Набор для выделения днк



Набор для выделения днк
Набор для выделения днк

 


Владельцы патента RU 2539030:

ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ УЧРЕЖДЕНИЕ "РОССИЙСКИЙ НАУЧНЫЙ ЦЕНТР РАДИОЛОГИИ И ХИРУРГИЧЕСКИХ ТЕХНОЛОГИЙ" МИНИСТЕРСТВА ЗДРАВООХРАНЕНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ /ФГБУ "РНЦРХТ" Минздрава России/ (RU)

Изобретение относится к медицине, а именно к биохимическим исследованиям биологических объектов. Набор состоит из лизирующего буфера на основе 3-10 М раствора мочевины, связывающего буфера на основе 2,5-5 М хлористого натрия, элюирующего буфера на основе раствора 10 мМ Трис-HCl и 1 мМ Трилона Б с pH 8 и 80% этилового спирта в качестве отмывочного буфера. При этом в качестве сорбента набор включает кварцевый песок с размером частиц 10-50 мкм. Набор позволяет выделять ДНК из биологических объектов с высоким выходом, высокой степенью чистоты и высокой молекулярной массой выделяемой ДНК. 2 ил., 1 пр.

 

Изобретение относится к медицине, а именно к биохимическим исследованиям биологических объектов, и может найти применение в диагностике злокачественных, вирусных и наследственных заболеваний.

В основе существующих в настоящее время коммерческих наборов для выделения ДНК из эукариотических клеток, включая человека, лежит обратимая сорбция молекул ДНК на частицах синтетического силикагеля в буферах, содержащих высокие концентрации йодистого натрия, перхлората натрия или гуанидинтиоцианата [Proc. Natl. Acad. Sci. 1979, v. 76, 615-619, 2; Nucl. Acids Res. 1990, v. 18, 1074].

Так, в качестве сорбционного буфера в наборе для выделения ДНК ″Geneclean″ компании BIO 101 используется йодистый натрий. В состав данного набора входят следующие компоненты: 6 М раствор йодистого натрия, суспензия сорбента Glassmilk и отмывочный буфер, состоящий из хлористого натрия, Трис-HCl, Трилона Б, этилового спирта и воды [The Geneclean Kit. 1989. BIO 101 Inc., Release 7]. Этот набор используется для выделения ДНК плазмид из бактерий и агарозных гелей. Качество выделяемой ДНК соответствует стандарту. Однако наличие в наборе йодистого натрия, способного необратимо связывать ДНК с сорбентом, приводит к ее потерям при выделении, а остаточная примесь йодистого натрия может ингибировать активность ферментов, используемых для последующей модификации ДНК.

Известен также набор для выделения ДНК ″Prep-A-Gene″ компании Bio-Rad, в состав которого входят следующие компоненты: 6 М раствор йодистого натрия в качестве связывающего буфера, суспензия сорбента в растворе 6 М перхлората натрия и отмывочный буфер [Prep-A-Gene DNA Purification Kit. 1990. Bio-Rad Laboratories, Bulletin 1541]. Данный набор используется для выделения плазмидной ДНК и извлечения фрагментов ДНК из агарозных гелей. Однако ценность набора снижается вследствие использования в нем йодистого натрия и перхлората натрия, остаточные примеси которых могут ингибировать активность ферментов-модификаторов ДНК.

Подавляющее большинство коммерческих наборов основано на использовании в качестве лизирующего и связывающего агента гуанидинтиоцианата [Lab. Times. 2005, 5: 51-58].

Общим недостатком наборов для выделения ДНК на основе гуанидинизотиоцианата является то, что малейшие остаточные примеси этого агента в элюируемой по протоколу ДНК ингибируют активность ферментов, используемых для последующей модификации ДНК, включая полимеразную цепную реакцию, что существенно снижает ценность данных наборов.

Для устранения этого недостатка нами ранее был разработан набор для выделения ДНК [Патент №2116795 на изобретение «Набор для выделения ДНК». Зарегистрирован 10 августа 1998 г. C07H 21/04] на основе ингредиентов, остаточные примеси которых не ингибируют активность ферментов. Этот набор взят нами в качестве прототипа.

Набор состоит из лизирующего буфера, состоящего из 3-10 М раствора мочевины, связывающего буфера, состоящего из 2,5-5 М хлористого натрия, отмывочного буфера, состоящего из 80%-ного этилового спирта, элюирующего буфера, состоящего из 10 мМ Трис-HCl, 1 мМ Трилона Б с pH 8 и сорбента, состоящего из 50%-ной водной суспензии силикагеля.

Использование в наборе мочевины и хлористого натрия, обладающих мягким денатурирующим действием и легко отмываемых от сорбента, обеспечило высокое качество получаемой ДНК и уменьшило ингибирующий эффект на ферменты модификации ДНК остаточных примесей компонентов используемых буферов. Это обусловлено тем, что мочевина и хлористый натрий, широко применяемые при выделении нативных белков, являются физиологичными и не привносят в процесс выделения ДНК иных компонентов.

Как и в подавляющем большинстве коммерческих наборов, в прототипе в качестве сорбента для ДНК использовался синтетический аморфный силикагель. Однако, в процессе длительного использования этого набора для выделения ДНК, а также других коммерческих наборов, сорбирующим компонентом которых являются частицы синтетического аморфного силикагеля, обнаружены следующие недостатки: во-первых, в зависимости от партии используемого аморфного силикагеля его сорбционные свойства различаются, что существенно сказывается на воспроизводимости результатов, особенно это касается количественной полимеразной цепной реакции; во-вторых, вариации пористости различных партий синтетического аморфного кремнезема приводят к вариациям примесей компонентов ингредиентов буферов набора в конечном препарате ДНК и, соответственно, к вариациям активности ферментов модификации ДНК; в-третьих, шарообразная поверхность синтетических частиц силикагеля обладает минимальной сорбционной способностью в отношении выделяемых молекул ДНК. Это ограничивает их применение в диагностических целях, особенно в области количественной полимеразной цепной реакции.

Технический результат настоящего изобретения состоит в повышении выхода ДНК, чистоты ДНК и более высокой молекулярной массы выделяемой ДНК.

Этот результат достигается тем, что в известном наборе выделения ДНК, состоящем из лидирующего буфера на основе 3-10 М раствора мочевины, связывающего буфера на основе 2,5-5 М хлористого натрия, промывочного - на основе 80% этанола, элюирующего - на основе 10 мМ Трис-HCl и 1 мМ Трилона Б с pH 8, согласно изобретению, в качестве сорбента используют кристаллический кварцевый песок с размером частиц 10-50 мкм.

В процессе многолетних исследований и сравнительного анализа сорбционной способности различных форм двуокиси кремния, а также соединений кремния, как синтетических, так и природного происхождения, нами было выяснено, что частицы природной кристаллической формы двуокиси кремния - кварцевого песка лишены всех вышеперечисленных недостатков, а именно: недостаточно высокой сорбционной емкости ДНК, недостаточной прочности связи ДНК с сорбентом, а также различий сорбционной емкости ДНК различных партий силикагелей. Причиной этого являются следующие свойства кристаллической формы двуокиси кремния: 1 - компактная регулярная кристаллическая решетка кварца обладает минимальным количеством микропор и, как следствие, привносит минимальные загрязнения ингредиентами набора в искомой ДНК; 2 - более высокий отрицательный заряд поверхности частиц кварца по сравнению с аморфным силикагелем приводит к более прочному связыванию молекул ДНК с частицами и, соответственно, обеспечивает меньшие потери ДНК в процессе процедур сорбции и отмывки ДНК на частицах; 3 - кристаллический кварц с частицами нерегулярной формы по сравнению с шарообразными частицами аморфного кремнезема имеет большую поверхность и, соответственно, большую емкость в отношении выделяемой ДНК. Следует отметить также, что стоимость кристаллического кварцевого песка во много раз ниже стоимости синтетического аморфного силикагеля. Все это приводит к тому, что использование набора для выделения ДНК на основе кристаллического кварцевого песка может быть более эффективным по сравнению как с прототипом, так и аналогичными коммерческими наборами.

Использование в наборе лизирующего буфера на основе мочевины позволяет исключить гуанидинтиоцианат и тем самым предотвратить ингибирование активности ферментов, используемых для последующей модификации ДНК.

Использование в качестве связывающего буфера хлористого натрия позволило исключить из набора перхлорат натрия, который, как и гуанидинтиоцианат, является ингибитором активности ферментов.

Использование кристаллического кварцевого песка (ГОСТ 22551-77, марка ООВС-010-В: «Кварцевый песок и жильный кварц, обогащенные и высшего сорта») с размером частиц 10-50 мкм в качестве сорбента обеспечивает высокую чистоту выделяемой ДНК за счет того, что кристаллический кварц обладает более высоким отрицательным зарядом поверхности по сравнению с аморфным силикагелем, что обеспечивает более высокую сорбционную емкость в отношении ДНК, а меньшая пористость кристаллов кварца по сравнению с частицами силикагеля обеспечивает более высокую эффективность удаления остаточных примесей используемых в процессе буферов, что, в конечном счете, обеспечивает более высокую чистоту искомого препарата ДНК.

Состав набора для выделения ДНК:

Набор состоит из 4-х буферов и сорбента, каждый из которых находится в отдельной пробирке и добавляется отдельно в реакционную смесь в соответствии с нижеприведенной методикой выделения ДНК, а также инструкции по выделению ДНК. Пробирки с ингредиентами набора находятся в картонной коробке с ячейками для их вертикального расположения.

Набор имеет следующий состав:

Лизирующий буфер (4 М раствор мочевины) - 1 мл;

Связывающий буфер (2.5 М раствор хлористого натрия) - 3 мл;

Отмывочный буфер (80% раствор этилового спирта) - 15 мл;

Элюирующий буфер (10 мМ Трис-HCl и 1 мМ Трилона Б с рН 8) -1,2 мл; Сорбент (50% суспензия кварцевого песка ГОСТ 22551-77, марка ООВС-01 О-В: «Кварцевый песок и жильный кварц, обогащенные и высшего сорта») с размером частиц 10-50 мкм в растворе 2.5 М хлористого натрия) - 1 мл.

Примеры использования набора.

Пример 1.

Для иллюстрации получения геномной ДНК приводим пример №1 - выделение ДНК из клеток крови человека с использованием данного набора.

Осадок белых клеток крови, полученных из 1 мл цельной крови, растворяли в 20 мкл лизисного буфера, после чего добавляли 100 мкл связывающего буфера, смесь перемешивали и добавляли 30 мкл суспензии сорбента, вновь перемешивали и оставляли на 10 мин при комнатной температуре, после чего добавляли 0,5 мл отмывочного буфера, перемешивали и центрифугировали при 5000 об/мин в течение 1 мин. Супернатант тщательно отбирали и отбрасывали, а к осадку добавляли 30 мкл элюирующего буфера, смесь пипетировали и помещали на 20 мин в водяную баню при +60°C, после чего центрифугировали при 5000 об/мин в течение 1 мин. Отбирали содержащий ДНК супернатант и измеряли концентрацию ДНК с помощью флуориметра. Выход обычно составлял 15-20 мкг ДНК из 1 мл крови, что соответствует максимальной величине. Степень очистки ДНК от примесей белков определяли спектрофотометрически по величине отношения А260/А280, которое было в пределах 1,8-2,0, что соответствует стандарту. Нативность ДНК и ее способность служить субстратом для ферментов модификации контролировали с помощью электрофореза в 0,8% агарозе, окрашивание ДНК осуществляли бромистым этидием (0,5 мкг/мл), фотографировали электрофореграммы в УФ-свете с использованием оранжевого фильтра.

Качество искомой ДНК проиллюстрировано электрофореграммами выделенной геномной ДНК и продуктов ее расщепления ферментами рестрикции, широко используемыми в молекулярной диагностике. На рис.1 приведены результаты выделения ДНК из клеток крови с использованием набора на основе аморфного кремнезема (прототип) (дорожка 1) и данного набора (дорожка 2). В качестве маркеров молекулярной массы использовали ДНК фага лямбда (дорожка М) и ДНК-лестницу из дрожжей (дорожка М′). Как видно из рис.1, выход геномной ДНК выше при использовании набора на основе кристаллического кварца (дорожка 2), чем при использовании аналогичного набора на основе аморфного кремнезема (дорожка 1), о чем свидетельствует сравнение интенсивности сигналов окрашенных бромистым этидием полосок ДНК на электрофореграмме. На рис.1 также видно, что молекулярная масса ДНК, полученной с помощью набора на основе кристаллического кварца (дорожка 2), в 2 раза больше, чем при использовании аналогичного набора на основе аморфного кремнезема (дорожка 1), о чем свидетельствует более низкая электрофоретическая подвижность искомой ДНК относительно маркеров молекулярной массы (дорожки М и М′).

Количественный анализ выхода искомой ДНК в трех независимых выделениях ДНК из образцов крови с флуоресцентным измерением количества ДНК на приборе DyNa Quant 200 (компания GE) показал, что выход ДНК с использованием набора на основе кристаллического кварца был на 30-40% выше, чем в случае использования аналогичного набора на основе аморфного кремнезема.

Ключевым физико-химическим параметром, определяющим величину и прочность связывания ДНК с сорбентом, является величина поверхностного заряда частиц. Поэтому мы сравнили величину поверхностного заряда частиц кварца и кремнезема. Величины поверхностного заряда частиц кварца, входящего в состав данного набора, и аморфного силикагеля, являющегося компонентом коммерческих наборов для выделения ДНК, определяли как величину дзетта-потенциала с помощью прибора Zetasizer Nano ZS (компания Malvern). Величина дзетта-потенциала частиц кварца составила -50,9 мВт, а для трех партий аморфного кремнезема эта величина составила -13,6, -14,8 и -16,5 мВт соответственно, то есть величина дзетта-потенциала поверхности частиц кристаллического кварца кремнезема была более чем в три раза выше, чем у аморфного кремнезема, что и определяет более высокую сорбирующую способность частиц кварца в отношении ДНК.

Важнейшим критерием чистоты, полученной с помощью набора ДНК, является ее способность служить субстратом для ферментов модификации ДНК, используемых в молекулярной диагностике. В качестве контроля качества искомой ДНК использовали ее ферментативный гидролиз тремя рестрикционными энданиклеазами. На рис.2 представлены результаты гидролиза ДНК следующими эндонуклеазами - EcoRI (дорожка 1), BamHI (дорожка 2) и HindIII (дорожка 3). Каждый фермент был добавлен в количестве 1 единица на 1 мкг ДНК, инкубацию проводили при +37°C в течение 12 ч, анализ гидролизатов ДНК проводили в 0,8% агарозе, окрашивание ДНК осуществляли бромистым этидием (0,5 мкг/мл), фотографировали электрофореграммы в УФ-свете с использованием оранжевого фильтра. В качестве маркера молекулярной массы использовали ДНК-лестницу с шагом 1000 пар нуклеотидов (дорожки М). Как показал ферментативный гидролиз геномной ДНК тремя рестрикционными энданиклеазами, искомая ДНК является прекрасным субстратом для эндонуклеаз.

Как видно из приведенных примеров, предлагаемый набор обеспечивает высокий выход ДНК, на 30-40% превышающий прототип и другие коммерческие наборы, а также высокую степень чистоты ДНК, что позволяет использовать ее в медицинской практике для диагностических целей.

Предлагаемый набор, по сравнению с известными, имеет ряд существенных преимуществ.

1. Использование кристаллического кварца обеспечивает получение более высокого выхода препаратов ДНК по сравнению с прототипом.

2. Использование кристаллического кварца обеспечивает получение более высококачественных препаратов ДНК с более высокой молекулярной массой по сравнению с прототипом.

3. Компоненты набора являются физиологичными, обладают мягким денатурирующим действием, легко отмываются от сорбента и тем самым обеспечивают высокое качество получаемой ДНК и отсутствие остаточных примесей используемых буферов, что не может обеспечить ни один из известных наборов.

4. Набор состоит из легко доступных, нетоксичных компонентов и является наиболее дешевым из известных наборов для этих целей.

Набор разработан автором в лаборатории генной инженерии Федерального государственного бюджетного учреждения «Российский научный центр радиологии и хирургических технологий» Министерства здравоохранения Российской Федерации, прошел лабораторные исследования в НИИ особочистых биопрепаратов (г. Санкт-Петербург), институте акушерства и гинекологии им. Отто (г. Санкт-Петербург), НИИ вирусологии им. Д.И. Иваницкого (г. Москва) и готов к внедрению в широкую медицинскую практику.

Набор для выделения ДНК, состоящий из лизирующего буфера на основе 3-10 М раствора мочевины, связывающего буфера на основе 2,5-5 М хлористого натрия, промывочного буфера на основе 80% этанола, элюирующего буфера на основе 10 мМ Трис-HCl и 1 мМ Трилона Б с pH 8, и сорбента, отличающийся тем, что в качестве сорбента ДНК он содержит кристаллический кварцевый песок с размером частиц 10-50 мкм.



 

Похожие патенты:

Представлены наборы олигонуклеотидных зондов и праймеров, биологический микрочип и тест-система для идентификации и типирования вируса гриппа А и В. Охарактеризованная тест-система содержит: набор реагентов для выделения РНК вируса гриппа из биологического материала человека; набор реагентов для проведения ПЦР-амплификации, совмещенной с обратной транскрипцией, с образованием флуоресцентно-меченных фрагментов генома вируса гриппа, содержащий описанные олигонуклеотиды-праймеры; набор реагентов для проведения гибридизации фрагментов ДНК, полученных после проведения амплификации на биочипе, содержащем элементы с иммобилизованными описанными олигонуклеотидными зондами; и при необходимости, отрицательный и положительный контрольные образцы.

Изобретение относится к биотехнологии и представляет собой способ спектрального анализа флуоресцентных свойств нуклеотидных последовательностей ДНК. Предложенное изобретение может быть использовано для генетической диагностики, исследования митогенетического излучения клеток, исследования кодирования наследственной и пролиферативной информации.
Изобретение относится к области молекулярной биологии и биохимии. Устройство состоит из источника света, излучение от которого направлено на прозрачную подложку с иммобилизованными на ее поверхности олигонуклеотидами и расположенной под ней системой детекции интенсивности света, прошедшего через подложку.

Группа изобретений относится к области биохимии. Заявлены варианты способа скрининга и мониторинга онкологических заболеваний, включающего забор образца ткани, выделение из образца ткани РНК, синтез кДНК, амплификацию методом множественной обратной транскрипции полимеразой цепной реакции с последующим анализом амплифицированных продуктов.

Изобретение относится к области молекулярной биологии и биотехнологии и касается сухой смеси для амплификации нуклеиновой кислоты и способа ее получения. Охарактеризованная смесь содержит термостабильную ДНК-полимеразу, обратную транскриптазу, первый стабилизатор, выбранный из группы, включающей моносахариды, дисахариды, полиспирты и второй стабилизатор, выбранный из группы, включающей полисахариды, альбумины, поливинилпирролидон.
Изобретение относится к области биохимии, в частности к набору синтетических олигонуклеотидов для выявления ДНК пародонтопатогенного микроорганизма Tannerella forsythensis методом полимеразной цепной реакции.

Группа изобретений относится к области биотехнологии и направлена на молекулы нуклеиновых кислот, которые кодируют белок, проявляющий свойства биосенсора для детекции пероксида водорода в живых клетках, обладающий флуоресценцией в красной области спектра.

Изобретение относится к медицине и биологии и предназначено для использования при проведении ПЦР-исследований. Устройство для полимеразной цепной реакции содержит, по крайней мере, четыре части, каждая из которых имеет две плоские, параллельные поверхности, перпендикулярные общей оси, и отверстия.

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности свободноягодника колючего, элеутерококка (Eleutherococcus senticocus (Rupr.

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности сушеницы болотной (Filaginella uliginosa (L.) Opiz).

Изобретение относится к области молекулярной биологии, биохимии, иммунологии и генетической инженерии. Предложена композиция для определения разнообразия CDR3 последовательностей TCRB или IGH в образце. Изобретение может быть использовано для оценки адаптивной иммунной системы пациентов в медицине. 35 з.п. ф-лы, 14 табл., 14 пр.

Группа изобретений относится к области генной инженерии. Копии секвенируемой молекулы ДНК помещают в четыре раствора, каждый из которых характеризуется сниженной концентрацией одного из нуклеотидов, по сравнению с остальными тремя нуклеотидами, во время проведения полимеризации ДНК в каждом из растворов регистрируют факты выделения ионов с помощью сенсоров на основе МДП-структур. Измеряют промежутки времени между моментами выделения ионов и по наличию большего промежутка времени делают вывод о присоединении нуклеотида с пониженной концентрацией и далее определяют расположение данного нуклеотида в секвенируемой ДНК. Определение момента присоединения нуклеотида к растущей цепи ДНК за счет измерения сигнала от каждого сенсора проводят в режиме стохастического резонанса. Режим стохастического резонанса обеспечивают за счет выбора рабочей точки МДП-структуры посередине участка бистабильности, а также за счет ввода сигнала шума от дополнительного генератора шума на катод МДП-структуры. Использование изобретений позволяет повысить точность регистрации момента присоединения очередного нуклеотида при полимеризации ДНК. 4 н.п. ф-лы, 9 ил.

Изобретение относится к области биохимии. Предложен олигонуклеотидный зонд с комплементарными концевыми последовательностями по типу "молекулярного маяка", обеспечивающий флуоресцентную детекцию при идентификации возбудителя кокцидиоидомикоза Coccidioides posadasii методом ПЦР с олигонуклеотидными праймерами CpSOW82s/CpSOWS2as, комплементарными фрагменту гена SOWgp82 С. posadasii. Зонд имеет структуру 5'(ROX)-CGCGGAGATGACTGTCGAGTGGCGCG-(BHQ2)3', где ROX - флуоресцентный краситель карбокси-Х-родамин, BHQ2 - гаситель флуоресценции. Изобретение позволяет в короткий срок с высокой чувствительностью и специфичностью детектировать ДНК С. posadasii в чистой культуре и биологическом материале. 1 ил., 1 табл., 3 пр.

Изобретение относится к биотехнологии. Описан способ предсказания ответа субъекта на терапевтическое средство для лечения ревматоидного артрита (RA). Также представлен способ предсказания, будет ли субъект с RA отвечать на лечение антагонистом В-клеток. Кроме того, представлен способ предсказания того, будет ли субъект с ревматоидным артритом эффективно отвечать на лечение антагонистом В-клеток, и способ выбора терапии пациента или субпопуляции пациентов с ревматоидным артритом. Все способы включают измерение в биологическом образце, полученном от субъекта, экспрессии одного гена или их комбинации или экспрессии одного белка или их комбинации, кодируемой одним геном или их комбинацией, где один ген или их комбинация выбраны из любого из CXCL13, FcRH5 и sFcRH5. Изобретение расширяет диагностические возможности в отношении RA. 4 н. и 16 з.п. ф-лы, 14 ил., 13 табл.

Группа изобретений относится к области генетики, молекулярной биологии, судебной медицины и криминалистики и касается инструмента для определения гаплогрупп Y-хромосомы человека. Группа изобретений представлена набором дифференцирующих олигонуклеотидных зондов, биочипом, содержащим эти зонды, и способом применения биочипа для анализа. Биочип обеспечивает возможность определения 10 гаплогрупп Y-хромосомы человека. Определение гаплогруппы осуществляется посредством генотипирования Y-хромосомы по 10 маркерам: М130 (С), М145 (DE), P257 (G), Мб9 (Н), U179 (I), M304 (J), М185 (L), M231 (N), M175 (О) и Р224 (R) с использованием биочипа, на котором иммобилизованы олигонуклеотиды, последовательность которых определена в табл.1. Структура дифференцирующих олигонуклеотидов, используемых в каждом изобретении группы, позволяет обеспечить их связывание только с полностью комплементарными мишенями, обеспечивая яркий флуоресцентный сигнал в соответствующих им ячейках биочипа. 3 н.п. ф-лы, 2 ил., 1 табл., 3 пр.

Изобретение относится к биотехнологии, а именно к способу пренатальной и постнатальной ДНК-диагностики синдрома Дауна, Эдвардса и Патау, мутации delF508 в гене муковисцидоза и резус-фактора плода методом количественной флюоресцентной полимеразной цепной реакции. Способ включает выделение ДНК из анализируемого материала сорбентом Nucleos набора DIAtom DNA Prep 100. Проводят элюацию ДНК дистиллированной стерильной водой. Осуществляют две мультиплексные амплификации с использованием набора флюоресцентно-меченых праймеров - первая на 4 локуса 21-й хромосомы, а именно D21S1435, D21S1411, D21S11 и IFNAR, на мутацию delF508 в гене муковисцидоза и на участок 10 экзона гена RhD, вторая - на 4 локуса 13 хромосомы, а именно D13S628, D13S634, D13S742, D13S305, и 4 локуса 18 хромосомы, а именно D18S386, D18S391, D18S535, D18S978. Смешивают полученные ПЦР-продукты в одной лунке. Проводят детекцию методом капиллярного электрофореза в полиакриламидном геле. Изобретение позволяет с высокой точностью диагностировать наличие синдромов Патау, Эдвардса и Дауна, мутации delF508 в гене муковисцидоза и резус принадлежности плода. 1 з.п. ф-лы, 4 ил., 1 табл., 4 пр.

Изобретение относится к ветеринарной вирусологии. Описан способ выявления геномной РНК вируса болезни Ибараки (ВБИ) с помощью ПЦР с детекцией продуктов амплификации в режиме реального времени с использованием олигонуклеотидных праймеров и зонда, комплементарных участку 10 сегмента генома ВБИ, кодирующему неструктурные белки NS3 и NS3a. Способ с помощью ПЦР-РВ проводят при следующем температурном режиме: 1) 5 мин предварительной денатурации кДНК при 94°С; 2) 5 циклов реакции (денатурация при 94°С - 15 сек, отжиг праймеров при 62°С - 15 сек, элонгация при 72°С - 15 сек); 3) 35 циклов реакции с детекцией на стадии отжига праймеров (денатурация при 94°С - 15 сек, отжиг праймеров при 62°С - 15 сек, элонгация при 72°С - 20 сек). Учет результатов реакции проводят, анализируя кривые накопления флуоресцентного сигнала для каждой пробы. Представлен нуклеотидный состав указанных праймеров и зонда: IbarF 5'-GATCAAACCATTTTGCGCTT-3' IbarR5'-CTCATCCTCACCGCCTCATTG-3' IbarZ 5'-[HEX] TCTTGTATGGTCAATCCGCTGGCT [BH2J-3'. Изобретение позволяет сократить время проведения исследования, а также осуществлять не только качественный, но и количественный анализ содержания НК в образцах. 3 н.п. ф-лы, 4 табл., 6 пр.

Изобретение касается способа определения биологической активности эмбрионированных яиц Trichuris. Охарактеризованный способ включает осуществление по меньшей мере 3-х анализов, выбранных из: - оценки и/или подтверждения стадии эмбрионального развития яиц с помощью метода количественной ПЦР с использованием пригодных маркерных последовательностей для определения количества копий геномной ДНК, - оценки метаболической активности эмбрионированных яиц с помощью биохимических и/или молекулярно-биологических методов, - оценки индуцибельности генной экспрессии в эмбрионированных яйцах, - оценки подвижности личинок Trichurs с помощью микроскопа в течение продолжительных периодов наблюдения после предварительной инкубации при повышенных температурах и/или - оценки коэффициента вылупляемости личинок Trichuris в организме лабораторного животного. Представленное изобретение может быть использовано при получении безопасных фармацевтических продуктов, терапевтически эффективных при применении у человека. 14 з.п. ф-лы, 10 ил., 11 табл., 6 пр.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченого зонда для детекции ДНК бокавируса человека. Указанный набор содержит прямой праймер 5'-ATCCWCTTGADAACGGTRAACC-3', обратный праймер 5'-RGGRATAAAGAGMGAGCYCAA-3' и флуоресцентно-меченый ДНК-зонд 5'-Cy5-CGCCGTGGCTCCTGCTC-BHQ2-3'. Изобретение обеспечивает надежную и достоверную детекцию бокавируса человека в клинических образцах и других биологических материалах методом ПЦР. 2 ил., 3 табл.

Изобретение относится к области биохимии, в частности к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации РНК респираторно-синцитиального вируса человека. Указанный набор содержит две пары олигонуклеотидных праймеров и два флуоресцентно-меченых ДНК-зонда, а именно внешний прямой праймер 5'-AGRCARCARAGTTAYTCYATYATGTC-3', внешний обратный праймер 5'-AATTTATTATWGGTTYMCCYTTTACATA-3', прямой праймер 5'-GACACHATGAAYAGYTTRACATTACC-3', обратный праймер 5'-AAATGTYTTTATDATYCCRCGATTT-3', зонды 5'-FAM-TCTCTAGGAGCCATTGTGTCATGCTATGG-BHQ1-3' и 5'-FAM-TCTCTWGGAGCYATAGTGTCATGYTATGG-BHQ1-3'. Изобретение обеспечивает надежную и достоверную детекцию респираторно-синцитиального вируса человека в клинических образцах и других биологических материалах методом ПЦР. 1 ил., 5 табл.
Наверх