специфичность αβ Т-клеток в значительной части определяется аминокислотной последовательностью, закодированной в петлях третьего определяющего комплементарность участка (CDR3) вариабельных доменов α и β цепи. CDR3 участки β и α цепей сформированы рекомбинацией между неперекрывающимися вариабельным (Vβ), разнообразным (Dβ) и соединяющим (Jβ) сегментами гена в локусе β цепи и между аналогичными Vα и Jα сегментами гена в локусе α цепи, соответственно. Существование множества таких генных сегментов в локусах α и β цепи TCR разрешает большое число отличных CDR3 последовательностей, подлежащих кодированию. Разнообразие CDR3 последовательностей, кроме того, увеличивается независимым от матрицы добавлением и делецией нуклеотидов на Vβ-Dβ, Dβ-Jβ и Vα-Jα соединениях во время процесса генной перестройки TCR.

[0026] Предыдущие попытки оценки разнообразия рецепторов в спектре αβ Т-клеток взрослого человека зависели от исследования перестроенных генов α и β цепи TCR, экспрессированных в небольших хорошо определенных подсовокупностей спектра с последующей экстраполяцией разнообразия, присутствующего в этих подсовокупностях, на полный спектр, с оценкой приблизительно 106 уникальных TCRβ цепи CDR3 последовательностей на индивидуум, с 10-20% этих уникальных TCRβ CDR3 последовательностей, экспрессированными клетками в «обученной» антигеном CD45RO+ категории. Точность и четкость этой оценки весьма ограничены необходимостью экстраполировать разнообразие, наблюдаемое в сотнях последовательностей, на полный спектр, и вполне возможно, что реальное число уникальных TCRβ цепи CDR3 последовательностей в αβ Т-клеточном спектре значительно больше, чем 1×106.

[0027] Недавние достижения в высокопроизводительной технологии ДНК секвенирования сделали возможным значительно более глубокое секвенирование, чем основанные на капиллярах технологии. Комплексная библиотека матричных молекул, несущих универсальные PCR адаптерные последовательности на каждом конце, гибридизирована с «газоном» комплементарных олигонуклеотидов, иммобилизированных на твердой поверхности. Твердофазная PCR используется для амплификации гибридизированной библиотеки, что дает в результате миллионы матричных кластеров на поверхности, причем каждый включает множество (~1000) идентичных копий отдельной молекулы ДНК из оригинальной библиотеки. Интервал 30-54 пар оснований в молекулах в каждом кластере секвенирован с использованием химической технологии обратимой терминации с использованием красителей, для разрешения одновременного секвенирования из геномной ДНК перестроенных CDR3 участков TCRβ цепи, выполняемого в миллионах Т-клеток. Такой подход дает возможность прямого секвенирования значительной доли уникально перестроенных CDR3 участков TCRβ в популяциях αβ Т-клеток, что тем самым разрешает оценить относительную частоту каждой CDR3 последовательности в популяции.

[0028] Точная оценка разнообразия CDR3 последовательностей TCRβ в полном αβ Т-клеточном спектре из разнообразия, измеренного в конечной выборке Т-клеток, требует оценки числа CDR3 последовательностей, присутствующих в спектре, которые не наблюдались в образце. CDR3 разнообразие TCRβ цепи в полном αβ Т-клеточном спектре было оценено с использованием прямых измерений числа уникальных CDR3 последовательностей TCRR, наблюдаемых в образцах крови, содержащих миллионы αβ Т-клеток. Результаты в данном документе идентифицируют нижнюю границу для CDR3 разнообразия TCRβ в CD4+ и CD8+ Т-клеточных категориях, которая в несколько раз выше, чем предыдущие оценки. Кроме того, результаты в данном документе демонстрируют, что имеется по меньшей мере 1,5×106 уникальных CDR3 последовательностей TCRβ в CD45RO+ категории «обученных» антигеном Т-клеток, большая доля которых присутствует при низкой относительной частоте. Существование такой разнообразной популяции CDR3 последовательностей TCRβ в «обученных» антигеном клетках ранее не было продемонстрировано.

[0029] Разнообразный пул TCRβ цепей в каждом здоровом индивидуум является образцом из оцененного теоретического предела более 1011 возможных последовательностей. Однако реализованная совокупность перестроенных TCR не равномерно отобрана из этого теоретического предела. Различные Vβ и Jβ обнаружены с более чем тысячекратной разностью частот. Кроме того, степени инсерции нуклеотидов являются сильно смещенными. Этот уменьшенный предел полученных TCRβ последовательностей ведет к вероятности обладания людьми общими β цепями. С данными о последовательностях, сгенерированными способами, описанными в данном документе, могут быть вычислены in vivo применение J, применение V, моно- и динуклеотидные смещения и зависимое от положения применение аминокислот. Эти смещения значительно уже размера предела последовательностей, из которого выбраны TCRβ, что указывает на то, что различные индивидуумы имеют общие TCRβ цепи с идентичными аминокислотными последовательностями. Результаты в данном документе показывают, что многие тысячи таких идентичных последовательностей являются попарно общими в геномах отдельных людей.

[0030] Технология оценивания использует два пула праймеров для обеспечения высоко мультиплексной реакции PCR. «Прямой» пул имеет праймер, специфический к каждому V сегменту в гене (несколько праймеров, направленных на высоко консервативный участок, используются, чтобы одновременно захватить множество V сегментов). Праймеры «обратного» пула отжигаются с консервативной последовательностью в соединяющем ("J") сегменте. Пул амплифицированного сегмента включает соответствующую последовательность для идентификации каждого J сегмента, а также для разрешения отжига J-сегмент-специфического праймера для ресеквенирования. Это дает возможность непосредственного наблюдения большой фракции соматических перестроек, присутствующих у индивидуума. Это, в свою очередь, позволяет быстро сравнить TCR спектр у индивидуумов с аутоиммунным нарушением (или показанием другого целевого заболевания) с TCR спектром контролей.

[0031] Адаптивная иммунная система теоретически может генерировать огромное разнообразие CDR3 последовательностей Т-клеточных рецепторов - гораздо больше, чем вероятно будет экспрессировано у какого-либо индивидуума в любой момент времени. Предыдущие попытки измерить, какая фракция этого теоретического разнообразия фактически используется в αβ Т-клеточном спектре у взрослого, однако, не предоставили четкую оценку разнообразия. Как описывалось в данном документе, разработка нового подхода к этому вопросу, основанная на секвенировании отдельной молекулы ДНК, и аналитический вычислительный подход к оцениванию разнообразия спектра с использованием измерений разнообразия в конечных выборках. Анализ продемонстрировал, что ряд уникальных CDR3 TCRβ последовательностей в спектре взрослого значительно превышает предыдущие оценки, основанные на исчерпывающем капиллярном секвенировании небольших сегментов спектра. Разнообразие TCRβ цепи в CD45RO- популяции (обогащенной наивными Т-клетками), наблюдаемое с использованием способов, описанных в данном документе, в пять раз больше, чем сообщалось ранее. Главное открытие заключается в числе уникальных CDR3 TCRβ последовательностей, экспрессированных в «обученных» антигеном CD45RO+ Т-клетках, результаты в данном документе показывают, что это число в 10-20 раз больше, чем ожидалось на основе предыдущих результатов других. Распределение частот CDR3 последовательностей в CD45RO+ клетках позволяет предположить, что Т-клеточный спектр содержит большое число клонов с небольшим размером клонов.

[0032] Результаты в данном документе показывают, что полученная совокупность TCRβ цепей отбирается неравномерно из огромного потенциального предела последовательностей. В частности, последовательности Р цепи, более близкие к зародышевой линии (несколько инсерций и делеций на границах V-D и D-J), по-видимому, созданы с относительно высокой частотой. TCR последовательности, близкие к зародышевой линии, являются общими у разных людей, потому что последовательность зародышевой линии для V, D и J является общей, по модулю небольшое число полиморфизмов, среди человеческой популяции.

[0033] Т-клеточные рецепторы, экспрессированные зрелыми αβ Т-клетками, являются гетеродимерами, у которых две составные цепи сгенерированы событиями независимой перестройки вариабельных локусов α и β цепей TCR. α цепь имеет меньшее разнообразие, чем β цепь, так, что более высокая фракция α является общей у индивидуумов, и сотни точных αβ рецепторов TCR являются общими у любой пары индивидуумов.

Клетки

[0034] В-клетки и Т-клетки могут быть полученными из ряда образцов ткани, включая костный мозг, тимус, лимфатические железы, периферические ткани и кровь, но периферическая кровь наиболее легкодоступна. Образцы периферической крови получаются путем флеботомии у субъектов. Мононуклеарные клетки периферической крови (РВМС) выделяются способами, известными специалисту в данной области, например, Ficoll-Hypaque® разделением по градиенту плотности. Предпочтительно, для анализа используются цельные РВМС. В- и/или Т-лимфоциты, вместо, могут быть проточно отсортированы на множество категорий для каждого субъекта: например, CD8+CD45RO+/- и CD4+CD45RO+/- с использованием флуоресцентно меченных античеловеческих антител, например, CD4 FITC (клон М-Т466, Miltenyi Biotec), CD8 РЕ (клон RPA-T8, BD Biosciences), CD45RO ECD (клон UCHL-1, Beckman Coulter) и CD45RO АРС (клон UCIIL-1, BD Biosciences). Окрашивание общих РВМС может быть выполнено с подходящей комбинацией антител с последующим промыванием клеток перед анализом. Лимфоцитные подсовокупности могут быть выделены FACS сортингом, например, с помощью системы сортировки клеток BD FACSAria™ (BD Biosciences), и анализом результатов с программным обеспечением FlowJo (Treestar Inc.), а также концептуально подобными способами, включающими специфические антитела, иммобилизированные на поверхностях или гранулах.

Выделение нуклеиновой кислоты

[0035] Общая геномная ДНК экстрагируется из клеток, например, с использованием QIAamp® DNA blood Mini Kit (QIAGEN®). Приблизительная масса отдельного гаплоидпого генома составляет 3 пг.Предпочтительно, по меньшей мере 100000-200000 клеток используются для анализа разнообразия, т.е. от около 0,6 до 1,2 мкг ДНК из диплоидных Т-клеток. С использованием РВМС в качестве источника, число Т-клеток может быть оценено в около 30% всех клеток.

[0036] Альтернативно, из клеток может быть выделена общая нуклеиновая кислота, включая и геномную ДНК, и мРНК. Если разнообразие оценивается по мРНК в экстракте нуклеиновой кислоты, мРНК должна быть превращена в кДНК до измерения. Это легко может быть выполнено способами, известными специалисту в данной области.

Амплификация ДНК

[0037] Система мультиплексной PCR используется для амплификации перестороенных TCR локусов из геномной ДНК, предпочтительно из CDR3 участка, более предпочтительно из CDR3 участка TCRα, TCRγ или TCRδ, наиболее предпочтительно из CDR3 участка TCRβ.

[0038] В целом, система мультиплексной PCR может использовать по меньшей мере 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25, предпочтительно 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38 или 39, наиболее предпочтительно 40, 41, 42, 43, 44 или 45 «прямых» праймеров, из которых каждый «прямой» праймер является специфическим к последовательности, соответствующей одному или нескольким сегментам TRB V участка, показанным в SEQ ID NOS:114-248; и по меньшей мере 3, 4, 5, 6, или 7, предпочтительно 8, 9, 10, 11, 12 или 13 «обратных» праймеров, из которых каждый «обратный» праймер является специфическим к последовательности, соответствующей одному или нескольким сегментам TRB J участка, показанным в SEQ ID N08:249-261. Наиболее предпочтительно существует праймер J сегмента для каждого J сегмента.

[0039] Предпочтительно праймеры сконструированы так, чтобы не пересекать границу интрона/экзона. «Прямые» праймеры предпочтительно должны отжигаться с V сегментами на участке относительно сильного сохранения последовательности между V сегментами так, чтобы максимизировать сохранение последовательности среди этих праймеров. Следовательно, это минимизирует потенциал для свойств дифференциального отжига каждого праймера, и, таким образом, амплифицированный участок между V и J праймерами содержит достаточно информации TCR V последовательности для идентификации используемого специфического сегмента V гена.

[0040] Предпочтительно, праймеры J сегментов гибридизируются с консервативным элементом J сегмента и имеют подобную прочность отжига. Наиболее предпочтительно, все праймеры J сегментов отжигаются с одинаковым мотивом консервативного каркасного участка. И «прямые», и «обратные» праймеры предпочтительно модифицированы на 5' конце с последовательностью универсального «прямого» праймера, совместимой с ДНК секвенатором.

[0041] Например, система мультиплексной PCR может использовать 45 «прямых» праймеров (Таблица 1), каждый специфический к функциональному TCR Vβ сегменту, и тринадцать «обратных» праймеров (Таблица 2), каждый специфический к TCR Jβ сегменту. Xn и Yn соответствуют полинуклеотидам с длинами пит, соответственно, которые были бы специфическими для технологии секвенирования отдельной молекулы, используемой для считывания в оценивании.

Таблица 1
TCR-Vβ последовательности прямых праймеров
Сегмент (сегменты) TRBV гена SEQ ID NO: Последовательность праймера*
TRBV2 1 XnTCAAATTTCACTCTGAAGATCCGGTCCACAA
TRBV3-1 2 XnGCTCACTTAAATCTTCACATCAATTCCCTGG
TRBV4-1 3 XnCTTAAACCTTCACCTACACGCCCTGC
TRBV(4-2, 4-3) 4 XnCTTATTCCTTCACCTACACACCCTGC
TRBV5-1 5 XnGCTCTGAGATGAATGTGAGCACCTTG
TRBV5-3 6 XnGCTCTGAGATGAATGTGAGTGCCTTG
TRBV(5-4, 5-5, 5-6, 5-7, 5-8) 7 XnGCTCTGAGCTGAATGTGAACGCCTTG
TRBV6-1 8 XnTCGCTCAGGCTGGAGTCGGCTG
TRBV(6-2, 6-3) 9 XnGCTGGGGTTGGAGTCGGCTG
TRBV6-4 10 XnCCCTCACGTTGGCGTCTGCTG
TRBV6-5 11 XnGCTCAGGCTGCTGTCGGCTG
TRBV6-6 12 XnCGCTCAGGCTGGAGTTGGCTG
TRBV6-7 13 XnCCCCTCAAGCTGGAGTCAGCTG
TRBV6-8 14 XnCACTCAGGCTGGTGTCGGCTG
TRBV6-9 15 XnCGCTCAGGCTGGAGTCAGCTG
TRBV7-1 16 XnCCACTCTGAAGTTCCAGCGCACAC
TRBV7-2 17 XnCACTCTGACGATCCAGCGCACAC
TRBV7-3 18 XnCTCTACTCTGAAGATCCAGCGCACAG
TRBV7-4 19 XnCCACTCTGAAGATCCAGCGCACAG
TRBV7-6 20 XnCACTCTGACGATCCAGCGCACAG
TRBV7-7 21 XnCCACTCTGACGATTCAGCGCACAG
TRBV7-8 22 XnCCACTCTGAAGATCCAGCGCACAC
TRBV7-9 23 XnCACCTTGGAGATCCAGCGCACAG
TRBV9 24 XnGCACTCTGAACTAAACCTGAGCTCTCTG
TRBV10-1 25 XnCCCCTCACTCTGGAGTCTGCTG
TRBV10-2 26 XnCCCCCTCACTCTGGAGTCAGCTA
TRBV10-3 27 XnCCTCCTCACTCTGGAGTCCGCTA
TRBV(11-1, 11-3) 28 XnCCACTCTCAAGATCCAGCCTGCAG
TRBV11-2 29 XnCTCCACTCTCAAGATCCAGCCTGCAA
TRBV(12-3, 12-4, 12-5) 30 XnCCACTCTGAAGATCCAGCCCTCAG
TRBV13 31 XnCATTCTGAACTGAACATGAGCTCCTTGG
TRBV14 32 XnCTACTCTGAAGGTGCAGCCTGCAG
TRBV15 33 XnGATAACTTCCAATCCAGGAGGCCGAACA
TRBV16 34 XnCTGMAPKEPCCTTGAGATCCAGGCTACGA
TRBV17 35 XnCTTCCACGCTGAAGATCCATCCCG
TRBV18 36 XnGCATCCTGAGGATCCAGCAGGMAPKEP
TRBV19 37 XnCCTCTCACTGTGACATCGGCCC
TRBV20-1 38 XnCTTGTCCACTCTGACAGTGACCAGTG
TRBV23-1 39 XnCAGCCTGGCAATCCTGTCCTCAG
TRBV24-1 40 XnCTCCCTGTCCCMAPKEPAGTCTGCCAT
TRBV25-1 41 XnCCCTGACCCTGGAGTCTGCCA
TRBV27 42 XnCCCTGATCCTGGAGTCGCCCA
TRBV28 43 XnCTCCCTGATTCTGGAGTCCGCCA
TRBV29-1 44 XnCTAACATTCTCAACTCTGACTGTGAGCAACA
TRBV30 45 XnCGGCAGTTCATCCTGAGTTCTAAGAAGC
Таблица 2
TCR-Jβ последовательности обратных праймеров
Сегмент TRBJ гена SEQ ID NO: Последовательность праймера*
TRBJ1-1 46 YmTTACCTACAACTGTGAGTCTGGTGCCTTGTCCAAA
TRBJ1-2 47 YmACCTACAACGGTTAACCTGGTCCCCGAACCGAA
TRBJ1-3 48 YmACCTACAACAGTGAGCCAACTTCCCTCTCCAAA
TRBJ1-4 49 YmCCAAGACAGAGAGCTGGGTTCCACTGCCAAA
TRBJ1-5 483 YmACCMAPKEPGATGGAGAGTCGAGTCCCATCACCAAA
TRBJ1-6 50 YmCTGTCACAGTGAGCCTGGTCCCGTTCCCAAA
TRBJ2-1 51 YmCGGTGAGCCGTGTCCCTGGCCCGAA
TRBJ2-2 52 YmCCAGTACGGTCAGCCMAPKEPAGCCTTCTCCAAA
TRBJ2-3 53 YmACTGTCAGCCGGGTGCCTGGGCCAAA
TRBJ2-4 54 YmAGAGCCGGGTCCCGGCGCCGAA
TRBJ2-5 55 YmGGAGCCGCGTGCCTGGCCCGAA
TRBJ2-6 56 YmGTCAGCCTGCTGCCGGCCCCGAA
TRBJ2-7 57 YmGTGAGCCTGGTGCCCGGCCCGAA

[0042] 45 «прямых» PCR праймеров Таблицы 1 являются комплементарными к каждому из 48 функциональных вариабельных сегментов, а тринадцать «обратных» PCR праймеров из Таблицы 2 комплементарны к каждому из функциональных соединяющих (J) генных сегментов из TRB локуса (TRBJ). Сегменты TRB V участка идентифицированы в Перечне последовательностей в SEQ ID NOS:114-248, а сегменты TRB J участка - в SEQ ID NOS:249-261. Праймеры сконструированы так, что соответствующая информация представлена в амплифицированной последовательности для однозначной идентификации и V, и J генов (>40 пар оснований последовательности вверх по сигнальной последовательности рекомбинации (RSS) V гена, и >30 пар оснований вниз по RSS J гена). Альтернативные праймеры могут быть выбраны специалистом из генов V и J участков каждой субъединицы TCR.

[0043] «Прямые» праймеры модифицированы на 5' конце с последовательностью универсального «прямого» праймера, совместимой с ДНК секвенатором (Xn Таблицы 1). Подобным образом, все из обратных праймеров модифицированы последовательностью универсального «обратного» праймера (Ym Таблицы 2). Один пример таких универсальных праймеров показан в Таблицах 3 и 4 для секвенирующей системы с одноконцевым считыванием Illumina GAII. 45 TCR Vβ «прямых» праймеров отжигаются с Vβ сегментами на участке относительно сильного сохранения последовательности между Vβ сегментами так, чтобы максимизировать сохранение последовательности среди этих праймеров.

Таблица 3
TCR-Vβ последовательности прямых праймеров
Сегмент (сегменты) TRBV гена SEQ ID NO: Последовательность праймера*
TRBV2 58 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTTCAAATTTCACTCTGAAGATCCGGTCCACAA
TRBV3-1 59 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGCTCACTTAAATCTTCACATCAATTCCCTGG
TRBV4-1 60 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCTTAAACCTTCACCTACACGCCCTGC
TRBV(4-2, 4-3) 61 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCTTATTCCTTCACCTACACACCCTGC
TRBV5-1 62 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGCTCTGAGATGAATGTGAGCACCTTG
TRBV5-3 63 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGCTCTGAGATGAATGTGAGTGCCTTG
TRBV(5-4, 5-5, 5-6, 5-7, 5-8) 64 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGCTCTGAGCTGAATGTGAACGCCTTG
TRBV6-1 65 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTTCGCTCAGGCTGGAGTCGGCTG
TRBV(6-2, 6-3) 66 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGCTGGGGTTGGAGTCGGCTG
TRBV6-4 67 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCCTCACGTTGGCGTCTGCTG
TRBV6-5 68 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGCTCAGGCTGCTGTCGGCTG
TRBV6-6 69 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCGCTCAGGCTGGAGTTGGCTG
TRBV6-7 70 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCCCTCAAGCTGGAGTCAGCTG
TRBV6-8 71 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCACTCAGGCTGGTGTCGGCTG
TRBV6-9 72 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCGCTCAGGCTGGAGTCAGCTG
TRBV7-1 73 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCACTCTGAAGTTCCAGCGCACAC
TRBV7-2 74 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCACTCTGACGATCCAGCGCACAC
TRBV7-3 75 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCTCTACTCTGAAGATCCAGCGCACAG
TRBV7-4 76 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCACTCTGAAGATCCAGCGCACAG
TRBV7-6 77 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCACTCTGACGATCCAGCGCACAG
TRBV7-7 78 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCACTCTGACGATTCAGCGCACAG
TRBV7-8 79 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCACTCTGAAGATCCAGCGCACAC
TRBV7-9 80 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCACCTTGGAGATCCAGCGCACAG
TRBV9 81 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGCACTCTGAACTAAACCTGAGCTCTCTG
TRBV10-1 82 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCCCTCACTCTGGAGTCTGCTG
TRBV10-2 83 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCCCCTCACTCTGGAGTCAGCTA
TRBV10-3 84 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCTCCTCACTCTGGAGTCCGCTA
TRBV(11-1, 11-3) 85 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCACTCTCAAGATCCAGCCTGCAG
TRBV11-2 86 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCTCCACTCTCAAGATCCAGCCTGCAA
TRBV(12-3, 12-4, 12-5) 87 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCACTCTGAAGATCCAGCCCTCAG
TRBV13 88 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCATTCTGAACTGAACATGAGCTCCTTGG
TRBV14 89 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCTACTCTGAAGGTGCAGCCTGCAG
TRBV15 90 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGATAACTTCCAATCCAGGAGGCCGAACA
TRBV16 91 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCTGMAPKEPCCTTGAGATCCAGGCTACGA
TRBV17 92 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCTTCCACGCTGAAGATCCATCCCG
TRBV18 93 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGCATCCTGAGGATCCAGCAGGMAPKEP
TRBV19 94 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCTCTCACTGTGACATCGGCCC
TRBV20-1 95 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCTTGTCCACTCTGACAGTGACCAGTG
TRBV23-1 96 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCAGCCTGGCAATCCTGTCCTCAG
TRBV24-1 97 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCTCCCTGTCCCMAPKEPAGTCTGCCAT
TRBV25-1 98 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCCTGACCCTGGAGTCTGCCA
TRBV27 99 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCCCTGATCCTGGAGTCGCCCA
TRBV28 100 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCTCCCTGATTCTGGAGTCCGCCA
TRBV29-1 101 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCTAACATTCTCAACTCTGACTGTGAGCAACA
TRBV30 102 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTCGGCAGTTCATCCTGAGTTCTAAGAAGC
Таблица 4
TCR-JR последовательности обратных праймеров
Сгмент TRBJ гена SEQ ID NO: Последовательность праймера*
TRBJ1-1 103 AATGATACGGCGACCACCGAGATCTTTACCTACAACTGTGAGTCTGGTGCCTTGTCCAAA
TRBJ 1-2 468 AATGATACGGCGACCACCGAGATCTACCTACAACGGTTAACCTGGTCCCCGAACCGAA
TRBJ 1-3 104 AATGATACGGCGACCACCGAGATCTACCTACAACAGTGAGCCAACTTCCCTCTCCAAA
TRBJ 1-4 105 AATGATACGGCGACCACCGAGATCTCCAAGACAGAGAGCTGGGTTCCACTGCCAAA
TRBJ 1-5 484 AATGATACGGCGACCACCGAGATCTACCTAGGATGGAGAGTCGAGTCCCATCACCAAA
TRBJ 1-6 106 AATGATACGGCGACCACCGAGATCTCTGTCACAGTGAGCCTGGTCCCGTTCCCAAA
TRBJ2-1 107 AATGATACGGCGACCACCGAGATCTCGGTGAGCCGTGTCCCTGGCCCGAA
TRBJ2-2 108 AATGATACGGCGACCACCGAGATCTCCAGTACGGTCAGCCTAGAGCCTTCTCCAAA
TRBJ2-3 109 AATGATACGGCGACCACCGAGATCTACTGTCAGCCGGGTGCCTGGGCCAAA
TRBJ2-4 110 AATGATACGGCGACCACCGAGATCTAGAGCCGGGTCCCGGCGCCGAA
TRBJ2-5 111 AATGATACGGCGACCACCGAGATCTGGAG
CCGCGTGCCTGGCCCGAA
TRBJ2-6 112 AATGATACGGCGACCACCGAGATCTGTCAGCCTGCTGCCGGCCCCGAA
TRBJ2-7 113 AATGATACGGCGACCACCGAGATCTGTGAGCCTGGTGCCCGGCCCGAA
* выделенная жирным шрифтом последовательность обозначает универсальный R олигонуклеотид для анализа последовательности

[0044] Общий продукт PCR для перестроенного CDR3 участка TCRR с использованием этой системы, как ожидали, имеет длину приблизительно 200 пар оснований. Геномные матрицы амплифицированы PCR с использованием пула из 45 TCR Vβ F праймеров ("VF пул") и пула из двенадцати TCR Jβ R праймеров ("JR пул"). Например, 50 мкл реакционных смесей PCR могут быть использованы с 1,0 мкМ VF пула (22 пМ для каждого уникального TCR Vβ F праймера), 1,0 мкМ JR пула (77 пМ для каждого уникального TCRBJR праймера), 1X смеси QIAGEN Multiplex PCR master (QIAGEN инвентарный номер 206145), 10% 0-раствора (QIAGEN) и 16 нг/мкл гДНК.

[0045] Совокупность праймеров IGH была сконструирована, чтобы попытаться вместить потенциал для соматической гипермутации в перестроенных IGH генах, как наблюдали после начальной стимуляции наивных В-клеток. Следовательно, все праймеры были сконструированы, чтобы быть немного длиннее нормального, и чтобы заякорить 3' концы каждого праймера в высоко консервативных последовательностях трех или более нуклеотидов, которые должны быть устойчивы и к функциональным, и к нефункциональным соматическим мутациям.

[0046] «Обратные» праймеры IGHJ были сконструированы, чтобы заякорить 3' конец каждого PCR праймера в мотиве высоко консервативной GGGG последовательности в IGHJ сегментах. Эти последовательности показаны в Таблице 5. Подчеркнутые последовательности имеют десять пар оснований из RSS, которые могут быть удалены. Они были исключены из штрихкодовой схемы. Выделенная жирным шрифтом последовательность является обратно-комплементарной последовательностью IGH J «обратных» PCR праймеров. Выделенная курсивом последовательность является штрихкодом для J идентичности (восемь штрихкодов показывают шесть генов и два аллеля в генах). Следующая последовательность в подчеркнутом сегменте может показывать дополнительные аллельные идентичности.

Таблица 5
IgH J сегмент SEQ ID NO: Последовательность
>IGHJ4*01/1-48 452 ACTACTTTGACTACTGGGGCCAAGGAACCCTGG TCACCGTCTCCTCAG
>IGHJ4*03/1-48 453 GCTACTTTGACTACTGGGGCCAAGGGACCCTGG TCACCGTCTCCTCAG
>IGHJ4*02/1-48 454 ACTACTTTGACTACTGGGGCCAGGGAACCCTGG TCACCGTCTCCTCAG
>IGIIJ3*01/1-50 455 TGATGCTTTTGATGTCTGGGGCCAAGGGACAAT GGTCACCGTCTCTTCAG
>IGHJ3*02/1-50 456 TGATGCTTTTGATATCTGGGGCCAAGGGACAAT GGTCACCGTCTCTTCAG
>IGHJ6*01/1-63 457 ATTACTACTACTACTACGGTATGGACGFCTGGGG GCAAGGGACCACGGTCACCGTCTCCTCAG
>IGHJ6*02/1-62 458 ATTACTACTACTACTACGGTATGGACGTCTGGGG CCAAGGGACCACGGTCACCGTCTCCTCAG
>IGHJ6*04/1- 459 ATTACTACTACTACTACGGTATGGACGTCTGGGG
63 CAAAGGGACCACGGTCACCGTCTCCTCAG
>IGHJ6*03/1-62 460 ATTACTACTACTACTACTACATGGACGFCTGGGG CAAAGGGACCACGGTCACCGTCTCCTCAG
>IGHJ2*01/1-53 461 CTACTGGTACTTCGATCTCTGGGGCCGTGGCAC CCTGGTCACTGTCTCCTCAG
>IGHJ5*01/1-51 462 ACAACTGGTTCGACTCCTGGGGCCAAGGAACCC TGGTCACCGTCTCCTCAG
>IGHJ5*02/1-51 463 ACAACTGGTTCGACCCCTGGGGCCAGGGAACCC TGGTCACCGTCTCCTCAG
>IGHJ1*01/1-52 464 GCTGAATACTTCCAGCACTGGGGCCAGGGCACC CTGGTCACCGTCTCCTCAG
>IGHJ2P*01/1 -61 465 CTACAAGTGCTTGGAGCACTGGGGCAGGGCAGC CCGGACACCGTCTCCCTGGGAACGTCAG
>IGHJ1P*01/1-54 466 AAAGGTGCTGGGGGTCCCCTGAACCCGACCCGC CCTGAGACCGCAGCCACATCA
>IGHJ3P*01/1-52 467 CTTGCGGTTGGACTTCCCAGCCGACAGTGGTGGT CTGGCTTCTGAGGGGTCA

Последовательности IGH J обратных PCR праймеров показаны в Таблице 6.

Таблица 6
IgH J сегмент SEQID NO: последовательность
>IGHJ4_1 421 TGAGGAGACGGTGACCAGGGTTCCTTGGCCC
>IGHJ4_3 422 TGAGGAGACGGTGACCAGGGTCCCTTGGCCC
>IGHJ4_2 423 TGAGGAGACGGTGACCAGGGTTCCCTGGCCC
>IGHJ3_12 424 CTGAAGAGACGGTGACCATTGTCCCTTGGCCC
>IGHJ6_1 425 CTGAGGAGACGGTGACCGTGGTCCCTTGCCCC
>IGHJ6_2 426 TGAGGAGACGGTGACCGTGGTCCCTTGGCCC
>IGHJ6_34 427 CTGAGGAGACGGTGACCGTGGTCCCTTTGCCC
>IGHJ2_1 428 CTGAGGAGACAGTGACCAGGGTGCCACGGCCC
>IGHJ5_1 429 CTGAGGAGACGGTGACCAGGGTTCCTTGGCCC
>IGHJ5_2 430 CTGAGGAGACGGTGACCAGGGTTCCCTGGCCC
>IGHJ1_1 431 CTGAGGAGACGGTGACCAGGGTGCCCTGGCCC

[0047] V праймеры были сконструированы в консервативном участке FR2 между двумя консервативными триптофановыми (W) кодонами.

[0048] Последовательности праймеров заякорены на 3' конце в триптофановом кодоне для всех IGHV семейств, которые сохраняют этот кодон. Он позволяет последним трем нуклеотидам (TGG триптофана) заякориться на последовательности, которая, как ожидали, будет устойчива к соматической гипермутации, обеспечивая 3' якорь пяти из шести нуклеотидов для каждого праймера. Последовательность протягивается вверх дальше, чем нормальная, и включает вырожденные нуклеотиды, чтобы разрешить ошибочные спаривания, индуцированные гипермутацией (или между близко родственными IGH V семействами) без значительного изменения характеристик отжига праймера, как показано в Таблице 7. Последовательностями V генных сегментов являются SEQ ID NOS:262-420.

Таблица 7
IgH V сегмент SEQ ID NO: последовательность
>IGHV1 443 TGGGTGCACCAGGTCCANGNACAAGGGCTTGAGTGG
>IGIIV2 444 TGGGTGCGACAGGCTCGNGNACAACGCCTTGAGTGG
>IGHV3 445 TGGGTGCGCCAGATGCCNGNGAAAGGCCTGGAGTGG
>IGHV4 446 TGGGTCCGCCAGSCYCCNGNGAAGGGGCTGGAGTGG
>IGHV5 447 TGGGTCCGCCAGGCTCCNGNAAAGGGGCTGGAGTGG
>IGHV6 448 TGGGTCTGCCAGGCTCCNGNGAAGGGGCAGGAGTGG
>IGH7_3.25p 449 TGTGTCCGCCAGGCTCCAGGGAATGGGCTGGAGTTGG
>IGH8_3.54p 450 TCAGATTCCCAAGCTCCAGGGAAGGGGCTGGAGTGAG
>IGH9_3.63p 451 TGGGTCAATGAGACTCMAPKEPGGAAGGGGCTGGAGGGAG

[0049] Условия тепловых циклов могут вытекать из способов, известных специалисту в данной области. Например, с использованием термоциклера PCR Express (Hybaid, Ashford, UK), могут быть использованы следующие условия циклов: 1 цикл при 95°С в течение 15 минут, 25-40 циклов при 94°С в течение 30 секунд, 59°С в течение 30 секунд и 72°С в течение 1 минуты с последующим одним циклом при 72°С в течение 10 минут.

Секвенирование

[0050] Секвенирование выполняется с использованием совокупности секвенирующих олигонуклеотидов, которые гибридизируются с определенным участком в амплифицированных молекулах ДНК.

[0051] Предпочтительно, каждый амплифицированный J генный сегмент имеет уникальный свободный конец из четырех оснований в положениях от +11 до +14 ниже RSS сайта. Следовательно, секвенирующие олигопуклеогиды гибридизируются рядом со свободным концом из четырех оснований в амплифицированных Jβ генных сегментах в положениях от +11 до +14 ниже RSS сайта.

[0052] Например, секвенируемые олигонуклеотиды для TCRB могут быть сконструированы для отжига с консенсусным нуклеотидным мотивом, наблюдаемого только ниже этого "свободного конца", так, что первые четыре основания считанной последовательности будут однозначно идентифицировать J сегмент (Таблица 8).

Таблица 8
Секвенирующие олигонуклеотиды
Секвенирующий олигонуклеотид SEQ ID NO: Олигонуклеотидная последовательность
Jseq 1-1 470 ACAACTGTGAGTCTGGTGCCTTGTCCAAAGAAA
Jseq 1-2 471 ACAACGGTTAACCTGGTCCCCGAACCGAAGGTG
Jseq 1-3 472 ACAACAGTGAGCCAACTTCCCTCTCCAAAATAT
Jseq 1-4 473 AAGACAGAGAGCTGGGTTCCACTGCCAAAAAAC
Jseq 1-5 474 AGGATGGAGAGTCGAGTCCCATCACCAAAATGC
Jseq 1-6 475 GTCACAGTGAGCCTGGTCCCGTTCCCAAAGTGG
Jseq 2-1 476 AGCACGGTGAGCCGTGTCCCTGGCCCGAAGAAC
Jseq 2-2 477 AGTACGGTCAGCCMAPKEPAGCCTTCTCCAAAAAAC
Jseq 2-3 478 AGCACTGTCAGCCGGGTGCCTGGGCCAAAATAC
Jseq 2-4 479 AGCACTGAGAGCCGGGTCCCGGCGCCGAAGTAC
Jseq 2-5 480 AGCACCAGGAGCCGCGTGCCTGGCCCGAAGTAC
Jseq 2-6 481 AGCACGGTCAGCCTGCTGCCGGCCCCGAAAGTC
Jseq 2-7 482 GTGACCGTGAGCCTGGTGCCCGGCCCGAAGTAC

[0053] Информация, используемая для определения J и V сегмента считанной последовательности, полностью вмещена в амплифицированной последовательности и не зависит от идентичности PCR праймеров. Эти секвенируемые олигонуклеотиды были выбраны так, что беспорядочное примирование реакции секвенирования для одного J сегмента олигонуклеотидом, специфическим к другому J сегменту, будет генерировать данные последовательности, начиная точно с такого же нуклеотида, что и данные последовательности от корректного секвенируемого олигонуклеотида. Таким образом, беспорядочный отжиг секвенируемых олигонуклеотидов не повлиял на качество генерируемых данных последовательности.

[0054] Средняя длина CDR3 участка, определенного как нуклеотиды между вторым консервативным цистеином V сегмента и консервативным фенилаланином J сегмента, составляет 35+/-3, поэтому последовательности, начинающиеся от свободного конца Jβ сегмента, почти всегда будут захватывать полное V-D-J соединение в считанных 50 парах оснований.

[0055] βj генные сегменты TCR имеют длину приблизительно 50 пар оснований. PCR праймеры, которые отжигаются и продлеваются с ошибочно спаренными последовательностями, называются беспорядочные праймеры. Jβ «обратные» PCR праймеры TCR были сконструированы для минимизации перекрывания с секвенирующими олигонуклеотидами, чтобы минимизировать беспорядочное примирование в контексте мультиплексной PCR. 13 Jβ «обратных» праймеров TCR заякорены на 3' конце в мотиве консенсусного сплайс-сайта с минимальным перекрыванием секвенируемых праймеров. Jβ праймеры TCR обеспечивают постоянную температуру отжига с использованием программы для секвенатора с параметрами по умолчанию.

[0056] Для реакции секвенирования IGHJ секвенируемые праймеры удлиняются на три нуклеотида по консервативным CAG последовательностям, как показано в Таблице 9.

Таблица 9
IgH J сегмент SEQ ID NO: последовательность
>IGHJSEQ4_1 432 TGAGGAGACGGTGACCAGGGTTCCTTGGCCCCAG
>IGHJSEQ4_3 433 TGAGGAGACGGTGACCAGGGTCCCTTGGCCCCAG
>IGHJSEQ4_2 434 TGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAG
>IGHJSEQ3_12 435 CTGAAGAGACGGTGACCATTGTCCCTTGGCCCCAG
>IGHJSEQ6_1 436 CTGAGGAGACGGTGACCGTGGTCCCTTGCCCCCAG
>IGHJSEQ6_2 437 TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG
>IGHJSEQ63_4 438 CTGAGGAGACGGTGACCGTGGTCCCTTTGCCCCAG
>IGHJSEQ2_1 439 CTGAGGAGACAGTGACCAGGGTGCCACGGCCCCAG
>IGHJSEQ5_1 440 CTGAGGAGACGGTGACCAGGGTTCCTTGGCCCCAG
>IGIIJSEQ5_2 441 CTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAG
>IGHJSEQ1_1 442 CTGAGGAGACGGTGACCAGGGTGCCCTGGCCCCAG

Последовательность обработки данных

[0057] Для быстрого анализа результатов секвенирования специалистом в данной области может быть разработан алгоритм. Предпочтительным способом является следующее.

[0058] Применение этапа PCR для амплификации CDR3 участков TCRβ перед секвенированием потенциально может ввести систематическое смещение в предполагаемом относительном изобилии последовательностей из-за различий в эффективности PCR амплификации CDR3 участков с использованием разных сегментов Vβ и Jβ генов. Каждый цикл PCR амплификации потенциально вводит смещение средней величины 1,51/15=1,027. Таким образом, 25 циклов PCR вводят общее смещение средней величины 1,02725=1,95 в предполагаемое относительное изобилие отличных последовательностей CDR3 участка.

[0059] Секвенированные считывания были отфильтрованы по тем, которые включают CDR3 последовательности. Обработка данных секвенатора включает серии этапов для устранения ошибок в первичной последовательности каждого считывания и для сжатия данных. Фильтр сложности удаляет приблизительно 20% последовательностей, которые прочитаны неправильно, из секвенатора. Затем последовательности должны были иметь совпадение минимум шести оснований и для одного из тринадцати J-участков TCRB, и для одного из 54 V-участков. При применении фильтра для контрольной линии, содержащей фаговую последовательность, в среднем только одна последовательность из 7-8 миллионов прошла эти этапы. Наконец, был применен алгоритм ближайшего соседа, чтобы разрушить данные уникальных последовательностей путем слияния близкородственных последовательностей, для устранения и ошибки PCR, и ошибки секвенирования.

[0060] При анализе данных соотношение последовательностей в продукте PCR должно быть получено в обратном направлении от данных последовательности перед оцениванием истинного распределения клонотипов в крови. Для каждой последовательности, наблюдаемой данное число раз в данных в данном документе, оценивается вероятность того, что эта последовательность была отобрана из пула PCR конкретного размера. Поскольку секвенированные CDR3 участки отбираются случайным образом из огромного пула продуктов PCR, число наблюдений для каждой последовательности получены из распределений Пуассона. Параметры Пуассона квантованы в соответствии с числом Т-клеточных геномов, которые предоставили матрицу для PCR. Простая смешанная модель Пуассона обеих оценок этих параметров и места попарной вероятности для каждой последовательности являются полученными из каждого распределения. Это метод максимизации ожидаемого результата, который воспроизводит изобилие каждой последовательности, которая была получена из крови.

[0061] Для оценки разнообразия применяется формула "ненаблюдаемых видов". Для употребления этой формулы клонотипы уникальных адаптивных иммунных рецепторов (например, TCRB) занимают место видов. Математическое решение предоставляет, что для общего числа "видов" или клонотипов TCRβ, S, при эксперименте секвенирования наблюдается xs копий последовательности s. Для всех из ненаблюдаемых клонотипов xs равняется 0, и каждый TCR клонотип "захвачен" в крови, полученной согласно пуассоновскому способу с параметром λS. Число Т-клеточных геномов секвенировали в первом измерении 7 и во втором измерении. Поскольку имеется большое число уникальных последовательностей, интеграл будет означать сумму. Если G(X) является эмпирической функцией распределения параметров λ1, …, λS, а nx является числом клонотипов секвенированных строго х раз, тогда общее число клонотипов, т.е. измерение разнообразия Е, выводится из следующей формулы:

E ( n x ) = S 0 ( e λ λ x x ! ) d G ( λ ) .

[0062] Для данного эксперимента, где Т-клетки отбираются из некого произвольного источника (например, полученная кровь), формула используется для оценки (estimate) общего разнообразия видов во всем источнике. Идея заключается в том, что отобранное число клонотипов при каждом размере вмещает достаточную информацию для оценки исходного распределения клонотипов во всем источнике. Для вывода формулы было оценено число ожидаемых новых видов, если точное измерение повторялось. Лимит формулы такой, как если бы повторяли измерения бесконечное число раз. Результатом является ожидаемое число видов в общей популяции исходного источника. Значение Д(1), число новых клонотипов, наблюдаемых во втором измерении, должно быть определено предпочтительно с использованием следующего уравнения:

Δ ( t ) = x E ( n x ) m s m t 1 + m s m t 2 x E ( n x ) m s m t 1 = S 0 e λ ( 1 e λ t ) d G ( λ ) ,

в котором msmt1 и msmt2 являются числом клонотипов из измерения 1 и 2, соответственно. Разложение Тейлора 1-е-λt дает A(t)=E(x1)t-E(x2)t2++E(x3)t3-…, которое может быть округленным, путем замещения ожидаемых результатов E(nx) наблюдаемыми числами в первом измерении. С использованием в числах, наблюдаемых в первом измерении, эта формула предсказывает, что 1,6*105 новых уникальных последовательностей должны наблюдаться во втором измерении. Фактическое значение второго измерения составило 1,8*105 новых последовательностей TCRβ, откуда следует, что прогноз предоставил действительную нижнюю границу общего разнообразия. Было использовано преобразование Эйлера для упорядочивания Δ(t) для продуцирования нижней границы Δ(∞).

Использование измерения разнообразия для диагностики заболевания

[0063] Измерение разнообразия может быть использовано для диагностики заболевания или эффекта курса лечения следующим образом. Спектры Т-клеточных и/или В-клеточных рецепторов могут быть измерены в различные точки времени, например, после курса лечения лейкемии трансплантацией гематопоэтических стволовых клеток (HSCT). И изменение разнообразия, и полное разнообразие спектра TCRB может быть использовано для измерения иммунокомпетентности. Может быть использован стандарт для ожидаемой степени иммунной реконструкция после трансплантации. Степень изменения разнообразия между любыми двумя точками времени может быть использована для интенсивной модификации курса лечения. Общее разнообразие в фиксированной точке времени также является важным показателем, поскольку этот стандарт может быть использован для сравнения различных пациентов. В частности, общее разнообразие является показателем, который должен коррелироваться с клиническим определением иммунной реконструкции. Эта информация может быть использована для модификации режимов приема профилактических лекарственных средств - антибиотиков, противовирусных препаратов и противогрибковых препаратов, например, после HSCT.

[0064] Оценка иммунной реконструкции после аллогенной трансплантации гематопоэтических клеток может быть определена путем измерения изменений разнообразия. Эти способы также расширят анализ того, как разнообразие лимфоцитов снижается с возрастом, если судить по анализу ответов Т-клеток на вакцинацию. Кроме того, способы данного изобретения обеспечивают средство оценки исследуемых терапевтических средств (например, интерлейкин-7 (IL-7)), которые оказывают прямое воздействие па воспроизведение, рост и развитие αβ Т-клеток. Более того, применение этих способов для изучения популяций тимусных Т-клеток обеспечит понимание процессов как генной перестройки Т-клеточного рецептора, так и положительной и отрицательной селекции тимоцитов.

[0065] Новорожденный, у которого еще нет полностью функционирующей иммунной системы, но у которого может быть переданное матерью антитело, является иммунодефицитным. Новорожденный восприимчив к ряду заболеваний, пока его иммунная система автономно развивается, и измерения адаптивной иммунной системы по данному изобретению, вероятно, могут оказаться полезными для новорожденных пациентов.

[0066] Разнообразие лимфоцитов может быть оценено при других состояниях врожденного или приобретенного иммунодефицита. Больные СПИДом пациенты с нарушенной или недостаточной иммунной системой могут быть проконтролированы для определения стадии заболевания и измерения ответа пациента на лечения, направленные на восстановление иммунокомпетентности.

[0067] Другое применение способов данного изобретения заключается в обеспечении диагностических показателей для реципиентов трансплантата паренхиматозного органа, принимающих лекарство так, что их организмы не будут отторгать орган донора. Обычно эти пациенты находятся под иммуносупрессивным лечением. Контролирование иммунокомпетентности хозяина поможет перед и после трансплантации.

[0068] Индивидуумы, подвергшиеся воздействию радиации или химиотерапевтических лекарственных средств, подлежат трансплантации костного мозга или, в противном случае, требуют пополнения популяций Т-клеток, наряду с соответствующей иммунокомпетентностью. Способы данного изобретения обеспечивают средство для качественной и количественной оценки трансплантата костного мозга или восстановления лимфоцитов в ходе этих курсов лечения.

[0069] Одним методом определения разнообразия является сравнение по меньшей мере двух образцов геномной ДНК, из которых предпочтительно один образец геномной ДНК является образцом от пациента, а другой образец взят у нормального субъекта, или, альтернативно, из которых один образец геномной ДНК является образцом от пациента перед терапевтическим курсом лечения, а другой образец - от пациента после курса лечения, или из которых два образца геномной ДНК являются образцами одного и того же пациента в различные точки времени во время курса лечения. Другой метод диагностики может быть основан на сравнении разнообразия среди образцов геномной DNA, например, в которых иммунокомпетентность пациента-человека оценивается путем сравнения.

Биомаркеры

[0070] Общие последовательности TCR у индивидуумов представляют новый класс потенциальных биомаркеров для ряда заболеваний, включая различные типы рака, аутоиммунные заболевания и инфекционные заболевания. Имеются "общие" Т-клетки, которые были описаны для множества заболеваний человека. TCR могут использоваться в качестве биомаркеров, поскольку Т-клетки являются результатом клепального расселения, с помощью которого иммунная система амплифицирует эти биомаркеры посредством быстрого деления клеток. После амплификацияи TCR легко диагностируются, даже если мишень небольшая (например, опухоль ранней стадии). TCR также могут использоваться в качестве биомаркеров, поскольку во многих случаях Т-клетки, кроме того, могут способствовать заболеванию и поэтому могут создавать мишень для лекарственного средства. Т-клеточные самовзаимодействия, как полагают, играют важную роль в некоторых заболеваниях, связанных с аутоиммунитетом, например рассеянный склероз, диабет I типа и ревматоидный артрит.

ПРИМЕРЫ

[0071] Пример 1: Получение образца, выделение РВМС, сортировка FACS и экстракция геномной ДНК

[0072] Образцы периферической крови двух здоровых доноров мужского пола возрастом 35 и 37 лет были получены с письменным информированным согласием с использованием форм, одобренных Экспертным советом организации Центра онкологических исследований Фреда Хатчинсона (FIICRC). Мононуклеарные клетки периферической крови (РВМС) были выделены разделением по градиенту плотности Ficoll-Hypaque®. Т-лимфоциты были проточно отсортированы на четыре категории для каждого субъекта: CD8+CD45RO+/- и CD4+CD45RO+/-. Для характеристики лимфоцитов были использованы следующие конъюгированные античеловеческие антитела: CD4 FITC (клон М-Т466, Miltenyi Biotec), CD8 РЕ (клон RPA-T8, BD Biosciences), CD45RO ECD (клон UCHL-1, Beckman Coulter) и CD45RO АРС (клон UCIIL-1, BD Biosciences). Окрашивание общих РВМС было выполнено с подходящей комбинацией антител в течение 20 минут при 4°С, и окрашенные клетки были один раз промыты перед анализом. Подсовокупности лимфоцитов были выделены FACS сортировкой в системе сортировки клеток BD FACSAria (BD Biosciences). Данные были проанализированы на программном обеспечении FlowJo (Treestar Inc.).

[0073] Общая геномная ДНК была экстрагирована из отсортированных клеток с использованием набора QIAamp® DNA blood Mini Kit (QIAGEN®). Приблизительная масса отдельного гаплоидного генома составляет 3 пг. Для того чтобы миллионы образцов перестроенных TCRB в каждой категории Т-клеток, было получено 6-27 микрограмм матричной ДНК из каждой категории (смотри Таблицу 10).

Таблица 10
CD8+/CD45R O- CD8+/CD45 RO+ CD4+/CD45 RO- CD4+/CD45 RO+ Донор
клетки (×106) 9,9 6,3 6,3 10
ДНК(мкг) 27 13 19 25
PCR циклы 25 25 30 30
кластеры (K/tile) 29,3 27 102,3* 118,3* 2
VJ последовательности (×106) 3,0 2,0 4,4 4,2
Клетки 4,9 4,8 3,3 9
ДНК 12 13 6,6 19
PCR циклы 30 30 30 30
Кластеры 116,3 121 119,5 124,6 1
VJ последовательности 3,2 3,7 4,0 3,8
Клетки Нет данных Нет данных Нет данных 0,03 Оценка PCR
ДНК Нет данных Нет данных Нет данных 0,015 смещения
PCR циклы Нет данных Нет данных Нет данных 25+15
кластеры Нет данных Нет данных Нет данных 1,4/23,8
VJ последовательности Нет данных Нет данных Нет данных 1,6

[0074] Пример 2: Виртуальное спектральное типирование β цепи Т-клеточного рецептора

[0075] Виртуальное спектральное типирование β цепи TCR было выполнено следующим образом. Комплементарная ДНК была синтезирована из РНК, экстрагированной из отсортированных Т-клеточных популяций, и использовалась в качестве матрицы для мультиплексной PCR амплификации перестроенного CDR3 участка β цепи TCR. Каждая мультиплексная реакция содержала 6-РАМ-меченый антисмысловой праймер, специфический для константного участка β цепи TCR, и от двух до пяти вариабельных ген-специфических смысловых праймеров β цепи TCR (TRBV). Были исследованы все 23 функциональных Vβ семейства. PCR реакции были выполнены на термоциклере Hybaid PCR Express (Hybaid, Ashford, UK) при следующих условиях цикла: 1 цикл при 95°С в течение 6 минут, 40 циклов при 94°С в течение 30 секунд, 58°С в течение 30 секунд и 72°С в течение 40 секунд, с последующим 1 циклом при 72°С в течение 10 минут. Каждая реакционная среда содержала матрицу кДНК, 500 мкМ dNTP, 2 мМ MgCl2 и 1 единицу ДНК-полимеразы AmpliTaq Gold (Perkin Elmer) в буфере AmpliTaq Gold, в окончательном объеме 20 мкл. После завершения аликвота PCR продукта была разбавлена 1:50 и проанализирована с использованием анализатора ДНК. Выход анализатора ДНК был превращен в распределение интенсивности флуоресценции против длины путем сравнения со следом интенсивности флуоресценции эталонного образца, содержащего стандарты известного размера.

[0076] Пример 3: Мультиплексная PCR амплификация CDR3 участков TCRβ

[0077] CDR3 участок соединения был оперативно определен следующим образом. Соединение начинается со второго консервативного цистенпа V-участка и заканчивается на консервативном фенилаланине J-участка. С получением обратно-комплементарных наблюдаемых последовательностей и транслированием фланкирующих участков были идентифицированы аминокислоты, определяющие границы соединения. Число нуклеотидов между этими границами определяет длину и, поэтому, рамку CDR3 участка. Для того, чтобы образовать матричную библиотеку для секвенирования система мультиплексной PCR была выбрана для амплификации перестроенных TCRβ локусов из геномной ДНК. Система мультиплексной PCR использует 45 «прямых» праймеров (Таблица 3), каждый специфичен к функциональному Vβ сегменту TCR, и тринадцать «обратных» праймеров (Таблица 4), каждый специфичен к Jβ сегменту TCR. Праймеры были выбраны для предоставления того, что адекватная информация представлена в амплифицированной последовательности для однозначного идентифицирования, и V, и J генов (>40 пар оснований последовательности вверх по сигнальной последовательности рекомбинации (RSS) V гена и >30 пар оснований вниз но RSS J гена).

[0078[«Прямые» праймеры модифицированы на 5' конце с последовательностью универсального «прямого» праймера, совместимой с твердофазовой PCR на кластерной станции Illumina GA2. Сходным образом, все из «обратных» праймеров модифицированы с последовательностью универсального «обратного» праймера GA2. 3' конец каждого «прямого» праймера заякорен в положении -43 в Vβ сегменте, относительно сигнальной последовательности рекомбинации (RSS), тем самым обеспечивая уникальную Vβ последовательность свободного конца в амплифицированном участке. Тринадцать «обратных» праймеров, специфических к каждому Jβ сегменту, заякорены на 3' интроне, причем 3' конец каждого праймера пересекает соединение интрон/экзон. Были сконструированы тринадцать секвенируемых праймеров, комплементарных Jβ сегментам, которые комплементарны амплифицированной части Jβ сегмента так, что несколько первых оснований сгенерированной последовательности будут захватывать уникальную Jβ последовательность свободного конца.

[0079] В среднем J делециями были 4 пар оснований +/-2,5 пары оснований, что подразумевает, что J делеции более 10 нуклеотидов встречаются в менее 1% последовательностей. Каждый из тринадцати различных Jβ генных сегментов TCR имел уникальный свободный конец из четырех оснований в положениях от +11 до +14 вниз по RSS сайту. Таким образом, были сконструированы секвенируемые олигонуклеотиды для отжига с консенсусным нуклеотидным мотивом, наблюдаемым только вниз по этому "свободному концу", так, что первые четыре основания считанной последовательности будут однозначно идентифицировать J сегмент (Таблица 5).

[0080] Использованная информация для определения J и V сегмента считанной последовательности целиком содержится в пределах амплифицированной последовательности и не зависит от идентичности PCR праймеров. Эти секвенируемые олигонуклеотиды были выбраны так, что беспорядочное примирование реакции секвенирования для одного J сегмента олигонуклеотидом, специфическим к другому J сегменту, будет генерировать данные последовательности, начиная с точно такого же нуклеотида, что и данные последовательности от корректного секвенируемого олигонуклеотида. Таким образом, беспорядочный отжиг секвенируемых олигонуклеотидов не влияет на качество генерированных данных о последовательностях.

[0081] Средняя длина CDR3 участка, определенного, следуя правилу, как нуклеотиды между вторым консервативным цистеином V сегмента и консервативным фенилаланином J сегмента, составляет 35+/-3, поэтому последовательности, начинающиеся с Jβ сегментного свободного конца, будут почти всегда захватывать полное VNDNJ соединение в считанных 50 парах оснований.

[0082] βJ генные сегменты TCR имеют длину приблизительно 50 пар оснований. PCR праймеры, которые отжигаются и удлиняются с ошибочно спаренными последовательностями, называются беспорядочными праймерами. Вследствие риска беспорядочного примирования в контексте мультиплексной PCR, особенно в контексте генного семейства, были сконструированы «обратные» PCR праймеры TCR Jβ для минимизации перекрывания с секвенируемыми олигонуклеотидами. Таким образом, 13 TCR Jβ «обратных» праймеров заякорены на 3' конце на мотиве консенсусного сплайс-сайта с минимальным перекрыванием секвенируемых праймеров. Были сконструированы TCR Jβ праймеры для постоянной температуры отжига (58 градусов в 50 мМ соли) с использованием программы OligoCalc с параметрами по умолчанию (http://www.basic. northwestern.edu/biotools/onnrocalc.html).

[0083] Были сконструированы 45 TCR Vβ «прямых» праймеров для отжига с Vβ сегментами на участке относительно сильного сохранения последовательности между Vβ сегментами для двух точных целей. Во-первых, увеличение до максимума сохранения последовательности среди этих праймеров минимизирует потенциал для свойств дифференциального отжига каждого праймера. Во-вторых, праймеры были выбраны так, что амплифицированный участок между V и J праймерами будет включать достаточную информацию последовательности TCR Vβ для идентификации используемого специфического Vβ генного сегмента. Это устраняет риск ошибочного распределения TCR Vβ генного сегмента в событии беспорядочного примирования TCR Vβ праймерами. TCR Vβ «прямые» праймеры были сконструированы для всех известных непсевдогенов в TCRβ локусе.

[0084] Общий PCR продукт для успешно пререстроенного CDR3 участка TCRβ с использованием этой системы, как ожидается, имеет длину приблизительно 200 пар оснований. Геномные матрицы были PCR амплифицированы с использованием эквимолярного пула 45 TCR Vβ F праймеров ("VF пул") и эквимолярного пула тринадцати TCR Jβ R праймеров ("JR пул"). 50 мкл реакционной смеси PCR было установлено при 1,0 мкМ VF пула (22 нМ для каждого уникального TCR Vβ F праймера), 1,0 мкМ JR пула (77 пМ для каждого уникального TCRBJR праймера), 1X смеси QIAGEN Multiplex PCR master (QIAGEN инвентарный номер 206145), 10% Q-раствора (QIAGEN) и 16 нг/мкл гДНК. Были использованы следующие условия термического цикла на термоциклере PCR Express (Hybaid, Ashford, UK) при следующих условиях цикла: 1 цикл при 95°С в течение 15 минут, 25-40 циклов при 94°С в течение 30 секунд, 59°С в течение 30 секунд и 72°С в течение 1 минуты, с последующим одним циклом при 72°С в течение 10 минут. 12-20 лунок PCR были выполнены для каждой библиотеки для того, чтобы отобрать от сотен тысяч до миллионов перестроенных TCRβ CDR3 локусов.

[0085] Пример 4: Предварительная обработка данных последовательности

[0086] Обработка данных секвенатора включает серии этапов для устранения ошибок в первичной последовательности каждого считывания и сжатия данных. Сначала фильтр сложности удаляет из секвенатора приблизительно 20% последовательностей, которые прочитаны неправильно. Затем последовательности должны были иметь совпадение минимум шести оснований, и для одного из тринадцати J-участков, и для одного из 54 V-участков. При употреблении фильтра для контрольной линии, содержащей фаговую последовательность, в среднем только одна последовательность из 7-8 миллионов прошла эти этапы без ложного распознавания сигнала. Наконец, был применен алгоритм ближайшего соседа, чтобы разрушить данные уникальных последовательностей путем слияния близкородственных последовательностей, для устранения, и ошибки PCR, и ошибки секвенирования (смотри Таблицу 10).

[0087] Пример 5: Оценивание относительного изобилия последовательности CDR3 в PCR пулах и образцах крови

[0088] После разрушения данных, исходное распределение Т-клеточных последовательностей в восстановлении крови было получено из данных последовательности. В способе используются три этапа: 1) проточная сортировка Т-клеток, полученных из периферической крови, 2) PCR амплификация и 3) секвенирование. При анализе данных соотношение последовательностей в PCR продукте должно быть получено в обратном направлении от данных последовательности перед оцениванием истинного распределения клонотипов в крови.

[0089] Для каждой последовательности, наблюдаемой данное число раз в данных в данном документе, оценивается вероятность того, что эта последовательность была отобрана из пула PCR конкретного размера. Поскольку секвенированные CDR3 участки отбираются случайным образом из огромного пула PCR продуктов, число наблюдений для каждой последовательности получены из распределений Пуассона. Параметры Пуассона квантованы в соответствии с числом Т-клеточных геномов, которые предоставили матрицу для PCR. Простая смешанная модель Пуассона, и оценок этих параметров, и места попарной вероятности для каждой последовательности являются полученными из каждого распределения. Это способ максимизации ожидаемого результата, который воспроизводит изобилие каждой последовательности, которая была взята из крови.

[0090] Пример 6: Модель ненаблюдаемых видов для оценивания истинного разнообразия

[0091] Смешанная модель может воссоздавать частоту каждого TCRβ CDR3 вида, полученного из крови, но возникает важный вопрос, сколько уникальных CDR3 видов присутствовало у донора? Это фундаментальный вопрос, который нуждается в ответе, поскольку у каждого донора доступный образец ограничен, и в будущем будет иметь более важное значение, так как эти способы экстраполированы на меньшие объемы крови, которые обоснованно могут быть получены от пациентов, подлежащих курсу лечению.

[0092] Математическое решение предоставляет то, что для общего числа "видов" или клонотипов TCRβ, S, при эксперименте секвенирования наблюдается xs копий последовательности s. Для всех из ненаблюдаемых клонотипов xs равняется 0, и каждый клонотип TCR "захвачен" в крови, полученной согласно пуассоновскому способу с параметром λS. Число Т-клеточных геномов секвенировали в первом измерении 1 и во втором измерении. Поскольку имеется большое число уникальных последовательностей, интеграл будет означать сумму. Если G(λ) является эмпирической функцией распределения параметров λ1, …, λS, а nx является числом клонотипов секвенированных строго х раз, тогда

E ( n x ) = S 0 ( e λ λ x x ! ) d G ( λ ) .

[0093] Значение A(t) является числом новых клонотипов, наблюдаемых во втором эксперименте секвенирования.

Δ ( t ) = x E ( n x ) exp 1 + exp 2 x E ( n x ) exp 1 = S 0 e λ ( 1 e λ t ) d G ( λ )

[0094] Разложение Тейлора l-e-λt дает Δ(t)=E(x1)t-E(x2)t2+E(x3)t3-…, которое может быть округленным, путем замещения ожидаемых результатов (Е(nx)) наблюдаемыми числами в первом измерении. С использованием в числах, наблюдаемых в первом измерении, эта формула предсказывает, что 1,6*105 новых уникальных последовательностей должны наблюдаться во втором измерении. Фактическое значение второго измерения составило 1,8* 105 новых последовательностей TCRβ, которые предполагают, что прогноз предоставил действительную нижнюю границу общего разнообразия. Было использовано преобразование Эйлера для упорядочения Δ(t) для продуцирования нижней границы Δ(∞).

[0095] Пример 7: Коррекция ошибки и оценка смещения

[0096] Ошибка последовательности в данных первичной последовательности получается прежде всего из двух источников: (1) ошибка включения нуклеотида, которая происходит во время амплификации TCRβ CDR3 матричных последовательностей с помощью PCR, и (2) ошибки восстановлений последовательности оснований, введенных во время секвенирования PCR-амплифицированпой библиотеки CDR3 последовательности. Большое количество данных разрешает выполнять прямой корректирующий ошибки код для коррекции большинства ошибок в данных первичной последовательности, относимых к этим двум источникам. После коррекции ошибок число уникальных в рамке CDR3 последовательностей и число наблюдений каждой уникальной последовательности были сведены в таблицу для каждой из четырех проточно отсортированных Т-клеточных популяций от двух доноров. Относительная частота распределения CDR3 последовательностей в четырех определенных проточной цитометрией популяциях продемонстрировала, что «обученные» антигеном CD45RO+ популяции содержали значительно больше уникальных CDR3 последовательностей с высокой относительной частотой, чем CD45RO- популяции. Гистограммы частоты CDR3 последовательностей TCRβ, наблюдаемых в четырех различных Т-клеточных подсовокупностях, отличающихся экспрессией CD4, CD8 и CD45RO и присутствующих в крови, показали, что каждая из десяти уникальных последовательностей наблюдались 200 раз в CD4+CD45RO+ («обученном» антигеном) Т-клеточном образце, который наблюдался чаще, в два раза, чем в CD4+CD45RO- популяциях.

[0097] Использование этапа PCR для амплификации CDR3 участков TCRR перед секвенированием могло бы потенциально ввести систематическое смещение в подразумеваемое относительное изобилие последовательностей из-за различий в эффективности PCR амплификации CDR3 участков с использованием различных Vβ и Jβ генных сегментов. Для оценки величины какого-либо такого смещения CDR3 участки TCRR из образца приблизительно 30000 уникальных CD4+CD45RO+ Т-лимфоцитных геномов было амплифицировано с помощью 25 циклов PCR, при которой точка PCR продукта была разделена на две половины. Половина совокупности была отложена, а другая половина PCR продукта была амплифицирована при дополнительных 15 циклах PCR, всего 40 циклов амплификации. Затем PCR продукты, амплифицированные с помощью 25 и 40 циклов, были секвенированы и сравнены. Более 95% последовательностей из 25 циклов также были обнаружены в образце из 40 циклов: линейная корреляция наблюдается при сравнении частоты последовательностей у этих образцов. Для последовательностей, наблюдаемых данное число раз в линии 25 циклов, комбинация смещения PCR и отбор ряд входит в ряд по среднему числу наблюдений при 40 циклах. Консервативно приписывая среднее отклонение по линии (в 1,5 раза) полностью смещению PCR, каждый цикл PCR амплификации потенциально вводит смещение средней величины 1,51/15=1,027. Таким образом, 25 циклов PCR вводят общее смещение средней величины 1,02725=1,95 в полученную относительную представленность отличных последовательностей CDR3 участка.

[0098] Пример 8: Использование Jβ генного сегмента

[0099] CDR3 участок в каждой β цепи TCR включает последовательность, полученную из одного из тринадцати Jβ генных сегментов. Анализ CDR3 последовательностей в четырех различных Т-клеточных популяциях от двух доноров продемонстрировал, что фракция общих последовательностей, которые включали последовательности, полученные из тринадцати различных Jβ генных сегментов, изменилась более чем в 20 раз. Использование Jβ среди четырех различных Т, определенных проточной цитометрией Т-клеток от отдельного донора, было относительно константным у данного донора. Более того, паттерны использования Jβ, наблюдаемые у двух доноров, которые были подрозумеваемы из анализа геномной ДНК из Т-клеток, секвенированных с использованием GA, качественно подобны таковым, наблюдаемым в Т-клетках из пуповинной крови и от здоровых взрослых доноров, оба из которых были подрозумеваемы из анализа кДНК из Т-клеток, секвенированных с использованием исчерпывающих, основанных на капиллярах способов.

[0100] Пример 9: Смещение нуклеотидной инсерции

[0101] Большая часть разнообразия на CDR3 соединениях в α и β цепях TCR создается инсерциями нематричных нуклеотидов с помощью фермента концевой дезоксинуклеотидил-трансферазы (TdT). Однако in vivo выбор играет значительную роль в создании спектра TCR, что приводит к непредсказуемости. Частоты TdT нуклеотидной инсерции, независимые от выбора, были рассчитаны с использованием TCR последовательностей рамки. Эти последовательности являются нефункциональными перестройками, которые выполняются на одном аллеле в Т-клетках, где второй аллель имеет функциональную перестройку. Смещение мононуклеотидной инсерции TdT способствует С и G (Таблица 11).

Таблица 11
Мононуклеотидное смещение в данных вне рамки
А С G Т
Линия 1 0,24 0,294 0,247 0,216
Линия 2 0,247 0,284 0,256 0,211
Линия 3 0,25 0,27 0,268 0,209
Линия 4 0,255 0,293 0,24 0,21

[0102] Подобные частоты нуклеотидов наблюдаются в последовательностях рамки (Таблица 12).

Таблица 12
Мононуклеотидное смещение в данных в рамке
А С G Т
Линия 1 0,21 0,285 0,275 0,228
Линия 2 0,216 0,281 0,266 0,235
Линия 3 0,222 0,266 0,288 0,221
Линия 4 0,206 0,294 0,228 0,27

[0103] N участки из последовательностей TCR вне рамки были использованы для показателя динуклеотидного смещения. Для выделения маргинального вклада динуклеотидного смещения, динуклеотидные частоты были разделены на мононуклеотидные частоты каждого из двух оснований. Показатель представляет собой

m = f ( n 1 n 2 ) f ( n 1 ) f ( n 2 ) .

[0104] Матрица для m представлена в Таблице 13.

Таблица 13
Динуклеотидные соотношения вероятности для данных вне рамки
А С G Т
А 1,198 0,938 0,945 0,919
С 0,988 1,172 0,88 0,931
G 0,993 0,701 1,352 0,964
Т 0,784 1,232 0,767 1,23

[0105] Многие из динуклеотидов являются недо- или сверхпоказанными. Например, вероятности обнаружения GG пары являются очень высокими. Поскольку кодоны GGN транслируются в глицин, на CDR3 участках ожидается множество глицинов.

[0106] Пример 10: Распределения аминокислот на CDR3 участках

[0107] Распределение аминокислот на CDR3 участках β цепей TCR является общим для зародышевых последовательностей для V, D и J участков, смещения инсерции TdT и выбора. Распределение аминокислот в этом участке для четырех различных Т-клеточных подкатегорий очень похоже у различных подтипов Т-клеток. Разделение последовательностей в β цепях фиксированной длины, зависимое от положения распределение среди аминокислот, которые сгруппированы по шести химическим признакам: небольшие, специфические и крупные гидрофобные, нейтральные полярные, кислотные и основные. Распределения практически идентичны, за исключением CD8+«обученных» антигеном Т-клеток, которые имеют более высокую долю кислотных оснований, особенно в положении 5.

[0108] Особенный интерес представляет сравнение между CD8+ и CD4+ последовательностями TCR, поскольку они связываются с пептидами, представленными HLA молекулами класса I и класса II, соответственно. CD8+ «обученные» антигеном Т-клетки имеют несколько положений с более высокой долей кислотных аминокислот. Это могло бы выполнить связывание с основным остатком, обнаруженным в HLA молекулах класса I, но не класса II.

[0109] Пример 11: β цепи TCR с идентичными аминокислогными последовательностями, обнаруженные у разных людей

[0110] Последовательности β цепи TCR были транслированы в аминокислоты, а затем попарно сравнивались у двух доноров. Наблюдалось несколько тысяч точных совпадений последовательностей. Например, при сравнении CD4+CD45RO- подкатегорий приблизительно 8000 из 250000 уникальных аминокислотных последовательностей от донора 1 точно совпадали с таковыми у донора 2. Многие из этих совпадающих последовательностей на аминокислотном уровне имеют множество нуклеотидных различий в положениях третьего кодона. Из примера, упомянутого выше, 1500/8000 идентичных аминокислотных совпадений имели >5 ошибочных спариваний нуклеотидов. Между любыми двумя Т-клеточными подтипами 4-5% уникальных последовательностей TCRβ, как было обнаружено, имеют идентичные аминокислотные совпадения.

[0111] Были рассмотрены две возможности: что 1) отбор при развитии TCR продуцирует эти общие последовательности, и 2) большое смещение в частоте нуклеотидной инсерции с помощью TdT создает сходные нуклеотидные последовательности. Попарные совпадения в рамке были сравнены с попарными совпадениями вне рамки (смотри Примеры 1-4, выше). Изменяющиеся рамки зафиксировали все из признаков генетического кода, и поэтому должно быть найдено одинаковое число совпадений, если смещение последовательности отвечало за все наблюдение. Однако было обнаружено почти в два раза больше совпадений в рамке, чем совпадений вне рамки, что позволяет предположить, что отбор на уровне белка играет значительную роль.

[0112] Для подтверждения этого обнаружения тысяч идентичных аминокислотных последовательностей β цепи TCR были сравнены два донора в отношении CD8+CD62L+CD45RA+ (подобных наивным) TCR от третьего донора - 44-летней женщины кавказской национальности CMV+. Были обнаружены идентичные попарные совпадения нескольких тысяч последовательностей на аминокислотном уровне между третьим донором и каждым из первоначальных двух доноров. В отличие от этого, 460 последовательностей были общими у всех трех доноров. Большое отклонение в общем числе уникальных последовательностей между донорами является продуктом исходного материала и отклонений загрузки в секвенатор, а не является показательным для отклонения в истинном разнообразии в крови доноров.

[0113] Пример 12: Клонотипы более высокой частоты являются более близкими к зародышевым

[0114] Отклонение в числе копий между различными последовательностями в каждой Т-клеточной подкатегории изменялось с коэффициентом более 10000 раз. Единственным свойством, коррелированным с числом копий, было (число инсерций плюс число делеций), которое обратно зависимо. Результаты анализа показали, что делеции играют меньшую роль, чем инсерции в обратной зависимости с числом копий.

[0115] Последовательности с меньшим количеством инсерций и делеций имеют рецепторные последовательности, более близкие к зародышевой линии. Одной из возможностей увеличения числа последовательностей, более близких к зародышевой линии, является то, что они создаются множество раз во время развития Т-клеток. Так как последовательности зародышевой линии общие у людей, общие TCRβ цепи, вероятно, создаются с помощью TCR с небольшим числом инсерций и делеций.

[0116] Пример 13: Анализ "спектрального типа" CDR3 последовательностей TCRβ с помощью использования V генного сегмента и CDR3 длины

[0117] TCR разнообразие главным образом оценивали с использованием способа спектрального типирования TCR, способ, основанный на PB-PCR, которая не позволяет оценить разнообразие CDR3 TCR на уровне последовательностей, а оценивает разнообразие длины CDR3 TCRα или TCRR, выраженные как мРНК в субпопуляциях αβ Т-клеток, которые используют одинаковый Vα или Vβ генный сегмент. Спектральные типы поликлональных Т-клеточных популяций с разнообразными спектрами CDR3 последовательностей TCR, например, рассматриваемых в пуповинной крови или в периферической крови здоровых молодых людей, обычно содержат CDR3 последовательности 8-10 различных длин, которые являются множествами из трех нуклеотидов, отражая отбор по транскриптам в рамке. Спектральное типирование также обеспечивает приблизительную количественную информацию об относительной частоте CDR3 последовательностей с каждой специфической длиной. Чтобы оценить, сможет ли прямое секвенирование CDR3 участков TCRβ из Т-клеточной геномной ДНК с использованием секвенатора точно захватить все из разнообразия длин CDR3, которые идентифицированы спектральным типированием, "виртуальные" спектральные типы TCRβ (смотри Примеры выше) были сгенерированы из данных последовательности и сравнивались со спектральными типами TCRβ, сгенерированными с использованием традиционных PCR способов. Виртуальные спектральные типы вмещали все из длин CDR3 и информацию об относительной частоте, представленную в традиционных спектральных типах. Прямое секвенирование CDR3 TCRβ захватывает всю информацию разнообразия TCR, представленную в традиционном спектральном типе. Сравнение данных стандартного спектрального типа TCRβ и вычисленных распределений длин CDR3 TCRβ для последовательностей с использованием типичных Vβ генных сегментов TCR и присутствием в CD4+CD45RO+ клетках от донора 1. Сокращение информации, вмещенной в последовательности данных, на гистограмме частоты уникальных последовательностей CDR3 с различными длинами в каждом Vβ семействе легко воспроизводит всю информацию, содержащуюся в данных спектрального типа. Кроме того, виртуальные спектральные типы выявили присутствие в каждом Vβ семействе редкие последовательности CDR3 и с очень короткой, и с очень протяженной длинами CDR3, которые не были обнаружены традиционным спектральным тонированием на основе PCR.

[0118] Пример 14: Оценивание общего разнообразия последовательностей CDR3

[0119] После коррекции ошибок число уникальных последовательностей CDR3, наблюдаемых в каждой линии проточной ячейки секвенатора, обычно превышала 1×105. Учитывая, что PCR продукты, секвенированные в каждой линии, обязательно были получены из небольшой фракции Т-клеточных геномов, присутствующих у каждого из двух доноров, общее число уникальных последовательностей CDR3 TCRβ во всем Т-клеточном спектре каждого индивидуума, вероятно, будет намного выше. Оценивание числа уникальных последовательностей во всем спектре, следовательно, требует оценки числа дополнительных уникальных последовательностей CDR3, которые существуют в крови, но не наблюдались в образце. Оценивание общего разнообразия видов в большой, комплексной популяции с использованием измерений разнообразия видов, присутствующего в выборе конечного объема, исторически назвали "проблемой ненаблюдаемых видов" (смотри Примеры выше). Решение начинается с определения числа новых видов или CDR3 последовательностей TCRβT, которые наблюдаются, если эксперимент повторяется, т.е. если секвенирование повторяется на идентичном образце Т-клеток периферической крови, например, на идентично полученной библиотеке PCR продуктов CDR3 TCRβ в различных линиях проточной ячейки секвенатора, и подсчитывается число новых последовательностей CDR3. Для CD8+CD45RO- клеток от донора 2 предсказано и обнаружено несколько новых последовательностей CDR3 во второй линии в пределах 5% (смотри Примеры выше), что предполагает, что это аналитическое решение может, в самом деле, быть использовано для оценки общего числа уникальных последовательностей CDR3 TCRβ во всем спектре.

[0120] Полученные в результате оценки общего числа уникальных последовательностей CDR3 TCRβ в четырех определенных проточной цитометрией Т-клеточных категориях показаны в Таблице 14.

Таблица 14
Разнообразие спектра TCR
Донор CD8 CD4 CD45RO Разнообразие
1 + - + 6,3*105
+ - - 1,24*106
- + + 8,2*105
- + - 1,28*10°
Общее разнообразие Т-клеток 3,97*106
2 + - + 4,4*105
+ - - 9,7*105
- + + 8,7*105
- + - 1,03*10°
Общее разнообразие Т-клеток 3,31*106

[0121] Примечательно, что общее разнообразие TCRβ в этих популяциях составляет 3-4 миллиона уникальных последовательностей в периферической крови. Удивительно, но CD45RO+ или «обученная» антигеном категория вмещает приблизительно 1,5 миллиона из этих последовательностей. Это по меньшей мере на порядок больше, чем ожидалось. Это расхождение, скорее всего, связано с большим числом этих последовательностей, наблюдаемых при низкой относительной частоте, что может быть выявлено только путем глубокого секвенирования. Оцененные размеры спектра CDR3 TCRβ каждой категории у двух доноров находятся в пределах 20% друг от друга.

[0122] Результаты в данном документе демонстрируют, что реализованное разнообразие рецептора TCRβ по меньшей мере в пять раз выше, чем предварительные оценки (~4*106 отличных CDR3 последовательностей), и, в частности, предполагают значительно большее разнообразие TCRβ среди CD45RO+ «обученных» антигеном αβ Т-клеток, чем это ранее сообщалось (~1,5*106 отличных CDR3 последовательностей). Однако биоинформатический анализ данных последовательностей TCR показывает сильные смещения в содержании моно- и динуклеотидов, что подразумевает, что использованные последовательности TCR отбираются из распределения гораздо меньшего, чем теоретический размер. При большом разнообразии цепей TCRβ у каждого человека, отобранных из сильно сокращенного предела последовательностей, у каждого человека можно ожидать перекрывание пулов последовательностей TCR. Фактически, результаты показали, что около 5% CD8+ наивных цепей TCRβ с точными аминокислотными совпадениями являются общими у каждой пары трех разных индивидуумов. Поскольку TCRα пул, как ранее было измерено, существенно меньше, чем теоретическое разнообразие TCRβ, эти результаты показывают, что могут быть обнаружены сотни и тысячи достоверных общих αβ TCR.

1. Композиция для определения разнообразия CDR3 последовательностей TCRB или IGH в образце, включающая:
(a) множество праймеров V-сегмента и
(b) множество праймеров J-сегмента;
при этом каждый из указанного множества праймеров V-сегмента и указанного множества праймеров J-сегмента состоит из 15-50 нуклеотидов,
где указанное множество праймеров V-сегмента содержит праймеры V-сегмента TCRB или праймеры V-сегмента IGH,
где указанное множество праймеров J-сегмента содержит праймеры J-сегмента TCRB или праймеры J-сегмента IGH,
где каждое из указанного множества праймеров V-сегмента содержит первую последовательность и вторую последовательность, причем указанная первая последовательность комплементарна части первого участка сегмента V-участка TCRB или сегмента V-участка тяжелой цепи иммуноглобулина (IGH), причем указанный первый участок расположен непосредственно на 5′ по отношению ко второму участку указанного сегмента V-участка TCRB или IGH, причем во время перестройки генов TCRB или IGH возникают нематричные делеции, причем указанный второй участок указанного сегмента V-участка TCRB или IGH находится рядом и на 5′ по отношению к сигнальной последовательности V-рекомбинации (V-RSS) указанного сегмента V-участка TCRB или IGH, причем указанная первая последовательность расположена на 3′ по отношению ко второй последовательности на указанном праймере V-сегмента,
где указанная вторая последовательность каждого из указанных праймеров V-сегмента TCRB не является комплементарной указанному первому участку указанного сегмента V-участка TCRB,
где указанная вторая последовательность каждого из указанных праймеров V-сегмента IGH не является комплементарной указанному первому участку указанного сегмента V-участка IGH,
где каждый из указанного множества праймеров J-сегмента имеет первую последовательность и вторую последовательность, причем указанная первая последовательность комплементарна части первого участка сегмента J-участка TCRB или сегмента J-участка IGH, причем указанный первый участок расположен непосредственно на 3′ по отношению ко второму участку указанного сегмента J-участка TCRB или IGH, причем во время перестройки генов TCRB или IGH возникают нематричные делеции, при этом указанный второй участок указанного сегмента J-участка TCRB или IGH находится рядом и на 3′ по отношению к сигнальной последовательности J-рекомбинации (J-RSS) указанного сегмента J-участка TCRB или указанного сегмента J-участка IGH, причем указанная первая последовательность расположена на 3′ по отношению ко второй последовательности на указанном праймере J-сегмента,
где указанная вторая последовательность указанного праймера J-сегмента TCRB не является комплементарной указанному первому участку указанного сегмента J-участка TCRB,
где указанная вторая последовательность указанного праймера J-сегмента IGH не является комплементарной указанному первому участку указанного сегмента J-участка IGH, и
где амплификация перестроенных молекул нуклеиновой кислоты путем одиночной многократной полимеразной цепной реакции (PCR) из образца, содержащего лимфоциты, полученного от субъекта млекопитающего, с использованием указанных праймеров V-сегмента и J-сегмента производит по меньшей мере 106 отличных ампликонов, представляющих разнообразие перестроенных последовательностей CDR3 TCRB или IGH, присутствующих в указанном образце.

2. Композиция по п.1, где множество праймеров V-сегмента имеет сходную прочность отжига.

3. Композиция по п.1, где все праймеры J-сегмента отжигаются с одинаковым мотивом консервативного каркасного участка.

4. Композиция по п.1, где ампликон содержит последовательность, которая начинается с консервативного мотива, включает CDR3 соединение и распространяется в V-сегмент, и где ампликон может быть использован для диагностического определения J-сегмента.

5. Композиция по п.1, дополнительно включающая набор олигонуклеотидов для секвенирования, где указанные олигонуклеотиды для секвенирования комплементарны указанной второй последовательности указанных праймеров V-сегмента и указанной второй последовательности указанных праймеров J-сегментов.

6. Композиция по п.1, где каждый из ампликонов охватывает V-D-J-соединение.

7. Композиция по п.1, где каждый из множества праймеров V-сегмента способен к гибридизации с множеством сегментов V-участка, и каждый из множества праймеров J-сегмента способен к гибридизации с множеством сегментов J-участка.

8. Композиция по п.1, дополнительно включающая универсальный праймер С-сегмента для образования кДНК из мРНК.

9. Композиция по п.1, где 3′ конец каждого из указанных праймеров V-сегмента заякорен в положении -43 в сегменте V-участка TCRB относительно сигнальной последовательности рекомбинации (V-RSS).

10. Композиция по п.1, где множество праймеров V-сегмента TCRB состоит по меньшей мере из 14 праймеров, специфичных к 14 различным генам V TCRB.

11. Композиция по п.1, где указанные первые последовательности указанного множества праймеров V-сегмента TCRB содержат последовательности, выбранные из группы, включающей SEQ ID NOS:1-45.

12. Композиция по п.1, где указанные первые последовательности указанного множества праймеров V-сегмента TCRB содержат последовательности, выбранные из группы, включающей SEQ ID NOS:58-102.

13. Композиция по п.1, где каждый V-сегмент комплементарен по меньшей мере одному праймеру V-сегмента.

14. Композиция по п.1, где указанные праймеры не пересекают границу интрона/экзона.

15. Композиция по п.1, где указанное множество праймеров J-сегмента TCRB гибридизируется с консервативным элементом указанного сегмента J-участка TCRB и характеризуется сходной прочностью отжига.

16. Композиция по п.1, где множество праймеров J-сегмента TCRB включает по меньшей мере пять праймеров, специфичных к пяти различным генам J TCRB.

17. Композиция по п.1, где указанное множество праймеров J-сегмента TCRB содержит последовательности, выбранные из группы, включающей SEQ ID NOS:46-57 и 483.

18. Композиция по п.1, где указанное множество праймеров J-сегмента TCRB содержит последовательности, выбранные из группы, включающей SEQ ID NOS:103-113, 468 и 484.

19. Композиция по п.1, где имеется праймер J-сегмента TCRB для каждого сегмента J-участка TCRB.

20. Композиция по п.1, где каждый амплифицированный сегмент J-участка TCRB имеет уникальную метку из четырех оснований в положениях от +11 до +14 в 5′-3′ направлении сайта J-RSS.

21. Композиция по п.20, дополнительно включающая набор олигонуклеотидов для секвенирования, которые гибридизируются рядом с меткой из четырех оснований в амплифицированных сегментах J-участка TCRB в положениях от +11 до +14 в 5′-3′ направлении сайта J-RSS.

22. Композиция по п.20, где указанный набор олигонуклеотидов для секвенирования выбран из группы, включающей SEQ ID NOS:470-482.

23. Композиция по п.1, где образец содержит геномную ДНК, полученную от субъекта-млекопитающего.

24. Композиция по п.1, где образец содержит кДНК, транскрибированную от мРНК, полученной от субъекта-млекопитающего.

25. Композиция по п.5, где олигонуклеотиды для секвенирования выбраны из группы, включающей SEQ ID NOS:470-482.

26. Композиция по п.1, где указанная вторая последовательность каждого из указанных праймеров V-сегмента содержит последовательность олигонуклеотида для секвенирования.

27. Композиция по п.26, где указанный олигонуклеотид для секвенирования выбран из группы, включающей SEQ ID NOS:470-482.

28. Композиция по п.1, где указанная вторая последовательность каждого из указанных праймеров J-сегмента содержит последовательность олигонуклеотида для секвенирования.

29. Композиция по п.28, где указанная последовательность олигонуклеотида для секвенирования выбрана из группы, включающей SEQ ID NOS:470-482.

30. Композиция по п.1, где указанный первый участок указанного V-сегмента составляет по меньшей мере 40 оснований от консенсусного мотива на 5′-конце V-RSS.

31. Композиция по п.1, где каждый из указанных праймеров J-сегмента имеет 3′-конец, местоположение которого определяется по меньшей мере 14 парами оснований от консенсусного мотива на 3′-конце J-RSS.

32. Композиция по п.1, где длина ампликонов, полученных от указанного множества праймеров V-сегмента и указанного множества праймеров J-сегмента, составляет приблизительно 200 оснований.

33. Композиция по п.1, где указанные первые последовательности указанного множества праймеров V-сегмента TCRB включают SEQ ID NOS:1-45.

34. Композиция по п.1, где указанные первые последовательности указанного множества праймеров V-сегмента TCRB включают SEQ ID NOS:58-102.

35. Композиция по п.1, где указанные первые последовательности указанного множества праймеров V-сегмента IGH содержат последовательности, которые выбраны из группы, включающей SEQ ID NOS:443-451.

36. Композиция по п.1, где указанные первые последовательности указанного множества праймеров J-сегмента IGH содержат последовательности, которые выбраны из группы, включающей SEQ ID NOS:421-431.



 

Похожие патенты:

Изобретение относится к медицине, а именно к биохимическим исследованиям биологических объектов. Набор состоит из лизирующего буфера на основе 3-10 М раствора мочевины, связывающего буфера на основе 2,5-5 М хлористого натрия, элюирующего буфера на основе раствора 10 мМ Трис-HCl и 1 мМ Трилона Б с pH 8 и 80% этилового спирта в качестве отмывочного буфера.

Представлены наборы олигонуклеотидных зондов и праймеров, биологический микрочип и тест-система для идентификации и типирования вируса гриппа А и В. Охарактеризованная тест-система содержит: набор реагентов для выделения РНК вируса гриппа из биологического материала человека; набор реагентов для проведения ПЦР-амплификации, совмещенной с обратной транскрипцией, с образованием флуоресцентно-меченных фрагментов генома вируса гриппа, содержащий описанные олигонуклеотиды-праймеры; набор реагентов для проведения гибридизации фрагментов ДНК, полученных после проведения амплификации на биочипе, содержащем элементы с иммобилизованными описанными олигонуклеотидными зондами; и при необходимости, отрицательный и положительный контрольные образцы.

Изобретение относится к биотехнологии и представляет собой способ спектрального анализа флуоресцентных свойств нуклеотидных последовательностей ДНК. Предложенное изобретение может быть использовано для генетической диагностики, исследования митогенетического излучения клеток, исследования кодирования наследственной и пролиферативной информации.
Изобретение относится к области молекулярной биологии и биохимии. Устройство состоит из источника света, излучение от которого направлено на прозрачную подложку с иммобилизованными на ее поверхности олигонуклеотидами и расположенной под ней системой детекции интенсивности света, прошедшего через подложку.

Группа изобретений относится к области биохимии. Заявлены варианты способа скрининга и мониторинга онкологических заболеваний, включающего забор образца ткани, выделение из образца ткани РНК, синтез кДНК, амплификацию методом множественной обратной транскрипции полимеразой цепной реакции с последующим анализом амплифицированных продуктов.

Изобретение относится к области молекулярной биологии и биотехнологии и касается сухой смеси для амплификации нуклеиновой кислоты и способа ее получения. Охарактеризованная смесь содержит термостабильную ДНК-полимеразу, обратную транскриптазу, первый стабилизатор, выбранный из группы, включающей моносахариды, дисахариды, полиспирты и второй стабилизатор, выбранный из группы, включающей полисахариды, альбумины, поливинилпирролидон.
Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для выявления ДНК пародонтопатогенного микроорганизма Tannerella forsythensis методом полимеразной цепной реакции.

Группа изобретений относится к области биотехнологии и направлена на молекулы нуклеиновых кислот, которые кодируют белок, проявляющий свойства биосенсора для детекции пероксида водорода в живых клетках, обладающий флуоресценцией в красной области спектра.

Изобретение относится к медицине и биологии и предназначено для использования при проведении ПЦР-исследований. Устройство для полимеразной цепной реакции содержит, по крайней мере, четыре части, каждая из которых имеет две плоские, параллельные поверхности, перпендикулярные общей оси, и отверстия.

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности свободноягодника колючего, элеутерококка (Eleutherococcus senticocus (Rupr.

Группа изобретений относится к области генной инженерии. Копии секвенируемой молекулы ДНК помещают в четыре раствора, каждый из которых характеризуется сниженной концентрацией одного из нуклеотидов, по сравнению с остальными тремя нуклеотидами, во время проведения полимеризации ДНК в каждом из растворов регистрируют факты выделения ионов с помощью сенсоров на основе МДП-структур. Измеряют промежутки времени между моментами выделения ионов и по наличию большего промежутка времени делают вывод о присоединении нуклеотида с пониженной концентрацией и далее определяют расположение данного нуклеотида в секвенируемой ДНК. Определение момента присоединения нуклеотида к растущей цепи ДНК за счет измерения сигнала от каждого сенсора проводят в режиме стохастического резонанса. Режим стохастического резонанса обеспечивают за счет выбора рабочей точки МДП-структуры посередине участка бистабильности, а также за счет ввода сигнала шума от дополнительного генератора шума на катод МДП-структуры. Использование изобретений позволяет повысить точность регистрации момента присоединения очередного нуклеотида при полимеризации ДНК. 4 н.п. ф-лы, 9 ил.

Изобретение относится к области биохимии. Предложен олигонуклеотидный зонд с комплементарными концевыми последовательностями по типу "молекулярного маяка", обеспечивающий флуоресцентную детекцию при идентификации возбудителя кокцидиоидомикоза Coccidioides posadasii методом ПЦР с олигонуклеотидными праймерами CpSOW82s/CpSOWS2as, комплементарными фрагменту гена SOWgp82 С. posadasii. Зонд имеет структуру 5'(ROX)-CGCGGAGATGACTGTCGAGTGGCGCG-(BHQ2)3', где ROX - флуоресцентный краситель карбокси-Х-родамин, BHQ2 - гаситель флуоресценции. Изобретение позволяет в короткий срок с высокой чувствительностью и специфичностью детектировать ДНК С. posadasii в чистой культуре и биологическом материале. 1 ил., 1 табл., 3 пр.

Изобретение относится к биотехнологии. Описан способ предсказания ответа субъекта на терапевтическое средство для лечения ревматоидного артрита (RA). Также представлен способ предсказания, будет ли субъект с RA отвечать на лечение антагонистом В-клеток. Кроме того, представлен способ предсказания того, будет ли субъект с ревматоидным артритом эффективно отвечать на лечение антагонистом В-клеток, и способ выбора терапии пациента или субпопуляции пациентов с ревматоидным артритом. Все способы включают измерение в биологическом образце, полученном от субъекта, экспрессии одного гена или их комбинации или экспрессии одного белка или их комбинации, кодируемой одним геном или их комбинацией, где один ген или их комбинация выбраны из любого из CXCL13, FcRH5 и sFcRH5. Изобретение расширяет диагностические возможности в отношении RA. 4 н. и 16 з.п. ф-лы, 14 ил., 13 табл.

Группа изобретений относится к области генетики, молекулярной биологии, судебной медицины и криминалистики и касается инструмента для определения гаплогрупп Y-хромосомы человека. Группа изобретений представлена набором дифференцирующих олигонуклеотидных зондов, биочипом, содержащим эти зонды, и способом применения биочипа для анализа. Биочип обеспечивает возможность определения 10 гаплогрупп Y-хромосомы человека. Определение гаплогруппы осуществляется посредством генотипирования Y-хромосомы по 10 маркерам: М130 (С), М145 (DE), P257 (G), Мб9 (Н), U179 (I), M304 (J), М185 (L), M231 (N), M175 (О) и Р224 (R) с использованием биочипа, на котором иммобилизованы олигонуклеотиды, последовательность которых определена в табл.1. Структура дифференцирующих олигонуклеотидов, используемых в каждом изобретении группы, позволяет обеспечить их связывание только с полностью комплементарными мишенями, обеспечивая яркий флуоресцентный сигнал в соответствующих им ячейках биочипа. 3 н.п. ф-лы, 2 ил., 1 табл., 3 пр.

Изобретение относится к биотехнологии, а именно к способу пренатальной и постнатальной ДНК-диагностики синдрома Дауна, Эдвардса и Патау, мутации delF508 в гене муковисцидоза и резус-фактора плода методом количественной флюоресцентной полимеразной цепной реакции. Способ включает выделение ДНК из анализируемого материала сорбентом Nucleos набора DIAtom DNA Prep 100. Проводят элюацию ДНК дистиллированной стерильной водой. Осуществляют две мультиплексные амплификации с использованием набора флюоресцентно-меченых праймеров - первая на 4 локуса 21-й хромосомы, а именно D21S1435, D21S1411, D21S11 и IFNAR, на мутацию delF508 в гене муковисцидоза и на участок 10 экзона гена RhD, вторая - на 4 локуса 13 хромосомы, а именно D13S628, D13S634, D13S742, D13S305, и 4 локуса 18 хромосомы, а именно D18S386, D18S391, D18S535, D18S978. Смешивают полученные ПЦР-продукты в одной лунке. Проводят детекцию методом капиллярного электрофореза в полиакриламидном геле. Изобретение позволяет с высокой точностью диагностировать наличие синдромов Патау, Эдвардса и Дауна, мутации delF508 в гене муковисцидоза и резус принадлежности плода. 1 з.п. ф-лы, 4 ил., 1 табл., 4 пр.

Изобретение относится к ветеринарной вирусологии. Описан способ выявления геномной РНК вируса болезни Ибараки (ВБИ) с помощью ПЦР с детекцией продуктов амплификации в режиме реального времени с использованием олигонуклеотидных праймеров и зонда, комплементарных участку 10 сегмента генома ВБИ, кодирующему неструктурные белки NS3 и NS3a. Способ с помощью ПЦР-РВ проводят при следующем температурном режиме: 1) 5 мин предварительной денатурации кДНК при 94°С; 2) 5 циклов реакции (денатурация при 94°С - 15 сек, отжиг праймеров при 62°С - 15 сек, элонгация при 72°С - 15 сек); 3) 35 циклов реакции с детекцией на стадии отжига праймеров (денатурация при 94°С - 15 сек, отжиг праймеров при 62°С - 15 сек, элонгация при 72°С - 20 сек). Учет результатов реакции проводят, анализируя кривые накопления флуоресцентного сигнала для каждой пробы. Представлен нуклеотидный состав указанных праймеров и зонда: IbarF 5'-GATCAAACCATTTTGCGCTT-3' IbarR5'-CTCATCCTCACCGCCTCATTG-3' IbarZ 5'-[HEX] TCTTGTATGGTCAATCCGCTGGCT [BH2J-3'. Изобретение позволяет сократить время проведения исследования, а также осуществлять не только качественный, но и количественный анализ содержания НК в образцах. 3 н.п. ф-лы, 4 табл., 6 пр.

Изобретение касается способа определения биологической активности эмбрионированных яиц Trichuris. Охарактеризованный способ включает осуществление по меньшей мере 3-х анализов, выбранных из: - оценки и/или подтверждения стадии эмбрионального развития яиц с помощью метода количественной ПЦР с использованием пригодных маркерных последовательностей для определения количества копий геномной ДНК, - оценки метаболической активности эмбрионированных яиц с помощью биохимических и/или молекулярно-биологических методов, - оценки индуцибельности генной экспрессии в эмбрионированных яйцах, - оценки подвижности личинок Trichurs с помощью микроскопа в течение продолжительных периодов наблюдения после предварительной инкубации при повышенных температурах и/или - оценки коэффициента вылупляемости личинок Trichuris в организме лабораторного животного. Представленное изобретение может быть использовано при получении безопасных фармацевтических продуктов, терапевтически эффективных при применении у человека. 14 з.п. ф-лы, 10 ил., 11 табл., 6 пр.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченого зонда для детекции ДНК бокавируса человека. Указанный набор содержит прямой праймер 5'-ATCCWCTTGADAACGGTRAACC-3', обратный праймер 5'-RGGRATAAAGAGMGAGCYCAA-3' и флуоресцентно-меченый ДНК-зонд 5'-Cy5-CGCCGTGGCTCCTGCTC-BHQ2-3'. Изобретение обеспечивает надежную и достоверную детекцию бокавируса человека в клинических образцах и других биологических материалах методом ПЦР. 2 ил., 3 табл.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации РНК респираторно-синцитиального вируса человека. Указанный набор содержит две пары олигонуклеотидных праймеров и два флуоресцентно-меченых ДНК-зонда, а именно внешний прямой праймер 5'-AGRCARCARAGTTAYTCYATYATGTC-3', внешний обратный праймер 5'-AATTTATTATWGGTTYMCCYTTTACATA-3', прямой праймер 5'-GACACHATGAAYAGYTTRACATTACC-3', обратный праймер 5'-AAATGTYTTTATDATYCCRCGATTT-3', зонды 5'-FAM-TCTCTAGGAGCCATTGTGTCATGCTATGG-BHQ1-3' и 5'-FAM-TCTCTWGGAGCYATAGTGTCATGYTATGG-BHQ1-3'. Изобретение обеспечивает надежную и достоверную детекцию респираторно-синцитиального вируса человека в клинических образцах и других биологических материалах методом ПЦР. 1 ил., 5 табл.

Изобретение относится к области молекулярной биологии и биохимии. Предложена димерная наноструктура, способ её конструирования, способ детектирования аналита и набор для детектирования аналита. Изобретение позволяет повысить чувствительность и точность детектирования единичных молекул. 4 н. и 19 з.п. ф-лы, 6 ил., 4 пр.
Наверх