Способ моделирования пролиферативной витреоретинопатии у крыс

Изобретение относится к медицине, в частности к экспериментальной офтальмологии, и предназначено для получения модели пролиферативной витреоретинопатии. Для этого крысам в полость стекловидного тела глаза вводят 2 мкл раствора диспазы, содержащего фермент в дозе 0,03U. Устанавливают признаки витреоретинопатии через 6 недель после введения фермента. Способ позволяет получить адекватную модель заболевания. 3 ил., 1 пр.


Область техники

Изобретение относится к области медицины, в частности к офтальмологии, и может быть использовано при разработке методов профилактики и лечения пролиферативной витреоретинопатии (ПВР).

Уровень техники

ПВР - это глазная патология, которая может возникать вследствие травмы, диабетической ретинопатии и регматогенной отслойки сетчатки. ПВР характеризуется пролиферацией клеток пигментного эпителия, глиальных, макрофагов и фибробластов на поверхности сетчатки, что приводит к образованию мембран. В среднем через 2 недели с момента начала ПВР у клеток, образующих мембраны, появляется сократительная способность, что соответствует следующей фазе процесса - формированию фиксированных складок отслоенной сетчатки с выраженным ее укорочением. ПВР является наиболее распространенной причиной рецидива отслойки сетчатки после хирургического лечения. Гемофтальм способствует разрастанию эпиретинальных мембран.

Профилактика и консервативное лечение этой патологии не разработаны. Весьма перспективным является разработка лечения на экспериментальных моделях.

Известны два типа моделирования ПВР: первый заключается во введении в стекловидное тело различных видов клеток (Sugita G. et al. Intravitreal autotransplantation of fibroblasts. // Am J Ophthalmol. 1980. Vol. 89, №LP. 121-130. Fastenberg D. et al. A comparison of different cellular inocula in an experimental model of massive periretinal proliferation. // Am. J. Ophthalmol. 1982. Vol. 93, №5. P. 559-564. Hui Y.N., Sorgente N., Ryan S. Posterior vitreous separation and retinal detachment induced by macrophages // Graefe′s Arch. Clin. Exp.Ophthalmol. 1987. Vol. 225. P. 279-284. Garcia-Layana A. et al. Porcine model of proliferative vitreoretinopathy with platelets // Curr Eye Res. 1997. Vol.16, №6. P. 556-563), второй требует хирургических манипуляций с глазом (Chinn С.et al. Strain-dependent gene expression in a lens extraction PVR model // Invest Ophthalmol Vis Sci. 2005. Vol. 46. P. E-Abstract 5528. Cleary P., Ryan S.. Experimental posterior penetrating eye injury in the rabbit. II. Histology of wound, vitreous, and retina. // Br J Ophthalmol. 1979. Vol. 63, №5. P. 312-321).

Метод введения в стекловидное тело клеток имеет следующие недостатки:

1. Вводится один тип клеток (фибробласты, тромбоциты, макрофаги или клетки пигментного эпителия), хотя исследования последних лет показали, что образование эпиретинальных мембран является результатом одновременной пролиферации различных типов клеток, в том числе и глиальных. Таким образом, введение одного типа клеток значительно отличает модель ПВР от клинических проявлений.

2. Пролиферация клеток в процессе образования мембран - это следствие, а не первое звено процесса. К пролиферации могут приводить следующие факторы: воспаление внутри глаза, нарушение гематоофтальмического барьера, травма, нарушение целостности сетчатки. Таким образом, введение клеток в стекловидное тело не отражает особенности патогенеза заболевания.

Метод моделирования ПВР с использованием различных хирургических манипуляций (удаление хрусталика и стекловидного тела, криопексия, отслоение сетчатки или ее удаление, проникающая травма глаза) приводит к сильному повреждению глаза и нарушению его строения и целостности. Эти модели могут быть использованы для изучения развития ПВР только при конкретных патологиях глаза.

Из уровня техники известен способ моделирования пролиферативной витреоретиноатии, предложенный Frenzel Е.М. и соавт.(Frenzel Е.М. et al. A new model of proliferative vitreoretinopathy. // Invest. Ophthalmol. Vis. Sci. 1998. Vol. 39, №11. P. 2157-2164). Недостатком способа является то, что в качестве экспериментального животного был выбран кролик. Строение сетчатки у кролика достаточно сильно отличается от сетчатки человека. Часть сетчатки кролика аваскулярна: только ее небольшая часть, в непосредственной близости от диска зрительного нерва, имеет двойной источник кровообращения, вся остальная сетчатка получает питание исключительно из хориоидеи. Также у кролика различные участки слоя клеток пигментного эпителия имеют разную форму и нерегулярное расположение, в отличие от регулярного гексагонального пигментного эпителия сетчатки человека. У кролика, в отличие от человека, отсутствует истинная фовеа, но имеются полосы повышенной остроты зрения с повышенной плотностью фоторецепторов и ганглиозных клеток. Так как в процессе формирования ПВР задействованы пигментный эпителий, слой ганглионарных клеток сетчатки и сосудистое русло глаза, то такие их значительные отличия в строении от человека могут играть выраженную роль в изменении процесса развития мембран. Процесс создания модели также отличается длительностью - 10 недель.

Наиболее близким к заявляемому решению является способ моделирования пролиферативной витреоретинопатии, предложенный Тихонович М.В. и соавт. (Тихонович М.В. и др. Влияние неселективного блокатора циклооксигеназ на развитие эпиретинального фиброза в моделях необратимой ишемии глаза и диспазовызванной пролиферативной витреоретинопатии. Механизмы функционирования висцеральных систем. Санкт-Петербург, 2012, с. 238). В данной публикации представлена информация о влиянии противовоспалительных средств на состояние сетчатки глаза крыс при внутриглазной инъекции диспазы. Однако в опубликованных материалах отсутствуют дозы вводимого фермента и морфологические критерии изменения сетчатки, которые предложены в настоящем изобретении по итогам проведенных исследований. Целью проведенных дополнительных исследований являлась отработка модели, касающейся сроков развития и клинической картины изменения, которые были приближены к таковым у людей. При этом были использованы несколько доз фермента и взяты разные сроки для разработки морфологических критериев оценки. Предлагаемая в заявляемом решении доза вызывает деструкцию сетчатки, а противовоспалительная терапия зрительно улучшает состояние глаза.

Раскрытие изобретения

Задачей изобретения является создание нового способа моделирования пролиферативной витреоретинопатии у крыс, которая будет вызвана эндогенными клетками и факторами, добиться высокой результативности и стабильности получаемого результата, а именно разрастания на поверхности сетчатки мембран в относительно короткие сроки. Это достигается за счет введения в витреальную полость глаза крысы водного раствора протеолитического фермента диспазы, что приводит к развитию воспаления в глазу и нарушению гематоофтальмического барьера.

Техническим результатом изобретения является получение ПВР в глазу крыс, отражающей патогенез процесса, близкий к изменениям у человека, сокращение длительности эксперимента и стабильность получаемого результата.

Технический результат достигается за счет использования протеолитического фермента, способного расщеплять межклеточные контакты и внутреннюю пограничную мембрану сетчатки, что активирует клеточную пролиферацию и нарушает целостность сосудистой стенки.

Согласно настоящему изобретению способ моделирования пролиферативной витреоретинопатии у крыс характеризуется тем, что в полость стекловидного тела глаза крысы вводят 2 мкл раствора протеолитического фермента диспазы в концентрации 0,03U, при этом образование мембран на поверхности сетчатки наблюдается через 6 недель после введения фермента.

Через 6 недель после введения фермента может быть проведена энуклеация глаза для последующего гистологического анализа образовавшихся на поверхности сетчатки мембран.

Диспаза используется для создания микроокружения между сетчаткой и стекловидным телом, в котором формируется мембрана, сокращающаяся и приводящая к отслойке сетчатки, что очень похоже на процесс ПВР у человека. Фермент расщепляет фибронектин, коллаген IV и, в меньшей степени, коллаген I. Диспаза обеспечивает активный пролиферативный процесс на поверхности сетчатки. Разрушение внутренней пограничной мембраны сетчатки и нарушение межклеточных контактов в ее слоях приводят к активации воспалительного процесса и пролиферации глиальных клеток, фибробластов и иммунных клеток. Нарушение гематоофтальмического барьера - это второй ключевой момент, приводящий к развитию ПВР. Кровь является источником различных цитокинов, которые стимулируют миграцию и пролиферацию вышеупомянутых клеток. Запущенные воспалительные процессы приводят к еще большему нарушению гематоофтальмического барьера. Получается замкнутый патологический круг развития ПВР.

Краткое описание чертежей

Изобретение поясняется фигурами 1-3.

На фиг. 1 изображена эпиретинальная мембрана, образовавшаяся на поверхности сетчатки в ответ на введение диспазы в витреальную полость, на фиг. 2 изображена эпиретинальная мембрана с более выраженной волокнистой структурой, приводящая к образованию складок сетчатки, на фиг. 3 - отслойка сетчатки.

Позицией 1 обозначена сетчатка, позицией 2 - эпиретинальная мембрана, позицией 3 - хрусталик, позицией 4 - стекловидное тело, позицией 5 - складчатость сетчатки, позицией 6 - отслойка сетчатки.

Осуществление изобретения

Способ осуществляется следующим образом:

1. Все манипуляции выполняли на наркотизированных хлоралгидратом крысах популяции Rattus norvegicus (400 мг/кг внутрибрюшинно).

2. В правый глаз крысы закапывали местный анестетик Алкаин 0,5% (Alcon), зрачок расширяли с помощью 1,0% раствора Тропикамида (Ромфарм компани), в качестве антисептика использовали Витабакт 0,05% (Novartis).

3. Диспазу, разведенную в изотоническом растворе, концентрацией 0,03U в объеме 2 мкл вводили в витреальную полость через прокол в плоской части цилиарного тела иглой 30G.

Предложенный способ применен в эксперименте на 15 крысах. У всех экспериментальных животных получен идентичный результат - формирование ПВР, подтвержденное гистологическим исследованием.

После эксперимента клиническое наблюдение проводилось в течение 1, 6 и 8 недель. После производили энуклеацию глаза и декапитацию животного. Глаза фиксировали в растворе Дэвидсона и подвергали гистологическому исследованию. После фиксации глаза обезвоживались в спиртах восходящей концентрации и заливались в парафин. Парафиновые срезы окрашивались гематоксилин-эозином. Клинически после введения диспазы в глаз экспериментальных животных в первые три дня отмечался легкий мидриаз, в стекловидном теле у 70% животных отмечался гемофтальм. Через 6 недель у 100% крыс наблюдалось образование выраженных эпиретинальных мембран, у 60% - отслойка сетчатки, гемофтальм был в 25% глаз, а катаракта к 8 недели эксперимента наблюдалась у 75%.

В качестве контроля мы использовали крыс (N =15), которые получили инравитреальную инъекцию изотонического раствор хлорида натрия (0,9%). У этих крыс на протяжении всего эксперимента не наблюдалось развития ПВР.


Крыса №12. Под общим обезболиванием в правый глаз инстилировали алкаин 0,5%, тропикамид 1,0% и витабакт 0,05%. Диспазу, разведенную в изотоническом растворе, концентрацией 0,03U в объеме 2 мкл ввели в витреальную полость через прокол в плоской части цилиарного тела иглой 30G. В послеоперационном периоде, в первые дни, наблюдался небольшой мидриаз, в стекловидном теле - плавающие помутнения. Через шесть недель в стекловидном теле формировались тяжи, складчатость сетчатки, ограниченная ее отслойка. Роговица не изменена. Заднекапсулярная катаракта.

Гистологически. В стекловидном теле вблизи внутренней поверхности сетчатки - уплотнение структур кортикальных слоев. В заднем отделе глаза множественные очаги ПВР, под которыми выявлялась зона разрушения внутренней пограничной мембраны, пролиферация клеток ганглионарного слоя, наряду с клеточными элементами в мембранах определялись волокнистые структуры (фиг. 1).

Контрактильные свойства в новообразованной эпиретинальной мембране проявлялись в формировании складок и очагов отслоенной сетчатки (фиг. 2, 3).

Патогистологический диагноз: Пролиферативная витреоретинопатия. Отслойка сетчатки.

Способ моделирования пролиферативной витреоретинопатии (ПВР) у крыс путем введения в полость стекловидного тела глаза крысы раствора протеолитического фермента диспазы, отличающийся тем, что вводят 2 мкл раствора, содержащего диспазу в дозе 0,03U, и устанавливают признаки ПВР через 6 недель после введения фермента.


Похожие патенты:
Изобретение относится к медицине, в частности к экспериментальной хирургии. Для моделирования инфравезикальной обструкции у мелких животных проводят перевязку уретры.
Изобретение относится к экспериментальной медицине, травматологии и ортопедии, хирургическому лечению травматических повреждений спинного мозга с одновременным ускорением его регенерации.

Изобретение относится к медицине, в частности к экспериментальной патофизиологии и трансплантологии, и касается моделирования посттрансплантационных изменений почки.

Изобретение относится к экспериментальной медицине и касается разработки тактики лечения химических ожогов пищевода и желудка. Для этого у лабораторных крыс моделируют химический ожог.

Изобретение относится к области испытаний изделий медицинской техники, а именно к вопросу производственных испытаний эндопротезов суставов с металлической парой трения, состояние которой в процессе испытаний оценивается с применением электрических (электрорезистивных) методов диагностирования.

Изобретение относится к экспериментальной фармакологии и экспериментальной хирургии и может быть использовано для стимуляции регенерации резецированной печени.

Изобретение относится к медицине, а именно к сосудистой хирургии, и может быть использовано при разработке способов лечения хронических облитерирующих заболеваний артерий нижних конечностей.

Изобретение относится к медицине, экспериментальной биологии и может быть использовано для моделирования экспериментальной амилоидной кардиопатии у животных. Способ заключается в однократном введении старым крысам-самцам смеси, состоящей из гомогенезированной ткани миокарда крыс - 25%, яичного альбумина - 25% и адъюванта Фрейнда - 50%.

Изобретение относится к рентгеноскопии, а именно к элементам медицинской рентгенодиагностики. Тест-фантом состоит из двух частей, образующих единое целое.

Изобретение относится к медицине, в частности к гастроэнтерологии, патофизиологии, и касается моделирования острого панкреатита. Для этого способ включает лигирование основного ствола выводного протока поджелудочной железы, введение в систему протоков поджелудочной железы агрессивного раствора для проявления панкреатита, удаление лигатуры.

Изобретение относится к биотехнологии. Описан способ ингибирования тромбообразования и ускорения фибринолиза с помощью ДНК аптамеров (олигонуклеотидов), ингибирующих активность тромбина. В способе использован ДНК аптамер, характеризующийся нуклеотидной последовательностью GTGACGTAGGTTGGTGTGGTTGGGGCGTCAC и конъюгированный по 5′ или 3′ концу с NH2 группой и/или с полиэтиленгликолем (PEG), и отвечающий общей формуле d-R-GTGACGTAGGTTGGTGTGGTTGGGGCGTCAC-R, где d - дезоксирибоза, при этом олигонуклеотид содержит дезоксирибозу во всех позициях, R - NH2 группа и/или PEG. Изобретение может быть использовано для повышения эффективности антитромботической и фибринолитической терапии. 4 ил., 3 пр.

Изобретение относится к медицине, в частности к экспериментальной фармакологии и экспериментальной хирургии, и может быть использовано для стимуляции регенерации резецированной печени. Для этого лабораторному животному на вторые сутки эксперимента осуществляют резекцию печени в объеме 70%. Для стимуляции регенерации печени животному вводят внутрижелудочно дигидрокверцитин в суточной дозе 5,5 мг/кг каждые 46 часов первые 7 суток эксперимента. Способ обеспечивает восстановление объема, структуры и функции резецированного органа до 28 суток после резекции. 1 пр., 2 табл.
Изобретение относится к медицинской технике, а именно к устройствам формирования медицинских умений и навыков. Система содержит медицинский симулятор организма человека, включающий имитаторы функциональных систем и органов, датчики измерения и контроля текущего состояния имитаторов и их положения в симуляторе, связанные мультиплексором с блоком управления симулятором, содержащим процессор с блоком установок значений нормы и патологии, корректором степени патологического состояния функциональных систем и органов и логическим блоком оценки правильности действий обучаемого и блоком корректировок, выполненным с возможностью внесения корректировок в оценку профессиональных умений и навыков и связанным с блоком инструктора, выполненным с возможностью формирования заданий и их корректировки в имитаторе функциональных систем и органов медицинского симулятора, и монитор компьютера обучаемого, связанный с блоком инструктора. Медицинский симулятор организма снабжен исполнительными механизмами формирования движения и положения имитаторов функциональных систем и органов, связанными с процессором и выполненными с возможностью формирования движения и положения имитаторов в состоянии нормы или патологии, и электронными нормирующими преобразователями сигналов, связанными с датчиками измерения. Использование изобретения позволяет сократить время формирования умений и навыков работы медицинских специалистов.

Изобретение относится к экспериментальной фармакологии и экспериментальной хирургии и может быть использовано для стимуляции регенерации резецированной печени. Для этого лабораторному животному на вторые сутки эксперимента осуществляют резекцию печени в объеме 70%. В качестве средства, обеспечивающего регенерацию печени, используют L-аргинин, который вводят внутрижелудочно в суточной дозе 200,0 мг/кг каждые 46 часов первые 7 суток эксперимента. Способ обеспечивает полное восстановление объема, структуры и функции резецированной печени. 1 пр., 2 табл.

Изобретение относится к медицине, а именно к экспериментальной фармакологии и сосудистой хирургии, и может быть использовано при лечении критической ишемии конечности. Для этого моделируют острую ишемию конечности у крыс-самцов линии Вистар путем иссечения участка магистральных сосудов, включающего бедренную артерию, подколенную артерию и начальные отделы артерий голени. Операцию проводят под наркозом хлоралгидратом в дозе 250-300 мг/кг. На протяжении 5 дней непосредственно после операции проводят интраперитонеальное введение препарата "Актовегин" в дозе 50 мкг/кг ежедневно 1 раз в сутки. Способ обеспечивает стимуляцию неоангиогенеза и активацию развития коллатерального кровотока в ишемизированной конечности и улучшение таким образом артериального притока крови из проксимальных отделов конечности в дистальные. 1 пр., 1 табл.

Изобретение относится к медицине, а именно к экспериментальной гнойной хирургии, и может быть использовано для моделирования абсцесса печени. Для этого крысе линии Wistar под ультразвуковым контролем проводят чрескожную пункцию печени в определенной точке. Для ее нахождения отмечают линию №1 - срединную линию, соответствующую анатомически срединной плоскости крысы; линию №2 - перпендикулярную первой, соединяющую наиболее нижние точки левой и правой реберной дуг, замеряют и делят на три равные части отрезок линии №2, идущий от точки пересечения линий №1 и №2 до левой реберной дуги. Выбирают точку пункции на границе внутренней и средней третей данного отрезка. Иглу вводят перпендикулярно к поверхности на глубину в 1.2 см. В качестве препарата, вызывающего некроз ткани печени с формированием полости, вводят 0.3 мл водного раствора трипсина с концентрацией 1 мг/мл. Затем стафилококковый гной вводят через 2 суток в объеме 0.5 мл, содержащем 1 млн KOE. Перекрывают просвет на 5 суток с последующим ультразвуковым контролем. Использование изобретения упрощает и удешевляет формирование абсцессов печени, предотвращает побочное действие на организм лабораторного животного, ведущее к его гибели. 1 з.п. ф-лы, 5 ил.
Изобретение относится к медицине, к экспериментальной онкологии и может быть использовано в качестве модели фибромиомы матки. Моделирование проводят на самках кролика весом 3-4 кг введением серотонина. Препарат вводят внутрибрюшинно в 1-й день эксперимента в дозе 50-60 мкг/кг, на 5-й день - 75-85 мкг/кг, на 10-й день - 100-115 мкг/кг, на 20-й день - 150-170 мкг/кг и на 30-й день -200-230 мкг/кг. Устанавливают развитие фибромиомы спустя 3 месяца. Способ обеспечивает упрощение создание модели заболевания. 2 пр.

Изобретение относится к медицине, а именно к экспериментальным исследованиям в онкологии, и может быть использовано для оценки противоопухолевого действия наночастиц (НЧ) металлов. Для этого с 6-х суток после перевивки лимфосаркомы Плисса крысам-самцам осуществляют восьмикратное внутрибрюшинное или локально в опухоль введение суспензии наночастиц железа на физиологическом растворе в концентрации 1 мг/мл. Введение проводят на 6, 7, 9, 10, 14, 15, 16 и 17 сутки в разовой дозе 1,25 мг/кг массы животного. Способ позволяет достичь противоопухолевого действия НЧ без повышения токсичности их воздействия на организм. 2 табл.

Изобретение относится к медицине, в частности к экспериментальной токсикологии. И может быть использовано при исследовании механизмов токсического действия урана на функциональное состояние почек и других органов и систем при комбинированном воздействии. Для этого моделирование острого воздействия обедненным ураном у анестезированных крыс осуществляют однократным последовательным введением различных форм урана. В виде пыли смешанного оксида урана (U3O8) уран вводят в легкие в дозовом диапазоне по элементу от 1 до 100 мг 238U/кг массы тела. Внутрижелудочное введение растворенной в деионизированной воде соли шестивалентного урана вводят также в дозовом диапазоне по элементу от 1 до 100 мг 238U/кг массы тела. Накожное введение урана осуществляют в виде аппликации путем погружения хвоста животного на 2/3 его длины в раствор 0,5 г/л урана в течение 10-60 минут. Способ воспроизводит острое комбинированное воздействие обедненным ураном, близкое к таковому у человека в условиях военных конфликтов, а также в условиях проживания в эндемических зонах урановых месторождений и хранилищ. 1 пр., 5 табл.
Изобретение относится к медицине, в частности к экспериментальной онкологии, и может быть использовано в качестве модели опухоли толстой кишки. Для этого крысе в просвет общего желчного протока вводят пикрилсульфоновую кислоту в дозе 0,03-0.05 мл. Введение осуществляют 2-кратно с интервалом 5-10 дней. Способ обеспечивает создание модели зубчатой аденомы толстой кишки. 3 пр.

Изобретение относится к медицине, в частности к экспериментальной офтальмологии, и предназначено для получения модели пролиферативной витреоретинопатии. Для этого крысам в полость стекловидного тела глаза вводят 2 мкл раствора диспазы, содержащего фермент в дозе 0,03U. Устанавливают признаки витреоретинопатии через 6 недель после введения фермента. Способ позволяет получить адекватную модель заболевания. 3 ил., 1 пр.
