Набор олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации burkholderia mallei и дифференциации его от burkholderia pseudomallei



Набор олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации burkholderia mallei и дифференциации его от burkholderia pseudomallei
Набор олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации burkholderia mallei и дифференциации его от burkholderia pseudomallei

 


Владельцы патента RU 2551208:

Федеральное казенное учреждение здравоохранения Волгоградский научно-исследовательский противочумный институт Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (RU)

Изобретение относится к биотехнологии, а именно к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации Burkholderia mallei и дифференциации его от Burkholderia pseudomallei. Прямой и обратный праймеры имеют следующую структуру: 5′-GGCGTCAGGACTACAACGAGC-3′-Bm-ISfl-f и 5′-CACGGGCGACATCACGAACA-3′-Bm-ISfl-r. Флуоресцентно-меченый зонд имеет следующую структуру: Bm-ISfl-Pr 5′ (FAM)-GGGCGTGAAGCTCGTTGACCTGCCC-(BHQ1) 3′, где FAM - карбоксифлуоресцеин, флуоресцентный краситель, длина волны поглощения которого составляет 490 нм, а BHQ1 - гаситель флуоресценции с диапазоном гашения 480-580 нм. Предложенное изобретение позволяет с высокой чувствительностью и специфичностью детектировать возбудителя сапа и дифференцировать его от возбудителя мелиоидоза в пробах чистых культур и биологическом материале. 1 ил., 1 табл., 3 пр.

 

Изобретение относится к биотехнологии, молекулярной биологии и может быть использовано в медицине для выявления генетического материала возбудителя сапа Burkholderia mallei в пробах как для диагностики в практическом здравоохранении и службе Роспотребнадзора, так и для научных исследований.

Возбудитель сапа (В. mallei) - аэробная грамотрицательная неферментирующая бактерия, принадлежащая к роду Burkholderia и относящаяся к потенциальным агентам биотерроризма группы В. Сап - тяжелое антропозо-онозное инфекционное заболевание, характеризующееся септицемией, образованием специфических гранулем, абсцессов в органах и тканях и высокой летальностью. Особенно это касается случаев внутрилабораторного заражения, поскольку возбудитель сапа чрезвычайно опасен при манипуляциях в лабораторных условиях.

В настоящее время сап регистрируют в Монголии, Турции, Иране, Ираке, Китае, Индии и других странах, использующих в различных сферах экономики непарнокопытных животных. В 2010 году случаи сапа выявлены среди львов и тигров в зоопарке Ирана. Заболеваемость среди людей носит в основном спорадический характер. Тем не менее, периодически появляются публикации о выделении В. mallei в клинических лабораториях Италии, Испании, США.

Необходимость исследований, направленных на диагностику штаммов В. mallei, связана с сохранением угрозы возникновения чрезвычайных ситуаций, возможных террористических актов с использованием этого возбудителя.

Метод полимеразной цепной реакции обладает высокой специфичностью и чувствительностью и является прямым методом выявления ДНК возбудителя сапа. В основе реакции лежит механизм репликации, который характеризуется внутриклеточным удвоением молекул ДНК ферментом ДНК-полимеразой. Выбор специфического фрагмента ДНК и подбор праймеров играет важнейшую роль в проведении амплификации, что сказывается на качестве диагностики исследуемых микроорганизмов.

Внедрение в лабораторную диагностику метода ПЦР в режиме реального времени с флуоресцентной детекцией, позволяет проводить выявление продуктов амплификации в процессе реакции и вести количественный учет ДНК. С использованием зондов, меченых различными флуоресцентными красителями, в одной пробирке вместе с праймерами можно осуществлять автоматическую регистрацию и интерпретацию полученных результатов. Подобный подход дает возможность отказаться от стадии электрофореза, что ведет к резкому уменьшению вероятности контаминации исследуемых проб продуктами амплификации, а также позволяет снизить требования, предъявляемые к ПЦР лаборатории.

Наиболее близким аналогом являются специфичные праймеры на основе фрагментов гена fliP, предложенные Н. Tomaso с соавторами в 2006 году [Tomaso Н., Scholz Н., Al Dahouk S., et al. Development of a 5′-Nuclease Real-Time PCR Assay Targeting fliP for the Rapid Identification of Burkholderia mallei in Clinical Samples // Clin Chem. 2006 Feb; 52(2):307-10], где впервые удалось дифференцировать В. mallei от В. pseudomallei и других гетерологичных микроорганизмов с помощью ПЦР тест-системы в режиме реального времени.

Праймеры на основе фрагментов гена fliP были использованы в ПЦР с электрофоретическим учетом результатов для обнаружения возбудителя сапа при вспышке среди львов и тигров в зоопарке Ирана, опубликованной в работе Khaki Р. с соавторами в 2012 [Khaki P., Mosavari N., Khajeh N., Emam M., Ahouran M., Hashemi S. et al. Glanders outbreak at Tehran Zoo, Iran // Iranian Journal Microbiology March 2012 4 (1): 3-7]. Применение данных праймеров с детекцией результатов методом электрофореза имеет определенный недостаток - это высокий риск контаминации проб на этапе постановки реакции.

Однако в настоящее время в России для ПЦР диагностики существуют наборы реагентов, которые идентифицируют возбудителей сапа и мелиоидоза, но не дифференцируют их между собой.

Целью настоящего изобретения является разработка высокоспецифичных олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации сапа, а также для дифференциации от возбудителя мелиоидоза методом полимеразной цепной реакции с флуоресцентной детекцией.

Цель достигается конструированием специфичных олигонуклеотидов для идентификации возбудителя сапа и дифференциации от возбудителя мелиоидоза, обладающих активностью прямого и обратного праймеров в реакции амплификации, имеющих следующую структуру:

5′-GGCGTCAGGACTACAACGAGC-3′-Bm-ISfl-f

5′-CACGGGCGACATCACGAACA-3′-Bm-ISfl-r

Флуоресцентная детекция реализуется при помощи сконструированного видоспецифического олигонуклеотидного зонда с комплементарными концевыми последовательностями по типу «молекулярного маяка»:

Bm-ISfl-Pr 5′(FAM)-GGGCGTGAAGCTCGTTGACCTGCCC-(BHQ1) 3′,

где FAM - карбоксифлуоресцеин, флуоресцентный краситель, длина волны поглощения которого составляет 490 нм, а длина волны флуоресценции - 520 нм, BHQ1 - гаситель флуоресценции с диапазоном гашения 480-580 нм.

Характеристика олигонуклеотидных праймеров, зонда и ДНК мишени для гибридизации.

Основываясь на данных, представленных в базе GenBank NCBI (National Center for Biotechnology Information, США), для идентификации возбудителя сапа и дифференциации от возбудителя мелиоидоза были подобраны праймеры, обозначенные Bm-ISfl-f/Bm-ISfl-r, и зонд, Bm-ISfl-Pr, комплементарные фрагментам гена fliP (flagellar biosynthetic protein fliP). Расчетная длина специфического фрагмента составляла 298 п.н.

В качестве положительного контроля эксперименты проводили на типовом штамме В. mallei 10230, используя для выделения ДНК обеззараженные суспензии микроорганизма в концентрациях от 1×109 м.к./мл до 1×101 м.к./мл. Апробация праймеров была осуществлена на наборе штаммов возбудителей сапа и мелиоидоза коллекционного центра ФКУЗ Волгоградский научно-исследовательский противочумный институт Роспотребнадзора.

Чувствительность реакции амплификации с флуоресцентной детекцией в режиме реального времени с праймерами Bm-ISfl-f/Bm-ISfl-r и зондом Bm-ISfl-Pr оценивалась при исследовании проб ДНК, выделенных из десятикратных разведений чистых культур возбудителя сапа, и составила 1×103 м.к./мл,

Примеры конкретного выполнения.

Пример 1. Методика конструирования олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации ДНК возбудителей сапа методом ПЦР в режиме реального времени.

На основе анализа in silico нуклеотидных последовательностей возбудителя сапа, присутствующих в базах данных (EMBL, Genbank, DDBJ), для конструирования прямого Bm-ISfl-f и обратного Bm-ISfl-r праймеров были выбраны участки, комплементарные фрагменту гена fliP В. mallei, кодирующего белок биосинтеза флагеллина - flagellar biosynthetic protein fliP (GenBank NCBI, GeneID: 3091254), имеющий вставку, фланкированную IS407A. Расчетная длина предполагаемого ампликона - 298 п.н. (табл.1)

Сконструирован олигонуклеотидный зонд Bm-ISfl-Pr размером 25 п.н., который гибридизуется на участке ампликона между прямым и обратным праймерами Bm-ISfl-f/Bm-ISfl-r. На разных концах зонда расположены флуорофор FAM и гасителем флуоресценции BHQ1. Комплементарные концевые последовательности зонда образуют «шпильку» по принципу «молекулярного маяка».

При подборе праймеров и зонда руководствовались общими требованиями к олигонуклеотидным затравкам, используемым в ПЦР. С помощью компьютерных программ была проанализирована структура выбранных пар праймеров (образование димеров, шпилек и других вторичных структур) и показана их теоретическая пригодность для успешной инициации реакции амплификации и гибридизации.

Праймеры Bm-ISfl-f/Bm-ISfl-r и зонд Bm-ISfl-Pr были проанализированы с использованием компьютерной программы BLAST на web-сервере Национального Центра Биотехнологической Информации (NCBI) (http://www.ncbi.nlm.nih.gov/BLAST/) для установления гомологии между ними и нуклеотидными последовательностями близкородственных буркхольдерий, в том числе с В. pseudomallei и других гетерологичных микроорганизмов, присутствующих в базах данных (EMBL, GenBank, DDBJ). На момент проведения компьютерного анализа гомологии выявлено не было.

Пример 2. Амплификация и детекция специфических фрагментов ДНК с помощью разработанных праймеров Bm-ISfl-f/Bm-ISfl-r и флуоресцентно-меченого зонда Bm-ISfl-Pr для идентификации возбудителя сапа методом ПЦР в режиме реального времени.

В состав реакционной смеси помимо анализируемой ДНК входили разработанные комплементарные специфическому фрагменту ДНК В. mallei прямой Bm-ISfl-f и обратный Bm-ISfl-r праймеры, олигонуклеотидный зонд Bm-ISfl-Pr, а также дезоксирибонуклеозидтрифосфаты, буферный раствор и фермент Taq-F полимераза (ФБУН ЦНИИ Эпидемиологии Роспотребнадзора). Амплификацию продолжительностью 45 циклов проводили в объеме 25 мкл. В качестве отрицательного контрольного образца в реакционную смесь добавляли ТЕ-буфер.

Анализ продуктов ПНР осуществляли в режиме реального времени на приборе «Rotor-Gene 6000» («Corbett Research», Австралия). Регистрацию результатов проводили в табличной и графической форме. Результат амплификации каждого штамма В. mallei считался положительным, в случае если кривая накопления флуоресценции по каналу детекции пересекала пороговую линию на участке характерного экспоненциального подъема флуоресценции, на цикле, не превышающем граничное значение порогового цикла реакции (Ct) в соответствующей графе в таблице результатов (рис.1). Рисунок 1 отображает график нарастания флуоресцентных кривых, полученных при амплификации ДНК штамма В. mallei 10230 с праймерами Bm-ISfl-f/Bm-ISfl-r и зондом Bm-ISfl-Pr (изображены кривые: 1 - В. mallei 10230 в концентрации 105 м.к./мл, 2 - B. mallei 10230 в концентрации 104 м.к./мл, 3 - В. mallei 10230 в концентрации 103 м.к./мл, 4 - отрицательный контроль и кривые накопления флуоресценции проб В. mallei в концентрации меньше 102 м.к./мл, не пересекающие пороговую линию).

Пример 3. Определение чувствительности и специфичности реакции амплификации с помощью разработанных олигонуклеотидных праймеров Bm-ISfl-f/Bm-ISfl-r и флуоресцентно-меченого зонда Bm-ISfl-Pr для идентификации возбудителя сапа и дифференциации его от возбудителя мелиоидоза.

Чувствительность реакции амплификации с разработанными специфичными праймерами Bm-ISfl-f/Bm-ISfl-r и флуоресцентно-меченым зондом Bm-ISfl-Pr оценивалась при исследовании проб ДНК, выделенных из бактериальных взвесей клеток В. mallei. Штаммы буркхольдерий выращивали на плотных питательных средах в течение 1-2 суток. Готовили бактериальные взвеси клеток в 4 мл 0,15 М раствора натрия хлорида в концентрации 1×109 м.к./мл по отраслевому стандартному образцу мутности ГИСК им. Л.А. Тарасевича (ОСО 42-28-85 П) и разводили таким образом, чтобы концентрация возбудителя сапа составляла от 1×109 до 1×101 м.к./мл.

Учитывая, что возбудитель сапа относится к агентам II группы патогенности, пробоподготовку и обеззараживание материала для проведения ПЦР осуществляли согласно МУ 1.3.2569-09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности» и МУ 4.2.2831-11 «Лабораторная диагностика сапа». Обеззараживание исследуемых проб проводили добавлением раствора мертиолята натрия до конечной концентрации 0,01% и прогреванием в течение 30 мин при температуре 56°С. Выделение ДНК из чистых культур буркхольдерий, близкородственных и гетерологичных микроорганизмов проводили путем нуклеосорбции и лизиса клеток гуанидинтиоцианатом с помощью набора «ДНК-сорб-В» (ФБУН ЦНИИ Эпидемиологии Роспотребнадзора) в соответствии с инструкцией по применению. Постановку реакции ПЦР проводили, как описано в примере 2.

Специфичность разработанных праймеров Bm-ISfl-f/Bm-ISfl-r и флуоресцентно-меченого зонда Bm-ISfl-Pr оценена на коллекции из 84 штаммов, из которых 14 штаммов В. mallei и 70 штаммов гетерологичных микроорганизмов (48 штаммов В. pseudomallei, 10 штаммов В. cepacia, 5 штаммов В. thailandensis и по 1 штамму Pseudomonas aeruginosa, Pseudomonas fluores-cens, Pseudomonas putida, Francisella tularensis, Yersinia pestis, Bacillus an-thracis, Echerichia coli). Оценка специфичности показала отсутствие перекрестных реакций с близкородственными гетерологичными штаммами, в том числе с ДНК В. pseudomallei, и наличие специфической амплификации со всеми штаммами В. mallei.

Чувствительность тест системы оценивали на десятикратных разведениях бактериальных взвесей штаммов В. mallei. В амплификационную смесь добавляли по 10 мкл ДНК, выделенной из разведений от 1×105 до 1×101 м.к./мл. Анализ результатов показал, что с помощью разработанных праймеров Bm-ISfl-f/Bm-ISfl-r и флуоресцентно-меченого зонда Bm-ISfl-Pr обнаруживают ДНК возбудителя сапа при концентрации в пробе 1×103 м.к./мл.

Таким образом, разработанные праймеры Bm-ISfl-f/Bm-ISfl-r и флуоресцентно-меченый зонд Вт-ISfl-Pr могут быть использованы для обнаружения ДНК возбудителя сапа. Позволяют в короткий срок с высокой чувствительностью и специфичностью детектировать возбудителя сапа и дифференцировать его от возбудителя мелиоидоза в пробах чистых культур и биологическом материале.

Олигонуклеотидные праймеры и флуоресцентно-меченый зонд по типу «молекулярного маяка» для идентификации сапа и дифференциации от возбудителя мелиоидоза методом полимеразной цепной реакции с флуоресцентной детекцией, имеющие следующую структуру:

5'- GGC GTC AGG ACT ACA ACG AGC -3' - Bm-ISfl- f

5'- CAC GGG CGA CAT CAC GAA CA - 3' - Bm- ISfl- r

5'(FAM)-GGGCGTGAAGCTCGTTGACCTGCCC-(BHQ1) 3' - Bm-ISfl-Pr,

комплементарные фрагменту гена fliP B. mallei, кодирующего белок биосинтеза флагеллина - flagellar biosynthetic protein fliP (GenBank NCBI, GeneID: 3091254), имеющий вставку, фланкированную IS407A, где FAM - карбоксифлуоресцеин, флуоресцентный краситель, длина волны поглощения которого сотавляет 490 нм, а длина волны флуоресценции - 520 нм; BHQ1 - гаситель флуоресценции с диапазоном гашения 480-580 нм.

Набор олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации Burkholderia mallei и дифференциации его от Burkholderia pseudomallei методом полимеразной цепной реакции с флуоресцентной детекцией, комплементарных фрагментам гена fliP (жгутиковый биосинтетический белок) возбудителя сапа, обладающих активностью прямого и обратного праймеров в реакции амплификации, и зонда с комплементарными концевыми последовательностями по типу «молекулярного маяка», обеспечивающего флуоресцентную детекцию, имеющие следующую структуру:



где FAM - карбоксифлуоресцеин, флуоресцентный краситель, длина волны поглощения которого составляет 490 нм, а длина волны флуоресценции - 520 нм; BHQ1 - гаситель флуоресценции с диапазоном гашения 480-580 нм.



 

Похожие патенты:

Изобретение относится к биотехнологии и представляет собой ДНКазу или ее ферментативно активный фрагмент, способы удаления загрязняющей нуклеиновой кислоты из реакции обратной транскрипции, в которых используется данная ДНКаза, нуклеиновую кислоту, кодирующую указанную ДНКазу, и наборы или композиции, содержащие указанную ДНКазу.

Изобретение относится к области биотехнологии, а именно к способу воздействия на пролиферативный статус клеток. Предложенное изобретение может быть использовано в медицине в области лечения онкологических заболеваний, в иммунологии, в геронтологии и косметологии.

Изобретение относится к биотехнологии, а именно к cпособу дифференциации типичных и атипичных штаммов Yersinia pestis основного подвида средневекового биовара. Способ предусматривает проведение в двух реакционных смесях ПЦР с гибридизационно-флуоресцентным учетом результатов с использованием соответствующих олигонуклеотидных праймеров и зондов на ДНК-мишени «Med24» и «pCKF» следующего состава: праймеры прямой Med24 RealTime-S GCCAGTGTGTGTCTAAA, обратный Med24 RealTime-As CAACATTCGTCGCAAAG и зонд Med24 Zond FAM-ACATTGTGCTGGACTCACAGCCCC-BHQ1, праймеры прямой pCKF RealTime-S AACCGCCTAAGCACTTTAT, обратный pCKF RealTime-As CGTCAGGAACTCAACGAA и зонд pCKF Zond FAM-ATCAGAGAGCATTTGAGCGGTTG-BHQ1.

Группа изобретений относится к области биотехнологии и касается синтетических олигонуклеотидных праймеров и способа их использования. Предложенный способ выявления и дифференциации генома вакцинного штамма В-82 от полевых изолятов вируса миксомы кроликов включает: выделение ДНК из биологического материала, постановку мультиплексной полимеразной цепной реакции с использованием синтезированных праймеров, комплементарных участкам генов M130R и M151R вируса миксомы кролика и имеющих следующий нуклеотидный состав: амплификацию ДНК вируса и оценку проведения реакции.

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела.

Группа изобретений относится к области биохимии. Предложено устройство для забора нуклеиновой кислоты, применение устройства для забора нуклеиновой кислоты, набор для амплификации нуклеиновой кислоты, а также способ амплификации нуклеиновой кислоты.

Изобретение относится к области биохимии, в частности к способу выявления соматических мутаций в гене PI3K, ответственных за чувствительность опухоли к таргетной терапии, с помощью технологии ДНК-биочипов.

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности вереска обыкновенного (Calluna vulgaris (L.) Hull.).

Изобретение относится к биотехнологии, в частности к способу выделения микроРНК из биологических жидкостей, содержащих экзосомы. Способ включает последовательное центрифугирование, ультрафильтрацию и ультрацентрифугирование культуральной конденсированной среды.

Изобретение относится к области биотехнологии и может быть использовано для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ММР9-1562 C>Т (rs3918242).

Изобретение относится к биотехнологии и молекулярной биологии. Предложен олигонуклеотидный зонд MS8 Flip-R для флуоресцентной детекции возбудителя гистоплазмоза Histoplasma capsulatum методом полимеразной цепной реакции с олигонуклеотидными праймерами HcMs8s, HcMs8as3, имеющий следующую структуру: MS8 Flip-R 5'(ROX)-GGCCTGACCAGTATAACCAAGGCC-(BHQ2) 3', где ROX - флуоресцентный краситель карбокси-Х-родамин, BHQ2 - гаситель флуоресценции "Black Hole 2".

Изобретение относится к области биотехнологии и касается набора, включающего олигодезоксирибонуклеотидные праймеры и флуоресцентно меченный зонд для идентификации ДНК аденовируса серотипов 3, 4, 7, 14, 21 методом гибридизационно-флуоресцентной полимеразной цепной реакции в режиме реального времени.

Изобретение относится к паразитологии и касается способа видовой ДНК-дифференциации гельминтов - возбудителей церкариального дерматита человека. Дифференциацию четырех видов Trichobilharzia: Т.
Изобретение относится к области медицинской микробиологии, а именно к способу молекулярно-генетического типирования штаммов Bordetella pertussis. Способ включает выделение ДНК из штаммов B.pertussis, проведение полимеразной цепной реакции с одновременным введением специфических праймеров PF-PR для получения ампликонов фрагмента промотора коклюшного токсина ptxP, рестрикции полученных ампликонов эндонуклеазами KpnI и MluI и электрофорезу продуктов рестрикции в агарозном геле.

Изобретение относится к области биотехнологии и касается набора олигонуклеотидных праймеров и флуоресцентно-меченых зондов для видоспецифичной экспресс-идентификации вируса Эбола-Заир методом полимеразной цепной реакции в реальном времени.

Изобретение относится к области биотехнологии и касается набора олигонуклеотидных праймеров и флуоресцентномеченых зондов для видоспецифической экспресс-идентификации вируса Эбола-Судан методом полимеразной цепной реакции в реальном времени.

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров и способа их использования для выявления Lactobacillus delbrueckii subspecies bulgaricus в заквасочных культурах.

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования В.mallei. .

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования В.mallei. .

Изобретение относится к области биотехнологии, молекулярной биологии, молекулярной эпидемиологии. .

Изобретение касается набора флуоресцентно-меченых олигонуклеотидных зондов для типирования штаммов Burkholderia mallei. Входящие в состав набора зонды имеют структуру «шпильки» с флуорофором и гасителем флуоресценции на концах и обладают комплементарностью к продуктам реакции амплификации с праймерами. Разработанный набор гибридизационных зондов может быть использован для флуоресцентной детекции результатов типирования возбудителя сапа методом амплификации дифференцирующих фрагментов генома при осуществлении эпидемиологического надзора за сапной инфекцией и обеспечивает возможность одновременного анализа девяти DFR-локусов. 2 ил., 1 табл., 3 пр.
Наверх