Набор дифференцирующих нуклеотидов и биочип для применения в способе генотипирования маркеров гаплогрупп y-хромосомы человека: m130 (c), м145 (de)



Набор дифференцирующих нуклеотидов и биочип для применения в способе генотипирования маркеров гаплогрупп y-хромосомы человека: m130 (c), м145 (de)
Набор дифференцирующих нуклеотидов и биочип для применения в способе генотипирования маркеров гаплогрупп y-хромосомы человека: m130 (c), м145 (de)

 


Владельцы патента RU 2539733:

Общество с ограниченной ответственностью "БИОЧИП-ИМБ" (RU)

Группа изобретений относится к области генетики, молекулярной биологии, судебной медицины и криминалистики и касается инструмента для определения гаплогрупп Y-хромосомы человека. Группа изобретений представлена набором дифференцирующих олигонуклеотидных зондов, биочипом, содержащим эти зонды, и способом применения биочипа для анализа. Биочип обеспечивает возможность определения 10 гаплогрупп Y-хромосомы человека. Определение гаплогруппы осуществляется посредством генотипирования Y-хромосомы по 10 маркерам: М130 (С), М145 (DE), P257 (G), Мб9 (Н), U179 (I), M304 (J), М185 (L), M231 (N), M175 (О) и Р224 (R) с использованием биочипа, на котором иммобилизованы олигонуклеотиды, последовательность которых определена в табл.1. Структура дифференцирующих олигонуклеотидов, используемых в каждом изобретении группы, позволяет обеспечить их связывание только с полностью комплементарными мишенями, обеспечивая яркий флуоресцентный сигнал в соответствующих им ячейках биочипа. 3 н.п. ф-лы, 2 ил., 1 табл., 3 пр.

 

Область техники, к которой относится изобретение

Изобретение относится к области генетики, молекулярной биологии, судебной медицины и криминалистики и касается инструмента для определения гаплогрупп Y-хромосомы человека.

Уровень техники

Задача определения гаплогрупп Y-хромосомы актуальна как в области судебно-медицинской экспертизы для предположения этнической принадлежности преступника, так и в области научных исследований расселения и миграции народов. Известен ряд способов генотипирования однонуклеотидных полиморфизмов ДНК, к которым относятся SNP-маркеры гаплогрупп Y-хромосомы.

1. Анализ полиморфизма длины рестриктазных фрагментов ДНК (ПДРФ - анализ). В результате мутаций в геномной ДНК возникают новые или утрачиваются ранее существовавшие сайты рестрикции - места воздействия рестриктаз, расщепляющих цепь ДНК. Это, в свою очередь, обусловливает изменение длины получающихся рестриктазных фрагментов ДНК. Распределение фрагментов по длинам выявляется с помощью электрофореза в агарозном или полиакриламидном геле. Метод трудоемок, малопроизводителен и не поддается автоматизации. Эти качества наряду с высокой требовательностью к количеству и сохранности исследуемой ДНК являются основными недостатками метода, приведшими к его исчезновению из молекулярно-биологической практики. [Joseph Т, Kusumakumary Р, Chacko Р, Abraham A, Radhakrishna Pillai M. Genetic polymorphism of CYP1A1, CYP2D6, GSTM1 and GSTT1 and susceptibility to acute lymphoblastic leukemia in Indian children. Pediatr Blood Cancer. 2004 Oct; 43(5):539-41.]

2. Секвенирование амплифицированных фрагментов ДНК, т.е. определение индивидуального генетического кода в заданном фрагменте ДНК. Самый точный и доказательный метод анализа индивидуальных генетических вариаций. Преимуществом является высокая точность и чувствительность метода, а недостатком - высокая стоимость оборудования и анализа, что мешает широкому внедрению метода в рутинную практику.

3. Выявление однонуклеотидного полиморфизма методом аллельспецифичной ПЦР. Аллельные варианты различаются за счёт того, что 3' концевой нуклеотид одного из праймеров в процессе ПЦР гибридизуется непосредственно с позицией SNP (т.е. если этот праймер комплементарен последовательности ДНК, то происходит амплификация продукта). Метод требует оборудования умеренной стоимости, однако для анализа полиморфизма в одном локусе потребуется 2 лунки плашки. Т.е. для исследования 1 образца по десяти маркерам гаплогрупп потребуется 20 лунок плашки. Зачастую в образце с места преступления может не оказаться количества ДНК, достаточного для проведения такого количества реакций. Преимуществом аллельспецифичной ПЦР является время анализа - всего 3-4 часа. [Murata M, Shiraishi Т, Fukutome К, Watanabe M, Nagao M, Kubota Y, Ito H, Kawamura J, Yatani R. Cytochrome P4501A1 and glutathione S-transferase Ml genotypes as risk factors for prostate cancer in Japan. Jpn J Clin Oncol. 1998 Nov; 28(11):657-60.]

4. Выявление однонуклеотидного полиморфизма методом гибридизации амплифицированного исследуемого образца с олигонуклеотидной матрицей. Данный метод предполагает предварительную мультиплексную амплификацию исследуемых фрагментов ДНК с использованием флюоресцентно меченных праймеров. В результате добавления избытка меченного праймера ПЦР достигается образование большого количества меченого преимущественно одноцепочечного продукта. Этот продукт гибридизуют с олигонуклеотидными зондами, иммобилизованными в определенном месте твердой подложки, либо в гелевых микрокаплях, закрепленных на подложке (такая матрица ДНК-зондов носит название биологического микрочипа или биочипа). Если последовательность анализируемой ДНК полностью комплементарна последовательность зонда, то образуется стабильный дуплекс (регистрируется флюоресцентный сигнал), если искомого фрагмента нет, или же в нем находится некомплементарное основание, то стабильного дуплекса не образуется (сигнал значительно ослаблен либо вообще не наблюдается). Простота метода, низкая стоимость и возможность использования флюоресцентной метки позволяет легко автоматизировать процесс. Кроме того, метод позволяет использовать мультиплексную ПЦР. Обычно при качественном подборе ПЦР-праймеров в ходе одной реакции могут быть амплифицированы до 15 локусов ДНК. Это является выигрышным моментом, учитывая обыкновенно малые количества ДНК, полученные с места преступления. [Wen SY, Wang H, Sun OJ, Wang SQ. Rapid detection of the known SNPs ofCYP2C9 using oligonucleotide microarray. World J Gastroenterol. 2003 Jun; 9(6):1342-6.] Пример реализации данного подхода описан в следующей работе [Наседкина Т.В., Фесенко Д.О., Митяева О.Н., Лысое Ю.П., Барский В.Е., Заседателев А.С. (2007). Способ генетической идентификации личности на основе анализа однонуклеотидного полиморфизма генома человека с использованием олигонуклеотидного биологического микрочипа. Патент PCT/RU/2007/000016, международная заявка № WO 2008088236], где предлагается инструмент, выполняющий выборочный анализ трех генов и позволяющий разделить всю популяцию на 1350 групп.

Ближайшим аналогом настоящего изобретения является инструмент, описанный в п.4.

Раскрытие изобретения

Сущность изобретения заключается в создании биочипа (под условным названием «Y-10»), в ячейках которого иммобилизованы оригинальные дифференцирующие олигонуклеотиды, подобранные таким образом, чтобы специфично связываться с аллелью исходного или группоспецифичного типа. Применение биочипа Y-10 позволит генотипировать 10 маркеров гаплогрупп Y-хромосомы: С, DE, G, H, I, J, L, N, О и R.

Дифференцирующие олигонуклеотиды (SEQ ID NO:1-20) иммобилизуются в ячейках гидрогелевого микрочипа, как описано в патенте [Мирзабеков А.Д., Рубина А.Ю., Паньков С.В., Перов А.Н., Чупеева В.В. Композиция для иммобилизации биологических макромолекул в гидрогелях, способ приготовления композиции, биочип, способ проведения ПЦР на биочипе. RU 2206575 С2] в концентрации 100-10000 пкмоль на 1 мкл геля в зависимости от задач исследователя. Схема расположения ячеек может быть произвольной, мы использовали схему, приведенную на Фиг.1. В верхней половине биочипа нанесены ячейки с дифференцирующими олигонуклеотидами исходного типа, а в нижней - группоспецифичные олигонуклеотиды. Флюоресцентный сигнал от ячеек в верхней части свидетельствует об исходном генотипе по данному маркеру, сигнал в нижней части - о принадлежности исследуемого образца к соответствующей гаплогруппе. Проведение анализа с использованием предлагаемого изобретения выполняется аналогично способу, описанному в работе [Наседкина Т.В., Фесенко Д.О., Митяева О.Н., Лысое Ю.П., Барский В.Е., Заседателев А.С. (2007). Способ генетической идентификации личности на основе анализа однонуклеотидного полиморфизма генома человека с использованием олигонуклеотидного биологического микрочипа. Патент PCT/RU/2007/000016, международная заявка № WO 2008088236}. По итогам гибридизации и отмывки анализируется полученная флуоресцентная картина, на основании чего делается вывод о генотипе (гаплогруппе) в исследуемом образце. Пример гибридизационной картины приведен на Фиг.2.

Характеристики анализируемых маркеров:

M130 - маркер гаплогруппы С. Высокой концентрации достигает у монголов (до 60%, а также у родственных им народов бурят, калмыков и хэзарейцев)

M145 - маркер гаплогруппы DE. Содержит два подкомпонента: гаплогруппу D и гаплогруппу Е. Достаточно широко распространена среди народов России и сопредельных стран.

Р257 - маркер западнокавказской гаплогруппы G.

М69 - маркер гаплогруппы Н. В наибольшей степени распространена у цыган, а также у коренных жителей Индии,

U179 - маркер гаплогруппы I. Встречается почти у 20% европейского населения, является единственной известной "большой" гаплогруппой, произошедшей на территории Европы.

М304 - маркер гаплогруппы J. Подгруппами гаплогруппы J являются J1 и J2. Гаплогруппа J1 (М267) - "западноазиатская" и "ближневосточная", наиболее типична для населения Восточной Анатолии. Распространена на Кавказе.

M185 - маркер гаплогруппы L. Происхождение этой гаплогруппы связывают с Южной Азией, с западом полуострова Индостан. Там же и превалируют ее носители. В России встречается не часто, но, тем не менее, достаточно для включения в список анализируемых гаплогрупп.

М231 - маркер гаплогруппы N. Гаплогруппа встречается в Центральной, Северной Европе и повсеместно в европейской и азиатской частях России. Наиболее генетически «чистые» представители - якуты, удмурты (68%) и финны (61%).

M175 - маркер гаплогруппы О. Характерна для представителей монголоидной расы. Высокая концентрация носителей этой гаплогруппы наблюдается в регионе Восточной и Юго-Восточной Азии у китайцев, японцев, филиппинцев, малайцев, а также у сопредельных народов, на которых они повлияли в качестве субстрата. Совершенно отсутствует эта гаплогруппа в Европе, Африке, Америке и на Ближнем Востоке.

Р224 - маркер гаплогруппы R. Наиболее распространена в Европе, Западной Евразии, индийском субконтиненте.

Данные, полученные с помощью настоящего изобретения, могут быть использованы для поисковых целей (этническая принадлежность, этническая специфика фамилии), сужения круга подозреваемых лиц, анализа смешанных образцов при изнасилованиях, определения принадлежности древних останков при проведении исследовательских работ.

В качестве образцов для исследования могут быть использованы любые биологические материалы, содержащие геномную ДНК: следы крови, слюны, пота, спермы, волосяная луковица, отпечатки пальцев, содержащие частички эпителия, влагалищный мазок, кости и проч.

Основным аспектом данного изобретения является набор дифференцирующих олигонуклеотидов, иммобилизованных на биочипе и последовательность которых приведена в Табл.1 и Перечне последовательностей (SEQ ID NO:1-20).

Осуществление изобретения

Задача настоящего изобретения состоит в создании биочипа, позволяющего определять 10 маркеров гаплогрупп Y-хромосомы: С, DE, G, H, I, J, L, N, О и R. Важнейшей задачей при осуществлении данного изобретения является обеспечение такой структуры дифференцирующих олигонуклеотидных зондов, чтобы происходило их связывание только с полностью комплементарными мишенями, обеспечивая яркий флуоресцентный сигнал в соответствующих им ячейках биочипа. В то же время неспецифическое связывание должно быть сведено к минимуму, чтобы исключить ложноположительное «срабатывание» ячеек. В связи с тем, что область полиморфного сайта консервативна (за исключением полиморфного нуклеотида), парные зонды (анализирующие один однонуклеотидный полиморфный сайт) отличаются только по внутреннему нуклеотиду и идентичны по флангам. В такой ситуации необходимо варьировать длину фланкирующих областей, чтобы обеспечить высокое специфическое и низкое неспецифическое связывание исследуемой мишени. Т.к. на данный момент отсутствуют точные термодинамические методики расчета структуры зонда, выбор структуры осуществляется эмпирически, последовательным подбором и экспериментальной проверкой. В ходе этой работы были выбраны такие структуры, и они приведены в Табл.1 и Перечне последовательностей (SEQ ID NO:1-20).

Таблица 1
Список дифференцирующих олигонуклеотидов, иммобилизованных на биочипе Y-10.
маркер (гаплогруппа) SEQ ID NO: полиморфизм последовательность 5'-3' название
М130 (С) 1 с TTGGATTTCCCTGCCCAG C-M130_C
2 Т TTGGATTTCTCTGCCCAG C-M130_T
М145 (DE) 3 С GCTAAGGCTGGCTCTCGCCT DE-M145_C
4 Т CTCTTGCCTTTCTTTCTGGTGT DE-M145_T
М257 (G) 5 G CATTTCTGGTGGCCCAGAT G-M257_G
6 А CATTTCTGATGGCCCAGAT G-M257_A
М69 (Н) 7 Т TCCTGAAATAAAATA H-M69_T
8 С ACTCCTGAAACAAAAT H-M69_C
U179 (I) 9 G ATGAAAGCCCAGGACC I-U179_G
10 А ATGAAAACCCAGGACCAG I-U179_A
М304 (J) 11 А GTAACTTGTGAAACAACTGG J-M304_A
12 С AACTTGTGACACAACTGGTG J-M304_C
М185 (L) 13 С GAGGCCGCATGGTCTTTACCAA L-M185_C
14 Т GAAGAGTCTGAGGCTGCATG L-M185_T
М231 (N) 15 G TCTACTGCTTTCAAATTGGG N-M231_G
16 А TCTACTGCTTTCGAATTGGG N-M231_A
М175 (O) 17 ТТСТС CTCACTTCTCTTCTCAAGAA O-M175_+v
18 del TTCTCACTTCTCAAGAATG O-M175_-v
Р224 (R) 19 С GAGTGTGACATCTTCCCCTGCT R-P224_C
20 Т GTGTGACATCTTTCCCTGCTG R-P224_T

Согласно приведенным в Табл.1 структурам выполняется синтез дифференцирующих олигонуклеотидов. Для закрепления в геле или на поверхности - по 5'- или 3' - концу могут быть присоединены якорные группы, обеспечивающие иммобилизацию, например NH2. Существуют разнообразные химические подходы к синтезу олигонуклеотидов, например фосфодиэфирный метод, гидрофосфорильный метод, и т.д. но наибольшее распространение в настоящее время имеет фосфорамидитный метод. Синтез олигонуклеотидов осуществляют, используя автоматические ДНК/РНК синтезаторы, например производства фирмы Applied Biosystems (США). Возможно использование широкого спектра групп для модификации иммобилизуемых олигонуклеотидов, таких как аминогруппа, тиол, гидразид, акриламидная группа, бензальдегид, тиофосфат и т.п. (Seliger H., Hinz М., Нарр Е, "Arrays of immobilized oligonucleotides - contributions to nucleic acids technology" Current Pharmaceutical Biotechnology, 2003, 4, 379-395). Модификация олигонуклеотида, имеющая целью введение активной группы, пригодной для последующей иммобилизации олигонуклеотида на биочипе, может быть осуществлена как в автоматическом режиме при синтезе с использованием широкого спектра модификаторов, которые коммерчески доступны, например, от Glen Research (USA), так и постсинтетически в ручном режиме.

Биочипы могут быть изготовлены путем создания на поверхности стеклянной подложки матрицы из ячеек полиакриламидного геля, активации ячеек и ковалентной иммобилизации в ячейках модифицированных олигонуклеотидов, несущих активные группы (Mirzabekov А. & Kolchinsky A. MAGIChip: Properties and applications in genomic studies. (2002) In Genomic Technologies : Present and Future. Eds. Galas D.J., S.J.McCormack. Caister Academic Press, pp.163-196). Также биочипы могут быть изготовлены методом химически индуцируемой или фотоиндуцируемой сополимеризации олигонуклеотида в акриламидном геле, как описано ранее (Vasiliskov, V., Timofeev E., Surzhikov S., Drobyshev, A., Shick, V. & Mirzabekov, A. 1999. Fabrication of microarray of gel-immobilized compounds on a chip by copolymerization. BioTechnique, 27, 592-606; Мирзабеков А.Д., Рубина А.Ю., Паньков С.В., Чернов Б.К Патент на изобретение N 2175972 «Способ иммобилизации олигонуклеотидов, содержащих непредельные группы, в полимерных гидрогелях при формировании микрочипа». Приоритет от 28.12.1999). Также биочипы могут быть изготовлены любыми другими известными специалисту в данной области способами (Seliger H., Hinz М., Нарр Е. "Arrays of immobilized oligonucleotides - contributions to nucleic acids technology" Current Pharmaceutical Biotechnology, 2003, 4, 379-395), а в качестве подложки, помимо стекла может быть использован другой материал (пластик, металл, гибкие мембраны и т.д.). Также для изготовления микрочипов могут быть использованы активированные подложки, коммерчески доступные от различных производителей (см., например, Ramakrishnan R, Dorris D, Lublinsky A, Nguyen A, Domanus М, Prokhorova A, Gieser L, Touma E, Lockner R, Tata M, Zhu X, Patterson M, Shippy R, Sendera TJ, Mazumder A. 2002.An assessment of Motorola CodeLink microarray performance for gene expression profiling applications. Nucleic Acids Res. 30: e30).

Для изготовления биочипа настоящего изобретения используют набор олигонуклеотидов SEQ ID NO:1-20, приведенных в Перечне последовательностей, а также Табл. 1. Расположение олигонуклеотидных зондов на биочипе может варьировать и определяется только удобством для интерпретации результатов гибридизации.

Далее приведем последовательность анализа с использованием данного изобретения. Образец ДНК используют как матрицу в мультиплексной «гнездной» двухэтапной ПЦР, использующей праймеры, специфично амплифицирующие локусы Y-хромосомы, содержащие маркеры М130 (С), М145 (DE), P257 (G), M69 (Н), U179 (I), М304 (J), M185 (L), M231 (N), M175 (О) и Р224 (R). ПЦР-праймеры не являются аспектом данного изобретения и могут быть подобраны и синтезированы квалифицированным исследователем самостоятельно. Мечение ПЦР-продукта на втором этапе ПЦР проводят с помощью праймеров, несущих флуоресцентную метку на 5'-конце, либо включением меченых трифосфатов в растущую цепь ампликона. В качестве флуоресцентной метки может быть использован любой флуорохром (например, без ограничения, FITC, Texas red, Су-3, Су-5 и т.д.), а также биотин. На втором этапе мультиплексной «гнездной» ПЦР праймеры, входящие в состав одной пары, используются в неравных количествах (преобладает обратный праймер). Это позволяет получать преимущественно одноцепочечный ампликон «-» цепи, способный к гибридизации с ДКН-зондами.

Меченый ПЦР-продукт используют для дальнейшей гибридизации на биочипе, содержащем иммобилизованные дифференцирующие олигонуклеотиды. Перед постановкой гибридизации ампликон денатурируют путем прогрева готовой гибридизационной смеси при 95°С в течение 5 мин с последующим охлаждением во льду. Гибридизация может быть проведена в любом известном специалисту в данной области гибридизационном буфере, например в SSPE-буфере или гуанидиновом буфере. Типичные условия гибридизации - 8-12 ч. при 37°С. Отмывка может быть проведена в любом известном в данной области техники буфере с добавлением соли (SSC, SSPE и т.п.) или в деионизованной воде, за 10-15 мин (J.F.Sambrook and D.W. Russell, 2001, "Molecular cloning: a laboratory manual" Cold Spring Harbor Laboratory Press).

Анализируемый фрагмент ДНК образует совершенные гибридизационные дуплексы только с соответствующими полностью комплементарными ему олигонуклеотидами. Со всеми остальными олигонуклеотидами анализируемый фрагмент ДНК будет образовывать несовершенные дуплексы, стабильность которых существенно ниже стабильности совершенных дуплексов.

Регистрация гибридизационной картины может быть произведена с помощью любой детектирующей системы, распознающей флуоресцентный сигнал (флуоресцентный микроскоп с ПЗС-камерой, лазерный сканер или портативный анализатор биочипов, доступные коммерчески от большого числа производителей, например портативный анализатор биочипов, производимый серийно ООО «БИОЧИП-ИМБ», и снабженной регистрирующим устройством (ПЗС-камерой, видеокамерой, фотокамерой)). Анализ изображения может быть произведен как визуально, так и в автоматическом режиме с использованием специальной программы. Дискриминацию совершенных и несовершенных дуплексов проводят после отмывки биочипа, сравнивая интенсивности флуоресценции соответствующих ячеек биочипа. Интенсивность сигнала в случае образования совершенного дуплекса выше, чем в случае несовершенного. Используя схему расположения олигонуклеотидов на биочипе, определяют генотип исследуемого образца.

Таким образом, с помощью биочипа «Y-10» можно проводить генотипирование образца ДНК по маркерам М130 (С), М145 (DE), P257 (G), M69 (Н), U179 (I), M304 (J), М185 (L), M231 (N), M175 (О) и Р224 (R).

Далее изобретение иллюстрируется примерами, которые показывают применение способа экспресс-анализа генетического полиморфизма. Следует, однако, понимать, что приводимые примеры служат исключительно для иллюстрации и не предназначены для ограничения объема притязаний, выраженных в формуле изобретения. На основании настоящего описания специалист в данной области сможет легко предложить свои варианты и модификации осуществления изобретения, не отходя от общей концепции настоящего изобретения и без привлечения собственной изобретательской деятельности, так что должно быть понятно, что такие варианты и модификации также будут входить в объем притязаний настоящего изобретения.

Пример 1. Изготовление биочипа «Y-10».

Олигонуклеотиды для иммобилизации на микрочипе синтезируют на автоматическом синтезаторе 394 DNA/RNA Synthesizer (Applied Biosystems, США) с использованием стандартной фосфоамидитной процедуры. 3'-конец олигонуклеотидов содержит спейсер со свободной аминогруппой, который вводят в состав олигонуклеотида при синтезе путем использования 3'-Ammo-Modifier C7 CPG 500 (Glen Research, USA).

Присоединение флуоресцентной метки к олигонуклеотидам по свободной аминогруппе осуществляют в соответствии с рекомендациями производителя.

Биочип изготавливают методом сополимеризации олигонуклеотида в акриламидном геле, как описано ранее (Патент на изобретение N 2175972 «Способ иммобилизации олигонуклеотидов, содержащих непредельные группы, в полимерных гидрогелях при формировании микрочипа» Мирзабеков А.Д., Рубина А.Ю., Паньков С.В., Чернов Б.К. Приоритет от 28.12.1999). Биочип содержит 20 типов олигонуклеотидов (SEQ ID NO:1-20), список которых представлен также в Таблице 1. Ячейки наносят согласно схеме на Фиг. 1.

Пример 2. Проведение исследования ДНК с помощью биочипа «Y-10»

Образец ДНК выделяют из слюны испытуемого набором Qiagen. Для амплификации всех анализируемых локусов используют мультиплексную двухэтапную «гнездную» ПЦР с набором локус-специфичных праймеров. ПЦР проводят на приборе MiniCycler (MJ Research, Inc., USA) в объеме 25 мкл реакционной смеси, составом: для 1-го этапа: 1 × буфер (67 мМ Трис-HCl, рН 8,6, 166 мМ (NH4)2SO4, 0,01% Тритон Х-100), 1,5 мМ MgCl2, 0,2 мМ каждого из dNTP («Силекс», Россия), 1-5 рМ каждого из праймеров 1-го этапа, 1 мкл геномной ДНК и 1,5 ед. акт. Taq-полимеразы («Силекс», Россия). ДНК денатурируют 5 мин при 94°С и проводят в первом этапе 35-45 циклов амплификации (94°С - 30 с, 60°С - 30 с, 72°С - 1 мин), затем 7 мин при 72°С. Смесь второго этапа ПЦР отличается составом и концентрацией праймеров: верхние праймеры берут в концентрации 1-5 пкмоль/мкл, а нижние 5-50 пкмоль/мкл. В смесь добавляют 2 мкл продукта из первого этапа и амплифицируют по схеме: 3,5 мин 94°С, 34 цикла (94°С - 30 с, 62°С - 30 с, 72°С - 1 мин), 7 мин при 72°С. Смесь также содержит 0,01 мМ Cy5-dUTP. Нижние праймеры 2-го этапа предварительно помечены по 5' концу флуоресцентным красителем Су5 (возб./исп.: 640/657 нм). После проведения ПЦР содержимое пробирки используют для гибридизации на биочипе в буфере следующего состава: 25% формамид (Gibco BRL), 5 × SSPE. Готовую гибридизационную смесь перед гибридизацией денатурируют при 95°С в течение 5 мин, охлаждают во льду, 2 мин., и вносят в гибридизационную камеру биочипа (30 мкл). Гибридизацию проводят в течение 8-12 ч при температуре 37°С. Отмывку проводят в буфере 1 × SSPE при комнатной температуре в течение 10 мин.

Пример 3. Регистрация и интерпретация результатов гибридизации.

Регистрацию гибридизационной картины производят с помощью портативного анализатора биочипов, снабженного ПЗС-камерой, производимого ООО «БИОЧИП-ИМБ». Изображение записывается в виде файла с расширением .spe и может быть переведено в другие графические форматы, такие как .jpg, .jpeg, .tiff и проч.

Определим генотип по гибридизационной картине, представленной на Фигуре 2. Для всех маркеров, кроме Ml 75 (маркер гаплогруппы О, 9-й столбец слева) флюоресцируют ячейки с дифференцирующими олигонуклеотидами исходного типа (верхние ряды), а для Ml 75 верхние ячейки исходного типа не дают сигнал, а нижние, группоспецифичные, флюоресцируют, что свидетельствует о принадлежности образца к Y-хромосомной гаплогруппе О.

1. Набор дифференцирующих олигонуклеотидов для генотипирования маркеров 10 гаплогрупп (C, DE, G, H, I, J, L, N, O и R) Y-хромосомы человека М130, М145, Р257, М69, U179, М304, М185, М231, М175, Р224, последовательность которых определена в табл.1.

2. Биочип для генотипирования маркеров 10 гаплогрупп (C, DE, G, H, I, J, L, N, O и R) Y-хромосомы человека М130, М145, Р257, М69, U179, М304, М185, М231, М175, Р224, содержащий набор иммобилизованных олигонуклеотидов, охарактеризованный в п.1.

3. Способ генотипирования маркеров 10 гаплогрупп (C, DE, G, H, I, J, L, N, O и R) Y-хромосомы человека М130, М145, Р257, М69, U179, М304, М185, М231, М175, Р224, предусматривающий использование биочипа, охарактеризованного в п.2, и включающий амплификацию локусов ДНК человека, содержащих вышеуказанные маркеры, и гибридизацию ампликонов с олигонуклеотидами, иммобилизованными на биочипе, охарактеризованном в п.2.



 

Похожие патенты:

Изобретение относится к биотехнологии. Описан способ предсказания ответа субъекта на терапевтическое средство для лечения ревматоидного артрита (RA).

Изобретение относится к области биохимии. Предложен олигонуклеотидный зонд с комплементарными концевыми последовательностями по типу "молекулярного маяка", обеспечивающий флуоресцентную детекцию при идентификации возбудителя кокцидиоидомикоза Coccidioides posadasii методом ПЦР с олигонуклеотидными праймерами CpSOW82s/CpSOWS2as, комплементарными фрагменту гена SOWgp82 С.

Группа изобретений относится к области генной инженерии. Копии секвенируемой молекулы ДНК помещают в четыре раствора, каждый из которых характеризуется сниженной концентрацией одного из нуклеотидов, по сравнению с остальными тремя нуклеотидами, во время проведения полимеризации ДНК в каждом из растворов регистрируют факты выделения ионов с помощью сенсоров на основе МДП-структур.

Изобретение относится к области молекулярной биологии, биохимии, иммунологии и генетической инженерии. Предложена композиция для определения разнообразия CDR3 последовательностей TCRB или IGH в образце.

Изобретение относится к медицине, а именно к биохимическим исследованиям биологических объектов. Набор состоит из лизирующего буфера на основе 3-10 М раствора мочевины, связывающего буфера на основе 2,5-5 М хлористого натрия, элюирующего буфера на основе раствора 10 мМ Трис-HCl и 1 мМ Трилона Б с pH 8 и 80% этилового спирта в качестве отмывочного буфера.

Представлены наборы олигонуклеотидных зондов и праймеров, биологический микрочип и тест-система для идентификации и типирования вируса гриппа А и В. Охарактеризованная тест-система содержит: набор реагентов для выделения РНК вируса гриппа из биологического материала человека; набор реагентов для проведения ПЦР-амплификации, совмещенной с обратной транскрипцией, с образованием флуоресцентно-меченных фрагментов генома вируса гриппа, содержащий описанные олигонуклеотиды-праймеры; набор реагентов для проведения гибридизации фрагментов ДНК, полученных после проведения амплификации на биочипе, содержащем элементы с иммобилизованными описанными олигонуклеотидными зондами; и при необходимости, отрицательный и положительный контрольные образцы.

Изобретение относится к биотехнологии и представляет собой способ спектрального анализа флуоресцентных свойств нуклеотидных последовательностей ДНК. Предложенное изобретение может быть использовано для генетической диагностики, исследования митогенетического излучения клеток, исследования кодирования наследственной и пролиферативной информации.
Изобретение относится к области молекулярной биологии и биохимии. Устройство состоит из источника света, излучение от которого направлено на прозрачную подложку с иммобилизованными на ее поверхности олигонуклеотидами и расположенной под ней системой детекции интенсивности света, прошедшего через подложку.

Группа изобретений относится к области биохимии. Заявлены варианты способа скрининга и мониторинга онкологических заболеваний, включающего забор образца ткани, выделение из образца ткани РНК, синтез кДНК, амплификацию методом множественной обратной транскрипции полимеразой цепной реакции с последующим анализом амплифицированных продуктов.

Изобретение относится к области молекулярной биологии и биотехнологии и касается сухой смеси для амплификации нуклеиновой кислоты и способа ее получения. Охарактеризованная смесь содержит термостабильную ДНК-полимеразу, обратную транскриптазу, первый стабилизатор, выбранный из группы, включающей моносахариды, дисахариды, полиспирты и второй стабилизатор, выбранный из группы, включающей полисахариды, альбумины, поливинилпирролидон.

Изобретение относится к биотехнологии, а именно к способу пренатальной и постнатальной ДНК-диагностики синдрома Дауна, Эдвардса и Патау, мутации delF508 в гене муковисцидоза и резус-фактора плода методом количественной флюоресцентной полимеразной цепной реакции. Способ включает выделение ДНК из анализируемого материала сорбентом Nucleos набора DIAtom DNA Prep 100. Проводят элюацию ДНК дистиллированной стерильной водой. Осуществляют две мультиплексные амплификации с использованием набора флюоресцентно-меченых праймеров - первая на 4 локуса 21-й хромосомы, а именно D21S1435, D21S1411, D21S11 и IFNAR, на мутацию delF508 в гене муковисцидоза и на участок 10 экзона гена RhD, вторая - на 4 локуса 13 хромосомы, а именно D13S628, D13S634, D13S742, D13S305, и 4 локуса 18 хромосомы, а именно D18S386, D18S391, D18S535, D18S978. Смешивают полученные ПЦР-продукты в одной лунке. Проводят детекцию методом капиллярного электрофореза в полиакриламидном геле. Изобретение позволяет с высокой точностью диагностировать наличие синдромов Патау, Эдвардса и Дауна, мутации delF508 в гене муковисцидоза и резус принадлежности плода. 1 з.п. ф-лы, 4 ил., 1 табл., 4 пр.

Изобретение относится к ветеринарной вирусологии. Описан способ выявления геномной РНК вируса болезни Ибараки (ВБИ) с помощью ПЦР с детекцией продуктов амплификации в режиме реального времени с использованием олигонуклеотидных праймеров и зонда, комплементарных участку 10 сегмента генома ВБИ, кодирующему неструктурные белки NS3 и NS3a. Способ с помощью ПЦР-РВ проводят при следующем температурном режиме: 1) 5 мин предварительной денатурации кДНК при 94°С; 2) 5 циклов реакции (денатурация при 94°С - 15 сек, отжиг праймеров при 62°С - 15 сек, элонгация при 72°С - 15 сек); 3) 35 циклов реакции с детекцией на стадии отжига праймеров (денатурация при 94°С - 15 сек, отжиг праймеров при 62°С - 15 сек, элонгация при 72°С - 20 сек). Учет результатов реакции проводят, анализируя кривые накопления флуоресцентного сигнала для каждой пробы. Представлен нуклеотидный состав указанных праймеров и зонда: IbarF 5'-GATCAAACCATTTTGCGCTT-3' IbarR5'-CTCATCCTCACCGCCTCATTG-3' IbarZ 5'-[HEX] TCTTGTATGGTCAATCCGCTGGCT [BH2J-3'. Изобретение позволяет сократить время проведения исследования, а также осуществлять не только качественный, но и количественный анализ содержания НК в образцах. 3 н.п. ф-лы, 4 табл., 6 пр.

Изобретение касается способа определения биологической активности эмбрионированных яиц Trichuris. Охарактеризованный способ включает осуществление по меньшей мере 3-х анализов, выбранных из: - оценки и/или подтверждения стадии эмбрионального развития яиц с помощью метода количественной ПЦР с использованием пригодных маркерных последовательностей для определения количества копий геномной ДНК, - оценки метаболической активности эмбрионированных яиц с помощью биохимических и/или молекулярно-биологических методов, - оценки индуцибельности генной экспрессии в эмбрионированных яйцах, - оценки подвижности личинок Trichurs с помощью микроскопа в течение продолжительных периодов наблюдения после предварительной инкубации при повышенных температурах и/или - оценки коэффициента вылупляемости личинок Trichuris в организме лабораторного животного. Представленное изобретение может быть использовано при получении безопасных фармацевтических продуктов, терапевтически эффективных при применении у человека. 14 з.п. ф-лы, 10 ил., 11 табл., 6 пр.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченого зонда для детекции ДНК бокавируса человека. Указанный набор содержит прямой праймер 5'-ATCCWCTTGADAACGGTRAACC-3', обратный праймер 5'-RGGRATAAAGAGMGAGCYCAA-3' и флуоресцентно-меченый ДНК-зонд 5'-Cy5-CGCCGTGGCTCCTGCTC-BHQ2-3'. Изобретение обеспечивает надежную и достоверную детекцию бокавируса человека в клинических образцах и других биологических материалах методом ПЦР. 2 ил., 3 табл.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации РНК респираторно-синцитиального вируса человека. Указанный набор содержит две пары олигонуклеотидных праймеров и два флуоресцентно-меченых ДНК-зонда, а именно внешний прямой праймер 5'-AGRCARCARAGTTAYTCYATYATGTC-3', внешний обратный праймер 5'-AATTTATTATWGGTTYMCCYTTTACATA-3', прямой праймер 5'-GACACHATGAAYAGYTTRACATTACC-3', обратный праймер 5'-AAATGTYTTTATDATYCCRCGATTT-3', зонды 5'-FAM-TCTCTAGGAGCCATTGTGTCATGCTATGG-BHQ1-3' и 5'-FAM-TCTCTWGGAGCYATAGTGTCATGYTATGG-BHQ1-3'. Изобретение обеспечивает надежную и достоверную детекцию респираторно-синцитиального вируса человека в клинических образцах и других биологических материалах методом ПЦР. 1 ил., 5 табл.

Изобретение относится к области молекулярной биологии и биохимии. Предложена димерная наноструктура, способ её конструирования, способ детектирования аналита и набор для детектирования аналита. Изобретение позволяет повысить чувствительность и точность детектирования единичных молекул. 4 н. и 19 з.п. ф-лы, 6 ил., 4 пр.

Изобретение относится к области биохимии, в частности к набору реагентов и способу для выявления ДНК возбудителей чумы, сибирской язвы и туляремии. Набор содержит шесть видоспецифичных олигонуклеотидных праймеров и три зонда, комплементарных фрагментам ДНК генов Yersinia pestis, Bacillus anthracis и Francisella tularensis. ДНК-мишенями для специфической амплификации являются фрагмент хромосомного гена уро2088 метилтрансферазы Yersinia pestis, фрагмент хромосомного гена sspE Bacillus anthracis и фрагмент хромосомной ДНК элемента вставки ISFtu5 Francisella tularensis. Изобретение позволяет быстро и высокоспецифично выявлять штаммы видов Y. pestis, B. anthracis и F. tularensis, независимо от плазмидного профиля штаммов. 2 н.п. ф-лы, 3 ил., 5 табл., 2 пр.

Группа изобретений относится к области биотехнологии, в частности к автоматическому устройству и способу очистки и выделения целевой нуклеиновой кислоты из биологического образца, причем устройство обеспечивает возможность предотвратить загрязнение выделенной целевой нуклеиновой кислоты от аэрозоля и которое может быть применено ко всем видам оборудования выделения и очистки нуклеиновых кислот из множества биологических образцов, использующего магнитный стержень или мультипипеточный блок, движущийся в двух или трех осевых направлениях. Группа изобретений обеспечивает повышение качества очистки выделенных из биологического образца целевых нуклеиновых кислот от загрязнения их аэрозолем, образующимся из биологического образца, содержащего целевую нуклеиновую кислоту в высокой концентрации, для обеспечения более точных результатов последующих исследований выделенных целевых нуклеиновых кислот. 2 н. и 17 з.п. ф-лы, 19 ил.

Изобретение относится к области биотехнологии и микробиологии. Предложен способ количественного определения видового состава пропионовых бактерий, обитающих на коже человека. Способ предусматривает получение образца, выделение из него ДНК и проводение количественной ПЦР-реакции. Реакцию осуществляют с праймерами GCG TGA GTG ACG GTA ATG GGT A, TTC CGA CGC GAT САА ССА, FAM-AGC GTT GTC CGG АТТ TAT TGG GCG-BHQ1, АСА TGG АТС CGG GAG СТТ С, АСС САА CAT CTC ACG АСА CG, R6G-CGG TTC АСА GGT GGT GCA TTG GC-BHQ2, GTC TGC AAC TCG АСС ССА Т, AGT ССТ ААТ ТАС CAG ТСС САС, ROX-ACC TGT GTG GGG GAG CCG TCG AAG-BHQ2, AGA ACT CTG AGC GCT AGC TGT AG, CGT AGA ACT AGC TGT AGC GCA, Cy5-AG CGG CTC СТА СТТ CTG CAG GGG-BHQ2. Способ позволяет сократить время исследований и дать количественную оценку видового разнообразия пропионовых бактерий, присутствующих на коже человека. Изобретение может быть использовано в медицине. 2 табл.

Группа изобретений касается дискриминирующего мишень зонда (TD-зонду), способа его конструирования и способов детекции нуклеиновокислотной последовательности-мишени с его использованием. TD-зонд гибридизуется с нуклеиновокислотной последовательностью-мишенью как через 5'-концевой второй участок гибридизации, так и 3'-концевой первый участок гибридизации. Когда TD-зонд гибридизуется с нуклеиновокислотной последовательностью, не являющейся мишенью, тогда и 5'-концевой второй участок гибридизации, и разделительный участок оба не гибридизуются с нуклеиновокислотной последовательностью, не являющейся мишенью, так что оба участка образуют одиночную цепь вследствие низкой величины своей Тпл. Представленные изобретения позволяют повысить специфичность гибридизации и могут быть использованы в области клинической диагностики и генетических исследований. 7 н. и 32 з.п. ф-лы, 14 ил., 9 пр.
Наверх