Способ дифференциации типичных и атипичных штаммов yersinia pestis средневекового биовара методом пцр с гибридизационно-флуоресцентным учетом результатов

Изобретение относится к биотехнологии, а именно к cпособу дифференциации типичных и атипичных штаммов Yersinia pestis основного подвида средневекового биовара. Способ предусматривает проведение в двух реакционных смесях ПЦР с гибридизационно-флуоресцентным учетом результатов с использованием соответствующих олигонуклеотидных праймеров и зондов на ДНК-мишени «Med24» и «pCKF» следующего состава: праймеры прямой Med24 RealTime-S GCCAGTGTGTGTCTAAA, обратный Med24 RealTime-As CAACATTCGTCGCAAAG и зонд Med24 Zond FAM-ACATTGTGCTGGACTCACAGCCCC-BHQ1, праймеры прямой pCKF RealTime-S AACCGCCTAAGCACTTTAT, обратный pCKF RealTime-As CGTCAGGAACTCAACGAA и зонд pCKF Zond FAM-ATCAGAGAGCATTTGAGCGGTTG-BHQ1. Разделяют типичные и атипичные штаммы средневекового биовара следующим образом: отсутствие гибридизационно-флуоресцентного сигнала по обеим ДНК-мишеням «Med24» и «pCKF» у типичных штаммов, наличие по обеим ДНК-мишеням «Med24» и «pCKF» у атипичных штаммов, наличие ДНК-сигнала по «Med24» и отсутствие по «pCKF» у штаммов, не относящихся к штаммам средневекового биовара. 1 ил., 1 табл., 3 пр.

 

Изобретение относится к области медицинской микробиологии, в частности к внутривидовой дифференциации и молекулярному типированию штаммов возбудителя чумы, и может быть использовано в научно-исследовательских учреждениях медицинского профиля и учреждениях Роспотребнадзора.

Штаммы Yersinia pestis вызывают особо опасную инфекционную природно-очаговую болезнь, которая в отсутствие лечения, как правило, приводит к летальному исходу. Существует опасность использования вирулентных типичных и атипичных штаммов возбудителя чумы в актах биотерроризма. Необходимость быстрого выявления возбудителя чумы, включая и его атипичные штаммы, требует разработки современных молекулярно-генетических способов их идентификации, которые существенно сокращают время проведения анализа и обеспечивают получение более полной и точной информации по сравнению с традиционно используемыми в практике лабораторной диагностики методами.

В Российской Федерации, других странах СНГ и сопредельных государствах наибольшее распространение имеют высоковирулентные штаммы Y. pestis основного подвида средневекового биовара, которые циркулируют в большинстве природных очагов России и граничащих с ней территорий. Штаммы средневекового биовара способны вызывать эпидемии чумы и в средние века явились этиологическим агентом пандемии «Черная смерть», поразившей средневековую Европу и унесшей более трети ее населения. Отличительным биохимическим признаком, используемым в лабораторной диагностике для выявления штаммов средневекового биовара, является отсутствие у них нитрифицирующей и денитрифицирующей активности, т.е. способности превращать нитриты в нитраты и осуществлять обратную реакцию. Однако таким же отличительным биохимическим свойством обладают и штаммы трех неосновных подвидов - алтайского гиссарского и улегейского, на основании чего их часто ошибочно относят к средневековому биовару. В то же время неосновные подвиды возбудителя чумы характеризуются избирательной вирулентностью и достаточно редко вызывают болезнь у человека. Из этого следует, что использование только одних биохимических признаков может приводить к ошибочному определению внутривидовой систематической принадлежности штаммов Y. pestis и, как следствие, к неправильной оценке их эпидемической значимости.

Сами штаммы средневекового биовара Y. pestis неоднородны по составу и наряду с типичными широко распространенными изолятами включают и отдельную группу штаммов с атипичными свойствами. Эта группа представлена штаммами из Центрально-Кавказского высокогорного очага чумы, расположенного в России. Атипичные штаммы обладают сниженной вирулентностью по сравнению с другими штаммами средневекового биовара, содержат дополнительную плазмиду размером около 5.4 т.п.н., отсутствующую у других штаммов Y. pestis. Они также имеют уникальную питательную потребность в аминокислоте пролине, не встречающуюся у других штаммов возбудителя чумы. Поскольку эти штаммы отличаются от типичных штаммов средневекового биовара сниженной вирулентностью и, следовательно, более низкой эпидемической значимостью, то необходимо предусмотреть и способ их дифференциации от типичных штаммов этого биовара.

При выборе современного метода для проведения дифференциации штаммов Y. pestis средневекового биовара следует учесть то, что высокой разрешающей способностью, специфичностью и чувствительностью обладает полимеразная цепная реакция, применение которой позволяет в короткие сроки получать стабильные и хорошо воспроизводимые результаты.

Традиционный вариант метода полимеразной цепной реакции - ПЦР с электрофоретическим учетом результатов достаточно широко применяется для определения видовой принадлежности, а в последнее время и для проведения внутривидовой дифференциации штаммов возбудителя чумы. Так, известен способ детекции бактерий рода Yersinia и дифференциации патогенных для человека видов иерсиний методом полимеразной цепной реакции на основе использования последовательности участка гена ompF порина возбудителя чумы. [Патент RU №2354700, опубликован 10.05.2009]. Этот способ позволяет разделять виды патогенных иерсиний - возбудителей чумы, псевдотуберкулеза, кишечного иерсиниоза на видовом уровне, но он не предусматривает проведения внутривидовой дифференциации штаммов Y. pestis, в том числе не позволяет проводить разделения штаммов внутри средневекового биовара.

Известен другой способ быстрой детекции и дифференциации Y. pestis и Y. pseudotuberculosis с помощью их амплификации и гибридизации, который включает два этапа детекции ДНК этих возбудителей методом ПЦР и гибридизации фрагментов амплификации со специфическими зондами, что повышает надежность проводимого исследования [Патент № DE10124342, опубликован 11.28.2002]. Однако этот способ более сложен в исполнении, занимает большее время при проведении анализа и не обеспечивает дифференциации штаммов Y. pestis по их биоварной принадлежности.

Известен способ дифференциации штаммов возбудителя чумы основного и неосновных подвидов и возбудителя псевдотуберкулеза методом полимеразной цепной реакции [Патент RU №2425891, опубликован 10.08.2011]. Этот способ, в отличие от вышеперечисленных, позволяет проводить внутривидовую дифференциацию штаммов Y. pestis. Он обеспечивает разделение не только штаммов Y. pestis и Y. pseudotuberculosis, но и штаммов основного и неосновных подвидов возбудителя чумы. Однако этот способ не предусматривает разделения штаммов основного подвида по их принадлежности к одному из трех биоваров возбудителя чумы и проведения дифференциации среди штаммов средневекового биовара.

Известен способ подвидовой и биоварной дифференциации штаммов Y. pestis методом ПЦР и мультилокусного сиквенс-типирования [Патент RU №2471872, опубликован 10.01.2013]. Применение этого метода обеспечивает определение подвидовой и биоварной принадлежности исследуемого штамма Y. pestis. В то же время способ основан на использовании метода мультилокусного секвенирования, связанного с использованием дорогостоящего оборудования и реактивов для проведения секвенирования амплифицированных в ПЦР фрагментов ДНК, а также требующего значительного увеличения времени проведения исследования. Этот способ также не позволяет проводить разделение штаммов Y. pestis внутри средневекового биовара.

Известен способ дифференциации штаммов возбудителя чумы основного подвида средневекового и античного биоваров методом полимеразной цепной реакции [патент RU №2496882, опубликован 27.10.2013], который направлен на разделение штаммов средневекового и античного биоваров Y. pestis с помощью метода ПЦР с электрофоретическим учетом результатов. Однако с помощью этого способа обеспечивается детекция типичных штаммов средневекового биовара, но не атипичных штаммов этого биовара.

Большими разрешающими возможностями при проведении идентификации микроорганизмов обладает метод ПЦР в режиме реального времени с гибридизационно-флуоресцентным учетом результатов, который позволяет проводить одновременное исследование большого количества образцов по нескольким ДНК-мишеням, что существенно сокращает время проведения анализа. Отсутствие этапа электрофоретического учета результатов, характерного для ПЦР в традиционном формате, позволяет избежать риска контаминации образцов на этапе учета результатов.

До сих пор метод ПЦР с гибридизационно-флуоресцентным учетом результатов применяли, в основном, для видоспецифической детекции возбудителя чумы. При этом для детекции возбудителя чумы в ПЦР использовали нуклеотидные последовательности генов и участков ДНК - cafl, pla, 3а [Тест-система для выявления ДНК Yersinia pestis методом ПЦР (ГенПест); набор реагентов для выявления ДНК Yersinia pestis методом полимеразной цепной реакции с гибридизационно-флуоресцентным учетом результатов в режиме реального времени (Ген Yersinia pestis индикация РГФ)]. ПЦР в реальном времени используется также для дифференциации вирулентных и авирулентных штаммов Ypestis по генам irp2, hmsH и IcrV [Набор реагентов для ускоренной идентификации штаммов Yersinia pestis методом мультилокусной полимеразной цепной реакции с гибридизационно-флуоресцентным учетом результатов в режиме реального времени (Ген Yersinia pestis идентификация - РГФ)]. Однако эти способы не обеспечивают проведение внутривидовой дифференциации штаммов Ypestis, в частности, дифференциации штаммов средневекового биовара.

В научной и специальной литературе отсутствуют публикации об использовании метода полимеразной цепной реакции для дифференциации штаммов средневекового биовара, включая и атипичные изоляты этого биовара. Все вышеизложенное требует разработки чувствительного, быстрого и простого способа дифференциации типичных и атипичных штаммов возбудителя чумы средневекового биовара.

Технический результат заключается в обеспечении простой и надежной молекулярной дифференциации типичных и атипичных штаммов средневекового биовара возбудителя чумы.

Технический результат достигается способом дифференциации типичных и атипичных штаммов возбудителя чумы средневекового биовара методом полимеразной цепной реакции с гибридизационно-флуоресцентным учетом результатов, который предусматривает амплификацию ДНК-мишеней «Med24» и «pCKF» в исследуемом материале в двух раздельных ПЦР реакциях, при этом олигонуклеотидные праймеры и зонды на ДНК-мишени имеют следующие последовательности: праймеры прямой Med24 RealTime-S GCCAGTGTGTGTCTAAA, обратный Med24 RealTime-As CAACATTCGTCGCAAAG и зонд Med24 Zond FAM-ACATTGTGCTGGACTCACAGCCCC-BHQ1, праймеры прямой pCKF RealTime-S AACCGCCTAAGCACTTTAT, обратный pCKF RealTime-As CGTCAGGAACTCAACGAA и зонд pCKF Zond FAM-ATCAGAGAGC ATTTGAGCGGTTG-BHQ1 и последующее разделение типичных и атипичных штаммов средневекового биовара по отсутствию гибридизационно-флуоресцентного сигнала по обеим ДНК-мишеням «Med24» и «pCKF» у типичных штаммов и по его наличию по обеим ДНК-мишеням у атипичных штаммов средневекового биовара. При наличии ДНК-сигнала по «Med24» и отсутствии по «pCKF» ДНК- мишеням исследуемые штаммы не относят к штаммам средневековым биовара.

Выделение ДНК исследуемого штамма чумного микроба проводят по стандартной методике в соответствии с МУ 1.3.2569-09 «Организация работ лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности».

Полимеразную цепную реакцию осуществляют с применением вышеуказанных праймеров на мишени «Med24» и «pCKF». Олигонуклеотидные праймеры, используемые для амплификации в ПЦР с гибридизационно-флуоресцентным учетом результатов хромосомной мишени «Med24», рассчитаны на основе нуклеотидной последовательности этого участка у штаммов Y. pestis С 092, KIM, Antiqua, и Nepal 516, представленных в базе данных NCBI GenBank, а праймеры на участок «pCKF» - на основе полученного нами полного сиквенса плазмиды размером 5,4 т.п.н атипичных штаммов средневекового биовара из Центрально-Кавказского высокогорного очага чумы. С помощью рассчитанных праймеров в ПЦР проводят амплификацию участков «Med24» и «рСКР».

Олигонуклеотидные праймеры на участки «Med24» и «pCKF» и зонды имеют следующий состав:

Праймеры: Med24 RealTime-S GCCAGTGTGTGTCTAAA

Med24 RealTime-As CAACATTCGTCGCAAAG

Зонд: Med24 Zond FAM-ACATTGTGCTGGACTCACAGCCCC-BHQ1

Праймеры: pCKF RealTime-S AACCGCCTAAGCACTTTAT pCKF RealTime-As CGTCAGGAACTCAACGAA Зонд: pCKF Zond FAM-ATCAGAGAGCATTTGAGCGGTTG-BHQ1

Амплификацию участков «Med24» и «pCKF» проводят в раздельных ПЦР-смесях с использованием специфических для каждой мишени праймеров. Полимеразную цепную реакцию с амплификацией участков «Med24» и «pCKF» проводят по следующей программе: 1 цикл при температуре 95°С в течение 15 мин, затем 35 циклов при температуре 95°С в течение 20 с, при температуре 56°С в течение 40 с, на этапе отжига праймеров осуществляют учет флуоресценции.

Типичные штаммы средневекового биовара не дают флуоресцентно-гибридизационного сигнала при использовании праймеров и зондов на обе ДНК-мишени, в то время как у атипичных штаммов средневекового биовара наблюдается положительный гибридизационно-флуоресцентный сигнал по обеим ДНК-мишеням. Штаммы других биоваров (античного и восточного) основного подвида и подвидов возбудителя чумы (кавказский, алтайский, гиссарский и улегейский) дают положительный гибридизационно-флуоресцентный сигнал с праймерами на мишень «Med24» и не дают положительного сигнала с праймерами на мишень «pCKF».

Дифференциацию типичных и атипичных штаммов Y. pestis основного подвида средневекового биовара проводят в соответствии с таблицей.

Сущность изобретения поясняется примерами.

Пример 1. Дифференциация типичного штамма Y. pestis средневекового биовара (модельный эксперимент)

Выделение ДНК Y.pestis проводят стандартным методом с помощью лизирующего раствора на основе 6М гуанидинизотиоцианата с предварительным обеззараживанием культуры путем добавления мертиолята натрия до концентрации 1:10000 с последующим прогреванием при температуре 56°С в течение 30 мин [МУ 1.3.2569-09].

Для ДНК-мишени «Med24» полимеразную цепную реакцию проводят в объеме 25 мкл, реакционная смесь содержит: 1х буфер (10х ПЦР-буфер - 2,5 мкл), MgCl2 - 2,0 ммоль, смесь dNTP - 0,3 ммоль, олигонуклеотидные праймеры (прямой Med24 RealTime-S, обратный Med24 RealTime-As) - 12 пмоль, олигонуклеотидный зонд (Med24 Zond) - 6 пмоль, Taq DNA полимераза - 0,1 ед., исследуемая ДНК - 10 мкл. Для ДНК-мишени «pCKF» реакционная смесь аналогична для ДНК-мишени «Med24». В ПЦР в режиме реального времени гибридизационно-флуоресцентный сигнал с праймерами на мишень «Med24» у исследуемого штамма отсутствует. У него также отсутствует гибридизационно-флуоресцентный сигнал в ПЦР с праймерами на мишень «pCKF». Следовательно, исследуемый штамм Y.pestis относится к типичным штаммам средневекового биовара.

Пример 2. Дифференциация атипичного штамма Y.pestis средневекового биовара

Исследование штамма Y. pestis проводят аналогично примеру №1. В ПЦР в режиме реального времени у изучаемого штамма присутствует гибридизационно-флуоресцентный сигнал с праймерами на мишени «Med24» и «pCKF». Следовательно, исследуемый штамм относится к атипичным штаммам средневекового биовара из Центрально-Кавказского высокогорного очага чумы.

Пример 3. Дифференциация штамма Y. pestis, не относящегося к средневековому биовару

Исследование штамма Y. pestis проводят аналогично примеру №1. В ПЦР в режиме реального времени у изучаемого штамма присутствует гибридизационно-флуоресцентный сигнал с праймерами на мишень «Med24» и отсутствует гибридизационно-флуоресцентный сигнал на мишень «pCKF». Следовательно, исследуемый штамм не относится к штаммам средневекового биовара.

Штаммы Y. pestis, которые могли бы дать положительный сигнал на мишень «pCKF» и отрицательный сигнал на мишень «Med24», в природе отсутствуют.

Пример дифференциации типичных и атипичных штаммов Y. pestis основного подвида средневекового биовара в ПЦР с гибридизационно-флуоресцентным учетом результатов с использованием мишеней «Med24»(A) и «pCKF»(Б) приведен на фигуре.

Таким образом, заявленный способ дифференциации типичных и атипичных штаммов Y. pestis основного подвида средневекового биовара, основанный на выявлении в ПЦР с гибридизационно-флуоресцентным учетом результатов в режиме реального времени мишеней «Med24» и «pCKF», обеспечивает простую и надежную молекулярную идентификацию этих штаммов.

Способ дифференциации типичных и атипичных штаммов Yersinia pestis основного подвида средневекового биовара, предусматривающий проведение в двух реакционных смесях ПЦР с гибридизационно-флуоресцентным учетом результатов с использованием соответствующих олигонуклеотидных праймеров и зондов на ДНК-мишени «Med24» и «pCKF» следующего состава: праймеры прямой Med24 RealTime-S GCCAGTGTGTGTCTAAA, обратный Med24 RealTime-As CAACATTCGTCGCAAAG и зонд Med24 Zond FAM-ACATTGTGCTGGACTCACAGCCCC-BHQ1, праймеры прямой pCKF RealTime-S AACCGCCTAAGCACTTTAT, обратный pCKF RealTime-As CGTCAGGAACTCAACGAA и зонд pCKF Zond FAM-ATCAGAGAGCATTTGAGCGGTTG-BHQ1, и разделение типичных и атипичных штаммов средневекового биовара по отсутствию гибридизационно-флуоресцентного сигнала по обеим ДНК-мишеням «Med24» и «pCKF» у типичных штаммов, по его наличию в обеих ДНК-мишенях у атипичных штаммов, а при наличии ДНК-сигнала по «Med24» и отсутствии по «pCKF» исследуемые штаммы не относятся к штаммам средневекового биовара.



 

Похожие патенты:

Группа изобретений относится к области биотехнологии и касается синтетических олигонуклеотидных праймеров и способа их использования. Предложенный способ выявления и дифференциации генома вакцинного штамма В-82 от полевых изолятов вируса миксомы кроликов включает: выделение ДНК из биологического материала, постановку мультиплексной полимеразной цепной реакции с использованием синтезированных праймеров, комплементарных участкам генов M130R и M151R вируса миксомы кролика и имеющих следующий нуклеотидный состав: амплификацию ДНК вируса и оценку проведения реакции.

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела.

Группа изобретений относится к области биохимии. Предложено устройство для забора нуклеиновой кислоты, применение устройства для забора нуклеиновой кислоты, набор для амплификации нуклеиновой кислоты, а также способ амплификации нуклеиновой кислоты.

Изобретение относится к области биохимии, в частности к способу выявления соматических мутаций в гене PI3K, ответственных за чувствительность опухоли к таргетной терапии, с помощью технологии ДНК-биочипов.

Изобретение относится к области молекулярной генетики, геносистематики и фармакогнозии и предназначено для выявления видовой принадлежности вереска обыкновенного (Calluna vulgaris (L.) Hull.).

Изобретение относится к биотехнологии, в частности к способу выделения микроРНК из биологических жидкостей, содержащих экзосомы. Способ включает последовательное центрифугирование, ультрафильтрацию и ультрацентрифугирование культуральной конденсированной среды.

Изобретение относится к области биотехнологии и может быть использовано для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ММР9-1562 C>Т (rs3918242).

Настоящее изобретение относится к области биотехнологии, конкретно к предварительной оценке эффективности трансплантации аутологичного клеточного материала для стимуляции роста кровеносных сосудов, и может быть использовано в медицине.
Группа изобретений относится к области биотехнологии. Способ выявления генома вируса инфекционной анемии лошадей предусматривает постановку полимеразной цепной реакции, амплификацию ДНК вируса, оценку проведения реакции.

Изобретение относится к области медицины, фтизиатрии и медицинской микробиологии и касается способа генотипирования штаммов Mycobacterium tuberculosis. Охарактеризованный способ основан на однонуклеотидном полиморфизме генов систем токсин-антитоксин II типа суперсемейств VapBC, HigAB и MazEF и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора олигонуклеотидных праймеров для 10 генов систем токсин-анатоксин.

Изобретение относится к области биотехнологии, а именно к способу воздействия на пролиферативный статус клеток. Предложенное изобретение может быть использовано в медицине в области лечения онкологических заболеваний, в иммунологии, в геронтологии и косметологии. Способ включает внесение в среду, окружающую клетки, и последующее проникновение в них специфических нуклеотидных последовательностей однонитевых оверхенгов G-цепи теломерной ДНК человека в конечной концентрации, не превышающей 30 мкМ. Указанные последовательности различаются вариациями теломерного повтора ДНК и триплетными окончаниями. Предложенное изобретение позволяет контролировать время наступления определенных фаз клеточного цикла и его общую продолжительность. 7 з.п. ф-лы, 8 ил., 4 пр.

Изобретение относится к биотехнологии и представляет собой ДНКазу или ее ферментативно активный фрагмент, способы удаления загрязняющей нуклеиновой кислоты из реакции обратной транскрипции, в которых используется данная ДНКаза, нуклеиновую кислоту, кодирующую указанную ДНКазу, и наборы или композиции, содержащие указанную ДНКазу. Указанная ДНКаза представляет собой ДНКазу, которая имеет последовательность SEQ ID NO: 1, или ферментативно активный вариант SEQ ID NO: 1, имеющий последовательность, которая по меньшей мере на 95% идентична ей, но где пролиновый остаток в положении 237 в SEQ ID NO: 1 или эквивалентный пролин в других последовательностях замещен, и где указанная ДНКаза или ее ферментативно активный фрагмент по существу необратимо инактивируются путем нагревания при температуре примерно 50°С в течение 5 мин в буфере, состоящем из 25 мМ Tris/HCI, pH 8,5, 5 мМ MgCl2 и 1 мМ DTT, и которые по существу специфичны в отношении двухцепочечной ДНК. Предложенное изобретение позволяет с высокой эффективностью удалять загрязняющую ДНК из реакционных смесей для обратной транскрипции, препаратов ДНК-полимеразы с горячим стартом и реакционных смесей для ПЦР с горячим стартом. 13 н. и 22 з.п. ф-лы, 19 ил., 9 пр.

Изобретение относится к биотехнологии, а именно к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации Burkholderia mallei и дифференциации его от Burkholderia pseudomallei. Прямой и обратный праймеры имеют следующую структуру: 5′-GGCGTCAGGACTACAACGAGC-3′-Bm-ISfl-f и 5′-CACGGGCGACATCACGAACA-3′-Bm-ISfl-r. Флуоресцентно-меченый зонд имеет следующую структуру: Bm-ISfl-Pr 5′ (FAM)-GGGCGTGAAGCTCGTTGACCTGCCC-(BHQ1) 3′, где FAM - карбоксифлуоресцеин, флуоресцентный краситель, длина волны поглощения которого составляет 490 нм, а BHQ1 - гаситель флуоресценции с диапазоном гашения 480-580 нм. Предложенное изобретение позволяет с высокой чувствительностью и специфичностью детектировать возбудителя сапа и дифференцировать его от возбудителя мелиоидоза в пробах чистых культур и биологическом материале. 1 ил., 1 табл., 3 пр.

Изобретение касается набора флуоресцентно-меченых олигонуклеотидных зондов для типирования штаммов Burkholderia mallei. Входящие в состав набора зонды имеют структуру «шпильки» с флуорофором и гасителем флуоресценции на концах и обладают комплементарностью к продуктам реакции амплификации с праймерами. Разработанный набор гибридизационных зондов может быть использован для флуоресцентной детекции результатов типирования возбудителя сапа методом амплификации дифференцирующих фрагментов генома при осуществлении эпидемиологического надзора за сапной инфекцией и обеспечивает возможность одновременного анализа девяти DFR-локусов. 2 ил., 1 табл., 3 пр.

Изобретение относится к биотехнологии, а именно к способу детекции нуклеиновокислотной последовательности-мишени из ДНК или смеси нуклеиновых кислот с использованием праймера, генерирующего сигнал от мишени (TSG-праймера). Способ включает гибридизацию нуклеиновокислотной последовательности-мишени с TSG-праймером, который содержит гибридизующуюся нуклеотидную последовательность, комплементарную нуклеиновокислотной последовательности-мишени, и репортерную молекулу и молекулу-гаситель. TSG-праймер не является структурой петля-шпилька. В случае если TSG-праймер не гибридизуется с нуклеиновокислотной последовательностью-мишенью, то репортерная молекула и молекула-гаситель пространственно располагаются близко друг к другу без образования структур петля-шпилька, что позволяет молекуле-гасителю гасить сигнал от репортерной молекулы. В случае если TSG-праймер гибридизуется с нуклеиновокислотной последовательностью-мишенью, то репортерная молекула и молекула-гаситель пространственно разделяются, что не позволяет молекуле-гасителю гасить сигнал от репортерной молекулы, в результате чего генерируется и выявляется сигнал, указывающий на присутствие нуклеиновокислотной последовательности-мишени. Приведение в контакт продукта с матричной полимеразой нуклеиновых кислот в условиях удлинения праймера так, что реакция 3′-удлинения индуцируется по 3′-концу TSG-праймера. Детекция сигнала, указывающего на присутствие нуклеиновокислотной последовательности-мишени. Предложенное изобретение позволяет с высокой чувствительностью и специфичностью детектировать нуклеиновокислотную последовательность-мишень. 3 н. и 18 з.п. ф-лы, 21 ил., 7 пр.

Изобретение относится к биотехнологии, а именно к способу идентификации микобактерий туберкулеза кластера Beijing B0/W148. Применяют полимеразную цепную реакцию для амплификации фрагментов ДНК М. tuberculosis с подобранными праймерами P1, Р2 и Р3, последовательности которых представлены SEQ ID NO 1, 2, 3, соответственно, в режиме амплификации 98°C - 10 мин, 30 циклов: 98°C - 30 с, 64°C - 30 с, 72°C - 50 с, 72°C - 10 мин, 4°C. Проводят разделение продуктов амплификации электрофорезом в 2% агарозном геле. В случае получения фрагмента размером 1021 пн определяют штамм микобактерий туберкулеза кластера Beijing B0/W148. Предложенное изобретение позволяет быстро и с высокой специфичностью идентифицировать микобактерии туберкулеза кластера Beijing B0/W148. 3 ил.
Изобретение касается набора олигонуклеотидных праймеров и зондов для идентификации и субтипирования ДНК бактерии Pasteurella multocida серотипов А, B, D, E, F методом ПЦР в режиме реального времени. Изобретение может быть использовано в генетической инженерии и ветеринарной практике для выявления генетического материала (ДНК) бактерии P. multocida указанных серотипов. 2 ил., 5 табл., 2 пр.
Изобретение относится к области биотехнологии и касается способа выявления и генотипирования бактерии Pasteurella multocida. Предложенный способ включает проведение ПЦР с электрофоретической детекцией результатов, перенос продукта амплификации на гель и оценку проведения реакции. При этом исследование каждой пробы проводят в двух реакциях с помощью праймеров. В первой реакции выявляют бактерию Pasteurella multocida и генотипируют серогруппы А и D, во второй реакции генотипируют серогруппы В, Ε и F. Способ позволяет выявлять и генотипировать штаммы и изоляты бактерии Pasteurella multocida пяти серогрупп - A, B, D, E, и F в чистых или смешанных культурах, а также непосредственно в пробах биологического материала от животных. Способ может быть использован в ветеринарной микробиологии для диагностики пастереллеза сельскохозяйственных животных. 4 табл., 4 пр.
Изобретение относится к области биохимии, в частности к набору олигонуклеотидных зондов для диагностики популяции людей, проживающих на территории РФ, на наследственные моногенные заболевания, путем выявления мутаций и/или полиморфизмов. Также заявлены способ получения ДНК-микрочипа, набор для исследования популяции людей, а также способ детекции ассоциированных с наследственными моногенными заболеваниями мутаций и/или полиморфизмов, в которых используется указанный набор олигонуклеотидных зондов. Изобретение позволяет повысить информативность, точность и сократить сроки исследования. 4 н.п. ф-лы, 3 табл., 3 пр.

Изобретение относится к области биохимии, в частности к способу выявления устойчивых к пиразииамиду изолятов Mycobacterium tuberculosis, путем определения наличия мутаций в гене pncA, ассоциированных с формированием устойчивости к пиразинамиду, посредством проведения ПЦР в режиме «реального времени» с использованием HRM-анализа. При этом проводят амплификацию на смеси равного количества тестируемой ДНК и ДНК дикого типа с использованием праймеров: Pnc18U: 5'-TACGCTCCGGTGTAGGCAC-3' и Pnc15R: 5'-GAAGCGGCGGACTACCATC-3', формируют гетеродуплексы за счет одновременной коамплификации ДНК дикого типа и тестируемой ДНК, при этом на первом этапе ПЦР проводят уравнивание концентрации с помощью количественной ПЦР с использованием той же пары праймеров (Pnc18U/Pnc15R) с построением калибровочной кривой и использованием регрессионного уравнения. Изобретение благодаря высокой специфичности и чувствительности позволяет надежно и быстро определить тип мутаций в гене pncA, ассоциированных с возникновением устойчивости к пиразинамиду.1 ил.

Изобретение относится к биотехнологии, а именно к cпособу дифференциации типичных и атипичных штаммов Yersinia pestis основного подвида средневекового биовара. Способ предусматривает проведение в двух реакционных смесях ПЦР с гибридизационно-флуоресцентным учетом результатов с использованием соответствующих олигонуклеотидных праймеров и зондов на ДНК-мишени «Med24» и «pCKF» следующего состава: праймеры прямой Med24 RealTime-S GCCAGTGTGTGTCTAAA, обратный Med24 RealTime-As CAACATTCGTCGCAAAG и зонд Med24 Zond FAM-ACATTGTGCTGGACTCACAGCCCC-BHQ1, праймеры прямой pCKF RealTime-S AACCGCCTAAGCACTTTAT, обратный pCKF RealTime-As CGTCAGGAACTCAACGAA и зонд pCKF Zond FAM-ATCAGAGAGCATTTGAGCGGTTG-BHQ1. Разделяют типичные и атипичные штаммы средневекового биовара следующим образом: отсутствие гибридизационно-флуоресцентного сигнала по обеим ДНК-мишеням «Med24» и «pCKF» у типичных штаммов, наличие по обеим ДНК-мишеням «Med24» и «pCKF» у атипичных штаммов, наличие ДНК-сигнала по «Med24» и отсутствие по «pCKF» у штаммов, не относящихся к штаммам средневекового биовара. 1 ил., 1 табл., 3 пр.

Наверх