Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение



Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение
Антагонисты trpv1, включающие дигидроксигруппу в качестве заместителя, и их применение

Владельцы патента RU 2621708:

ШИОНОГИ ЭНД КО. ЛТД. (JP)
ПУРДЬЮ ФАРМА Эл. Пи. (US)

Изобретение относится к соединению формулы (I) или его фармацевтически приемлемой соли, в котором R1 представляет собой -гало или -CF3; R4 представляет собой -Н или -CH3; каждый из R8 и R9 независимо представляет собой -Н, -гало, -СН3 или -ОСН3, каждый гало независимо представляет собой -F, -Cl, -Br или -I; и m означает целое число 0 или 1; (1) при условии, что если R4 представляет собой -Н, то m означает 1; и (2) при условии, что если R4 представляет собой -Н и атом углерода в положении а связи а-b находится в (S)-конфигурации, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу; (3) при условии, что если R4 представляет собой -Н, атом углерода в положении а связи а-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой -гало, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу; (4) при условии, что если R4 представляет собой -Н, атом углерода в положении а связи а-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу; и (5) при условии, что если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи а-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой -гало, и m означает 1, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу. Изобретение также относится к соединению формулы (II) или его фармацевтически приемлемой соли, конкретному соединению формулы (Ia) или его фармацевтически приемлемой соли и/или сокристаллу фумаровой кислоты. Также изобретение относится к конкретным соединениям формулы (Ib) или его фармацевтически приемлемой соли. Соединения по изобретению предназначены для ингибирования TRPV1 функции в клетке и для лечения боли, боли, связанной с остеоартритом, остеоартрита, недержания мочи (UI), язвы, воспалительного заболевания кишечника (IBD) или синдрома раздраженного кишечника (IBS) у животного. Технический результат – соединения, обладающие сродством к рецептору TRPV1. 14 н. и 24 з.п. ф-лы, 11 табл., 3 ил., 16 пр.

,, ,

 

1. ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

Настоящее изобретение относится к соединениям формулы (I) и их фармацевтически приемлемым производным, композициям, содержащим эффективное количество соединения формулы (I), и способам лечения или профилактики болезненного состояния, такого как боль, например боль, связанная с остеоартритом, остеоартрита, UI (недержание мочи), язвы, IBD (воспалительное заболевание кишечника (inflammatory-bowel disease)) и IBS (синдром раздраженного кишечника (irRitable-bowel syndrome)), содержащим введение животному по показаниям эффективного количества соединения формулы (I).

2. УРОВЕНЬ ТЕХНИКИ

Боль является наиболее распространенным симптомом, по поводу которого пациентам требуется медицинский совет или лечение. Боль может быть острой или хронической. В то время как острая боль, как правило, носит самоограничивающий характер, хроническая боль сохраняется в течение трех месяцев или более и может приводить к значительным изменениям личности пациента, его образа жизни, функциональных возможностей и общего качества жизни (Foley, "Pain," в Cecil Textbook of Medicine, pp.100-107 (Bennett и Plum eds., 20th ed. 1996)).

Более того, хроническая боль может быть отнесена к ноцицептивной или к нейропатической. Ноцицептивная боль включает в себя боль, вызванную повреждением ткани, и воспалительную боль, такую как при артрите. Нейропатическая боль возникает в результате повреждения периферической или центральной нервной системы и поддерживается нарушенными соматосенсорными процессами. Существует большое количество доказательств, касающихся активности ваниллоидных рецепторов (Di Marzo et al., "Endovanilloid signaling in pain," Current Opinion in Neurobiology 12:372-379 (2002)) в отношении боли.

Ноцицептивную боль традиционно лечат введением неопиоидных анальгетиков, таких как ацетилсалициловая кислота, холинмагнийтрисалицилат, ацетаминофен, ибупрофен, фенопрофен, дифлузинал и напроксен; или опиоидных анальгетиков, включая морфин, гидроморфон, метадон, леворфанол, фентанил, оксикодон и оксиморфон (там же). В дополнение к вышеперечисленным схемам лечения, нейропатическая боль, которая может с трудом поддаваться лечению, также может лечиться противоэпилептическими средствами (например, габапентин, карбамазепин, вальпроевая кислота, топирамат, фенитоин), антагонистами NMDA (например, кетамин, декстрометорфан), топическим лидокаином (для постгерпетической невралгии) и трициклическими антидепрессантами (например, флуоксетин, сертралин и амитриптилин).

UI (недержание мочи) представляет собой неконтролируемое мочеиспускание, обычно вызываемое нестабильностью мышцы детрузора мочевого пузыря. UI страдают люди всех возрастов и состояния здоровья, как находящиеся в лечебных учреждениях, так и вне их.

Физиологическое сокращение мочевого пузыря большей частью определяется воздействием ацетилхолина на сайты постганглионарных мускариновых рецепторов гладкой мышцы мочевого пузыря. Лечение UI включает в себя введение лекарств, оказывающих расслабляющее действие на мочевой пузырь, и тем самым сдерживающих гиперактивность детрузора мочевого пузыря.

Ни один из существующих коммерческих препаратов не позволяет добиться полного излечения у пациентов с разными видами UI, также как и избежать значимых неблагоприятных побочных эффектов.

Лечение язвенной болезни часто включает уменьшение или подавление агрессивных факторов. Например, для нейтрализации кислот в желудке могут применяться антациды, такие как гидроксид алюминия, гидроксид магния, бикарбонат натрия и бикарбонат кальция. Однако антациды могут вызывать алкалоз, приводящий к тошноте, головной боли и слабости. Антациды также могут препятствовать всасыванию других лекарств в кровоток и быть причиной диареи.

H2-антагонисты, такие как циметидин, ранитидин, фамотидин и низатидин, также используются для лечения язв. H2-антагонисты, способствуют заживлению язвы, уменьшая секрецию желудочной кислоты и пищеварительного фермента, вызываемую гистамином и другими H2-агонистами, в желудке и двенадцатиперстной кишке. Однако H2-антагонисты могут быть причиной увеличения грудных желез и импотенции у мужчин, умственных расстройств (особенно у пожилых), головных болей, головокружения, тошноты, миалгии, диареи, сыпи и лихорадки.

Ингибиторы H+, K+-АТФазы, такие как омепразол и лансопразол, также применяются для лечения язв. Ингибиторы H+, K+-АТФазы подавляют выработку ферментов, используемых для секреции кислоты в желудке. Побочные эффекты, связанные с ингибиторами H+, K+-АТФазы, включают в себя тошноту, диарею, вызванные вздутием колики, головную боль, головокружение, сонливость, кожную сыпь и временное увеличение активности аминотрансфераз в плазме.

Воспалительное заболевание кишечника (inflammatory-bowel disease, "IBD") представляет собой хроническое заболевание, при которых развивается воспаление кишки, часто являющееся причиной повторяющихся спастических болей в животе и диареи. Выделяют два вида IBD - болезнь Крона и неспецифический язвенный колит.

Болезнь Крона, которая может включать в себя региональный энтерит, гранулематозный илеит и энтероколит, представляет собой хроническое воспаление кишечной стенки. Болезнью Крона в равной мере страдают пациенты обоих полов, наиболее часто евреи восточно-европейского происхождения. В большинстве случаев болезнь Крона дебютирует в возрасте до 30 лет и наиболее часто в возрасте от 14 до 24 лет. Заболевание часто поражает полную толщину стенки кишечника. Обычно заболевание поражает конечную часть тонкой кишки (подвздошная кишка) и толстую кишку, однако, возможно поражение пищеварительного тракта на любом участке.

Спазмы и диарея, побочные эффекты, связанные с болезнью Крона, могут быть купированы антихолинергическими препаратами, дифеноксилатом, лоперамидом, дезодорированной настойкой опия или кодеином.

В случаях, когда болезнь Крона вызывает обструкцию кишки или развитие не поддающихся лечению абсцессов и свищей, необходима операция с целью удаления пораженных участков кишки. Однако операция не приводит к излечению, воспалительный процесс имеет тенденцию рецидивировать в месте наложения межкишечного анастомоза. Почти в половине случаев необходимо повторное вмешательство. Berkow et al., eds., "Crohn's Disease," Merck Manual of Medical Information, pp.528-530 (1997).

Неспецифический язвенный колит представляет собой хроническое заболевание, при котором развивается воспаление толстой кишки с образованием язв, что проявляется эпизодами жидкого стула с кровью, спастических болей в животе и лихорадки. Неспецифический язвенный колит обычно дебютирует в возрасте от 15 до 30 лет, однако у небольшой группы людей первый приступ наблюдается в возрасте от 50 до 70 лет. В отличие от болезни Крона, неспецифический язвенный колит никогда не затрагивает тонкую кишку и не поражает стенку толстой кишки на всю ее толщину. Обычно болезнь начинается в прямой кишке и в сигмовидной ободочной кишке и со временем распространяется частично или на всю толстую кишку.

Причина неспецифического язвенного колита не известна.

Лечение язвенного колита направлено на сдерживание воспаления, уменьшение симптоматики и восполнение потерь жидкости и питательных веществ. При умеренно выраженной диарее назначают антихолинергические препараты и низкие дозы дифеноксилата или лоперамида. При более выраженной диарее применяют более высокие дозы дифеноксилата или лоперамида или дезодорированную настойку опия, кодеин.

Синдром раздраженной кишки (irRitable-bowel syndrome, "IBS") представляет собой расстройство моторики всего желудочно-кишечного тракта, проявляющееся болями в животе, запорами и/или диареей. Болезнь IBS поражает в три раза чаще женщин, чем мужчин. При IBS различные воздействия, такие как стресс, диета, лекарства, гормоны или раздражающие средства, могут приводить к нарушению сокращений желудочно-кишечного тракта. Во время эпизода IBS сокращения желудочно-кишечного тракта становятся более сильными и частыми, что приводит к ускоренному прохождению пищи и каловых масс по тонкой кишке, часто вызывая диарею. Болезненные спазмы являются результатом сильных сокращений толстой кишки и повышенной чувствительности болевых рецепторов толстой кишки.

Лечение IBS часто включает изменение рациона питания больного IBS. Больным IBS часто рекомендуют исключить бобовые, капусту, сорбитол и фруктозу. Диета с низким содержанием жиров и высоким содержанием пищевых волокон также может помочь некоторым больным IBS. Регулярная физическая активность также способствует нормализации деятельности желудочно-кишечного тракта. Лекарства, замедляющие моторику желудочно-кишечного тракта, такие как пропантелин, обычно не эффективны при лечении IBS. Антидиарейные препараты, такие как дифеноксилат и лоперамид, показаны при диарее. Berkow et al., eds., "IrRitable Bowel Syndrome," Merck Manual of Medical Information, pp.525-526 (1997).

Международная публикация № WO 98/31677 описывает класс ароматических аминов, полученных из циклических аминов, которые применяются в качестве антидепрессантов. Международная публикация № WO 01/027107 описывает класс гетероциклических соединений, которые являются ингибиторами обмена натрий/протон. Международная публикация № WO 99/37304 описывает замещенные оксазагетероциклические соединения, применяемые для ингибирования фактора Ха. Патент США №6248756, выданный Anthony et al., и международная публикация № WO 97/38665 описывают класс соединений, содержащих пиперидин, которые ингибируют фарнезилпротеинтрансферазы (Ftase). Международная публикация № WO 98/31669 описывает класс ароматических аминов, полученных из циклических аминов, применяемых в качестве антидепрессантов.

Международная публикация № WO 97/28140 описывает класс пиперидинов, полученных из 1-(пиперазин-1-ил)арил(окси/амино)карбонил-4-арил-пиперидина, которые применяются в качестве антагонистов рецептора 5-HT1Db. Международная публикация № WO 97/38665 описывает класс соединений, содержащих пиперидин, которые применяются в качестве ингибиторов фарнезилпротеинтрансферазы.

Патент США №4797419, выданный Moos et al., описывает класс соединений мочевины для стимулирования высвобождения ацетилхолина, и применяемых для лечения симптомов старческих когнитивных нарушений. Патент США №5891889, выданный Anthony et al., описывает класс замещенных пиперидиновых соединений, которые применяются в качестве ингибиторов фарнезилпротеинтрансферазы и фарнезилирования онкогенного белка Ras. Патент США №6150129, выданный Cook et al., описывает класс динитрогенных гетероциклов, применяемых в качестве антибиотиков. Патент США №5529998, выданный Habich et al., описывает класс бензооксазолил- и бензотиазолилоксазолидонов, применяемых в качестве антибактериальных средств.

Международная публикация № WO 01/57008 описывает класс производных 2-бензотиазолилмочевины, применяемых в качестве ингибиторов серин/треонин- и тирозинкиназ. Международная публикация № WO 02/08221 описывает арилпиперазиновые соединения, применяемые для лечения состояний хронической и острой боли, зуда и недержания мочи. Международная публикация № WO 00/59510 описывает аминопиримидины, применяемые в качестве ингибиторов сорбитолдегидрогеназы.

Японская патентная заявка №11-199573, выданная Kiyoshi et al., описывает производные бензотиазола, которые представляют собой агонисты нейрональных 5НТ3-рецепторов в нервной системе кишечника и применяются для лечения нарушений пищеварения и недостаточности поджелудочной железы. Немецкая заявка на патент №19934799, выданная Rainer et al., описывает хиральную смектическую жидкокристаллическую смесь, содержащую соединения с 2-мя соединенными (гетеро)ароматическими кольцами или соединения с 3-мя соединенными (гетеро)ароматическими кольцами.

Chu-Moyer et al., J. Med. Chem. 45:511-528 (2002) описывает гетероцикл-замещенные пиперазино-пиримидины, применяемые в качестве ингибиторов сорбитолдегидрогеназы. Khadse et al., Bull. Haff. Instt. 1(3):27-32 (1975) описывает 2-(N4-замещенные-N1-пиперазинил)-пиридо(3,2-d)тиазолы и 5-нитро-2-(N4-замещенные-N1-пиперазинил)бензотиазолы, применяемые в качестве антигельминтных агентов.

Публикация заявки на патент США № US 2004/0186111 А1 и Международная публикация № WO 2004/058754 А1 описывают класс соединений, которые применяются для лечения боли. Публикация заявки на патент США № US 2006/0199824 А1 и Международная публикация № WO 2005/009987 А1 описывают класс соединений, которые применяются для лечения боли. Публикация заявки на патент США № US 2006/0128717 А1 и Международная публикация № WO 2005/009988 А1 описывают класс соединений, которые применяются для лечения боли. Публикация заявки на патент США № US 2009/0170867 А1, US 2009/0170868 А1 и 2009/0176796 А1 и Международная публикация № WO 2008/132600 А2 описывают класс соединений, которые применяются для лечения боли.

Тем не менее, в данной области сохраняется явная потребность в новых лекарственных средствах, применяемых для лечения или профилактики боли, например боли, связанной с остеоартритом, остеоартрита, UI, язвы, IBD и IBS. Упоминание любой ссылки во 2-м разделе данной заявки не предполагает, что такая ссылка является приоритетной по отношению к данной заявке.

3. РАСКРЫТИЕ ИЗОБРЕТЕНИЯ

Первый объект изобретения относится к новым соединениям, которые обладают сродством к рецептору TRPV1.

В некоторых вариантах осуществления такие новые соединения обладают антагонистической активностью к рецептору TRPV1. В других вариантах осуществления такие новые соединения обладают частичной антагонистической активностью к рецептору TRPV1.

Некоторые новые соединения по изобретению может быть использованы для лечения животного, страдающего от боли, например, хронической или острой боли.

Другой объект изобретения относится к способам лечения хронической или острой боли у животного введением одного или нескольких соединений формулы (I) животному, нуждающемуся в таком лечении. В некоторых вариантах осуществления такие новые соединения формулы (I) эффективно лечат хроническую или острую боль у животного, вызывая меньше побочных эффектов или уменьшенные побочные эффекты по сравнению с ранее доступными соединениями.

Соединения формулы (I), которые раскрыты здесь:

или их фармацевтически приемлемое производное, где:

R1 представляет собой галоген или -CF3;

R4 представляет собой -Н или -СН3;

каждый R8 и R9 независимо представляет собой -Н, галоген, -СН3, -CF3, -ОСН3, -OCF3, -ОСН2СН3, -CH2OCH3 или -C(O)OR10;

R10 представляет собой -(C14)алкил;

каждый галоген независимо представляет собой -F, -Cl, -Br или -I; и

m означает целое число 0 или 1;

(1) при условии, что если R4 представляет собой -Н, то m означает 1; и

(2) при условии, что если R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (S)-конфигурации, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления, в связи с соединением формулы (I), дополнительно при условии, что:

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу;

(4) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу, и/или

(5) если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген и m означает 1, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу.

Соединения формулы (I) демонстрируют способность взаимодействовать с рецепторами TRPV1 и растворимы в водных растворах при рН 6,8 или рН 1,2.

Соединение формулы (I) или его фармацевтически приемлемое производное применяется для лечения или профилактики боли, например, боли, связанной с остеоартритом, остеоартрита, UI, язвы, IBD или IBS (каждое из которых называется "болезненным состоянием") у животного.

Настоящее изобретение также относится к композициям, содержащим эффективное количество соединения формулы (I) или его фармацевтически приемлемого производного и фармацевтически приемлемый носитель или наполнитель. Композиции применяются для лечения или профилактики болезненного состояния у животного.

Настоящее изобретение дополнительно относится к способам лечения болезненного состояния, содержащим введение животному по показаниям эффективного количества соединения формулы (I) или его фармацевтически приемлемого производного.

Изобретение дополнительно относится к соединению формулы (I), его фармацевтически приемлемому производному, композиции, содержащей соединение формулы (I), и/или композиции, содержащей фармацевтически приемлемое производное соединения формулы (I), для применения в лечении боли, например, боли, связанной с остеоартритом, остеоартрита, UI, язвы, IBD или IBS у животного.

Изобретение дополнительно относится к применению соединения формулы (I) или его фармацевтически приемлемого производного в производстве лекарственного средства для лечения и/или профилактики такого болезненного состояния, как боль и/или остеоартрит.

Изобретение дополнительно относится к соединению формулы (I) или его фармацевтически приемлемому производному для применения в лечении и/или профилактике такого болезненного состояния, как боль и/или остеоартрит.

Изобретение дополнительно относится к способам профилактики болезненного состояния, содержащим введение животному по показаниям эффективного количества соединения формулы (I) или его фармацевтически приемлемого производного.

Изобретение дополнительно относится к способам ингибирования функции рецептора Transient Receptor Potential Vanilloid 1 ("TRPV1", ранее известного как ваниллоидный рецептор 1 или VR1) в клетке, содержащим контактирование клетки, способной экспрессировать TRPV1, с эффективным количеством соединения формулы (I) или его фармацевтически приемлемым производным.

Кроме того, изобретение дополнительно относится к способу получения композиции, содержащей стадию смешения соединения формулы (I) или его фармацевтически приемлемого производного и фармацевтически приемлемого носителя или наполнителя. Кроме того, изобретение дополнительно относится к набору, содержащему контейнер, содержащий эффективное количество соединения формулы (I) или его фармацевтически приемлемого производного.

В одном варианте осуществления предпочтительные соединения формулы (I) представляют собой соединения формулы (II):

или их фармацевтически приемлемое производное, где:

R4 представляет собой -Н или -СН3;

R8 представляет собой -Н, -F или СН3;

R9 представляет собой -Н, галоген, -СН3, -CF3, -ОСН3, -OCF3, -ОСН2СН3, -CH2OCH3 или С(O)ОСН2СН3; и

каждый галоген независимо представляет собой -F, -Cl, -Br или -I;

(1) при условии, что если R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (S)-конфигурации, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления, в связи с соединением формулы (II), дополнительно при условии, что:

(2) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3 -метильную группу;

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу, и/или

(4) если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу.

Многие соединения формулы (II) растворимы, в некоторых случаях хорошо растворимы, в водных растворах при рН 6,8 или рН 1,2, демонстрируют способность взаимодействовать с рецепторами TRPV1, перорально биодоступны, имеют хороший терапевтический индекс и считаются весьма эффективными при лечении боли и/или остеоартрита у животных. Более того, соединения формулы (II) способны к облегчению нежелательных побочных эффектов, таких как увеличение температуры тела, которые могут возникнуть при введении in vivo некоторых соединений, которые модулируют рецептор TRPV1.

Изобретение может быть понято более полно с помощью отсылки на следующее подробное описание и иллюстративные примеры, которые предназначены для иллюстрирации неограничивающих вариантов осуществления изобретения.

3.1. КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На фигуре 1 показана порошковая рентегенограма (Power X-Ray Diffraction, PXRD) (CuKα-излучение) продукта, приготовленного с соединением А155(а) и фумаровой кислотой.

На фигуре 2 изображены 15N ЯМР CP/MAS спектры продукта, приготовленного с соединением А155(а) и фумаровой кислотой, дигидрохлоридной солью соединения А155(а) и соединением А155(а) в виде свободного основания.

На фигуре 3 изображен 13C ЯМР CP/MAS спектр продукта, приготовленного с соединением А155(а) и фумаровой кислотой.

4. ОСУЩЕСТВЛЕНИЕ ИЗОБРЕТЕНИЯ

Настоящее изобретение включает в себя следующее:

(1.) Соединение формулы (I):

или его фармацевтически приемлемое производное, в котором:

R1 представляет собой галоген или -CF3;

R4 представляет собой -Н или -СН3;

каждый R8 и R9 независимо представляет собой -Н, галоген, -СН3, -CF3, -ОСН3, -OCF3, -ОСН2СН3, -CH2OCH3 или -С(O)OR10;

R10 представляет собой -(C14)алкил;

каждый галоген независимо представляет собой -F, -Cl, -Br или -I; и

m означает целое число 0 или 1;

(1) при условии, что если R4 представляет собой -Н, то m означает 1; и

(2) при условии, что если R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (S)-конфигурации, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу.

(2.) Соединение по приведенному выше (1.) или его фармацевтически приемлемое производное, в котором дополнительно при условии, что:

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу;

(4) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу, и/или

(5) если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген и m означает 1, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу.

(3.) Соединение по приведенному выше (1.) или (2.) или его фармацевтически приемлемое производное, в котором R1 представляет собой -F, -Cl или -CF3.

(4.) Соединение по любому из вышеупомянутых пунктов от (1.) до (3.) или его фармацевтически приемлемое производное, в котором R1 представляет собой -F.

(5.) Соединение по любому из вышеупомянутых пунктов от (1.) до (4.) или его фармацевтически приемлемое производное, в котором R10 представляет собой -СН3 или -СН2СН3.

(6.) Соединение по любому из вышеупомянутых пунктов от (1.) до (5.) или его фармацевтически приемлемое производное, в котором R10 представляет собой -СН2СН3.

(7.) Соединение по любому из вышеупомянутых пунктов от (1.) до (6.) или его фармацевтически приемлемое производное, в котором R9 представляет собой -Н, -F, -Cl, -Br, -СН3, CF3, -ОСН3, OCF3, -OCH2CH3, -CH2OCH3 или -С(O)ОСН2СН3.

(8.) Соединение по любому из вышеупомянутых пунктов от (1.) до (7.) или его фармацевтически приемлемое производное, в котором R8 представляет собой -Н, -F или -СН3.

(9.) Соединение по любому из вышеупомянутых пунктов от (1.) до (8.) или его фармацевтически приемлемое производное, в котором R8 представляет собой -F или -СН3.

(10.) Соединение по любому из вышеупомянутых пунктов от (1.) до (9.) или его фармацевтически приемлемое производное, в котором R9 представляет собой -Н.

(11.) Соединение по любому из вышеупомянутых пунктов от (1.) до (10.) или его фармацевтически приемлемое производное, в котором R4 представляет собой -СН3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

(12.) Соединение по любому из вышеупомянутых пунктов от (1.) до (10.) или его фармацевтически приемлемое производное, в котором R4 представляет собой -СН3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

(13.) Соединение по любому из вышеупомянутых пунктов (1.) до (10.) или его фармацевтически приемлемое производное, в котором R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (S)-конфигурации.

(14.) Соединение по любому из вышеупомянутых пунктов от (1.) до (10.) или его фармацевтически приемлемое производное, в котором R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (R)-конфигурации.

(15.) Соединение по любому из вышеупомянутых пунктов от (1.) до (14.) или его фармацевтически приемлемое производное, в котором m означает 1 и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу.

(16.) Соединение по вышеупомянутому пункту от (1.) до (15.), в котором фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, меченную радиоактивным изотопом форму, сокристалл или их комбинацию.

(17.) Соединение по вышеупомянутому пункту (15.) или (16.), в котором фармацевтически приемлемое производное представляет собой гидрохлоридную соль, натриевую соль, калиевую соль, соль п-толуолсульфоновой кислоты, фумаровую кислоту-соль или сокристалл фумарата.

(18.) Соединение по любому из вышеупомянутых пунктов от (15.) до (16.), в котором фармацевтически приемлемое производное представляет собой фумаровую кислоту-соль, сокристалл фумарата или их комбинацию.

(19.) Соединение по любому из вышеупомянутых пунктов от (1.) до (12.) или его фармацевтически приемлемое производное, в котором m означает 0.

(20.) Соединение по вышеупомянутому пункту (19.), в котором фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, меченную радиоактивным изотопом форму или гидрохлорат, тартрат, бензолсульфонат, p-толуолсульфонат или сокристалл фумарата.

(21.) Соединение по любому из вышеупомянутых пунктов (19.) или (20.), в котором фармацевтически приемлемое производное представляет собой гидрохлоридную соль, натриевую соль, калиевую соль, соль p-толуолсульфоновой кислоты, фумаровую кислоту-соль или сокристалл фумарата.

(22.) Соединение по вышеупомянутому пункту (19.), в котором фармацевтически приемлемое производное представляет собой фумаровую кислоту-соль, сокристалл фумарата или их комбинацию.

(23.) Соединение по любому из вышеупомянутых пунктов от (1.) до (8.), (11.) или (19.) или его фармацевтически приемлемое производное, которое представляет собой

(24.) Соединение по любому из вышеупомянутых пунктов от (1.) до (3.), от (5.) до (8.), (11.) или (19.) или его фармацевтически приемлемое производное, которое представляет собой

(25.) Соединение по любому из вышеупомянутых пунктов от (1.) до (8.), (11.) или (19.) или его фармацевтически приемлемое производное, которое представляет собой

(26.) Соединение по любому из вышеупомянутых пунктов от (1.) до (9.), (11.) или (19.) или его фармацевтически приемлемое производное, которое представляет собой

(27.) Соединение по любому из вышеупомянутых пунктов от (23.) до (26.), которое представляет собой свободное основание.

(28.) Соединение по любому из вышеупомянутых пунктов от (23.) до (26.), которое представляет собой фумаровую кислоту-соль, сокристалл фумарата или их комбинацию.

(29.) Композиция, содержащая соединение по любому из вышеупомянутых пунктов от (1.) до (28.) или его фармацевтически приемлемое производное и фармацевтически приемлемый носитель или наполнитель.

(30.) Способ лечения боли, боли, связанной с остеоартритом, остеоартрита, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества соединения по любому из вышеупомянутых пунктов от (1.) до (28.) или его фармацевтически приемлемого производного.

(31.) Способ лечения боли, боли, связанной с остеоартритом, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества соединения по любому из вышеупомянутых пунктов от (1.) до (28.) или его фармацевтически приемлемого производного.

(32.) Способ лечения боли, остеоартрита, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества соединения по любому из вышеупомянутых пунктов от (1.) до (28.) или его фармацевтически приемлемого производного.

(33.) Способ лечения боли, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества соединения по любому из вышеупомянутых пунктов (1.) до (28.) или его фармацевтически приемлемого производного.

(34.) Способ ингибирования функции TRPV1 в клетке, содержащий контактирование клетки, способной экспрессировать TRPV1, с эффективным количеством соединения по любому из вышеупомянутых пунктов (1.) до (28.) или его фармацевтически приемлемого производного.

(35.) Продукт объединения соединения по любому из вышеупомянутых пунктов от (1.) до (28.) с фумаровой кислотой, в котором молярное соотношение (соединение формулы (I)):(фумаровая кислота) в продукте составляет около 1:0,5.

(36.) Композиция, содержащая продукт по вышеупомянутому пункту (35.) и фармацевтически приемлемый носитель или наполнитель.

(37.) Способ лечения боли, боли, связанной с остеоартритом, остеоартрита, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества продукта по вышеупомянутому пункту (35.).

(38.) Способ лечения боли, боли, связанной с остеоартритом, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества продукта по вышеупомянутому пункту (35.).

(39.) Способ лечения боли, остеоартрита, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества продукта по вышеупомянутому пункту (35.).

(40.) Способ лечения боли, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества продукта по вышеупомянутому пункту (35.).

(41.) Способ ингибирования функции TRPV1 в клетке, содержащий контактирование клетки, способной экспрессировать TRPV1, с эффективным количеством продукта по вышеупомянутому пункту (35.).

(42.) Соединение по любому из вышеупомянутых пунктов (1.), (4.), (6.) или (8.), которое представляет собой соединение формулы (II):

или его фармацевтически приемлемое производное, в котором:

R4 представляет собой -Н или -СН3;

R8 представляет собой -Н, -F или СН3;

R9 представляет собой -Н, галоген, -СН3, -CF3, -ОСН3, -OCF3, -ОСН2СН3, -CH2OCH3 или С(O)ОСН2СН3; и

каждый галоген независимо представляет собой -F, -Cl, -Br или -I;

(1) при условии, что если R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (S)-конфигурации, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу.

(43.) Соединение по вышеупомянутому пункту (42.) или его фармацевтически приемлемое производное, в котором дополнительно при условии, что:

(2) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу;

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу, и/или

(4) если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу.

(44.) Соединение по любому из вышеупомянутых пунктов (42.) или (43.) или его фармацевтически приемлемое производное, в котором R4 представляет собой -СН3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

(45.) Соединение по любому из вышеупомянутых пунктов (42.) или (43.) или его фармацевтически приемлемое производное, в котором R4 представляет собой -СН3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

(46.) Соединение по любому из вышеупомянутых пунктов (42.) или (43.) или его фармацевтически приемлемое производное, в котором R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (S)-конфигурации.

(47.) Соединение по любому из вышеупомянутых пунктов (42.) или (43.) или его фармацевтически приемлемое производное, в котором R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (R)-конфигурации.

(48.) Соединение по любому из вышеупомянутых пунктов от (42.) до (47.) или его фармацевтически приемлемое производное, в котором метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу.

(49.) Соединение по вышеупомянутому пункту (48.) или его фармацевтически приемлемое производное, в котором R9 представляет собой -Н.

(50.) Соединение по любому из вышеупомянутых пунктов (48.) или (49.) или его фармацевтически приемлемое производное, в котором R8 представляет собой -F.

(51.) Соединение по любому из вышеупомянутых пунктов от (48.) до (50.), в котором фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль или сокристалл фумарата.

(52.) Соединение по любому из вышеупомянутых пунктов от (48.) до (51.), в котором фармацевтически приемлемое производное представляет собой гидрохлоридную соль, натриевую соль, калиевую соль, соль p-толуолсульфоновой кислоты, фумаровую кислоту-соль или сокристалл фумарата.

(53.) Соединение по любому из вышеупомянутых пунктов от (48.) до (50.), в котором фармацевтически приемлемое производное представляет собой фумаровую кислоту-соль, сокристалл фумарата или их комбинацию.

(54.) Соединение по любому из вышеупомянутых пунктов от (42.) до (47.) или его фармацевтически приемлемое производное, в котором метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу.

(55.) Соединение по вышеупомянутому пункту (54.) или его фармацевтически приемлемое производное, в котором R9 представляет собой -Н.

(56.) Соединение по любому из вышеупомянутых пунктов (54.) или (55.) или его фармацевтически приемлемое производное, в котором R8 представляет собой -F.

(57.) Соединение по любому из вышеупомянутых пунктов (54.) до (56.), в котором фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль или сокристалл фумарата

(58.) Соединение по любому из вышеупомянутых пунктов (54.) до (57.), в котором фармацевтически приемлемое производное представляет собой гидрохлоридную соль, натриевую соль, калиевую соль, соль p-толуолсульфоновой кислоты, фумаровую кислоту-соль или сокристалл фумарата.

(59.) Соединение по любому из вышеупомянутых пунктов от (54.) до (56.), в котором фармацевтически приемлемое производное представляет собой фумаровую кислоту-соль, сокристалл фумарата или их комбинацию.

(60.) Соединение по любому из вышеупомянутых пунктов от (42.) до (47.) или его фармацевтически приемлемое производное, в котором метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу.

(61.) Соединение по вышеупомянутому пункту (60.) или его фармацевтически приемлемое производное, в котором R9 представляет собой -Н.

(62.) Соединение по любому из вышеупомянутых пунктов (60.) или (61.) или его фармацевтически приемлемое производное, в котором R8 представляет собой -F.

(63.) Соединение по любому из вышеупомянутых пунктов от (60.) до (62.), в котором фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль или сокристалл фумарата.

(64.) Соединение по любому из вышеупомянутых пунктов от (60.) до (63.), в котором фармацевтически приемлемое производное представляет собой гидрохлоридную соль, натриевую соль, калиевую соль, соль p-толуолсульфоновой кислоты, фумаровую кислоту-соль или сокристалл фумарата.

(65.) Соединение по любому из вышеупомянутых пунктов (60.) до (62.), в котором фармацевтически приемлемое производное представляет собой фумаровую кислоту-соль, сокристалл фумарата или их комбинацию.

(66.) Соединение по любому из вышеупомянутых пунктов (42.), (43.), (46.), (54.), (55.) или от (57.) до (59.) или его фармацевтически приемлемое производное, которое представляет собой

(67.) Соединение по любому из вышеупомянутых пунктов от (42.) до (44.), (60.) или от (62.) до (65.) или его фармацевтически приемлемое производное, которое представляет собой

(68.) Соединение по любому из вышеупомянутых пунктов (42.), (43.), (47.) или от (54.) до (59.) или его фармацевтически приемлемое производное, которое представляет собой

(69.) Соединение по любому из вышеупомянутых пунктов (42.), (43.), (46.) или от (54.) до (59.) или его фармацевтически приемлемое производное, которое представляет собой

(70.) Соединение по любому из вышеупомянутых пунктов (42.), (43.), (46.), (54.) или от (57.) до (59.) или его фармацевтически приемлемое производное, которое представляет собой

(71.) Соединение по любому из вышеупомянутых пунктов (42.), (43.) или (47) или его фармацевтически приемлемое производное, которое представляет собой

(72.) Соединение по любому из вышеупомянутых пунктов (42.), (43.), (46.), (54.) или от (56.) до (59.) или его фармацевтически приемлемое производное, которое представляет собой

(73.) Соединение по любому из вышеупомянутых пунктов (42.), (43.), (46.), (60.) или от (63.) до (65.) или его фармацевтически приемлемое производное, которое представляет собой

(74.) Соединение по любому из вышеупомянутых пунктов от (66.) до (73.), которое представляет собой свободное основание.

(75.) Соединение по любому из вышеупомянутых пунктов от (66.) до (73.), которое представляет собой фумаровую кислоту-соль, сокристалл фумарата или их комбинацию.

(76.) Композиция, содержащая соединение по любому из вышеупомянутых пунктов от (42.) до (75.) или его фармацевтически приемлемое производное и фармацевтически приемлемый носитель или наполнитель.

(77.) Способ лечения боли, боли, связанной с остеоартритом, остеоартрита, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества соединения по любому из вышеупомянутых пунктов от (42.) до (75.) или его фармацевтически приемлемого производного.

(78.) Способ лечения боли, боли, связанной с остеоартритом, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества соединения по любому из вышеупомянутых пунктов от (42.) до (75.) или его фармацевтически приемлемого производного.

(79.) Способ лечения боли, остеоартрита, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества соединения по любому из вышеупомянутых пунктов от (42.) до (75.) или его фармацевтически приемлемого производного.

(80.) Способ лечения боли, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества соединения по любому из вышеупомянутых пунктов от (42.) до (75.) или его фармацевтически приемлемого производного.

(81.) Способ ингибирования функции TRPV1 в клетке, содержащий контактирование клетки, способной экспрессировать TRPV1, с эффективным количеством соединения по любому из вышеупомянутых пунктов от (42.) до (75.) или его фармацевтически приемлемого производного.

(82.) Продукт объединения соединения по любому из вышеупомянутых пунктов от (42.) до (74.) с фумаровой кислотой, в котором молярное соотношение соединения формулы (I) к фумаровой кислоте в продукте составляет около 1:0,5.

(83.) Композиция, содержащая продукт по вышеупомянутому пункту (82.) и фармацевтически приемлемый носитель или наполнитель.

(84.) Способ лечения боли, боли, связанной с остеоартритом, остеоартрита, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества продукта по вышеупомянутому пункту (82.).

(85.) Способ лечения боли, боль, связанную с остеоартритом, UI, язву, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества продукта из вышеупомянутых пунктов (82.).

(86.) Способ лечения боли, боли, связанной с остеоартритом, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества продукта по вышеупомянутому пункту (82.).

(87.) Способ лечения боли, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества продукта по вышеупомянутому пункту (82.).

(88.) Способ ингибирования функции TRPV1 в клетке, содержащий контактирование клетки, способной экспрессировать TRPV1, с эффективным количеством продукта по вышеупомянутому пункту (82.).

(89.) Соединение, которое представляет собой

или его фармацевтически приемлемое производное.

(90.) Композиция, содержащая соединение по указанному выше пункту (89.) или его фармацевтически приемлемое производное и фармацевтически приемлемый носитель или наполнитель.

(91.) Способ лечения боли, боли, связанной с остеоартритом, остеоартрита, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества соединения по вышеупомянутому пункту (89.) или его фармацевтически приемлемого производного.

(92.) Способ лечения боли, боли, связанной с остеоартритом, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества соединения по вышеупомянутому пункту (89.) или его фармацевтически приемлемого производного.

(93.) Способ лечения боли, остеоартрита, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества соединения по вышеупомянутому пункту (89.) или его фармацевтически приемлемого производного.

(94.) Способ лечения боли, UI, язвы, IBD или IBS у животного, содержащий введение животному по показаниям эффективного количества соединения по вышеупомянутому пункту (89.) или его фармацевтически приемлемого производного.

(95.) Способ ингибирования функции TRPV1 в клетке, содержащий контактирование клетки, способной экспрессировать TRPV1, с эффективным количеством соединения по вышеупомянутому пункту (89.) или его фармацевтически приемлемого производного.

(96.) Соединение по любому из вышеупомянутых пунктов от (1.) до (95.) или его фармацевтически приемлемое производное, в котором % ее соединения составляет по меньшей мере около 90%.

(97.) Соединение по любому из вышеупомянутых пунктов от (1.) до (96.) или его фармацевтически приемлемое производное, в котором % ее соединения составляет по меньшей мере около 93%.

(98.) Соединение, продукт или его фармацевтически приемлемое производное или композиция по любому из пунктов от (1.) до (29.), (35.), (36.), от (42.) до (76.), (82.), (83.), (89.), (90.), (96.) или (97.) для применения в лечении боли, боли, связанной с остеоартритом, остеоартрита, UI, язвы, IBD или IBS у животного.

(99.) Соединение, продукт или его фармацевтически приемлемое производное или композиция по любому из пунктов от (1.) до (29.), (35.), (36.), от (42.) до (76.), (82.), (83.), (89.), (90.) или от (96.) до (98.) для применения в лечении боли у животного.

(100.) Соединение, продукт или композиция по любому из вышеупомянутых пунктов от (1.) до (29.), (35.), (36.), от (42.) до (76.), (82.), (83.), (89.), (90.) или от (96.) до (98.) для применения в лечении боли, связанной с остеоартритом, у животного.

(101.) Соединение, продукт или его фармацевтически приемлемое производное или композиция по любому из пунктов от (1.) до (29.), (35.), (36.), от (42.) до (76.), (82.), (83.), (89.), (90.) или от (96.) до (98.) для применения в лечении остеоартрита у животного.

(102.) Применение соединения, продукта или композиции по любому из вышеупомянутых пунктов от (1.) до (29.), (35.), (36.), от (42.) до (76.), (82.), (83.), (89.), (90.) или от (96.) до (98.) или его фармацевтически приемлемого производного в изготовлении лекарственного средства для лечения боли, боли, связанной с остеоартритом, остеоартрита, UI, язвы, IBD или IBS.

4.1 Соединения формулы (I)

Настоящее изобретение охватывает соединения формулы (I):

или их фармацевтически приемлемое производное,

(1) при условии, что если R4 представляет собой -Н, то m означает 1; и

(2) при условии, что если R4 представляет собой -Н и связь a-b находится в (S)-конфигурации, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу.

где R1, R4, R8, R9 и m таковы, как определено выше для соединений формулы (I.)

Некоторые варианты осуществления формулы (I) представлены ниже.

В одном варианте осуществления соединение формулы (I) представляет собой свободное основание.

В другом варианте осуществления соединение формулы (I) представляет собой фармацевтически приемлемое производное соединения формулы (I).

В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (I) представляет собой фармацевтически приемлемую соль. В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (I) представляет собой фумаровую кислоту-соль. В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (I) представляет собой фумаровую кислоту-соль, где молярное соотношение соединения формулы (I) к фумаровой кислоте составляет около 1:0,5.

В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (I) представляет собой сокристалл. В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (I) представляет собой сокристалл фумарата. В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (I) представляет собой сокристалл фумарата, где молярное соотношение соединение формулы (I): фумарат составляет около 1:0,5.

В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (I) представляет собой фумаровую кислоту-соль, сокристалл фумарата или их комбинацию. В другом варианте осуществления молярное соотношение соединение формулы (I): (фумаровая кислота и/или фумарат) составляет около 1:0,5.

Другие варианты осуществления относятся к продукту объединения соединения формулы (II) с фумаровой кислотой, где молярное соотношение (соединение формулы (II)): (фумаровая кислота) в продукте составляет около 1:0,5; композиции, содержащей данный продукт и фармацевтически приемлемый носитель или наполнитель; способу лечения боли, например, боли, связанной с остеоартритом, остеоартрита, UI, язвы, IBD или IBS у животного, содержащему введение животному по показаниям эффективного количества данного продукта, и способу ингибирования функции TRPV1 в клетке, содержащему контактирование клетки, способной экспрессировать TRPV1 с эффективным количеством данного продукта.

В другом варианте осуществления дополнительно при условии, что:

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(4) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(5) если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген и m означает 1, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3 -метильную группу; и

(4) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу; и

(5) если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген и m означает 1, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(4) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу; и

(5) если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген и m означает 1, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу;

(4) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу; и

(5) если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген и m означает 1, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(5) если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген и m означает 1, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу; и

(5) если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген и m означает 1, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(4) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу; и

(5) если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген и m означает 1, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу; (4) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации R8 представляет собой -Н и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу; и

(5) если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген и m означает 1, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления R1 представляет собой -F, -Cl, -Br или -CF3.

В другом варианте осуществления R1 представляет собой -F, -Cl или -CF3.

В другом варианте осуществления R1 представляет собой -F или -CF3.

В другом варианте осуществления R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R1 представляет собой -F или -Cl.

В другом варианте осуществления R1 представляет собой -F.

В другом варианте осуществления R1 представляет собой -Cl.

В другом варианте осуществления R1 представляет собой -CF3.

В другом варианте осуществления R1 представляет собой -Br.

В другом варианте осуществления R10 представляет собой -СН3 или -ОСН2СН3.

В другом варианте осуществления R10 представляет собой -ОСН2СН3.

В другом варианте осуществления R10 представляет собой -СН3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -СН3, -CF3, -ОСН3, -OCF3, -ОСН2СН3, -CH2OCH3, -С(O)ОСН3 или -С(O)ОСН2СН3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -СН3, -CF3, -ОСН3, -OCF3, -ОСН2СН3, -CH2OCH3 или -С(O)ОСН2СН3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -СН3, -CF3, -ОСН3, -OCF3, -ОСН2СН3 или -CH2OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -СН3, -CF3, -ОСН3, -OCF3 или -ОСН2СН3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -С(O)OCH3 или -С(O)OCH2CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -С(O)OCH2CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3 или -OCF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3 или -OCF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -Cl.

В другом варианте осуществления R9 представляет собой -Н или -F.

В другом варианте осуществления R9 представляет собой -Н или -Cl.

В другом варианте осуществления R9 представляет собой -Н или -CH3.

В другом варианте осуществления R9 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -F или -Cl.

В другом варианте осуществления R9 представляет собой -Cl или -CH3.

В другом варианте осуществления R9 представляет собой -Н.

В другом варианте осуществления R9 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -CH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3 или -OCF3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3 или -OCF3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCF3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -CH3 или -OCF3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -CH3 или -OCH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl или -CH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl или -OCH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl или -OCF3.

В другом варианте осуществления R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R8 представляет собой -Н, -F или -OCH3.

В другом варианте осуществления R8 представляет собой -Н, -F или -OCF3.

В другом варианте осуществления R8 представляет собой -Н, -F или -Cl.

В другом варианте осуществления R8 представляет собой -Н или -F.

В другом варианте осуществления R8 представляет собой -Н или -Cl.

В другом варианте осуществления R8 представляет собой -Н или -CH3.

В другом варианте осуществления R8 представляет собой -F или -CH3.

В другом варианте осуществления R8 представляет собой -F или -Cl.

В другом варианте осуществления R8 представляет собой -Cl или -CH3.

В другом варианте осуществления R8 представляет собой -Н.

В другом варианте осуществления R8 представляет собой -F.

В другом варианте осуществления R8 представляет собой -Cl.

В другом варианте осуществления R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R8 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3 или -OCF3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3 или -OCF3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCF3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCF3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -CH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCF3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -CH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCF3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -Cl и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н или -F и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н или -Cl и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н или -CH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -F или -CH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -F или -Cl и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Cl или -CH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -F и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Cl и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -CH3 и R8 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3 или -OCF3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3 или -OCF3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCF3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCF3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCF3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCF3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -Cl и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н или -F и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н или -Cl и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н или -CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -F или -CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -F или -Cl и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Cl или -CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -F и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Cl и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -OCH3CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -CH3OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3 или -OCF3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3 или -OCF3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCF3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCF3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCF3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F или -CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCF3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F или -Cl и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н или -F и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н или -Cl и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н или -CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -F или -CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -F или -Cl и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Cl или -CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -F и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Cl и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3 или -OCF3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3 или -OCF3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCF3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCF3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -CH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCF3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -CH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCF3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -Cl, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н или -F, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н или -Cl, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н или -CH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -F или -CH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -F или -Cl, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Cl или -CH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -F, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Cl, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -CH3, R8 представляет собой -F или -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH3CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3 или -OCF3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3 или -OCF3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCF3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCF3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -CH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCF3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -CH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCF3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -Cl, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н или -F, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н или -Cl, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н или -CH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -F или -CH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -F или -Cl, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Cl или -CH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -F, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Cl, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -CH3, R8 представляет собой -F и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3 или -OCF3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3 или -OCF3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCF3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCF3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -CH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCF3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -CH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCF3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -Cl, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н или -F, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н или -Cl, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н или -CH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -F или -CH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -F или -Cl, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Cl или -CH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -F, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Cl, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -CH3, R8 представляет собой -CH3 и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -OCH3CH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3, -C(O)OCH3 или -C(O)OCH2CH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3 или -OCF3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3 или -OCF3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCF3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCF3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -CH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCF3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F или -CH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCF3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, -F или -Cl, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н или -F, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н или -Cl, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н или -CH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -F или -CH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -F или -Cl, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Cl или -CH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Н, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -F, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -Cl, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -CH3, R8 представляет собой -F и R1 представляет собой -Cl.

В другом варианте осуществления R4 представляет собой -Н.

В другом варианте осуществления R4 представляет собой -CH3.

В другом варианте осуществления R4 представляет собой -Н и R1 представляет собой -F, -Cl или -CF3.

В другом варианте осуществления R4 представляет собой -CH3 и R1 представляет собой -F, -Cl или -CF3.

В другом варианте осуществления R4 представляет собой -Н и R1 представляет собой -F или -CF3.

В другом варианте осуществления R4 представляет собой -CH3 и R1 представляет собой -F или -CF3.

В другом варианте осуществления R4 представляет собой -Н и R1 представляет собой -F или -Cl.

В другом варианте осуществления R4 представляет собой -CH3 и R1 представляет собой -F или -Cl.

В другом варианте осуществления R4 представляет собой -Н и R1 представляет собой -Cl или -CF3.

В другом варианте осуществления R4 представляет собой -CH3 и m означает 0.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F, -Cl или -CF3 и m означает 0.

В другом варианте осуществления R4 представляет собой -Н и m означает 1.

В другом варианте осуществления R4 представляет собой -CH3 и m означает 1.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F, -Cl или -CF3 и m означает 1.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F, -Cl или -CF3 и m означает 1.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -Cl или -CF3 и m означает 0.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -Cl или -CF3 и m означает 1.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -Cl или -CF3 и m означает 1.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -CF3 и m означает 0.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F или -CF3 и m означает 1.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -CF3 и m означает 1.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -Cl и m означает 0.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F или -Cl и m означает 1.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -Cl и m означает 1.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -Cl и m означает 0.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -Cl и m означает 1.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой Cl и m означает 1.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -CF3 и m означает 0.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -CF3 и m означает 1.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -CF3 и m означает 1.

В другом варианте осуществления R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F, -Cl или -CF3 и атом углерода в положении а связи a-b находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F или -CF3 и атом углерода в положении а связи a-b находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F или -Cl и атом углерода в положении а связи a-b находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -Cl или -CF3 и атом углерода в положении а связи a-b находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, m означает 1 и атом углерода в положении а связи a-b находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F, -Cl или -CF3, m означает 1 и атом углерода в положении а связи a-b находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -Cl или -CF3, m означает 1 и атом углерода в положении а связи a-b находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F или -CF3, m означает 1 и атом углерода в положении а связи a-b находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F или -Cl, m означает 1 и атом углерода в положении а связи a-b находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -Cl, m означает 1 и атом углерода в положении а связи a-b находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -CF3, m означает 1 и атом углерода в положении а связи a-b находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F, -Cl или -CF3 и атом углерода в положении а связи a-b находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F или -CF3 и атом углерода в положении а связи a-b находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F или -Cl и атом углерода в положении а связи a-b находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -Cl или -CF3 и атом углерода в положении а связи a-b находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, m означает 1 и атом углерода в положении а связи a-b находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F, -Cl или -CF3, m означает 1 и атом углерода в положении а связи a-b находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -Cl или -CF3, m означает 1 и атом углерода в положении а связи a-b находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F или -CF3, m означает 1 и атом углерода в положении а связи a-b находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -F или -Cl, m означает 1 и атом углерода в положении а связи a-b находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -Cl, m означает 1 и атом углерода в положении а связи a-b находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н, R1 представляет собой -CF3, m означает 1 и атом углерода в положении а связи a-b находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F, -Cl или -CF3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -CF3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -Cl и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -Cl или -CF3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F, -Cl или -CF3, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F, -Cl или -CF3, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -Cl или -CF3, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -Cl или -CF3, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -CF3, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -CF3, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -Cl, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи с-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -Cl, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи с-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -Cl, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой Cl, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -CF3, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -CF3, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F, -Cl или -CF3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -CF3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -Cl и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -Cl или -CF3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F, -Cl или -CF3, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F, -Cl или -CF3, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -Cl или -CF3, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -Cl или -CF3, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R» представляет собой -CH3, R1 представляет собой -F или -CF3, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -CF3, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -Cl, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи с-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -F или -Cl, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи с-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -Cl, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой Cl, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой - CF3, m означает 0 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3, R1 представляет собой -CF3, m означает 1 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления m означает 1 и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу.

В другом варианте осуществления m означает 1 и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу.

В другом варианте осуществления m означает 1 и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу.

Растворимость соединений в воде часто является желательным свойством. Например, растворимость соединения в воде позволяет более легкое приготовление соединения в виде различных лекарственных форм, которые могут быть введены животному. Когда соединение не является полностью растворимым в биологических жидкостях, например, в крови, оно может выпадать в осадок, и, соответственно, степень воздействия препарата на животное не будет соответствовать введенной дозе. Растворимость в воде увеличивает вероятность того, что соединение будет лучше растворяться, и для соединений с хорошей проникающей способностью это приводит к их присутствию в более высоких количествах в крови животного, а также увеличивает способность предсказывать количество соединения в точке, являющейся его мишенью.

Многие соединения формулы (I) растворимы, а в некоторых случаях хорошо растворимы, в водном растворе. Например, при величине рН 6,8 или рН 1,2, соединение 200 не растворимо в водном растворе, то есть имеет величину растворимости в воде, составляющую менее 0,1 мкм. В противоположность этому, растворимость в воде при величине рН, равной 1,2, следующих соединений формулы (I) составляет более 50 мкМ: А126(а), А155(а), A155(d), A155(e), А158(а), C125(r) и C126(r). Растворимость в воде при величине рН, равной 6,8, в мкМ, соединений формулы (I) A126(a), A155(a), A155(d), А155(е), А158(а), C125(r) и C126(r) составляет 14, 17, 4.0, 5.0, 5.0, 3.0, и 4.0, соответственно. Дополнительно, растворимость в воде при величине рН, равной 1,2 или рН 6,8, соединения формулы (I) А122(а) составляет более 50 мкМ. Растворимость в воде, в мкМ, при величине рН, равной 1,2, соединений 209, 210, 211, 212, 213, 214 и 215 составляет 9,3, 2,0, 1,3, 10,3, 39,6, более 50 и 9,6, соответственно. Следующие соединения являются водонерастворимыми при величине рН, равной 6,8: 203, 207, 200 и 208. Следующие соединения имеют низкую растворимость в воде при величине рН, равной 6,8: 209, 210, 211, 212, 213, 214 и 215 имеют растворимость в воде, в мкМ, составляющую 1,0, 0,4, 0,4, 1,9, 0,8, 1,8 и 0,6, соответственно.

Следующие химические структуры относятся к некоторым из рассмотренных выше соединений:

4.2 Соединения формулы (II)

Предпочтительные соединения формулы (I) представляют собой соединения формулы (II):

или его фармацевтически приемлемое производное,

(I) при условии, что если R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (S)-конфигурации, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу,

где R4, R8 и R9 таковы, как определено выше для соединения формулы (II.)

Некоторые варианты формулы (II), представлены ниже.

В одном варианте осуществления соединение формулы (II) представляет собой свободное основание.

В другом варианте осуществления соединение формулы (II) представляет собой фармацевтически приемлемое производное соединения формулы (II.)

В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (II) представляет собой фармацевтически приемлемую соль. В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (II) представляет собой фумаровую кислоту-соль. В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (II) представляет собой фумаровую кислоту-соль, в котором молярное соотношение соединение формулы (II): фумаровая кислота составляет около 1:0,5.

В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (II) представляет собой сокристалл. В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (II) представляет собой сокристалл фумарата. В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (II) представляет собой сокристалл фумарата, в котором молярное соотношение соединение формулы (II): фумарат составляет около 1:0,5.

В другом варианте осуществления фармацевтически приемлемое производное соединения формулы (II) представляет собой фумаровую кислоту-соль, сокристалл фумарата или их комбинацию. В другом варианте осуществления молярное соотношение соединение формулы (II): (фумаровая кислота и/или фумарат) составляет около 1:0,5.

Другие варианты осуществления относятся к продукту объединения соединения формулы (II) с фумаровой кислотой, в котором молярное соотношение (соединение формулы (II)): (фумаровая кислота) в продукте составляет около 1:0,5; композиции, содержащей данный продукт и фармацевтически приемлемый носитель или наполнитель; способу лечения боли, например, боли, связанной с остеоартритом, остеоартрита, UI, язвы, IBD или IBS у животного, содержащему введение животному по показаниям эффективного количества данного продукта, и способу ингибирования функции TRPV1 в клетке, содержащему контактирование клетки, способной экспрессировать TRPV1 с эффективным количеством данного продукта.

В другом варианте осуществления дополнительно при условии, что:

(2) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(4) если R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(2) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу; и

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(2) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу; и

(4) если R4 представляет собой -CH3, каждый из атомов углерода в положениях a и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу; и

(4) если R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(2) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу;

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу; и

(4) если R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(4) если R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу. В другом варианте осуществления дополнительно при условии, что:

(2) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу; и

(4) если R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновьм кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу; и

(4) если R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления дополнительно при условии, что:

(2) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу;

(3) если R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу; и

(4) если R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой галоген, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH3CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH3OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -OCH3CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -CH3OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3 или -OCF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3 или -OCF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCF3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCF3.

В другом варианте осуществления R9 представляет собой -Н, -F или -Cl.

В другом варианте осуществления R9 представляет собой -Н или -F.

В другом варианте осуществления R9 представляет собой -Н или -Cl.

В другом варианте осуществления R9 представляет собой -Н или -CH3.

В другом варианте осуществления R9 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -F или -Cl.

В другом варианте осуществления R9 представляет собой -Cl или -CH3.

В другом варианте осуществления R9 представляет собой -Н.

В другом варианте осуществления R9 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Cl.

В другом варианте осуществления R9 представляет собой -CH3.

В другом варианте осуществления R8 представляет собой -Н или -F.

В другом варианте осуществления R8 представляет собой -Н или -CH3.

В другом варианте осуществления R8 представляет собой -F или -CH3.

В другом варианте осуществления R8 представляет собой -Н.

В другом варианте осуществления R8 представляет собой -F.

В другом варианте осуществления R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3 или -OCF3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3 или -OCF3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCF3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCF3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCF3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCF3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -Cl и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н или -F и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н или -Cl и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н или -CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -F или -CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -F или -Cl и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Cl или -CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -F и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Cl и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -CH3 и R8 представляет собой -F или -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3 или -OCF3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3 или -OCF3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCF3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCF3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCF3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F или -CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCF3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F или -Cl и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н или -F и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н или -Cl и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н или -CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -F или -CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -F или -Cl и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Cl или -CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -F и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Cl и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -CH3 и R8 представляет собой -F.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3 или -CH3OCH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3 или -CH2OCH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -OCH2CH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3, -OCF3 или -CH2OCH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3 или -OCF3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3, -OCH3 или -OCF3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCF3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3, -CF3 или -OCH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCF3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl, -CH3 или -OCH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -CH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F, -Cl или -OCF3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -CH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -OCF3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н, -F или -Cl и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н или -F и R8 представляет собой -CH3.

В другом варианте осуществления R8 представляет собой -Н или -Cl и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н или -CH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -F или -CH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -F или -Cl и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Cl или -CH3 и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Н и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -F и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -Cl и R8 представляет собой -CH3.

В другом варианте осуществления R9 представляет собой -CH3 и R8 представляет собой -CH3.

В другом варианте осуществления R4 представляет собой -Н.

В другом варианте осуществления R4 представляет собой -CH3.

В другом варианте осуществления R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (R)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации.

В другом варианте осуществления R4 представляет собой -CH3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации.

В другом варианте осуществления метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу.

В другом варианте осуществления метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу.

В другом варианте осуществления метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу.

В другом варианте осуществления R4 представляет собой -Н, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу.

В другом варианте осуществления R4 представляет собой -Н, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу и R8 представляет собой -F или -CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу и R8 представляет собой -F или -CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу и R8 представляет собой -F или -CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу и R8 представляет собой -F или -CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу и R8 представляет собой -F или -CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу и R8 представляет собой -F или -CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу и R8 представляет собой -F или -CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу и R8 представляет собой -F или -CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу и R8 представляет собой -F или -CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу и R8 представляет собой -F или -CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу и R8 представляет собой -F или -CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях a и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу и R8 представляет собой -F или -CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу и R9 представляет собой -Н, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу и R9 представляет собой -Н, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу и R9 представляет собой -Н, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу и R8 представляет собой -Н, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу и R9 представляет собой -Н, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу и R9 представляет собой -Н, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу и R9 представляет собой -Н, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу и R9 представляет собой -Н, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу и R9 представляет собой -Н, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу и R9 представляет собой -Н, -CH3, -CF3, -OCH3, -OCF3, -OCH3CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях я и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу и R9 представляет собой -Н, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях a и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу и R9 представляет собой -Н, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, R8 представляет собой -F или -CH3 и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, R8 представляет собой -F или -CH3 и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, R8 представляет собой -F или -CH3 и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, R8 представляет собой -F или -CH3 и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу, R8 представляет собой -F или -CH3 и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу, R8 представляет собой -F или -CH3 и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу, R8 представляет собой -F или -CH3 и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу, R8 представляет собой -F или -CH3 и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу, R8 представляет собой -F или -CH3 и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу, R8 представляет собой -F или -CH3 и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу, R8 представляет собой -F или -CH3 и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях a и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу, R8 представляет собой -F или -CH3 и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, R8 представляет собой -F и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, R8 представляет собой -F и R9 представляет собой Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях a и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, R8 представляет собой -F и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, R8 представляет собой -F и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу, R8 представляет собой -F и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу, R8 представляет собой -F и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCFs, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу, R8 представляет собой -F и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу, R8 представляет собой -F и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу, R8 представляет собой -F и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу, R8 представляет собой -F и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу, R8 представляет собой -F и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу, R8 представляет собой -F и R9 представляет собой -Н, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, R8 представляет собой -CH3 и R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, R8 представляет собой -CH3 и R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, R8 представляет собой -CH3 и R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, R8 представляет собой -CH3 и R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу, R8 представляет собой -CH3 и R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу, R8 представляет собой -CH3 и R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу, R8 представляет собой -CH3 и R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях a и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу, R8 представляет собой -CH3 и R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу, R8 представляет собой -CH3 и R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -Н, атом углерода в положении а связи a-b находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу, R8 представляет собой -CH3 и R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу, R8 представляет собой -CH3 и R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

В другом варианте осуществления R4 представляет собой -CH3, каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации, метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу, R8 представляет собой -CH3 и R9 представляет собой -Н, -F, -Cl, -Br, -CH3, -CF3, -OCH3, -OCF3, -OCH2CH3, -CH2OCH3 или -C(O)OCH2CH3.

Иллюстративные соединения формул (I) и/или (II), перечислены в таблицах 1-3 в графической части.

4.3 Определения

Как используют в настоящем описании, термины, применяемые ниже, имеют следующие значения:

"-(С14)алкил" означает прямую цепь или разветвленный нециклический углеводород, имеющий 1, 2, 3 или 4 атомов углерода. Примеры имеющих прямую цепь -(С14)алкилов включают в себя -метил, -этил, -н-пропил и н-бутил. Примеры имеющих разветвленную цепь -(С1- С4)алкилов включают в себя -изопропил, -втор-бутил, -изобутил и -трет-бутил.

"галоген" или "-гало" означает -F, -Cl, -Br или -I.

В связи с метильным заместителем в пиперазиновом кольце, например, из соединений формулы (I), "2-метильная группа", "2-положение метильной группы" и тому подобное означает

где R1, R4, R8 и R9 такие, как определено выше для соединений формулы (I), и где цифры обозначают положение каждого атома в пиперазиновом кольце.

В связи с метильным заместителем в пиперазиновом кольце, например, из соединений формулы (I), "(R)-2-метильная группа", "(R)-2-положение метильной группы" и тому подобное означает

где R1, R4, R8 и R9 такие, как определено выше для соединений формулы (I), и где цифры обозначают положение каждого атома в пиперазиновом кольце.

В связи с метильным заместителем в пиперазиновом кольце, например, из соединений формулы (I), "(S)-2-метильная группа", "(S)-2-положение метильной группы" и тому подобное означает

где R1, R4, R8 и R9 такие, как определено выше для соединений формулы (I), и где цифры обозначают положение каждого атома в пиперазиновом кольце.

В связи с метильным заместителем в пиперазиновом кольце, например, из соединения формулы (I), "3-метильная группа", "3-положение метильной группы" и тому подобное означает

где R1, R4, R8 и R9 такие, как определено выше для соединений формулы (I), и где цифры обозначают положение каждого атома в пиперазиновом кольце. В связи с метильным заместителем в пиперазиновом кольце, например, из соединений формулы (I), "(R)-3-метильная группа", "(R)-3-положение метильной группы" и тому подобное означает

где R1, R4, R8 и R9 такие, как определено выше для соединений формулы (I), и где цифры обозначают положение каждого атома в пиперазиновом кольце.

В связи с метильным заместителем в пиперазиновом кольце, например, из соединений формулы (I), "(S)-3-метильная группа", "(S)-3-положение метильной группы" и тому подобное означает

где R1, R4, R8 и R9 такие, как определено выше для соединений формулы (I), и где цифры обозначают положение каждого атома в пиперазиновом кольце.

В связи с заместителем пиридинового кольца, содержащего R4, фраза "в котором R4 представляет собой -CH3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (S)-конфигурации" и тому подобное означает

где строчные буквы используются для обозначения определенной связи С-O в данном заместителе.

В связи с заместителем пиридинового кольца, содержащего R4, фраза "в котором R4 представляет собой -CH3 и каждый из атомов углерода в положениях а и с связи a-b и связи c-d находится в (R)-конфигурации" и тому подобное означает

где строчные буквы используются для обозначения определенной связи С-O в данном заместителе.

В связи с заместителем пиридинового кольца, содержащего R4, фраза "в котором R4 представляет собой -CH3, атом углерода в положении а связи a-b находится в (R)-конфигурации и атом углерода в положении с позиции связи c-d находится в (S)-конфигурации" и тому подобное означает

где строчные буквы используются для обозначения определенной связи С-O в данном заместителе.

В связи с заместителем пиридинового кольца, содержащего R4, фраза "в котором R4 представляет собой -CH3, атом углерода в положении а связи a-b находится в (S)-конфигурации и атом углерода в положении с позиции связи c-d находится в (R)-конфигурации" и тому подобное означает

где строчные буквы используются для обозначения определенной связи С-O в данном заместителе.

В связи с заместителем пиридинового кольца, содержащего R4, фраза "в котором R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (S)-конфигурации" и тому подобное означает

где строчные буквы используются для обозначения определенной связи С-O в данном заместителе.

В связи с заместителем пиридинового кольца, содержащего R4, фраза "в котором R4 представляет собой -Н и атом углерода в положении а связи a-b находится в (R)-конфигурации" и тому подобное означает

где строчные буквы используются для обозначения определенной связи С-O в данном заместителе.

Термин "животное" включает, но без ограничения, корову, обезьяну, бабуина, шимпанзе, лошадь, овцу, свинью, курицу, индейку, перепелку, кошку, собаку, мышь, крысу, кролика, гвинейского поросенка и человека. Выражение "фармацевтически приемлемое производное", как используют в настоящем описании, включает в себя любую фармацевтически приемлемую соль, полиморф, псевдополиморф, сольват, сокристалл, пролекарство, меченную радиоактивным изотопом форму, стереоизомер, энантиомер, диастереомер, другую стереоизомерную форму, рацемическую смесь, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия.

В одном варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, псевдополиморф, сольват, сокристалл, пролекарство, меченную радиоактивным изотопом форму, стереоизомер, энантиомер, диастереомер, другую стереоизомерную форму, рацемическую смесь, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, псевдополиморф, сольват, сокристалл, пролекарство, меченную радиоактивным изотопом форму, стереоизомер, энантиомер, диастереомер, другую стереоизомерную форму, рацемическую смесь, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, псевдополиморф, сольват, сокристалл, пролекарство, стереоизомер, энантиомер, диастереомер, другую стереоизомерную форму, рацемическую смесь, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, псевдополиморф, сольват, сокристалл, стереоизомер, энантиомер, диастереомер, другую стереоизомерную форму, рацемическую смесь, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, сокристалл, меченную радиоактивным изотопом форму, стереоизомер, энантиомер, диастереомер, другую стереоизомерную форму, рацемическую смесь, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, сокристалл, пролекарство, стереоизомер, энантиомер, диастереомер, другую стереоизомерную форму, рацемическую смесь, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, сокристалл, стереоизомер, энантиомер, диастереомер, другую стереоизомерную форму, рацемическую смесь, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, сокристалл, меченную радиоактивным изотопом форму, стереоизомер, энантиомер, диастереомер, другую стереоизомерную форму, рацемическую смесь, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, сокристалл, пролекарство, стереоизомер, энантиомер, диастереомер, другую стереоизомерную форму, рацемическую смесь, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, сокристалл, стереоизомер, энантиомер, диастереомер, другую стереоизомерную форму, рацемическую смесь, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия.

В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, псевдополиморф, сольват, сокристалл, меченную радиоактивным изотопом форму, стереоизомер, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, псевдополиморф, сольват, сокристалл, пролекарство, стереоизомер, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, псевдополиморф, сольват, сокристалл, стереоизомер, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, сокристалл, меченную радиоактивным изотопом форму, стереоизомер, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, сокристалл, пролекарство, стереоизомер, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, сокристалл, стереоизомер, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, сокристалл, меченную радиоактивным изотопом форму, стереоизомер, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, сокристалл, пролекарство, стереоизомер, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, сокристалл, стереоизомер, геометрический изомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, сокристалл, стереоизомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, полиморф, стереоизомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, стереоизомер и/или таутомер, например, соединения формулы (I) настоящего раскрытия.

В другом варианте осуществления фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой полиморф, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой псевдополиморф, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой сольват, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой сокристалл, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой пролекарство, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой меченную радиоактивным изотопом форму, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой стереоизомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой энантиомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой диастереомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой стереоизомерную форму, кроме стереоизомера, энантиомера и диастереомера, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой рацемическую смесь, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой геометрический изомер, например, соединения формулы (I) настоящего раскрытия. В другом варианте осуществления фармацевтически приемлемое производное представляет собой таутомер, например, соединения формулы (I) настоящего раскрытия.

Термин "фармацевтически приемлемая соль", как используют в настоящем описании, означает любую фармацевтически приемлемую соль, которая может быть получена из соединения формулы (I), включая соль, образованную из кислоты и такой основной функциональной группы, как азотная группа, соединения формулы (I). Иллюстративные соли включают в себя, но без ограничения, сульфат, цитрат, ацетат, трифторацетат, оксалат, хлорид, бромид, иодид, нитрат, бисульфат, фосфат, кислый фосфат, изоникотинат, лактат, салицилат, кислый цитрат, тартрат, олеат, таннат, пантотенат, битартрат, аскорбат, сукцинат, малеат, гентисинат, фумарат, глюконат, глюкарбонат, сахарат, формиат, бензоат, глутамат, метансульфонат, этансульфонат, бензолсульфонат, p-толуолсульфонат, и соли памоата (т.е. 1,1'-метилен-бис-(2-гидрокси-3-нафтоат)). Термин "фармацевтически приемлемая соль" также включает в себя соль, полученную из соединения формулы (I), имеющего кислотную функциональную группу, такую как функциональная группа карбоновой кислоты и фармацевтически приемлемого неорганического или органического основания. Подходящие основания включают в себя, но без ограничения, гидроксиды щелочных металлов, таких как натрий, калий, цезий и литий; гидроксиды щелочно-земельных металлов, таких как кальций и магний; гидроксиды других металлов, таких как алюминий и цинк; аммиак и органические амины, такие как незамещенный или гидроксизамещенный моно-, ди- или триалкиламин; дициклогексиламин; трибутиламин; пиридин; пиколин, N-метил, N-этиламин; диэтиламин; триэтиламин; моно-, бис- или трис-(2-гидрокси-(С13)алкиамины), такие как моно-, бис- или трис-(2-гидроксиэтил)амин, 2-гидрокси-трет-бутиламин или трис-(гидроксиметил)метиламин, N,N-ди[(С13)алкил]-N-(гидрокси-(С13)алкил)амины, такие как N,N-диметил-N-(2 гидроксиэтил)амин или три-(2-гидроксиэтил)амин; N-метил-D-глюкамин; и аминокислоты, такие как аргинин, лизин и им подобные. В одном варианте осуществления фармацевтически приемлемой солью является гидрохлоридная соль, сульфатная соль, натриевая соль, калиевая соль, соль бензолсульфоновой кислоты, соль p-толуолсульфоновой кислоты или соль фумаровой кислоты. В другом варианте осуществления фармацевтически приемлемой солью является гидрохлоридная соль или сульфатная соль. В другом варианте осуществления фармацевтически приемлемой солью является гидрохлоридная соль. В другом варианте осуществления фармацевтически приемлемой солью является сульфатная соль. В другом варианте осуществления фармацевтически приемлемой солью является натриевая соль. В другом варианте осуществления фармацевтически приемлемая соль представляет собой калиевая соль. В другом варианте осуществления фармацевтически приемлемая соль представляет собой соль пара-толуолсульфоновой кислоты. В другом варианте осуществления фармацевтически приемлемая соль представляет собой соль фумаровой кислоты. В другом варианте осуществления фармацевтически приемлемая соль фумаровой кислоты содержит около одного эквивалента соединения формулы (I) и около 0,5 эквивалента фумаровой кислоты, например, от около 0,3 до около 0,7 эквивалентов фумаровой кислоты в одном варианте осуществления, от около 0,4 до около 0,6 эквивалентов фумаровой кислоты в другом варианте осуществления, от около 0,44 до около 0,56 эквивалентов фумаровой кислоты в другом варианте осуществления или от около 0,47 до около 0,53 эквивалентов фумаровой кислоты в другом варианте осуществления. В другом варианте осуществления фармацевтически приемлемая соль фумаровой кислоты содержит один эквивалент соединения формулы (I) и 0,5 эквивалентов фумаровой кислоты. Специалисту в данной области техники очевидно, что, например, кислотно-аддитивные соли соединения формулы (I) могут быть получены взаимодействием соединений с соответствующей кислотой различными известными способами.

Соединения по изобретению, предлагаемые в настоящем описании, также охватывают все полиморфы и псевдополиморфы соединений формулы (I). "Полиморфы" известны в данной области техники (см., например, Giron, "Investigations of Polymorphism and Pseudo-polymorphism in Pharmaceuticals by Combined Thermoanalytical Techniques," J. Thermal Anal. Cal. 64:37-60 (2001)) и рассматриваются как различные кристаллические фазы, в которых соединение формулы (I) способно существовать. Кристаллические фазы могут иметь различные укладки ("упаковочный полиморфизм") и/или конформации ("конформационный полиморфизм") молекул в кристаллической решетке. Например, в двух различных полиморфных формах соединения формулы (I) каждый полиморф может иметь молекулы, расположенные в различной фундаментальной кристаллической системе - триклинной, моноклинной, ромбической, тетрагональной, тригональной, гексагональной или кубической. Термин "ангидрат", как используется в настоящем описании, обозначает любую кристаллическую форму соединения формулы (I), в которой молекулы воды не являются неотъемлемой частью кристалла. Ангидрат соединения формулы (I) может быть получен, например, кристаллизацией из растворителя, по существу свободного от воды. В одном варианте осуществления соединение формулы (I) присутствует в виде ангидрата, т.е. в виде свободного основания, в котором кристаллическая решетка по существу не содержит молекул воды, и любые присутствующие молекулы воды присутствуют в виде "поверхностной воды" (например, рыхлосвязанной с поверхностью кристалла), которые специалист в данной области техники может заметить и отличить, например, термогравиметрическим анализом (thermogravimetric analysis (TGA)) и/или дифференциальной сканирующей калориметрией (differential scanning calorimetry (DSC)), от молекул воды, которые являются неотъемлемой частью кристалла (например, гидрат.) Ангидрат соединения формулы (I) имеет менее чем около 0,2 моль воды в одном варианте осуществления, меньше чем около 0,15 моль воды в другом варианте осуществления, меньше чем около 0,12 моль воды в другом варианте осуществления, менее чем около 0,1 моль воды в другом варианте осуществления, менее чем около 0,085 моль воды в другом варианте осуществления, менее чем около 0,075 моль воды в другом варианте осуществления, менее чем около 0,06 моль воды в другом варианте осуществления, менее чем около 0,057 моль воды в другом варианте осуществления, менее чем около 0,05 моль воды в другом варианте осуществления, менее чем около 0,03 моль воды в другом варианте осуществления, менее чем около 0,025 моль воды в другом варианте осуществления, менее чем около 0,02 моль воды в другом варианте осуществления, менее чем около 0,01 моль воды в другом варианте осуществления, менее чем около 0,005 моль воды в другом варианте осуществления и менее чем около 0,001 моль воды в другом варианте осуществления, причем в каждом упомянутом варианте осуществления принимается во внимание наличие поверхностной воды и в каждом упомянутом варианте осуществления расчет производится на 1 моль соединения формулы (I).

Соединения по изобретению, предлагаемые в настоящем описании, также охватывают все сольваты соединений формулы (I). "Сольваты" известны в данной области техники и рассматриваются как комбинация, физическое объединение и/или сольватация соединения формулы (I) с молекулой растворителя. Данная физическая ассоциация может включать в себя различные степени ионной и ковалентной связи, включая водородную связь. Когда сольват представляет собой сольват стехиометрического типа, существует фиксированное соотношение молекулы растворителя к молекуле соединения формулы (I), например, дисольват, моносольват или гемисольват, когда молярное соотношение молекула растворителя: молекула соединения формулы (I) составляет 2:1, 1:1 или 1:2, соответственно. В других вариантах осуществления сольват представляет собой сольват нестехиометрического типа. Например, кристалл соединения формулы (I) может содержать молекулы растворителя в структурных пустотах, например, каналах, кристаллической решетки. В некоторых случаях сольват может быть выделен, например, когда одна или более молекул растворителя включены в кристаллическую решетку кристаллического твердого вещества. Таким образом, понятие "сольват", как используют в настоящем описании, охватывает как фазу раствора, так и изолируемые сольваты. Поскольку кристаллическая форма сольвата может также упоминаться как "псевдополиморф", соединения по изобретению, предлагаемые в настоящем описании, также охватывают все псевдополиморфы соединений формулы (I). Соединение формулы (I) по изобретению может присутствовать в виде сольватированной формы с фармацевтически приемлемым растворителем, таким как вода, метанол, этанол и им подобным, и предполагается, что настоящее изобретение включают в себя как сольватированные, так и несольватированные формы соединения формулы (I). "Гидрат" относится к конкретной подгруппе сольватов, т.е. в котором молекулой растворителя является вода, гидраты включены в сольваты настоящего раскрытия. В одном варианте осуществления соединение формулы (I) присутствует в виде моногидрата, т.е. в виде свободного основания, в котором молярное соотношение вода:соединение формулы (I) составляет около 1:1, например, от 0,91:1 до 1,09:1 в одном варианте осуществления, от 0,94:1 до 1,06:1 в другом варианте осуществления, от 0,97:1 до 1,03:1 в другом варианте осуществления и от 0,985:1 до 1,015:1 в другом варианте осуществления, причем в каждом упомянутом варианте осуществления принимается во внимание наличие поверхностной воды, которая может присутствовать, если таковая имеется.

Получение сольватов известно в данной области. Например, у Caira et al., "Preparation and Crystal Characterization of a Polymorph, and Monohydrate и an Ethyl Acetate Solvate of the Antifungal Fluconazole," J. Pharmaceut. Sci., 93(3):601-611 (2004), описывается получение сольватов флуконазола этилацетатом и водой. Подобные получения сольватов, гемисольвата, гидратов и им подобных описываются у Van Tonder et al., "Preparation and Physicochemical Characterization of 5 Niclosamide Solvates and 1 Hemisolvate," AAPS Pharm. Sci. Tech., 5(1): Article 12 (2004), и Bingham et al., "Over one hundred solvates of sulfathiazole," Chem. Comm., pp.603-604 (2001). В одном варианте осуществления не ограничивающий способ включает в себя растворение соединения формулы (I) в желаемом количестве желаемого растворителя (органического, воды или их смеси) при температуре от превышающей около 20°С до около 25°С, охлаждение раствора со скоростью, достаточной для образования кристаллов, и выделение кристаллов известными способами, например, фильтрацией. Могут быть использованы аналитические способы, например, инфракрасная спектроскопия, чтобы показать наличие растворителя в кристалле сольвата.

Соединения по изобретению, предлагаемые в настоящем описании, также охватывают все сокристаллы соединений формулы (I). "Сокристаллы" известны в данной области техники; сокристалл считается структурно однородным кристаллическим материалом, который содержит два или более нейтральных строительных блока, например, соединение формулы (I) с сообразующим материалом, которые присутствуют в определенных стехиометрических количествах. Aakeroy et al., "Co-crystal or Salt: Does it Really Matter?" Mol. Pharmaceutics 4(3):317-322 (2007). Для целей настоящего изобретения термин "сокристалл" включает в себя все полиморфы данного сокристалла, т.е. все различные кристаллические фазы данного сокристалла. Основное различие между сольватами и сокристаллами заключается в физическом состоянии отдельных чистых компонентов. Для, например, двухкомпонентной системы, если один компонент представляет собой жидкость при температуре, составляющей около 25°С, то кристалл, содержащий оба компонента, обозначается как сольват, если оба компонента являются твердыми веществами при данной температуре, то кристалл, содержащий оба компонента, обозначается как сокристалл. Sekhon, "Pharmaceutical Co-crystals - A Review," Ars. Pharm. 50(3):99-117 (2009). Дополнительно, сокристаллы и соли можно рассматривать как противоположные "крайности" на шкале возможных многокомпонентных структур. Соли образуются посредством ионизации, например, кислотно-щелочной реакции или реакции переноса протона в системе донор-акцептор, происходящих между активным фармацевтическим ингредиентом и кислым или основным веществом. В противоположность этому, когда у активного фармацевтического ингредиента(ов) отсутствует ионизируемый сайт, способствующий образованию соли, сокристалл может быть образован посредством юнионизации, например, водородных связей, π-π или ван-дер-ваальсовых взаимодействий между компонентами. Структурные различия между сокристаллом, солью и гидратом проиллюстрированы, например, в фигурах 1 и 2 у Schultheiss et al., "Pharmaceutical Co-crystals and their Physicochemical Properties," Crystal Growth & Design 9(6):2950-2967 (2009), который включен в настоящее описание посредством ссылки. Получение сокристаллов известно в данной области техники, например, как описано в приведенных выше ссылках и в патентах США №№7452555 В2 и 7935817 В2.

В одном варианте осуществления сокристалл с соединением формулы (I) содержит хлористоводородную кислоту, винную кислоту, бензолсульфоновую кислоту, толуолсульфоновую кислоту, янтарную кислоту, фумаровую кислоту, лимонную кислоту, щавелевую кислоту, бензойную кислоту или любую их смесь. В другом варианте осуществления сокристалл с соединением формулы (I) содержит хлористоводородную кислоту, бензолсульфоновую кислоту, толуолсульфоновую кислоту, L-винную кислоту, фумаровую кислоту или любую их смесь. В другом варианте осуществления сокристалл состоит из соединения формулы (I) и соляной кислоты. В другом варианте осуществления сокристалл состоит из соединения формулы (I) и бензолсульфоновой кислоты. В другом варианте осуществления сокристалл состоит из соединения формулы (I) и толуолсульфоновой кислоты. В другом варианте осуществления сокристалл состоит из соединения формулы (I) и L-винной кислоты. В другом варианте осуществления сокристалл состоит из соединения формулы (I) и фумаровой кислоты. В другом варианте осуществления сокристалл содержит около одного эквивалента соединения формулы (I) и около 0,5 эквивалента фумаровой кислоты, например, от около 0,3 до около 0,7 эквивалентов фумаровой кислоты в одном варианте осуществления, от около 0,4 до около 0,6 эквивалента фумаровой кислоты в другом варианте осуществления, от около 0,44 до около 0,56 эквивалентов фумаровой кислоты в другом варианте осуществления или от около 0,47 до около 0,53 эквивалентов фумаровой кислоты в другом варианте осуществления. В другом варианте осуществления сокристалл содержит один эквивалент соединения формулы (I) и 0,5 эквивалента фумаровой кислоты. Аналитические способы, например, инфракрасная спектроскопия, дифракция рентгеновских лучей на монокристалле (x-ray diffraction (XRD), порошковая дифракция рентгеновских лучей (powder x-ray diffraction (PXRD), определение температуры плавления, DSC, дифференциальный термический анализ (DTA), TGA, твердотельный ЯМР (SSNMR) и рентгеновская фотоэлектронная спектроскопия (XPS) могут быть использованы для выяснения структуры сокристалла. В некоторых вариантах осуществления XRD, SSNMR и/или XPS используется для определения, присутствует ли сокристалл или его соль. В некоторых вариантах осуществления, когда достаточно большой монокристалл не может быть выращен, используется SSNMR или XPS для определения, присутствует ли сокристалл или его соль.

Тем не менее в данной области техники признается, что "точная классификация соединений в виде соли или сокристалла иногда может быть несколько неоднозначной" Aakeroy et al., на странице 321. Например, Aakeroy et al. описывают исследование, в котором дифракция рентгеновских лучей и нейтронная дифракция были использованы для изучения водородных связей между N-оксидом уротропина и муравьиной кислотой в зависимости от температуры, в котором был обнаружено, что точное местонахождение протона изменяется с температурой и, при некоторых условиях, система отображает частичный перенос протона от кислоты к N-оксидной группе, т.е. система обладает характеристиками, промежуточными между характеристиками соли и сокристалла. Там же. Кроме того, Pop et al. описывают фумарат тиотропия как, одновременно, соль и сокристалл со стехиометрическим соотношением катион: анион:сообразователь, равным 2:1:1. Pop et al., "Tiotropium Fumarate: An Interesting Pharmaceutical Co-crystal," J. Pharma. Sci. 98(5):1820-1834 (2009). Структура, определенная XRD, описывается как "состоящая из двух одновалентных катионов тиотропия в сочетании с двухвалентным анионом фумарата для получения соли, плюс остаток неионизованной свободной фумаровой кислоты для получения сокристалла." Там же. Таким образом, в связи с отсутствием бесспорно четкого различия между солью и сокристаллом, следует понимать, что фраза "и их комбинации", когда используется в контексте соли и/или сокристалла, означает, что характеристика, относящаяся к соли, и другая характеристика, относящаяся к сокристаллу, одновременно присутствуют в одном варианте осуществления; а в другом варианте осуществления присутствует характеристика, промежуточная между характеристикой, относящейся к соли, и характеристикой, относящейся к сокристаллу.

Соединения, раскрытые в данном описании, также содержат все пролекарства соединений формулы (I). "Пролекарствами", известными в данной области техники и не обязательно обладающими какой-либо фармацевтической активностью сами по себе, считаются любые ковалентно связанные носитель(и), которые высвобождают активное исходное лекарство in vivo. В общем случае, такие пролекарства будут представлять собой функциональное производное соединения формулы (I), которое легко превращается in vivo, например, в результате метаболизирования, в требуемое соединение формулы (I). Обычные процедуры отбора и получения подходящих производных пролекарств описаны, например, у Н. Bundgaard ed., Design of Prodrugs, Elsevier (1985); "Drug and Enzyme Targeting, Part A," Widder et al., eds., Vol.112 in Methods in Enzymology, Academic Press (1985); Bundgaard, "Design and Application of Prodrugs," Chapter 5, pp.113-191 in A Textbook of Drug Design and Development, Krogsgaard-Larsen and Bundgaard Eds., Harwood Academic Publishers (1991); Bundgaard et al., "(C) Means to Enhance Penetration (1) Prodrugs as a means to improve the delivery of peptide drugs," Adv. Drug Delivery Revs. 8:1-38 (1992); Bundgaard et al., "Glycolamide Esters as Biolabile Prodrugs of Carboxylic Acid Agents: Synthesis, Stability, Bioconversion, and Physicochemical Properties," J. Pharmaceut. Sci. 77(4):285-298 (1988); и Kakeya et al., "Studies on Prodrugs of Cephalosporins. I. Synthesis and Biological Properties of Glycyloxygenzoyloxymethyl and Glycylaminobenzoyloxymethyl Esters of 7β-[2-(2-Aminothiazol-4-yl)-(Z)-2-methoxyiminoacetamido]3-methyl-3-cephem-4-carboxylic Acid," Chem. Pharm. Bull. 32:692-698 (1984).

В дополнение, один или более атомов водорода, углерода или других атомов соединения формулы (I) могут быть заменены радиоактивным изотопом водорода, углерода или других атомов. Такое "радиоактивное" соединение формулы (I), "радиоактивная форма" соединения формулы (I) и им подобные соединения формулы (I), каждое из которых включено в объем раскрытия, применяется в качестве исследовательского и/или диагностического инструмента в фармакокинетических исследований метаболизма и в анализах связывания. "Радиоактивный", как используют в настоящем описании по отношению к атому, означает атом, который содержит радиоактивный атом, и поэтому его удельная радиоактивность превышает фоновый уровень радиоактивности. Примеры радиоактивных изотопов, которые могут быть включены в соединения формулы (I) по изобретению, включают в себя изотопы водорода, углерода, азота, кислорода, фосфора, серы, фтора, хлора, брома и йода, такие как 2H, 3H, 11C, 13C, 14C, 15N, 17O, 18О,31P, 32P, 35S, 18F, 19F, 36Cl, 37Cl, 76Br, 77Br, 81Br, 123I, 124I, 125I и 131I, соответственно. В одном варианте осуществления меченное радиоактивным изотопом соединение формулы (I) содержит 1, 2, 3, 4 или более радиоактивных изотопов, каждый из которых независимо выбран из водорода, углерода, азота, кислорода, фосфора, серы, фтора, хлора, брома и йода. В другом варианте осуществления меченное радиоактивным изотопом соединение формулы (I) содержит 1 или 2 радиоактивных изотопа, каждый из которых независимо выбран из водорода, углерода, азота, кислорода, фосфора, серы, фтора, хлора, брома и йода. В другом варианте осуществления меченное радиоактивным изотопом соединение формулы (I) содержит один радиоактивный изотоп, выбранный из водорода, углерода, азота, кислорода, фосфора, серы, фтора, хлора, брома и йода. В другом варианте осуществления меченное радиоактивным изотопом соединение формулы (I) содержит 1, 2, 3, 4 или более радиоактивных изотопов, каждый из которых независимо выбран из 2H, 3H, 11C, 13C, 14C, 15N, 17O, 18O, 31P, 32P, 35S, 18F, 19F, 36Cl, 37Cl, 76Br, 77Br, 81Br, 123I, 124I, 125I и 131I. В другом варианте осуществления меченное радиоактивным изотопом соединение формулы (I) содержит 1 или 2 радиоактивных изотопа, каждый из которых независимо выбран из 2H, 3H, 11C, 13C, 14C, 15N, 17O, 18O, 31P, 32P, 35S, 18F, 19F, 36Cl, 37Cl, 76Br, 77Br, 81Br, 123I, 124I, l25I и 131I. В другом варианте осуществления меченное радиоактивным изотопом соединение формулы (I) содержит один радиоактивный изотоп, выбранный из 2H, 3H, 11C, 13C, 14C, 15N, 17O, 18O, 31P, 32P, 35S, 18F, 19F, 36Cl, 37Cl, 76Br, 77Br, 81Br, 123I, 124I, 125I и 131I. В другом варианте осуществления меченное радиоактивным изотопом соединение формулы (I) содержит 1, 2, 3, 4 или более радиоактивных изотопов, каждый из которых независимо выбран из 2H, 3H, 13C, 14C, 15N, 18O, 32Р и 125I. В другом варианте осуществления меченное радиоактивным изотопом соединение формулы (I) содержит 1 или 2 радиоактивных изотопа, каждый из которых независимо выбран из 3H, 14C, 15N, 18O, 32P и 125I. В другом варианте осуществления меченное радиоактивным изотопом соединение формулы (I) содержит один радиоактивный изотоп, выбранный из 3H, 14C, 15N, 18O, 32P и 125I.

Меченные радиоактивным изотопом соединения по изобретению могут быть получены способами, известными в данной области техники. Например, меченные тритием соединения формулы (I) могут быть получены введением трития в определенное соединение формулы (I), например, каталитическим дегалогенированием с тритием. Данный способ может включать в себя взаимодействие подходящим образом галогензамещенного предшественника соединения формулы (I) с газообразным тритием в присутствии подходящего катализатора, например, Pd/C, в присутствии или в отсутствие основания. Другие подходящие способы получения тритиированного соединения можно найти у Filer, "The Preparation and Characterization of Tritiated Neurochemicals," Chapter 6, pp.155-192 in Isotopes in the Physical and Biomedical Sciences, Vol.1, Labeled Compounds (Part A) (1987). 14C-меченые соединения могут быть получены, используя исходные материалы, содержащие атомы углерода 14С. Соединения, содержащие пиперазин, обогащенный изотопами 13С и/или 15N, могут быть получены, как описано, например, в фигуре 5А и в соответствующем описании, из патента США №7355045 В2.

Соединение формулы (I) может содержать один или более асимметричных центров и может, таким образом, давать энантиомеры, диастереомеры и другие стереоизомерные формы. Если специально не указано иное, настоящее описание охватывает соединения со всеми такими возможными формами, а также их рацемическими и разделенными формами или любую их смесь. Когда соединение формулы (I) содержит олефиновую двойную связь или другой центр геометрической асимметрии, и, если специально не указано иное, то подразумевается, что данное соединение формулы (I) включает в себя все "геометрические изомеры", например, как Е-, так и Z-геометрические изомеры. Если специально не указано иное, все "таутомеры", например, таутомеры кетон-енол, амид-имидовая кислота, лактам-лактим, енамин-имин, амин-имин и енамин-енимин, также предназначены для включения в настоящее раскрытие.

Для целей настоящего изобретения термины "стереоизомер", "стереоизомерные формы" и тому подобное представляют собой общие термины для всех изомеров индивидуальных молекул, которые отличаются только ориентацией своих атомов в пространстве. Данные термины включают в себя энантиомеры и изомеры соединений с более чем одним хиральным центром, которые не являются зеркальными отражениями друг с другом ("диастереомеры").

Термин "хиральный центр" относится к атому углерода, к которому присоединены четыре различные группы.

Термин "энантиомер" или "энантиомерный" относится к молекуле, которая не совмещается со своим зеркальным изображением и, следовательно, оптически активна, где энантиомер вращает плоскость поляризованного света в одном направлении, а его зеркальное изображение вращает плоскость поляризованного света в противоположном направлении.

Термин "рацемический" относится к смеси равных частей энантиомеров, которая является оптически неактивной.

Термин "разрешение" относится к разделению или концентрации или истощению одной из двух энантиомерных форм молекулы. Оптические изомеры соединения формулы (I) могут быть получены известными способами, такими как хиральная хроматография или образование диастереомерных солей из оптически активной кислоты или основания. Оптическая чистота может быть сформулирована в терминах энантиомерного избытка (enantiomeric excess) (% ее), который определяется по формуле:

Термин "МеОН" означает метанол, т.е. метиловый спирт.

Термин "EtOH" означает этанол, т.е. этиловый спирт.

Термин "t-BuOH" означает трет-бутиловый спирт, т.е. 2-метилпропан-2-ол.

Термин "THF" означает тетрагидрофуран.

Термин "DMF" означает N,N-диметилформамид.

Термин "DCM" означает метиленхлорид, т.е. дихлорметан.

Термин "DCE" означает дихлорэтан.

Термин "DME" означает 1,2-диметоксиэтан, то есть диметиловый эфир этиленгликоля.

Термин "EtOAc" означает этилацетат.

Термин "NH4OH" означает гидроксид аммония.

Термин "TEA" означает триэтиламин.

Термин "MeCN" означает ацетонитрил.

Термин "NaH" означает гидрид натрия.

Термин "АсОН" означает уксусную кислоту.

Термин "DMSO" означает диметилсульфоксид, т.е. метилсульфинилметан.

Термин "DIEA" означает диизопропилэтиламин, т.е., N-этил-N-изопропилпропан-2-амин.

Термин "BuLi" означает бутиллитий.

Термин "ВОС" означает трет-бутилоксикарбонил:

Термин "НОВТ" означает гидрат 1-гидроксибензотриазола.

Термин "EDCI" означает 1-этил-3-[3-(диметиламино)пропил]карбодиимид.

Термин "IBD" означает воспалительное заболевание кишечника (inflammatory-bowel disease).

Термин "IBS" означает синдром раздраженного кишечника (irritable-bowel syndrome).

Термин "ALS" означает боковой амиотрофический склероз (amyotrophic lateral sclerosis).

Выражение "эффективное количество" при использовании в связи с соединением формулы (I) представляет собой количество, эффективное для: (а) лечения или профилактики болезненного состояния или его симптома, (b) детектируемого ингибирования функции рецептора TRPV1 в клетке или (с) детектируемой активации функции рецептора TRPV1 в клетке.

Выражение "эффективное количество" при использовании в связи с другим терапевтическим средством или вторым терапевтическим средством означает количество для обеспечения терапевтического эффекта второго терапевтического средства.

Выражение "терапевтический индекс" описывает промежуток между дозой, которая является эффективной, и дозой, которая вызывает побочные эффекты.

Термины "модулировать", "модулирование" и тому подобные, как используется в настоящем описании по отношению к рецептору TRPV1, означают опосредование фармакодинамического ответа (например, анальгезия) у животного (i) ингибированием или активированием рецептора или (ii) прямым или косвенным влиянием на нормальную регуляцию активности рецептора. Соединения, которые модулируют активность рецептора, включают в себя агонисты, частичные агонисты, антагонисты, смешанные агонисты/антагонисты, смешанные частичные агонисты/антагонисты и соединения, которые прямо или косвенно влияют на регуляцию активности рецептора.

Для целей настоящего изобретения соединение, которое связывается с рецептором и имитирует регулирующий эффект(ы) эндогенного лиганда, определяется как "агонист". Для целей настоящего изобретения соединение, которое связывается с рецептором и является только частично эффективным в качестве агониста, определяется как "частичный агонист". Для целей настоящего изобретения соединение, которое связывается с рецептором, но не производит регулирующее действие, а скорее блокирует связывание другого агента с рецептором, определяется как "антагонист". (См. Ross and Kenakin, Pharmacodynamics: Mechanisms of Drug Action and the Relationship Between Drug Concentration and Effect, Chapter 2 in Goodman & Gilman's The Pharmacological Basis of Therapeutics 31-32 (Hardman et al., eds., 10th ed. 2001).

Выражения "лечение", "лечить" и тому подобное включают в себя улучшение или прекращение болезненного состояния или его симптома. В одном варианте осуществления лечение включает в себя подавление, например, уменьшение общей частоты эпизодов болезненного состояния или его симптома.

Выражения "профилактика", "предотвращение" и тому подобное включают в себя избегание наступления болезненного состояния или его симптома.

"Расстройство" включает в себя, но без ограничения, болезненные состояния, определенные выше.

В случае возникновения сомнений в отношении согласия изображенной химической структуры и химического названия, определяющей является изображенная химическая структура.

Следует понимать, что различные признаки раскрытия настоящего изобретения, которые для ясности описаны в контексте отдельных вариантов осуществления, также могут быть представлены в комбинации в одном варианте осуществления, если иное не исключено в настоящем описании специально. Наоборот, различные признаки раскрытия настоящего изобретения, которые для краткости описаны в контексте одного варианта осуществления, также могут быть представлены отдельно и/или в любой подходящей субкомбинации, если иное не исключено в настоящем описании специально.

4.4 Способы изготовления соединений формулы (I)

Соединения формулы (I) могут быть изготовлены с использованием обычного органического синтеза или иллюстративными способами, приведенными на схемах ниже.

4.4.1 Способы введения винильной группы в замещенный пиридин

4.4.1.1 Реакция перекрестного сочетали Сузуки

Введение винильной группы реакцией перекрестного сочетания Сузуки иллюстрируется на схеме 1 ниже, где R1 и R4 такие, как определено выше, L представляет собой галоген, и каждый R5 независимо выбран из -(С14)алкила, или обе R5-группы вместе образуют группу -СН2-CH2- или -СН2-СН2-СН2-, связывающую каждый атом кислорода и атом бора, к которому они присоединены в кольцо, которое может быть необязательно замещено одной или более -CH3-группами.

В одном варианте осуществления уходящие группы (L) в положении 2 и положении 5 пиридинового кольца соединения формулы 1 могут быть выбраны так, чтобы представлять собой тот же самый атом галогена, например, каждая группа представляет собой бром, или, в другом варианте осуществления, могут быть выбраны так, чтобы представлять собой различные атомы галогена. Например, уходящая группа в положении 2 пиридинового кольца в соединении формулы 1 может представлять собой -Cl, в то время как уходящая группа в положении 5 пиридинового кольца может представлять собой -Br. Примеры боронатных сложных эфиров 2 включают в себя, но без ограничения, 4,4,6-триметил-2-винил-1,3,2-диоксаборинан, 4,4,5,5-тетраметил-2-винил-1,3,2-диоксаборолан и ди-н-бутилвиниловый эфир бороновой кислоты. Реакцию проводят в подходящем органическом растворителе (например, THF или DMF) в присутствии избытка фторида тетра(н-бутил)аммония (TBAF). В альтернативном варианте осуществления вместо TBAF может быть использован CsF. Примеры палладиевых катализаторов включают в себя, но без ограничения, [1,1'-бис(дифенилфосфино)ферроцен]дихлорпалладий(II) (Pd(DPPF)Cl2) и бис(трифенилфосфин)дихлорпалладий(II) (Pd(PPh3)2Cl2). Реакцию можно проводить в присутствии такого основания, как карбонат калия. Соединения формулы 1 являются коммерчески доступными или могут быть получены способами, известными в данной области техники.

4.4.1.2 Окисление с последующим олефинированием по Виттигу

Альтернативный способ введения винильной группы показан на схеме 2 ниже, где R1 и L такие, как определено выше.

Первая стадия включает в себя окисление спиртовой группы в соединении формулы 4 до альдегида с получением таким образом соединения формулы 5. Альдегидную группу в соединении формулы 5 затем превращают в винильную группу реакцией олефинирования по Виттигу, чтобы обеспечить соединение формулы 6. Соединения формулы 4 являются коммерчески доступными или могут быть получены способами, известными в данной области техники.

4.4.1.3 Восстановление с последующей дегидратацией

Альтернативный способ введения винильной группы показан на схеме 3 ниже, где R1, R4 и L такие, как определено выше.

Первая стадия включает в себя восстановление кетоновой группы в соединении формулы 7 до гидроксильной группы соединения формулы 8. После добавления п-толуолсульфоновой кислоты соединение формулы 8 дегидратируется с образованием соединения формулы 3. Соединения формулы 7 являются коммерчески доступными или могут быть получены способами, известными в данной области техники.

4.4.2 Способы получения диолов

4.4.2.1 Асимметричное дигидроксилирование винилзамещенных пиридинов

Асимметричное дигидроксилирование может быть осуществлено, как показано ниже на схеме 4, где соединение формулы 3 показано в качестве исходного материала, и где R1, R4 и L такие, как определено выше. Соединение формулы 6 может также служить в качестве исходного материала в схеме 4.

Как изображено на схеме 4, стереохимия полученного диола зависит от хиральности лиганда, используемого в смеси AD, как описано, например, у Sharpless et al., J. Org. Chem. 57:2768-2771 (1992) и на схемах 1.14 и 1.15 в заявке на патент США №2009/0170868 A1. AD-смесь состоит из следующих компонентов: осмат калия (K2OsO2(OH)4), феррицианид калия (K3Fe(CN)6), карбонат калия (K2CO3) и хиральные лиганды, как изображено на схеме 5. В одном варианте осуществления в результате реакции образуется хиральный диол, содержащий энантиомерный избыток (enantiomeric excess (ее)), составляющий по меньшей мере около 80%. В другом варианте осуществления в результате реакции образуется хиральный диол, имеющий % ее, составляющий по меньшей мере около 90%. В другом варианте осуществления в результате реакции образуется хиральный диол, имеющий % ее, составляющий по меньшей мере около 93%. В другом варианте осуществления в результате реакции образуется хиральный диол, имеющий % ее, составляющий по меньшей мере около 94%. В другом варианте осуществления в результате реакции образуется хиральный диол, имеющий % ее, составляющий по меньшей мере около 95%. В другом варианте осуществления в результате реакции образуется хиральный диол, имеющий % ее, составляющий более 95% (например, от 95,1% до 99,9%.) В другом варианте осуществления в результате реакции образуется хиральный диол, имеющий % ее, составляющий по меньшей мере около 96%. В другом варианте осуществления в результате реакции образуется хиральный диол, имеющий % ее, составляющий более 96% (например, от 96,1% до 99,9%.) В другом варианте осуществления в результате реакции образуется хиральный диол, имеющий % ее, составляющий по меньшей мере около 97%. В другом варианте осуществления в результате реакции образуется хиральный диол, имеющий % ее, составляющий более 97% (например, от 97,1% до 99,9%.)

Схема 5

4.4.2.2 Получение хиральных диодов посредством амидов Вайнреба (Weinreb)

Диастереомеры соединений формул 10а и 10b могут быть получены альтернативного синтетическим путем. Пример такого альтернативного пути изображен на схемах 6-10 ниже. Амид Вайнреба формулы 14 сначала получают обычными способами, как изображено на схеме 6.

На схеме 6 защита гидроксильной группы в соединении формулы 11 трет-бутилдиметилсилиловой (TBS) группой с последующим гидролизом дает соединение формулы 12. Взаимодействие соединения формулы 12 с соединением формулы 13 (в котором WSC представляет собой 1-(3-(диметиламино)пропил-3-этил-карбодиимид) дает соединение формулы 14. Соединения формул 11 и 13 являются коммерчески доступными или могут быть получены способами, известными в данной области техники.

Соединение формулы 14 затем подвергают взаимодействию с соединением формулы 1 в присутствии хлорида изо-пропилмагния и хлорида лития для получения соединения формулы 15, как изображено на схеме 7, где R1 и L такие, как определено выше.

Диастереоселективное восстановление соединения формулы 15 с восстановителем органоборана L-селектридом дает соединение формулы 16, как изображено на схеме 8.

Реакцию предпочтительно проводят в смешанной системе растворителей, такой как гексан/THF при низкой температуре (например, -78°С). Соединение формулы 16 затем подвергают взаимодействию с 4-нитробензойной кислотой в присутствии трифенилфосфина и диэтилазодикарбоксилата (DEAD) с получением соединения формулы 17, как изображено на схеме 9.

Схема 9

Основный гидролиз соединения формулы 17 с последующим удалением группы TBS дает соединение формулы 10c', как изображено на схеме 10, где знак апострофа ("'") обозначает, что R4 представляет собой CH3. Энантиомерный избыток (ее) соединения формулы 10c' составляет по меньшей мере около 80% и/или % ее значений, как изложено выше со ссылкой на схему 4.

Следует иметь в виду, что, когда энантиомер соединения формулы 11 (см. схему 6), т.е. соединение 11a, используют в качестве исходного материала, то энантиомер соединения формулы 10c', т.е. соединение 10d', получают, как изображено на схеме 11, выполняя стадии, как изображено на схемах от 6 до 10.

Энантиомерный избыток (ее) соединения формулы 10d' составляет по меньшей мере около около 80% и/или % ее значений, как изложено выше со ссылкой на схему 4.

Соединения формулы 11а являются коммерчески доступными или могут быть получены способами, известными в данной области техники.

4.4.2.3 Получение рацемических диодов

Рацемические диолы могут быть получены способами, известными в данной области техники, с использованием тетроксида осмия (OsO4) и N-метилморфолин-N-оксида (NMO) в водном растворе ацетона.

4.4.3 Способы присоединения замещенных пиридинов к пиперазинам

Соединение формулы 18 может быть получено добавлением соединения формулы 10 к соединению формулы 19 в присутствии палладиевого катализатора, как изображено на схеме 12, где R1, R4, m и L такие, как определено выше.

Следует иметь в виду, что в соответствии с настоящим описанием, соединение формулы 19 имеет одну из следующих структур:

Соединения формулы 19 являются коммерчески доступными или могут быть получены способами, известными в данной области техники. Следует дополнительно отметить, что соединение формулы 19 может быть подвергнуто взаимодействию с соединением формулы 10а, 10b, 10c' или 10d', чтобы получить соединение формулы 18а, 18b, 18c' или 18d', соответственно.

В альтернативном варианте осуществления соединение формулы 18 может быть получено, как изображено на схеме 13, где R1, R4, m и L такие, как определено выше, и PN представляет собой защитную группу азота (например, ВОС).

В данном варианте осуществления гидроксильные группы в соединении формулы 10 защищены с получением соединения формулы 20 до присоединения соединения формулы 20 к соединению формулы 21. Такая защита осуществляется через добавление 2,2-диметоксипропана к соединению формулы 10 в присутствии моногидрата пара-толуолсульфоновой кислоты (PTSA) для получения соединения формулы 20. Соединение формулы 20 затем подвергают взаимодействию с соединением формулы 21 в присутствии палладиевого катализатора и основания с получением соединения формулы 22. Соединение формулы 22 затем подвергают взаимодействию с избытком кислоты, например, HCl, для получения незащищенного соединения формулы 18. Следует иметь в виду, что в соответствии с настоящим описанием, соединение формулы 21 имеет одну из следующих структур:

Соединения формулы 21 являются коммерчески доступными или могут быть получены способами, известными в данной области техники. Следует также отметить, что соединение формулы 10 может быть заменено в схеме 13 соединением формулы 10а, 10b, 10c' или 10d' с получением соединения формулы 18а, 18b, 18c' или 18d', соответственно. В данных вариантах осуществления энантиомерный избыток (ее) соединения формулы 18а (или 18b или 18c' или 18d') составляет по меньшей мере около 80% и/или % ее значений, как изложено выше со ссылкой на схему 4.

4.4.4 Способы получения бензотиазол-2-аминов формулы 23

Соединение формулы 23 может быть получено добавлением тиоцианата калия, брома и уксусной кислоты к соединению формулы 24, как изображено на схеме 14, где R8 и R9 такие, как определено выше. Соединение формулы 23 осаждают из раствора после добавления гидроксида аммония. Соединения формулы 24 являются коммерчески доступными или могут быть получены способами, известными в данной области техники.

4.4.5 Способы получения карбоксамидов формулы 26

Соединение формулы 26 может быть получено добавлением соединения формулы 23 к соединению формулы 25 в присутствии основания, такого как TEA или DIEA, как изображено на схеме 15, где R1, R4, R8, R9 и m такие, как определено выше, и каждый L2 представляет собой уходящую группу, независимо выбранную из фенильной, 4-нитрофенильной и имидазол-1-ильной группы. Соединения формулы 25 являются коммерчески доступными или могут быть получены способами, известными в данной области техники.

Схема 15

4.4.6 Способы получения пиперазиновых производных формулы (I)

Соединение формулы (I) может быть получено добавлением соединения формулы 26 к соединению формулы 18, как изображено на схеме 16, где R1, R4, R8, R9, m и L2 такие, как определено выше.

В некоторых вариантах осуществления реакцию проводят в DCM или апротонном органическом растворителе. В некоторых вариантах осуществления соединение формулы 18а, 18b, 18c' или 18d' обрабатывают соединением формулы 26 с получением энантиомерно обогащенного диола, как проиллюстрировано в неограничивающей схеме 17 для соединения формулы 18а, где R1, R4, R8, R9, m и L2 такие, как определено выше. В данных вариантах осуществления энантиомерный избыток (ее) соединения формулы (I) составляет по меньшей мере около 80%. В другом варианте осуществления реакция производит соединение формулы (I), имеющее % ее, составляющее по меньшей мере около 90%. В другом варианте осуществления реакция производит соединение формулы (I), имеющее % ее, составляющее по меньшей мере около 93%. В другом варианте осуществления реакция производит соединение формулы (I), имеющее % ее, составляющее по меньшей мере около 94%. В другом варианте осуществления реакция производит соединение формулы (I), имеющее % ее, составляющее по меньшей мере около 95%. В другом варианте осуществления реакция производит соединение формулы (I), имеющее ее, составляющее более 95% (например, от 95,1% до 99,9%.) В другом варианте осуществления реакция производит соединение формулы (I), имеющее % ее, составляющее по меньшей мере около 96%. В другом варианте осуществления реакция производит соединение формулы (I), имеющее % ее, составляющее более 96% (например, от 96,1% до 99,9%.) В другом варианте осуществления реакция производит соединение формулы (I), имеющее % ее, составляющее по меньшей мере около 97%. В другом варианте осуществления реакция производит соединение формулы (I), имеющее % ее, составляющее более 97% (например, от 97,1% до 99,9%.)

Следует иметь в виду, что для получения соединений формулы (I) могут быть использованы альтернативные способы. Например, как изображено на схеме 18, соединение формулы 3 может быть добавлено к соединению формулы 21 с получением соединения формулы 27, например, по способу стадии 2 схемы 13, где R1, R4, m, и PN такие, как определено выше.

Схема 18

Соединение формулы 27 затем дигидроксилируют, например, по способу схемы 4, схем от 6 до 10 или схемы 11 с получением соединения формулы 28, как изображено на схеме 19, где R1, R4, m, и PN такие, как определено выше.

Например, реакция, изображенная на схеме 19, может быть выполнена энантиоселективным способом с использованием реакционных условий, описанных на схеме 4. Альтернативно, рацемический диол может быть получен способами, известными в данной области техники, с использованием тетроксида осмия (OsO4) и N-метилморфолин-N-оксида (NMO) в водном растворе ацетона.

Как изображено на схеме 20, где R1, R4, m, PN и L2 такие, как определено выше, с соединения формулы 28 снимают защиту избытком кислоты, например, HCl, с получением соединения формулы 18, например, по способу стадии 3 схемы 13. Взаимодействие соединения формулы 18 с соединением формулы 26 в присутствии основания (см., например, схемы 16 и 17) дает соединение формулы (I).

Схема 20

Ход вышеизложенной(ых) реакции(й) можно контролировать с помощью обычных аналитических способов, включая, но без ограничения, высокоэффективную жидкостную хроматографию (ВЭЖХ), колоночную хроматографию, тонкослойную хроматографию (ТСХ), газовую хроматографию (ГХ), масс-спектрометрию (MS) и спектроскопию ядерного магнитного резонанса (ЯМР), например, 1Н-ЯМР и 13C-ЯМР. Соединения формулы (I) могут быть выделены и дополнительно обработаны при желании. В одном варианте осуществления соединение формулы (I) выделяют удалением растворителя при пониженном давлении. В другом варианте осуществления соединение формулы (I) выделяют экстракцией. Соединения формулы (I) могут быть дополнительно подвергнуты, например, колоночной хроматографии или перекристаллизации.

Подходящие апротонные органические растворители для применения в иллюстративных способах включают в себя, но без ограничения, DCM, ДМСО, хлороформ, толуол, бензол, ацетонитрил, тетрахлорид углерода, пентан, гексан, лигроин и диэтиловый эфир. В одном варианте осуществления апротонный органический растворитель представляет собой DCM.

Один или более атомов водорода, углерода или другой атом(ы) соединения формулы (I) может быть заменен на изотоп атома водорода, углерода или другого атома(ов). Такие соединения, которые охватываются настоящим раскрытием, могут применяться, например, в качестве исследовательских и диагностических средств в фармакокинетических исследованиях метаболизма и в анализах связывания.

4.5 Терапевтическое применение соединений формулы (I)

В соответствии с настоящим описанием соединения формулы (I) вводят животному, нуждающемуся в лечении или профилактике болезненного состояния.

В одном варианте осуществления эффективное количество соединения формулы (I) может быть использовано для лечения или профилактики любого болезненного состояния, которое поддается лечению или предотвращается ингибированием TRPV1. Примеры болезненных состояний, которые поддаются лечению или предотвращаются ингибированием TRPV1, включают в себя, но без ограничения, боль, например, боль, связанную с остеоартритом, остеоартрит, UI, язвенную болезнь, IBD и/или IBS.

Соединения формулы (I) или их фармацевтически приемлемое производное могут быть использованы для лечения или профилактики острых или хронических болей. Примеры боли, которую можно лечить или предотвращать с помощью соединения формулы (I), включают в себя, но без ограничения, раковую боль, невропатическую боль, боль при работе, боль при инфаркте миокарда, боль при нарушениях поджелудочной железы, колики, послеоперационную боль, головную боль, мышечную боль, боль в суставах и боль, связанную с пародонтозными заболеваниями, включая гингивит и периодонтит.

Соединения формулы (I) или их фармацевтически приемлемое производное также могут быть использованы для лечения или профилактики боли, связанной с воспалением или с воспалительным заболеванием у животного. Такая боль может возникать там, где происходит воспаление ткани тела, которое может представлять собой локальный воспалительный ответ и/или системное воспаление. Например, соединения формулы (I) могут быть использованы для лечения или профилактики боли, связанной с воспалительными заболеваниями, включая, но без ограничения: отторжение пересаженного органа; реоксигенационную травму в результате трансплантации органов (см. Grupp et al., "Protection against Hypoxia-reoxygenation in the Absence of Poly (ADP-ribose) Synthetase in Isolated Working Hearts," J. Mol. Cell Cardiol. 31:297-303 (1999)), включая, но без ограничения, пересадку сердца, легких, печени или почек; хронические воспалительные заболевания суставов, включая артрит, ревматоидный артрит, остеоартрит и костные заболевания, связанные с повышенной резорбцией кости; воспалительные заболевания кишечника, такие как илеит, язвенный колит, синдром Барретта и болезнь Крона; воспалительные заболевания легких, такие как астма, респираторный дистресс-синдром взрослых и хроническую обструктивную болезнь дыхательных путей; воспалительные заболевания глаз, включая дистрофию роговицы, трахому, онхоцеркоз, увеит, симпатической офтальмит и эндофтальмит; хронические воспалительные заболевания десен, включая гингивит и периодонтит; туберкулез, проказу; воспалительные заболевания почек, включая уремические осложнения, гломерулонефрит и нефроз; воспалительные заболевания кожи, включая склеродермию, псориаз и экзему; воспалительные заболевания центральной нервной системы, включая хронические демиелинизирующие заболевания нервной системы, рассеянный склероз, СПИД-связанную нейродегенерацию и болезнь Альцгеймера, инфекционный менингит, энцефаломиелит, болезнь Паркинсона, болезнь Хантингтона, боковой амиотрофический склероз и вирусный или аутоиммунный энцефалит; аутоиммунные заболевания, включая сахарный диабет I типа и II типа; диабетические осложнения, включая, но без ограничения, диабетическую катаракту, глаукому, ретинопатию, нефропатию (например, микроальбуминурию и прогрессивную диабетическую нефропатию), полинейропатию, мононевропатию, автономную нейропатию, гангрену ног, атеросклеротическую коронарную артериальную болезнь, заболевание периферических артерий, некетонемическую гипергликемическую гиперосмолярную кому, язвы ног, проблемы с суставами и осложнение, связанное с кожей или слизистой оболочкой (например, инфекция, пятно на голени, кандидозная инфекция или некробиоз lipoidica diabeticorum); иммуннокомплексный васкулит и системная красная волчанка (СКВ); воспалительные заболевания сердца, такие как кардиомиопатия, гиперхолестеринемия при ишемической болезни сердца и атеросклероз; а также различные другие заболевания, которые могут иметь значительные воспалительные компоненты, включая преэклампсию, хроническую недостаточность печени, травмы мозга и спинного мозга и рак. Соединения формулы (I) также могут быть использованы для ингибирования, лечения или профилактики боли, связанной с воспалительным заболеванием, которое, например, может представлять собой системное воспаление тела, примером которого является грамположительный или грамотрицательный шок, геморрагический или анафилактический шок, или шок, индуцированный химиотерапией рака в ответ на провоспалительные цитокины, например, шок, связанный с провоспалительными цитокинами. Такой шок может быть вызван, например, химиотерапевтическим средством, который вводят для лечения рака.

Соединения формулы (I) или их фармацевтически приемлемое производное также могут быть использованы для лечения или профилактики боли, связанной с повреждением нерва (т.е. невропатической боли). Хроническая невропатическая боль представляет собой гетерогенное болезненное состояние с неясной этиологией. При хронической невропатической боли боль может быть опосредована несколькими механизмами. Данный тип боли обычно возникает после травмы в периферической или центральной нервной ткани. Синдромы включают в себя боль, связанную с повреждением спинного мозга, рассеянным склерозом, постгерпетической невралгией, невралгией тройничного нерва, фантомной болью, каузалгией и рефлекторной симпатической дистрофией и болью в пояснице. Хроническая боль отличается от острой боли в том, что хронические больные с нейропатической болью страдают аномальными болевыми ощущениями, которые могут быть описаны как спонтанные боли, постоянное поверхностное горение и/или глубокая ноющая боль. Боль может быть вызвана тепло-, холодо- и механогипералгезией или тепло-, холодо- или механоаллодинией.

Хроническая невропатическая боль может быть вызвана травмой или инфекцией периферических сенсорных нервов. Она включает, но без ограничения, боль, вызванную травмой периферических нервов, инфекцией вируса герпеса, сахарным диабетом, каузалгией, повреждением сплетения, невромой, ампутацией конечностей и васкулитом. Невропатическая боль также может быть вызвана повреждением нервов при хроническом алкоголизме, инфекции вируса иммунодефицита человека, гипотиреозе, уремии или витаминной недостаточности. Инсульт (спинного или головного мозга) и повреждение спинного мозга может также вызвать нейропатическую боль. Связанная с раком нейропатическая боль возникает от сжатия растущей опухолью соседних нервов, мозга или спинного мозга. Кроме того, лечение рака, включая химиотерапию и лучевую терапию, может привести к травме нерва. Нейропатическая боль включают в себя, но без ограничения, боль, вызванную травмой нервов, такую как, например, боль, от которой страдают больные сахарным диабетом.

Соединения формулы (I) или их фармацевтически приемлемое производное могут быть использованы для лечения или профилактики мигрени, включая, но без ограничения, мигрень без ауры ("общую мигрень"), мигрень с аурой ("классическую мигрень"), мигрень без головной боли, базилярную мигрень, семейную гемиплегическую мигрень, мигренозный миокард и мигрень с длительной аурой.

Соединения формулы (I) или их фармацевтически приемлемое производное могут быть использованы для лечения или профилактики боли, связанной с остеоартритом. Остеоартрит (ОА), также известный как остеоартроз, дегенеративный артрит или дегенеративное заболевание суставов, представляет собой группу механических нарушений, включающую в себя деградацию суставов, включая суставной хрящ и субхондральную кость. Примеры ОА, поддающихся лечению или предотвратимых с помощью соединений формулы (I), включают в себя, но без ограничения, боли в суставе, тугоподвижность сустава, нежность сустава, "запирание" сустава и эффузию сустава.

Соединения формулы (I) или их фармацевтически приемлемое производное могут быть использованы для лечения или профилактики UI. Примеры UI, поддающихся лечению или предотвратимых с помощью соединений формулы (I), включают в себя, но без ограничения, недержание мочи, стрессовое недержание мочи, недержание переполнения, нейрогенное недержание мочи и общее недержание мочи.

Соединения формулы (I) или их фармацевтически приемлемое производное могут быть использованы для лечения или предотвращения язвы. Примеры язв, поддающихся лечению или предотвратимых с помощью соединений формулы (I), включают в себя, но без ограничения, язву двенадцатиперстной кишки, язву желудка, маргинальную язву, язву пищевода или язву, вызванную стрессом.

Соединения формулы (I) или их фармацевтически приемлемое производное могут быть использованы для лечения или профилактики IBD, включая болезнь Крона и язвенный колит.

Соединения формулы (I) или их фармацевтически приемлемое производное могут быть использованы для лечения или профилактики IBS. Примеры IBS, поддающихся лечению или предотвратимых с помощью соединений формулы (I), включают в себя, но без ограничения, тип IBS "спастический толстый кишечник" и IBS с преобладанием запоров. Заявители полагают, что соединения формулы (I) или их фармацевтически приемлемое производное являются антагонистами TRPV1. Настоящее изобретение дополнительно относится к способам ингибирования функции TRPV1 в клетке, содержащим контактирование клетки, способной экспрессировать TRPV1, с эффективным количеством соединения формулы (I) или его фармацевтически приемлемого производного. Данный способ может быть использован in vitro, например, как тест для отбора клеток, которые экспрессируют TRPV1 и, соответственно, применяются как часть теста для отбора соединений, применяемых для лечения или профилактики боли, например, боли, связанной с остеоартритом, остеоартрита, UI, язвы, IBD или IBS. Способ также применяют для ингибирования функции TRPV1 в клетке in vivo, в животном, человеке в одном варианте осуществления, контактированием клетки, в животном, с эффективным количеством соединения формулы (I) или его фармацевтически приемлемого производного. В одном варианте осуществления способ применяют для лечения или профилактики боли у животного. В другом варианте осуществления способ применяют для лечения или профилактики UI у животного. В другом варианте осуществления способ применяют для лечения или профилактики язвы у животного. В другом варианте осуществления способ применяют для лечения или профилактики IBD у животного. В другом варианте осуществления способ применяют для лечения или профилактики IBS у животного.

Примеры тканей, содержащих клетки, способные экспрессировать TRPV1, включают в себя, но без ограничения, ткани нейронов, мозга, почек, уротелия и мочевого пузыря.

Способы анализа клеток, которые экспрессируют TRPV1, известны в данной области техники.

4.6 Терапевтическое/профилактическое введение и композиции раскрытия

Благодаря их активности, соединения формулы (I) или их фармацевтически приемлемое производное предпочтительно применяются в ветеринарии и медицине. Как описано выше, соединения формулы (I) или их фармацевтически приемлемое производное применяются для лечения или профилактики болезненного состояния.

При введении в организм животного соединения формулы (I) или их фармацевтически приемлемые производные вводят, в одном варианте осуществления, в качестве компонента композиции, которая содержит фармацевтически приемлемый носитель или наполнитель. Композиции, которые содержат соединение формулы (I) или его фармацевтически приемлемое производное, могут быть введены перорально. Соединения формулы (I) или их фармацевтически приемлемое производное также могут быть введены любым другим удобным способом, например, инфузией или болюсной инъекцией, абсорбцией через эпителиальные или кожно-слизистые накладки (например, пероральные, ректальные и слизистой оболочки кишечника и т.д), и могут быть введены вместе с другим терапевтически активным средством. Введение может быть системным или местным. Известны различные системы доставки, например, инкапсулирование в липосомы, микрочастицы, микрокапсулы, капсулы и т.п., которые могут быть использованы для введения соединения формулы (I) или его фармацевтически приемлемого производного.

Способы введения включают в себя, но без ограничения, внутрикожный, внутримышечный, внутрибрюшинный, внутривенный, подкожный, интраназальный, эпидуральный, пероральный, сублингвальный, внутримозговой, интравагинальный, чрескожный, ректальный, ингаляцией или местный, в частности, в уши, нос, глаза или на кожу. Способ введения остается на усмотрение врача. В большинстве случаев введение приводит к высвобождению соединений формулы (I) или его фармацевтически приемлемого производного в кровоток.

В определенных вариантах осуществления может возникнуть необходимость введения соединений формулы (I) или его фармацевтически приемлемого производного локально.

Это может быть достигнуто, например, а не в качестве ограничения, локальной инфузией во время операции, локальным применением, например, в сочетании с раневой повязкой после операции, инъекцией, посредством катетера, посредством суппозитория или клизмы или с помощью имплантата, причем указанный имплантат состоит из пористого, непористого или желатинового материала, в том числе мембран, например сиаластичных, или волокон.

В некоторых вариантах осуществления может возникнуть необходимость введения соединений формулы (I) или его фармацевтически приемлемого производного в центральную нервную систему или желудочно-кишечный тракт любым подходящим путем, включая внутрижелудочковый, внутриоболочечный и эпидуральную инъекцию и клизму. Внутрижелудочковая инъекция может быть облегчена с помощью внутрижелудочкового катетера, например, прикрепленного к резервуару, такому как резервуар Оммайя (Ommaya).

Также может быть использовано легочное введение, например, используя ингалятор или распылитель и препарат с распылительным средством, или через перфузию в фторуглероде или синтетическом легочном сурфактанте. В некоторых вариантах осуществления соединения формулы (I) могут быть приготовлены в виде суппозитория с общепринятыми связующими веществами и наполнителями, такими как триглицериды.

В другом варианте осуществления соединения формулы (I) или их фармацевтически приемлемое производное могут быть доставлены в везикуле, в частности, в липосоме (см. Langer, "New Methods of Drug Delivery," Science 249:1527-1533 (1990); Lopez-Berestein, "Treatment of Systemic Fungal Infections with Liposomal-Amphotericin B," Liposomes in the Therapy of Infectious Disease and Cancer, pp.317-327 (1989); и Treat et al., "Liposome encapsulated doxorubicin - preliminary results of phase I and phase II trials" Liposomes in the Therapy of Infectious Disease and Cancer, pp.353-365 (1989).

В еще одном варианте осуществления соединения формулы (I) или их фармацевтически приемлемое производное могут быть доставлены в системе с контролируемым или замедленным высвобождением (см., например, Goodson, "Dental Applications," pp.115-138 in Medical Applications of Controlled Release, Vol.2, Applications and Evaluation, Langer and Wise, eds., CRC Press (1984), далее "Goodson"). Могут быть использованы другие контролируемые системы или системы с замедленным высвобождением, обсуждаемые в обзоре Langer, Science 249:1527-1533 (1990). В одном из вариантов осуществления может быть использован насос (Langer, Science 249:1527-1533 (1990); Sefton, "Implantable Pumps," в CRC Crit. Rev. Biomed. Eng. 14(3):201-240 (1987); Buchwald et al., "Long-term, Continuous Intravenous Heparin Administration by an Implantable Infusion Pump in Ambulatory Patients with Recurrent Venous Thrombosis," Surgery 88:507-516 (1980); и Saudek et al., "A Preliminary Trial of the Programmable Implantable Medication System for Insulin Delivery," New Engl. J. Med. 321:574-579 (1989)). В другом варианте осуществления могут быть использованы полимерные материалы (см. Goodson; Smolen et al., "Drug Product Design and Performance," Controlled Drug Bioavailability Vol.1, John Wiley & Sons, New York (1984); Langer et al., "Chemical and Physical Structure of Polymers as Carriers for Controlled Release of Bioactive Agents: A Review," J. Macromol. Sci. Rev. Macromol. Chem. C23(1):61-126 (1983); Levy et al., "Inhibition of Calcification of Bioprosthetic Heart Valves by Local Controlled-Release Diphosphonate," Science 228:190-192 (1985); During et al., "Controlled Release of Dopamine from a Polymeric Brain Implant: In Vivo Characterization," Ann. Neurol. 25:351-356 (1989); и Howard et al., "Intracerebral drug delivery in rats with lesion-induced memory deficits," J. Neurosurg. 71:105 (1989)). В еще одном варианте осуществления система с контролируемым или замедленным высвобождением может быть размещена в непосредственной близости от мишени соединений формулы (I), представляющей собой, например, позвоночник, мозг или желудочно-кишечный тракт, таким образом, требуя только часть системной дозы.

Композиции могут необязательно содержать подходящее количество фармацевтически приемлемого наполнителя с тем, чтобы обеспечить форму для надлежащего введения животному. Таким фармацевтическим наполнителем может служить разбавитель, суспендирующий агент, солюбилизатор, связующее вещество, разрыхлитель, консервант, краситель, смазывающее вещество и тому подобное. Фармацевтический наполнитель может представлять собой жидкость, например, воду или масло, включая таковое из нефти, животного, растительного или синтетического происхождения, такое как арахисовое масло, соевое масло, минеральное масло, кунжутное масло и тому подобное. Фармацевтический наполнитель может представлять собой физиологический раствор, аравийскую камедь, желатин, крахмальную пасту, тальк, кератин, коллоидный диоксид кремния, мочевину и тому подобное. В дополнение, могут быть использованы вспомогательные, стабилизирующие, загущающие, смазывающие вещества и красители. В одном варианте осуществления фармацевтически приемлемый наполнитель является стерильным при введении животному. Вода представлять собой особенно применимый наполнитель, когда соединение формулы (I) вводят внутривенно. Солевые растворы и водные растворы декстрозы и глицерина также могут быть использованы в качестве жидких наполнителей, особенно для инъекционных растворов. Подходящие фармацевтические наполнители также включают в себя крахмал, глюкозу, лактозу, сахарозу, желатин, солод, рис, муку, мел, силикагель, стеарат натрия, моностеарат глицерина, тальк, хлорид натрия, сухое снятое молоко, глицерин, пропиленгликоль, воду, этанол и тому подобное. При желании композиции могут также содержать небольшие количества смачивающих или эмульгирующих агентов или рН-буферные агенты. Конкретные примеры фармацевтически приемлемых носителей и наполнителей, которые могут быть использованы для составления пероральных дозированных форм, описаны в Handbook of Pharmaceutical Excipients, (Amer. Pharmaceutical Ass'n, Washington, DC, 1986), включено в настоящее описание посредством ссылки.

Композиции могут принимать форму растворов, суспензий, эмульсии, таблеток, пилюль, гранул, мультичастиц, капсул, капсул, содержащих жидкость, порошков, множественных частиц, составов с замедленным высвобождением, суппозиториев, эмульсий, аэрозолей, спреев, суспензий или любой другой формы, подходящей для использования. В одном варианте осуществления композиция находится в форме капсулы (см., например, патент США №5698155). Другие примеры подходящих фармацевтических наполнителей описаны у Radebough et al., "Preformulation," pp.1447-1676 in Remington's Pharmaceutical Sciences Vol.2 (Gennaro, ed., 19th ed., Mack Publishing, Easton, PA, 1995), включено в настоящее описание посредством ссылки.

В одном варианте осуществления соединения формулы (I) составлены в соответствии с обычными процедурами в виде композиции, адаптированной для перорального введения человеку. Соединение формулы (I) для перорального введения может быть, например, в виде таблеток, капсул, желатиновых капсул, каплеток, лепешек, водных или масляных растворов, суспензий, гранул, порошков, эмульсий, сиропов или эликсиров. Когда соединение формулы (I) включено в пероральные таблетки, такие таблетки могут быть прессованными, таблетками triturates, покрытыми энтеросолюбильной оболочкой, в виде драже, покрытыми оболочкой, многократно прессованными или многослойными. Способы и композиции для изготовления твердых пероральных дозированных форм описаны в Pharmaceutical Dosage Forms: Tablets (Lieberman et al., eds., 2nd ed., Marcel Dekker, Inc., 1989 & 1990). Способы и композиции для изготовления таблеток (прессованные и формованные), капсулы (твердые и мягкие желатиновые) и пилюлей также описаны у King, "Tablets, Capsules, and Pills," pp.1553-1593 в Remington's Pharmaceutical Sciences (Osol, ed., 16 ed., Mack Publishing, Easton, PA, 1980).

Жидкие пероральные лекарственные формы включают в себя водные и неводные растворы, эмульсии, суспензии и растворы и/или суспензии, восстановленные из нешипучих гранул, возможно содержащие один или более подходящие растворители, консерванты, эмульгаторы, суспендирующие агенты, разбавители, подсластители, красители, ароматизирующие агенты и тому подобное. Способы и композиции для приготовления жидких пероральных дозированных форм, описаны в Pharmaceutical Dosage Forms: Disperse Systems (Lieberman et al., eds., 2nd ed., Marcel Dekker, Inc., 1996 & 1998).

Когда соединение формулы (I) предназначено для парентерального введения, оно может быть, например, в виде стерильного изотонического раствора. Альтернативно, когда соединение формулы (I) предназначено для вдыхания, она может быть приготовлено в сухом аэрозоле или может быть приготовлено в виде водного или частично водного раствора.

Перорально вводимое соединение формулы (I) может содержать один или более агентов, например, подсластители, такие как фруктоза, аспартам или сахарин; ароматизирующие агенты, такие как мята перечная, масло грушанки или вишни; красители и консерванты для создания фармацевтического препарата, приятного на вкус. Кроме того, если композиции находятся в форме таблетки или пилюли, они могут быть покрыты, чтобы задержать дезинтеграцию и абсорбцию в желудочно-кишечном тракте, тем самым, обеспечивая замедленное действие в течение длительного перйода времени. Избирательно проницаемые мембраны, окружающие осмотически активное движущее соединение, также являются подходящими для перорально вводимых композиций. В данных упомянутых последними платформах доставки жидкость из среды, окружающей капсулу, впитывается движущим соединением, которое набухает, чтобы вытеснить агент или композицию агента через отверстие. Данные платформы доставки могут обеспечивать профиль доставки по существу нулевого порядка, в отличие от вспрыскивающих профилей в лекарственных формах с немедленным высвобождением. Также может быть использован материал временной задержки, такой как моностеарат глицерина или стеарат глицерина. Пероральные композиции могут включать в себя стандартные наполнители, такие как маннит, лактоза, крахмал, стеарат магния, сахарин натрия, целлюлоза и карбонат магния. В одном из вариантов осуществления наполнители являются наполнителями фармацевтического класса.

В другом варианте осуществления соединения формулы (I) могут быть приготовлены для внутривенного введения. В одном варианте осуществления композиции для внутривенного введения содержат стерильный изотонический водный буфер. При необходимости композиции могут также включать в себя солюбилизирующий агент.

Соединение формулы (I) для внутривенного введения может дополнительно включать в себя местный анестетик, такой как бензокаин или прилокаин, чтобы уменьшить боль в месте инъекции. Как правило, ингредиенты поставляются либо отдельно, либо в смеси друг с другом в единичной дозированной форме, например, в виде сухого лиофилизированного порошка или безводного концентрата в герметично закрытом контейнере, таком как ампула или саше, с указанием количества активного агента. В случае, когда соединение формулы (I) следует вводить инфузией, его можно вводить, например, с использованием инфузионного флакона, содержащего стерильную фармацевтического класса чистоты воду или физиологический раствор. В случае, когда соединение формулы (I) вводят инъекцией, может быть предоставлена ампула со стерильной водой для инъекций или физиологическим раствором, так что ингредиенты могут быть смешаны перед введением.

Соединения формулы (I) или их фармацевтически приемлемое производное могут быть введены посредством контролируемого высвобождения или замедленного высвобождения или устройствами доставки, которые известны специалистам в данной области техники. Примеры включают в себя, но без ограничения, те, которые описаны в патентах США №№:3845770; 3916899, 3536809, 3598123; 4008719; 5674533; 5059595; 5591767; 5120548; 5073543; 5639476; 5354556; и 5733566, каждый из которых включен в данное описание посредством ссылки. Такие лекарственные формы могут быть использованы для обеспечения контролируемого или замедленного высвобождения одного или более активных ингредиентов, используя, например, гидропропилметилцеллюлозу, этилцеллюлозу, другие полимерные матрицы, гели, проницаемые мембраны, осмотические системы, многослойные покрытия, микрочастицы, липосомы, микросферы или их комбинацию, чтобы обеспечить желаемый профиль высвобождения в различных пропорциях. Подходящие композиции с контролируемым или замедленным высвобождением, известные специалистам в данной области техники, включая те, которые описаны в настоящем описании, могут быть легко выбраны для применения с активными ингредиентами данного раскрытия. Изобретение, таким образом, включает в себя единичные лекарственные формы, подходящие для перорального введения, такие как, но без ограничения, таблетки, капсулы, желатиновые капсулы и таблетки в форме капсулы, которые приспособлены для контролируемого или замедленного высвобождения.

Фармацевтические композиции с контролируемым или замедленным высвобождением могут иметь общую цель улучшения лекарственной терапии по сравнению с тем, что достигается их аналогами с неконтролируемым или незамедленным высвобождением. В одном варианте осуществления композиция с контролируемым или замедленным высвобождением содержит минимальное количество соединения формулы (I) для лечения или контроля болезненного состояния за минимальное количество времени. Преимущества композиции с контролируемым или замедленным высвобождением включают в себя увеличенную активность препарата, снижение частоты дозировки и улучшенное соблюдение режима пациентом. Кроме того, композиции с контролируемым или замедленным высвобождением могут благоприятно влиять на время начала действия или другие характеристики, такие как уровни соединения формулы (I) в крови и, таким образом, уменьшить возникновение неблагоприятных побочных эффектов.

Композиции с контролируемым или замедленным высвобождением могут быть разработаны для немедленного высвобождения количества соединения формулы (I) или его фармацевтически приемлемого производного, что быстро приводит к желаемому терапевтическому или профилактическому эффекту, и для постепенного и непрерывного высвобождения других количеств соединения формулы (I), чтобы поддерживать такой уровень терапевтического или профилактического эффекта в течение длительного периода времени. Для поддержания постоянного уровня соединения формулы (I) в организме соединение формулы (I) может высвобождаться из дозированной формы со скоростью, которая позволит заменить количество соединения формулы (I), которое метаболизируется и выводится из организма. Контролируемое или замедленное высвобождение активного ингредиента можно стимулировать различными условиями, включая, но без ограничения, изменение рН, изменение температуры, концентрации или доступности ферментов, концентрации или наличия воды или других физиологических условий или соединений.

Количество соединения формулы (I) или его фармацевтически приемлемого производного, которое является эффективным для лечения или предупреждения болезненного состояния, может быть определено стандартными клиническими способами. Кроме того, дополнительно могут быть использованы анализы in vitro или in vivo, чтобы помочь определить оптимальные диапазоны доз. Точная используемая доза также будет зависеть от способа введения и серьезности болезненного состояния и может быть определена в соответствии с решением практикующего врача и/или обстоятельств, связанных с каждым животным. Подходящие эффективные дозированные количества, однако, будут варьировать, в одном варианте осуществления, в диапазоне от около 0,01 мг/кг массы тела до около 2500 мг/кг массы тела, хотя они, в другом варианте осуществления, составляют около 100 мг/кг массы тела или меньше. В одном варианте осуществления эффективное дозированное количество варьирует в пределах от около 0,01 мг/кг массы тела до около 100 мг/кг массы тела соединения формулы (I); в другом варианте осуществления от около 0,02 мг/кг массы тела до около 50 мг/кг массы тела; и в другом варианте осуществления от около 0,025 мг/кг массы тела до около 20 мг/кг массы тела.

В одном варианте осуществления эффективное дозированное количество вводят приблизительно каждые 24 часа, пока болезненное состояние не улучшится. В другом варианте осуществления эффективное дозированное количество вводят приблизительно каждые 12 часа, пока болезненное состояние не улучшится. В другом варианте осуществления эффективное дозированное количество вводят приблизительно каждые 8 часа, пока болезненное состояние не улучшится. В другом варианте осуществления эффективное дозированное количество вводят приблизительно каждые 6 часа, пока болезненное состояние не улучшится. В другом варианте осуществления эффективное дозированное количество вводят приблизительно каждые 4 часа, пока болезненное состояние не улучшится.

Эффективные дозированные количества, описанные здесь, относятся к суммарным вводимым количествам; то есть если вводят более чем одно соединение формулы (I) или его фармацевтически приемлемое производное, то эффективные дозированные количества соответствуют суммарному вводимому количеству.

В случае, когда клетка, способная экспрессировать TRPV1, контактирует с соединением формулы (I) in vitro, количество, эффективное для ингибирования функции рецептора TRPV1 в клетке, находится в интервале от около 0,01 мкг/л до около 5 мг/л; в одном варианте осуществления от около 0,01 мкг/л до около 2,5 мг/л, и в другом варианте осуществления от около 0,01 мкг/л до около 0,5 мг/л, и в другом варианте осуществления от около 0,01 мкг/л до 0,25 мг/л раствора или суспензии фармацевтически приемлемого носителя или наполнителя. В одном варианте осуществления объем раствора или суспензии, содержащего соединение формулы (I) или его фармацевтически приемлемое производное, составляет от около 0,01 мкл до около 1 мл. В другом варианте осуществления объем раствора или суспензии составляет около 200 мкл.

Соединения формулы (I) или их фармацевтически приемлемое производное могут быть проанализированы in vitro или in vivo на желаемую терапевтическую или профилактическую активность перед применением в организме человека. Могут быть использованы системы на основе животной модели, чтобы продемонстрировать безопасность и эффективность.

Способы лечения или профилактики болезненного состояния у животного, нуждающегося в этом, могут дополнительно содержать введение животному, которому нужно вводить соединение формулы (I) или его фармацевтически приемлемое производное (т.е. первый терапевтический агент), второго терапевтического средства. В одном из вариантов осуществления второе терапевтическое средство вводят в эффективном количестве. В одном из вариантов осуществления второе терапевтическое средство вводят в эффективном количестве.

Способы ингибирования функции TRPV1 в клетке, способной экспрессировать TRPV1, могут дополнительно содержать контактирование клетки с эффективным количеством второго терапевтического средства.

Эффективное количество второго терапевтического средства(в), как известно специалистам в данной области техники, зависит от данного агента. Однако определение оптимального диапазона эффективного количества второго лекарственного агента находится в пределах компетенции специалиста в данной области техники. Соединение формулы (I) и второе терапевтическое средство, будучи объединенными, могут действовать или аддитивно или синергически, чтобы лечить то же самое состояние, или они могут действовать независимо друг от друга таким образом, что соединение формулы (I) лечит или предотвращает первое состояние, и второе терапевтическое средство лечит или предотвращает второе расстройство, которое может быть таким же, как первое болезненное состояние, или другим расстройством. В одном варианте осуществления изобретения, в котором второе терапевтическое средство вводят животному для лечения болезненного состояния (например, боль), минимальное эффективное количество соединения формулы (I) будет меньше, чем его минимальное эффективное количество в том случае, когда второе терапевтическое средство не вводят. В данном варианте осуществления соединение формулы (I) и второе терапевтическое средство могут действовать синергически для лечения или профилактики болезненного состояния. В одном варианте осуществления соединение формулы (I) вводят одновременно со вторым терапевтическим средством в виде одной композиции, содержащей эффективное количество соединения формулы (I) и эффективное количество второго терапевтического средства. Альтернативно, композицию, содержащую эффективное количество соединения формулы (I), и вторую композицию, содержащую эффективное количество второго терапевтического средства, вводят одновременно. В другом варианте осуществления эффективное количество соединения формулы (I) вводят до или после введения эффективного количества второго терапевтического средства. В данном варианте осуществления соединение формулы (I) вводят, в то время как второе терапевтическое средство оказывает свое терапевтическое действие, или второе терапевтическое средство вводят, в то время как соединение формулы (I) оказывает свое терапевтическое действие для лечения или профилактики болезненного состояния.

Второе терапевтическое средство может представлять собой, но без ограничения, опиоидный агонист, неопиоидный анальгетик, нестероидное противовоспалительное средство, средство для лечения мигрени, ингибитор Сох-II, противорвотное средство, блокатор β-адренорецепторов, противосудорожное средство, антидепрессант, блокатор Ca2+-канала, противораковое средство, средство для лечения или профилактики UI, средство для лечения или профилактики язвы, средство для лечения или профилактики IBD, средство для лечения или профилактики IBS, средство для лечения риска привыкания, средство для лечения болезни Паркинсона и паркинсонизма, средство для лечения тревоги, средство для лечения эпилепсии, средство для лечения инсульта, средство для лечения припадка, средство для лечения зуда, средство для лечения психоза, средство для лечения хореи Гентингтона, средство для лечения ALS, средство для лечения когнитивных расстройств, средство для лечения мигрени, средство для лечения рвоты, средство для лечения дискинезии, средство для лечения депрессии, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых опиоидных агонистов включают в себя, но без ограничения, альфентанил, аллилпродин, альфапродин, анилеридин, бензилморфин, бецитрамид, бупренорфин, буторфанол, клонитазен, кодеин, дезоморфин, декстроморамид, децосин, диапромид, диамилифон, дигидрокодеин, дигидроморфин, димексадол, димефефанол, диметилтиамбутен, диоксафетилбутират, дипипанон, эптацосин, этохептацин, этилметилтиамбутен, этилморфин, этонитацен, фентанил, героин, гидрокодон, гидроморфон, гидроксипетидин, изометадон, кетобемидон, леворфанол, левофенацилморфан, лофентанил, меперидин, мептацинол, метазоцин, метадон, метопон, морфин, мирофин, нальбуфин, нарсеин, никоморфин, норлеворфанол, норметадон, налорфин, норморфин, норпипанон, опиум, оксикодон, оксиморфон, папаверетум, пентазоцин, фенадоксон, феноморфан, феназоцин, феноперидин, пиринодин, пиритрамид, прохептацин, промедол, проперидин, пропирам, пропоксифен, суфентанил, тилидин, трамадол, их фармацевтически приемлемые производные или любую их смесь.

В некоторых вариантах опиоидный агонист представляет собой кодеин, гидроморфон, гидрокодон, оксикодон, дигидрокодеин, дигидроморфин, морфин, трамадол, оксиморфон, их фармацевтически приемлемые производные или любую их смесь.

Примеры применяемых неопиоидных анальгетиков включают в себя, но без ограничения, нестероидные противовоспалительные средства, такие как аспирин, ибупрофен, диклофенак, напроксен, беноксапрофен, флурбипрофен, фенопрофен, флубуфен, кетопрофен, индопрофен, пиропрофен, карпрофен, оксапрозин, прамопрофен, муропрофен, триоксапрофен, супрофен, аминопрофен, тиапрофеновую кислоту, флупрофен, буклоксиновую кислоту, индометацин, сулиндак, толметин, зомепирак, тиопинак, зидометацин, ацеметацин, фентиазак, клиданак, оксинак, мефенамовую кислоту, меклофенамовую кислоту, флуфенамовую кислоту, нифлумовую кислоту, толфенамовую кислоту, дифлуризал, флуфенизал, пироксикам, судоксикам, изоксикам, их фармацевтически приемлемое производное или любую их смесь. Другие подходящие неопиоидные анальгетики включают в себя следующие, не ограничивающие, химические классы анальгетических, жаропонижающих, нестероидных противовоспалительных препаратов: производные салициловой кислоты, включая аспирин, салицилат натрия, трисалицилат холина магния, салсалат, дифлунизал, салицилсалициловые кислоты, сульфасалазин и оксалацин; производные пара-аминофенола, включая ацетаминофен и фенацетин; индол- и инденуксусные кислоты, включая индометацин, сулиндак и этодолак; гетероарилуксусные кислоты, включая толметин, диклофенак и кеторолак; антраниловые кислоты (фенаматы), включая мефенамовую кислоту и меклофенамовую кислотыу; енольное кислоты, включая оксикамы (пироксикам, теноксикам) и пиразолидиндионы (фенилбутазон, оксифентартазон); алканоны, включая набуметон; их фармацевтически приемлемое производное или любую их смесь. Для более подробного описания NSAID, см. Insel, "Analgesic-Antipyretic and Anti-inflammatory Agents and Drugs Employed in the Treatment of Gout," pp.617-657 в Goodman & Gilman's The Pharmacological Basis of Therapeutics (Goodman et al., Eds., 9th Ed., McGraw-Hill, New York 1996), и Hanson, "Analgesic, Antipyretic and Anti-Inflammatory Drugs," pp.1196-1221 в Remington: The Science and Practice of Pharmacy Vol 2 (Gennaro, ed., 19th ed., Mack Publishing, Easton, PA, 1995), которые приведены в настоящем описании посредством ссылки во всей их полноте. Примеры применяемых средств для лечения мигреней включают в себя, но без ограничения, алпироприд, бромокриптин, дигидроэрготамин, доласетрон, эргокорнин, эргокорнинин, эргокриптин, эргоновин, эргот, эрготамин, флумедроксон-ацетат, фоназин, кетансерин, лизурид, ломеризин, метилэргоновин, метисергид, метопролол, наратриптан, оксеторон, пизотилин, пропранолол, рисперидон, ризатриптан, суматриптан, тимолол, тразодон, золмитриптан, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых ингибиторов COX-II и ингибиторов 5-липоксигеназы, а также их комбинации описаны в патенте США №6136839, который приведен в настоящем описании посредством ссылки в полном объеме. Примеры применяемых ингибиторов COX-II включают в себя, но без ограничения, целекоксиб, DUP-697, флозулид, мелоксикам, 6-MNA, L-745337, рофекоксиб, набуметон, нимесулид, NS-398, SC-5766, Т-614, L-768277, GR-253035, JTE-522, RS-57067-000, SC-58125, SC-078, PD-138387, NS-398, флозулид, D-1367, SC-5766, PD-164387, эторикоксиб, валдекоксиб, парекоксиб, их фармацевтически приемлемое производное или любую их смесь.

Второе терапевтическое средство может также быть средством, применяемым для уменьшения потенциальных побочных эффектов соединения формулы (I). Например, второе терапевтическое средство может представлять собой противорвотное средство. Примеры применяемых противорвотных средством включают в себя, но без ограничения, метоклопрамид, домперидон, прохлорперазин, прометазин, хлорпромазин, триметобензамид, ондансетрон, гранисетрон, гидроксизин, ацетиллейцин моноэтаноламин, ализаприд, азасетрон, бензхинамид, биэтанаутин, бромоприд, буклизин, клебоприд, циклизин, дименгидринат, дифенидол, доласетрон, меклизин, металлатал, метопимазин, набилон, оксипендил, пипамазин, скополамин, сульпирид, тетрагидроканнабинол, тиэтилперазин, тиопроперзаин, трописетрон, его фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых β-адренергических блокаторов включают в себя, но без ограничения, ацебутолол, алпренолол, амосулалол, аротинолол, атенолол, бефунолол, бетаксолол, бевантолол, бисопролол, бопиндолол, букумолол, буфетолол, буфуралол, бунитролол, бупранолол, гидрохлорид бутидрина, бутофилолол, каразолол, картеолол, карведилол, целипролол, цетамолол, клоранолол, дилевалол, эпанолол, эсмолол, инденолол, лабеталол, левобунолол, мепиндолол, метипранолол, метопролол, мопролол, надолол, надоксолол, небивалол, нифеналол, нипрадилол, окспренолол, пенбутолол, пиндолол, практолол, пронеталол, пропранолол, соталол, сульфиналол, талинолол, тертатолол, тилизолол, тимолол, толипролол, ксибенолол, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых противосудорожных средств включают в себя, но без ограничения, ацетилфенетурид, альбутоин, алоксидон, аминоглютетимид, 4-амино-3-гидроксимасляную кислоту, атролактамид, бекламид, бурамат, бромид кальция, карбамазепин, цинромид, клометиазол, клоназепам, децимемид, диэтадион, диметадион, доксенитоин, этеробарб, этадион, этосуксимид, этотоин, фелбамат, флуорезон, габапентин, 5-гидрокситриптофан, ламотриджин, бромид магния, сульфат магния, мефенитоин, мефобарбитал, метарбитал, мететоин, метсуксимид, 5 метил-5-(3-фенантрил)-гидантоин, 3-метил-5-фенилгидантоин, наркобарбитал, ниметазепам, нитразепам, окскарбазепин, параметадион, фенацемид, фенэтарбитал, фенетурид, фенобарбитал, фенсуксимид, фенилметилбарбитуровую кислоту, фенитоин, фетенилат натрия, бромид калия, прегабалин, примидон, прогабид, бромид натрия, паслен, бромид стронция, суклофенид, сультиам, тетрантоин, тиагабин, топирамат, триметадион, вальпроевую кислоту, вальпромид, вигабатрин, зонисамид, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых антидепрессантов включают в себя, но без ограничения, бинедалин, кароксазон, циталопрам, (S)-циталопрам, диметазан, индальпин, фенкамин, флувоксамина малеат, индельоксазин гидрохлорид, нефопам, номифензин, окситриптан, оксипертин, пароксетин, сертралин, тиазезим, тразодон, бенмоксин, ипроклозид, ипрониазид, изокарбоксазид, ниаламид, октамоксин, фенелзин, котинин, ролициприн, ролипрам, мапротилин, метралиндол, мианзерин, миртацепин, адиназолам, амитриптилин, амитриптилиноксид, амоксапин, бутриптилин, кломипрамин, демексиптилин, дезипрамин, дибензепин, диметракрин, дотиепин, доксепин, флуацизин, имипрамин, имипрамина N-оксид, иприндол, лофепрамин, мелитрацен, метапрамин, нортриптилин, ноксиптилин, опипрамол, пизотилин, пропизепин, протриптилин, хинупрамин, тианептин, тримипрамин, адрафинил, бенактизин, бупропион, бутацетин, диоксадрол, этоперидон, фебарбамат, фемоксетин, фенпентадиол, флуоксетин, флувоксамин, гематопорфирин, гиперцинин, левофацетоперан, медифоксамин, милнаципран, минаприн, моклобемид, нефазодон, оксафлозан, пибералин, пролинтан, пирисукцидеанол, ритансерин, роксиндол, хлорид рубидия, сульпирид, тандоспирон, тозалинон, тофенацин, толоксатон, транилципромин, L-триптофан, венлафаксин, вилоксазин, зимельдин, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых блокаторов Ca2+-каналов включают в себя, но без ограничения, бепридил, клентиазем, дилтиазем, фендилин, галлопамил, мибефрадил, прениламин, семотиадил, теродилин, верапамил, амлодипин, аранидипин, барнидипин, бенидипин, цилнидипин, эфонидипин, элгодипин, фелодипин, исрадипин, лацидипин, лерканидипин, манидипин, никардипин, нифедипин, нилвадипин, нимодипин, нисолдипин, нитрендипин, циннаризин, флунарисин, лидофлазин, ломеризин, бенциклан, этафенон, фантофарон, пергексилин, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых противоопухолевых средств включают в себя, но без ограничения, ацивицин, акларубицин, гидрохлорид акодазола, акронин, адоцелезин, альдеслейкин, альтретамин, амбомицин, аметантрона ацетат, аминоглутетимид, амсакрин, анастрозол, антрамицин, аспарагиназу, асперлин, азацитидин, азетепу, азотомицин, батимистат, бензодепу, бикалутамид, бизантрен-гидрохлорид, бизнафид-димезилат, бицелезин, блеомицин-сульфат, бреквинар-натрий, бропиримин, бусульфан, кактиномицин, калустерон, карцелезин, карбетимер, карбоплатин, кармустин, карубицин-гидрохлорид, карцелезин, цедефингол, хлорамбуцил, циролемицин, цисплатин, кладрибин, криснатол-мезилат, циклофосфамид, цитарабин, дакарбазин, дактиномицин, даунорубицин-гидрохлорид, децитабин, дексормаплатин; дезагуанин; дезагуанин-мезилат; диазихон, доцетаксел, доксорубицин, доксорубицин-гидрохлорид, дролоксифен, дролоксифен-цитрат, дромостанолон-пропионат, дуазомицин, эдатрексат, эфлорнитин-гидрохлорид, элзамитрусин, энлоплатин, энпромат, эпипропидин, эпирубицин-гидрохлорид, эрбулозол, эзорубицин-гидрохлорид, эстрамустин, экстрамустин-натрийфосфат, этанидазол, этопозид, этопозид-фосфат, этоприн, фадрозол-гидрохлорид, фазарабин, фенретинид, флоксуридин, флударабин-фосфат, фторурацил, флуроцитабин, фосквидон, фостриецин-натрий, гемцитабин, гемцитабин-гидрохлорид, гидроксимочевину, идарубицин-гидрохлорид, ифосфамид, илмофозин, интерлейкин II (включая рекомбинантный интерлейкин II или rIL2), интерферон альфа-2а, интерферон альфа-2b, интерферон альфа-n1, интерферон альфа-n3, интерферон бета-Ia, интерферон гамма-Ib, ипроплатин, иринотекан-гидрохлорид; ланреотид-ацетат; летрозол; леупролид-ацетат; лиарозол-гидрохлорид; лометрексол-натрий; ломустин; лозоксантрон-гидрохлорид; мазопрокол; маитанзин; мехлоретамин-гидрохлорид; мегестрол-ацетат; меленгестрол-ацетат; мелфалан; меногарил; меркаптопурин; метотрексат; метотрексат-натрий; метоприн; метуредепа; митиндомид; митокарцин; митокромин; митогиллин; митомалцин; митомицин; митоспер; митотан; митоксантрон-гидрохлорид; микофенольную кислоту; нокодазол; ногаламицин; ормаплатин; оксисуран; паклитаксел; пегаспаргазу; пелиомицин; пентамустин; пепломицин-сульфат; перфосфамид; пипоброман; пипосульфан; пироксантрон-гидрохлорид; пликамицин; пломестан; порфимер-натрий; порфиромицин; преднимустин; прокарбазин-гидрохлорид; пуромицин; пуромицин-гидрохлорид; пиразофурин; рибоприн; роглетимид, сафингол; сафингол-гидрохлорид; семустин; симтразен; спарфосат-натрий; спарсомицин; спирогерманий-гидрохлорид; спиромустин; спироплатин; стрептонигрин; стрептозоцин; сулофенур; талисомицин; текогалан-натрий; тегафур; телоксантрон-гидрохлорид; темопорфин; тенипозид; тероксирон; тестолактон; тиамиприн; тиогуанин; тиотепу; тиазофурин; тирапазамин; торемифен-цитрат; трестолон-ацетат; трицирибин-фосфат; триметрексат; триметрексат-глюкуронат; трипторелин; тубулозол-гидрохлорид; урацил-мустард; уредепу; вапреотид; вертепорфин; винбластин-сульфат; винкристин-сульфат; виндезин; виндезин-сульфат; винепидин-сульфат; винглицинат-сульфат; винлейрозин-сульфат; винорелбин-тартрат; винрозидин-сульфат; винзолидин-сульфат; ворозол; зениплатин; зиностатин, зорубицин-гидрохлорид, их фармацевтически приемлемое производное или любую их смесь.

Примеры других противоопухолевых препаратов включают в себя, но без ограничения, 20-эпи-1,25-дигидроксивитамин D3; 5-этинилурацил; абиратерон; акларубицин; ацилфульвен; адеципенол; адозелецин; альдезлейкин; антагонисты ALL-TK; альтретамин; амбамустин; амидокс; амифостин; аминолевулиновую кислоту; амрубицин; амсакрин; анагрелид; анастрозол; андрографолид; ингибиторы ангиогенеза; антагонист D; антагонист G; антареликс; anti-dorsalizing морфогенетический белок-1; антиандроген, карцинома предстательной железы; антиэстроген; антинеопластон; антисмысловые олигонуклеотиды; афидиколин-глицинат; модуляторы гена апоптоза; регуляторы апоптоза; апуриновую кислоту; ara-CDP-DL-PTBA; аргининдеаминазу; асулакрин; атаместан; атримустин; аксинастатин 1; аксинастатин 2; аксинастатин 3; азасетрон; азатоксин; азатирозин; производные баккатина III; баланол; батимастат; антагонисты BCR/ABL; бензохлорины; бензоилстауроспорин; производные бета-лактама; бета-алетин; бетакламицин В; бетулиновую кислоту; ингибитор bFGF; бикалутамид; бисантрен; бисазиридинилспермин; биснафид; бистратен А; бизелезин; брефлат; бропиримин; будотитан; бутионин-сульфоксимин; кальципотриол; калфостин С; производные камптотецина; канарипокс IL-2; капецитабин; карбоксамид-аминотриазол; карбоксиаминотриазол; CaRest M3; CARN 700; ингибитор, полученный из хрящей; карзелезин; ингибиторы казеинкиназы (ICOS); кастаноспермин; цекропин В; цетрореликс; chlorlns; хлорхиноксалин-сульфонамид; цикапрост; цис-порфирин; кладрибин; аналоги кломифена; клотримазол; коллисмицин А; коллисмицин В; комбретастатин А4; аналог комбретастатина; конагенин; крамбесцидин 816; криснатол; криптофицин 8; производные криптофицина А; курацин А; циклопентантрахиноны; циклоплатам; ципемицин; цитарабин-ocfosfat; цитолитический фактор; цитостатин; дакликсимаб; децитабин; дегидродидемнин В; деслорелин; дексаметазон; дексифосфамид; дексразоксан; дексверапамил; диазиквон; дидемнин В; дидокс; диэтилнорспермин; дигидро-5-азацитидин; 9-дигидротаксол; диоксамицин; дифенилспиромустин; доцетаксел; докозанол; долазетрон; доксифлуридин; доксорубицин; дролоксифен; дронабинол; дуокармицин SA; эбселен; экомустин; эделфозин; эдреколомаб; эфлорнитин; элемене; эмитефур; эпирубицин; эпристерид; аналоги эстрамутина; агонисты эстрогена; антагонисты эстрогена; этанидазол; этопозид-фосфат; эксеместан; фадрозол; фазарабин; фенретинид; филграстим; финастерид; флавопиридол; флезеластин; флуастерон; флударабин; флуородаунорубицин-гидрохлорид; форфенимекс; форместан; фостриецин; фотемустин; гадолиний-тексафурин; галлий нитрат; галоцитабин; ганиреликс; ингибиторы гелатиназы; гемцитабин; ингибиторы глутатиона; гепсульфам; герегулин; гексаметилен-бисацетамид; гиперицин; ибандроновую кислоту; идарубицин; идоксифен; идрамантон; илмофозин; иломастат; имидозоакридоны; имиквимод; иммуностимулирующие пептиды; ингибиторы рецептора инсулиноподобного фактора роста 1; агонисты интерферона; интерфероны; интерлейкины; иобенгуан; йододоксорубицин; ипомеанол; иропласт; ирсогладин; изобенгазол; изогомогаликондрин В; итасетрон; джасплакинолид; кахалалид F; ламелларин-N-триацетат; ланреотид; леинамицин; ленограстим, лентинан-сульфат; лептолстатин; летрозол; фактор, ингибирующий активность лейкозных клеток; интерферон-альфа лейкоцитов; лейпролин + эстроген + прогестерон; лейпрорелин; левамизол; лиарозол; аналоги линейного полиамина; липофильный дисахаридный пептид; липофильные соединения платины; лиссоклинамид 7; лобаплатин; ломбрицин; ломотрексол; лонидамин; лозоксантрон; локсорибин; луртотекан; лютеция тексафирин; лизофуллин; литические пептиды; маитанзин; манностатин А; маримастат; мазопрокол; маспин; ингибиторы матрилизина; ингибиторы матричной металлопротеиназы; меногарил; мербарон; метерелин; метиониназа; метоклопрамид; ингибитор MIF; мифепристон; милтефозин; миримостим; несовпадающую двухцепочечную РНК; митогуазон; митолактол; аналоги митомицина; митонафид; митотоксиновый фактор роста фибробластов сапорина; митоксантрон; мофаротен; молграмостим; моноклональное антитело, человеческий хорионический гонадотропин; монофосфориллипид А + стенка клеток миобактерий sk; мопидамол; ген ингибитора мультилекарственной резистентности; политерапия на основе опухолевого супрессора-1; противораковое средство на основе априта; микапероксид В; экстракт микобактериальной клеточной стенки; мириапорон; N-ацетилдиналин; N-замещенный бензамид; нафарелин; нагрестип; налоксон + пентазоцин; напавин; нафтерпин; нартограстим; недаплатин; неморубицин; неридроновая кислота; нилутамид; низамицин; модуляторы оксида азота; антиоксидант нитроксида; нитруллин; O6-бензилгуанин; октреотид; окиценон; олигонуклеотиды; онапристон; ондансетрон; орацин; пероральный цитокиновый индуктор; ормаплатин; осатерон; оксалиплатин; оксауномицин; паклитаксел; аналоги паклитаксела; производные паклитаксела; палауамин; пальмитоилризоксин; памидроновую кислоту; панакситриол; паномифен; парабактин; пазеллиптин; пегаспаргаз; пелдесин; пентосан-натрийполисульфат; пентостатин; пентрозол; перфлуброн; перфосфамид; периллиловый спирт; феназиномицин; фенилацетат; ингибиторы фосфатазы; пицибанил; пилокарпин-гидрохлорид; пирарубицин; пиритрексим; плацетин А; плацетин В; ингибитор плазминогенного активатора; платиновый комплекс; соединения платины; комплекс платина-триамин; порфимер-натрий; порфиромицин; преднизон; пропил-бис-акридон; простагландин J2; ингибиторы протеасомы; иммуномодулятор на основе белка А; ингибитор протеинкиназы С; ингибиторы протеинкиназы С; из микроводорослей; ингибиторы протеинтирозинфосфатазы; ингибиторы пуриннуклеозидфосфорилазы; пурпурины; пиразолакридин; пиридоксилированный гемоглобинполиоксиэтиленовый конъюгат; антагонисты raf; ралтитрексед; рамосетрон; ингибиторы фарнезилпротеинтрансферазы raf; ингибиторы ras; ингибитор ras-GAP; ретеллиптин деметилированный; рений Re 186 этидронат; ризоксин; рибозимы; RII ретинамид; рохитукин; ромуртид; роквинимекс; рубигинон В1; рубоксил; сафингол; саинтопин; SarCNU; саркофитол А; сарграмостин; миметики Sdi1; семустин; ингибитор 1, происходящий из стареющих клеток; смысловые олигонуклеотиды; ингибиторы сигнальной трансдукции; сизофиран; собузоксан; борокаптан-натрий; фенилацетат натрия; солверол; соматомедин-связывающий белок; сонермин; спарфозовая кислота; спикамицин D; спиромустин; спленопентин; спонгистатин 1; скваламин; стипиамид; ингибиторы стромелизина; сульфинозин; антагонисты гиперактивного вазоактивного интестинального пептида; сурадиста; сурамин; сваинсонин; таллимустин; тамоксифен-метиодид; тауромустин; тазаротен; текогалан-натрий; тегафур; теллурапирилий; ингибиторы теломеразы; темопорфин; тенипозид; тетрахлородекаоксид; тетразомин; талибластин; тиокоралин; тромбопоиэтин; тромбопоэтиновый миметик; тималфазин; агонист рецептора тимопоэтина; тимотринан; тиреостимулирующий гормон; этиловоэтиопурпурин; тирапазамин; титаноцен-дихлорид; топсентин; торемифен; ингибиторы трансляции; третиноин; триацетилуридин; трицирибин; триметрексат; трипторелин; трописетрон; туростерид; ингибиторы тирозинкиназы; тирфостины; ингибиторы UBC; убенимикс; полученный из мочеполовой пазухи ингибирующий рост фактор; антагонисты рецептора урокиназы; вапреотид; вариолин В; веларезол; верамин; вердины; вертепорфин; винорелбин; винксалтин; витаксин; ворозол; занотерон; зениплатин; зиласкорб; зиностатин стималамер, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики UI включают в себя, но без ограничения, пропантелин, имипрамин, гиосциамин, оксибутинин, дицикломин, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики язвы включают, антациды, такие как гидроксид алюминия, гидроксид магния, бикарбонат натрия и бикарбонат кальция; сукрафлат; соединения висмута, такие как субсалицилат висмута и субцитрат висмута; H2-антагонисты, такие как циметидин, ранитидин, фамотидин и низатидин; ингибиторы H+, K+-АТФазы, такие как омепразол, ианзопразол и лансопразол; карбеноксолон; миспростол; антибиотики, такие как тетрациклин, метронидазол, тимидазол, кларитромицин и амоксициллин; их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики IBD включают в себя, но без ограничения, антихолинергические средства, дифеноксилат; лоперамид; дезодорированную опиумную настойку; кодеин; антибиотики широкого спектра, такие как метронидазол; сульфасалазин; оксалазин; мезаламин; преднизон; азатиоприн; меркаптопурин; метотрексат; их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики IBS включают в себя, но без ограничения, пропантелин; антагонисты мускариновых рецепторов, такие как пирензапин, метоктрамин, ипратропий, тиотропий, скополамин, метокополамин, гоматропин, гоматропин-метилбромид и метантелин; антидиарейные лекарственные средства, такие как дифеноксилат и лоперамид; их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики расстройства, связанного с возникновением зависимости, включают в себя, но без ограничения, метадон, дезипрамин, амантадин, флуоксетин, бупренорфин, агонист опиатов, 3-феноксипиридин, левометадил-ацетат гидрохлорид, антагонисты серотонина, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики болезни Паркинсона и паркинсонизма включают в себя, но без ограничения, карбидопа/леводопа, перголид, бромокриптин, ропинирол, прамипексол, энтакапон, толкапон, селегилин, амантадин, тригексифенидил-гидрохлорид, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или предупреждения тревоги включают в себя, но без ограничения, бензодиазепины, такие как алпразолам, бротизолам, хлордиазепоксид, клобазам, клоназепам, клоразепат, демоксепам, диазепам, эстазолам, флумазенил, флуразепам, галазепам, лоразепам, мидазолам, нитразепам, нордазепам, оксазепам, празепам, квазепам, темазепам и триазолам; небензодиазепиновые агенты, такие как буспирон, гепирон, ипсапирон, тиоспирон, цолпикон, золпидем и залеплен; транквилизаторы, такие как барбитураты, например, амобарбитал, апробарбитал, бутабарбитал, буталбитал, мефобарбитал, метогекситал, пентобарбитал, фенобарбитал, секобарбитал и тиопентал, пропандиолкарбаматы, такие как мепробамат и тибамат; их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или предупреждения эпилепсии включают в себя, но без ограничения, карбамазепин, этосуксимид, габапентин, ламотриджин, фенобарбитал, фенитоин, примидон, вальпроевую кислоту, триметадион, бензодиазепины, γ-винил-ГАМК, ацетазоламид, фелбамат, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики инсульта включают в себя, но без ограничения, антикоагулянты, такие как гепарин, средства, которые разрушают тромбы, такие как стрептокиназа или тканевый активатор плазминогена, средства, которые уменьшают разбухание, такие как маннит или кортикостероиды, ацетилсалициловую кислоту, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики припадка включают в себя, но без ограничения, карбамазепин, этосуксимид, габапентин, ламотриджин, фенобарбитал, фенитоин, примидон, вальпроевую кислоту, триметадион, бензодиазепины, габапентин, ламотриджин, γ-винил-ГАМК, ацетазоламид, фелбамат, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики болезненного состояния зуда, включают в себя, но без ограничения, налтрексон; налмефен; даназол; трициклические соединения, такие как амитриптилин, имипрамин и доксепин; антидепрессанты, такие как те, которые приведены ниже, ментол; камфара; фенол; прамоксин; капсаипин; смолы; стероиды; антигистаминные препараты; их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики психоза включают в себя, но без ограничения, фенотиазины, такие как хлорпромазин-гидрохлорид, мезоридазин-безилат и торидазин-гидрохлорид; тиоксантены, такие как хлоропротиксен и тиотиксен-гидрохлорид; клозапин; рисперидон; оланзапин; кветиапин; кветиапин-фумарат; галоперидол; галоперидол деканоат; локсапин-сукцинат; молиндон-гидрохлорид; пимозид; зипразидон; их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики хореи Гентингтона, включают в себя, но без ограничения, галоперидол, пимозид, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики ALS включают в себя, но без ограничения, баклофен, нейротрофические факторы, рилузол, тизанидин, бензодиазепины, такие как клоназепан, дантролен, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики когнитивных расстройств включают в себя, но без ограничения, агенты для лечения или профилактики деменции, такие как такрин; донепезил; ибупрофен; антипсихотические препараты, такие как тиоридазин и галоперидол; антидепрессанты, такие как приведенные выше; их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики мигрени, включают в себя, но без ограничения, алпироприд, бромокриптин, дигидроэрготамин, доласетрон, эргокорнин, эргокорнинин, эргокриптин, эргоновин, эргот, эрготамин, флумедроксон-ацетат, фоназин, кетансерин, лизурид, ломеризин, метилэргоновин, метисергид, метопролол, наратриптан, оксеторон, пизотилин, пропранолол, рисперидон, ризатриптан, суматриптан, тимолол, тразодон, золмитриптан, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики рвоты, включают в себя, но без ограничения, антагонисты рецептора 5-HT3, такие как ондансетрон, гранисетрон, доласетрон и трописетрон; антагонисты рецептора допамина, такие как прохлорперазин, тиэтилперазин, хлорпромазин, метоклопрамид и домперидон; глюкокортикоиды, такие как дексаметазон; бензодиазепины, такие как лоразепам и алпразолам; их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики дискинезии включают в себя, но без ограничения, резерпин, тетрабеназин, их фармацевтически приемлемое производное или любую их смесь.

Примеры применяемых терапевтических средств для лечения или профилактики депрессии включают в себя, но без ограничения, трициклические антидепрессанты, такие как амитриптилин, амоксапин, бупропион, кломипрамин, дезипрамин, доксепин, имипрамин, мапротилин, нефазадон, нортриптилин, протриптилин, тразодон, тримипрамин и венлафаксин; селективные ингибиторы обратного захвата серотонина, такие как циталопрам, (S)-циталопрам, флуоксетин, флувоксамин, пароксетин и сертралин; ингибиторы моноаминоксидазы, такие как изокарбоксазид, паргилин, фенелзин и транилципромин; психостимуляторы, такие как декстроамфетамин и метилфенидат; их фармацевтически приемлемое производное или любую их смесь.

Соединение формулы (I) или его фармацевтически приемлемое производное и второе терапевтическое средство могут действовать аддитивно или, в одном варианте осуществления, синергически. В одном варианте осуществления соединение формулы (I) вводят одновременно со вторым терапевтическим средством, например, могут быть введены композиция, содержащая эффективное количество соединения формулы (I), и эффективное количество второго терапевтического средства. Альтернативно, могут быть одновременно введены композиция, содержащая эффективное количество соединения формулы (I), и другая композиция, содержащая эффективное количество второго терапевтического средства. В другом варианте осуществления эффективное количество соединения формулы (I) вводят до или после введения эффективного количества второго терапевтического средства. В данном варианте осуществления соединение формулы (I) вводят, в то время как второе терапевтическое средство оказывает свое терапевтическое действие, или второе терапевтическое средство вводят, в то время как соединение формулы (I) оказывает свое терапевтическое действие для лечения или профилактики болезненного состояния.

Композицию по раскрытию получают способом, содержащим смешивание соединения формулы (I) или его фармацевтически приемлемого производного вместе с фармацевтически приемлемым носителем или наполнителем. Смешивание может быть осуществлено с использованием способов, известных для смешивания соединения (или производного) и фармацевтически приемлемого носителя или наполнителя. В одном варианте осуществления соединение формулы (I) присутствует в композиции в эффективном количестве.

4.7 Наборы

Настоящее изобретение дополнительно относится к наборам, которые могут упростить обработку и введение соединения формулы (I) в организм животного.

В одном варианте осуществления набор по изобретению содержит стандартную лекарственную форму соединения формулы (I). В одном варианте осуществления стандартная лекарственная форма содержит первый контейнер, который может быть стерильным, содержащий эффективное количество соединения формулы (I) и фармацевтически приемлемый носитель или наполнитель. Набор может дополнительно содержать наклейку или печатные инструкции по применению соединения формулы (I) для лечения или профилактики болезненного состояния. Набор может дополнительно содержать стандартную лекарственную форму второго терапевтического средства, например, второй контейнер, содержащий эффективное количество второго терапевтического средства и фармацевтически приемлемый носитель или наполнитель. В другом варианте осуществления набор содержит контейнер, содержащий эффективное количество соединения формулы (I), эффективное количество второго терапевтического средства и фармацевтически приемлемый растворитель, носитель или наполнитель. Примеры второго терапевтического средства включают в себя, но без ограничения, те, которые перечислены выше.

Наборы по изобретению могут дополнительно содержать устройство, которое применяется для введения единичных дозированных форм. Примеры такого устройства включают, но без ограничения, шприц, капельницу, пластырь, ингалятор и клизму.

Следующие примеры приведены для лучшего понимания изобретения и не должны истолковываться как ограничивающие изобретение, описанное и заявленное в настоящем описании. Такие вариации настоящего изобретения, включая замещение всех эквивалентов, известных сейчас или разработанных позже, которые были бы в компетенции специалистов в данной области техники, и изменения в составе или изменения в эксперименте, должны быть рассмотрены, чтобы подпадать под объем изобретения, включенного в настоящее описание.

5. ПРИМЕРЫ

Некоторые примеры, приведенные ниже, относятся к синтезу иллюстративных соединений формул (I) и/или (II).

5.1 Пример 1: Получение соединения С126(r)

Трет-бутил-4-(5-бром-3-фторпиридин-2-ил)пиперазин-1-карбоксилат (103)

Реакционную смесь 5-бром-2-хлор-3-фторпиридина (101, 8,0 г, 38,02 ммоль, Oakwood Пр Products, Inc., West Columbia, SC) и трет-бутилпиперазин-1-карбоксилата (102, 7,08 г, 38,02 ммоль, Sigma-Aldrich) в ДМСО (32 мл) нагревали при 100°С в течение 16 часов. Смесь охлаждали до температуры около 25°С, выливали в холодный 10%-ный водный раствор карбоната натрия и экстрагировали этилацетатом. Органический слой промывали водой, промывали насыщенным раствором соли, сушили над сульфатом натрия и концентрировали с получением 15,5 г полутвердого вещества. Полутвердое вещество промывали гексаном и фильтровали. Фильтрат концентрировали с получением 7,5 г остатка. Остаток хроматографировали на колонке с силикагелем с элюированием градиентом от 100% гексанов до 10:90 EtOAc:гексаны с получением соединения 103 в виде твердого вещества (выход 24%).

(Е)-трет-бутил-4-(3-фтор-5-(проп-1-енил)пиридин-2-ил)пиперазин-1-карбоксилат (105)

В атмосфере аргона к раствору 103 (3,30 г, 9,16 ммоль) и (E)-проп-1-енилбороновой кислоты (104, 0,95 г, 11,0 ммоль, Sigma-Aldrich) добавляли 1М раствор фторида тетра(н-бутил)аммония (TBAF) в THF (22 мл, 22,0 ммоль, Sigma-Aldrich) и [1,1'-бис(дифенилфосфино)ферроцен]дихлорпалладия (II) (Pd(DPPF)Cl2, 0,075 г, 0,092 ммоль, Sigma-Aldrich). Полученную реакционную смесь перемешивали при нагревании с обратным холодильником в течение 2 часов, охлаждали до температуры около 25°С, разбавляли водой и экстрагировали этилацетатом. Органический слой промывали насыщенным солевым раствором и концентрировали с получением 3,6 г остатка. Остаток хроматографировали на колонке с силикагелем при элюировании смесью EtOAc:гексаны с получением 105 соединения (выход 91%).

трет-Бутил-4-(5-((1S,2S)-1,2-дигидроксипропил)-3-фторпиридин-2-ил)пиперазин-1-карбоксилат (106)

К раствору 105 (2,67 г, 8,29 ммоль) в трет-бутаноле (80 мл) и воде (80 мл) добавляли метансульфонамид (0,79 г, 8,29 ммоль, Sigma-Aldrich). Смесь охлаждали до 5°С и добавляли AD-mix-α-(11,50 г, 8,29 ммоль) с образованием реакционной смеси. После нагревания реакционной смеси до температуры около 25°С и перемешивания в течение 16 часов добавляли избыток твердого сульфита натрия и полученную суспензию оставляли перемешиваться при 15°С в течение 30 мин. Смесь дважды экстрагировали EtOAc. Органические части объединяли, промывали солевым раствором, сушили (Na2SO4) и концентрировали при пониженном давлении. Остаток хроматографировали на колонке с силикагелем при элюировании смесью 50:50 EtOAc:гексаны и 70:30 EtOAc:гексаны с получением соединения 106 в виде твердого вещества (выход более 99%).

(1S,2S)-1-(5-фтор-6-(пиперазин-1-ил)пиридин-3-ил)пропан-1,2-диол (107)

К раствору 106 (3,0 г, 8,65 ммоль) в DCM (25 мл) добавляли 4N HCl в диоксане (2,51 мл, 43,2 ммоль). Полученную реакционную смесь перемешивали при температуре около 25°С в закрытом сосуде в течение 16 часов; образовалась суспензия. Суспензию перемешивали с диэтиловым эфиром; выпадал твердый осадок. Осадок собирали фильтрованием и промывали несколько раз эфиром с получением соединения 107 (выход 91%) в виде рыжевато-коричневого твердого вещества, которое, будучи чистотой, превышающей 99%, как было проанализировано с помощью LC/MS, непосредственно использовали на следующей стадии.

(6-Метилбензотиазол-2-ил)амид 4-[5-((1S,2S)-1,2-дигидрокси-пропил)-3-фтор-пиридин-2-ил]пиперазин-1-карбоновой кислоты (соединение С126(r))

Суспензию 107 (200 мг, 0,61 ммоль) и N-(6-метилбензо[d]тиазол-2-ил)-1H-имидазол-1-карбоксамид (108, 160 мг, 0,61 ммоль) в DCM (6,0 мл) охлаждали на бане со льдом. Диизопропилэтиламин (DIEA, 2,0 мл, Sigma-Aldrich) добавляли с образованием реакционной смеси. Реакционную смесь перемешивали при температуре около 25°С в течение 16 часов; образовался осадок. Осадок отфильтровывали и промывали DCM. После этого осадок растворяли в смеси 20:80 MeOH:DCM, концентрировали на силикагеле и хроматографировали на колонке с силикагелем с элюированием градиентом от 30:70 EtOAc:DCM до 80:20 EtOAc:DCM с получением С126(r) в виде белого твердого вещества (выход 24%). 1H-ЯМР (ДМСО-d6) δ: 0,88 (3Н, d, J=6,4 Гц), 2,37 (3Н, s), 3,38 (4H, m), 3,69 (5H, m), 4,37 (1H, t, J=4,8 Гц), 4,65 (1Н, d, J=4,6 Гц), 5,28 (1Н, d, J=4,4 Гц), 7,18 (1Н, m), 7,44 (1Н, d, 7=14,3 Гц), 7,52 (1Н, br s), 7,66 (1Н, br s), 7,97 (1Н, s), 11,20 (1Н, br s). LC/MS (M+1): m/z=446.

Соединение 108 получали следующим образом:

К раствору 6-метилбензо[D]тиазол-2-амина (109, 328 мг, 2 ммоль, Sigma-Aldrich) в DMF (5 мл) добавляли ди(1H-имидазол-1-ил)метанон (110, 357 мг, 2,2 ммоль, Sigma-Aldrich) при 0°С. При интенсивном перемешивании полученную реакционной смеси медленно давали нагреться до температуры около 25°С в течение 14 часов. Образовался белый осадок. Осадок собирали фильтрованием при пониженном давлении, промывали дважды EtOAc (10 мл для каждой промывки) и сушили при пониженном давлении с получением 108 (выход более 99%).

5.2 Пример 2: Получение соединений B122(j), B122(k), B122(o), B122(p), (j), B125(k), В125(о), В125(p), B155(h), B155(j), B155(o), B158(j), B158(o), C4(r), C123(r), C125(r), и C170(r)

Используя методики, подобные тем, которые описаны выше в примере 1, получили следующие соединения формулы (I).

В 122(j): (R)-N-(бензо[d]тиазол-2-ил)-4-{5-[(1S,2S)-1,2-дигидроксипропил]-3-фторпиридин-2ил}-3-метилпиперазин-1-карбоксамид. 1H-ЯМР (ДМСО-d6) δ: 0,87 (3Н, d, J=6,1 Гц), 1,07 (3Н, d, J=6,4 Гц), 3.08-3.45 (3Н, m), 3.75-3.54 (2Н, m), 3.94-4.30 (3Н, m), 4,35 (1Н, t, J=5,0 Гц), 4,66 (1Н, d, J=4,6 Гц), 5,28 (1Н, d, J=4,4 Гц), 7,20 (1Н, t, J=7,4 Гц), 7.70-7.28 (3Н, m), 7.72-7.91 (1Н, m), 7,96 (1Н, s), 11,33 (1Н, br s). LC/MS (M+1): m/z=447.

В122(k): (S)-N-(бензо[d]тиазол-2-ил)-4-{5-[(1S,2S)-1,2-дигидроксипропил]-3-фторпиридин-2ил}-3-метилпиперазин-1-карбоксамид. 1H-ЯМР (ДМСО-d6) δ: 0,87 (3Н, d, J=6,4 Гц), 1,07 (3H, d, J=6,6 Гц), 3,28-3,39 (3H, m), 3,60-3,70 (2H, m), 4.20-4.22 (3H, m), 4,34 (1H, d, J=5,5 Гц), 4,67 (1H, br s), 5,25 (1H, br s), 7,20 (1H, t, J=7,5 Гц), 7.32-7.51 (3H, м), 7,80 (1H, br s), 7,96 (1H, s), 11,32 (1H, br s). LC/MS (M+1): m/z=447.

В 122(o): (R)-N-(бензо[d]тиазол-2-ил)-4-{5-[(1R,2R)-1,2-дигидроксипропил]-3-фторпиридин-2ил}-3-метилпиперазин-1-карбоксамид. 1Н-ЯМР (ДМСО-d6) δ: 0,88 (3H, d, J=6,3 Гц), 1,05 (3H, d, J=6,4 Гц), 2.99-3.46 (3H, m), 3,50-3,60 (1H, m), 3.61-3.75 (1H, m), 4.00-4.31 (3H, m), 4,33 (1H, d, J=5,3 Гц), 4,66 (1H, br s), 5,27 (1H, br s), 6,89 (1H, t, J=7,4 Гц), 7,11 (1H, t, J=7,1 Гц), 7,25 (1H, d, J=7,9 Гц), 7,39 (1H, dd, J=1,8, 14,5 Гц), 7,54 (1H, d, J=7,2 Гц), 7,95 (1H, s). LC/MS (M+1): m/z=447.

В 122(p): (S)-N-(бензо[d]тиазол-2-ил)-4-{5-[(1R,2R)-1,2-дигидроксипропил]-3-фторпиридин-2ил}-3-метилпиперазин-1-карбоксамид. 1H-ЯМР (ДМСО-d6) δ: 0,87 (3H, d, J=6,3 Гц), 1,07 (3H, d, J=6,6 Гц), 3.21-3.35 (3H, m), 3,62-3,66 (2H, m), 4.03-4.36 (4H, m), 4,66 (1H, d, J=4,0 Гц), 5,28 (1H, d, J=4,0 Гц), 7,20 (1H, t, J=7,5 Гц), 7,33-7,50 (3H, m), 7,80 (1H, br s), 7,95 (1H, s), 11,27 (1H, br s). LC/MS (M+1): m/z=447.

B125(j): (R)-4-{5-[(1S,2S)-1,2-дигидроксипропил]-3-фторпиридин-2-ил}-N-(6-фторбензо[d]тиазол-2-ил)-3-метилпиперазин-1-карбоксамид. 1H-ЯМР (ДМСО-d6) δ: 0,87 (3H, d, J=6,3 Гц), 1,07 (3H, d, J=6,6 Гц), 3.10-3.46 (3H, m), 3,55-3,75 (2H, m), 4,03 (1H, d, J=13,9 Гц), 4.11-4.28 (2H, m), 4,35 (1H, t, J=4,7 Гц), 4,66 (1H, d, J=4,6 Гц), 5,28 (1H, d, J=4,4 Гц), 7,20 (1H, td, J=2,7, 9,1 Гц), 7,41 (1H, dd, J=1,6, 14,4 Гц), 7,50-7,59 (1H, м), 7,77 (1H, dd, J=2,6, 8,5 Гц), 7,95 (1H, s), 11,43 (1H, br s). LC/MS (M+1): m/z=465.

B125(k): (S)-4-{5-[(1S,2S)-1,2-дигидроксипропил]-3-фторпиридин-2-ил}-N-(5-фторбензо[d]тиазол-2-ил)-3-метилпиперазин-1-карбоксамид. 1H-ЯМР (ДМСО-d6) δ: 0,87 (3H, d, J=6,3 Гц), 1,07 (3H, d, J=6,4 Гц), 3,24-3,40 (3H, m), 3.71-3.60 (2H, m), 4.04-4.20 (3H, m), 4,35 (1H, t, J=4,6 Гц), 4,65 (1H, d, J=4,6 Гц), 5,27 (1H, d, J=4,6 Гц), 7,24-7,38 (3H, m), 7,82 (1H, br s), 7,96 (1H, s), 11,27 (1H, br s). LC/MS (M+1): m/z=465.

В125(о): (R)-4-{5-[(1R,2R)-1,2-дигидроксипропил]-3-фторпиридин-2-ил}-N-(6-фторбензо[d]тиазол-2-ил)-3-метилпиперазин-1-карбоксамид. 1Н-ЯМР (ДМСО-d6)) δ: 0,87 (3H, d, J=6,4 Гц), 1,07 (3H, d, J=6,6 Гц), 3.43-3.08 (3H, m), 3.55-3.74 (2H, m), 3.97-4.08 (1H, m), 4.13-4.26 (2H, m), 4,34 (1H,, d, J=5,0 Гц), 4,66 (1H, br s), 5,28 (1H, br s), 7,15 (1H, td, J=2,7, 9,1 Гц), 7,41 (1H, dd, J=1,6, 14,4 Гц), 7,48 (1H, dd, J=4,7, 8,7 Гц), 7,70 (1H, dd, J=2,6, 8,7 Гц), 7,95 (1H, c). LC/MS (M+1): m/z=465.

В125(p): (S)-4-Z{5-[(1R,2R)-1,2-дигидроксипропил]-3-фторпиридин-2-ил}-N-(5-фторбензо[d]тиазол-2-ил)-3-метилпиперазин-1-карбоксамид. 1H-ЯМР (ДМСО-d6) δ: 0,87 (3H, d, J=6,3 Гц), 1,07 (3H, d, J=6,6 Гц), 3.21-3.35 (3H, m), 3.62-3.69 (2H, m), 4.02-4.20 (3H, m), 4,34 (1H, t, J=4,6 Гц), 4,66 (1Н, d, J=4,6 Гц), 5,28 (1Н, d, J=4,6 Гц), 7,21 (1Н, dt, J=1,7, 9,0 Гц), 7,41 (1Н, dd, J=1,7, 14,3 Гц), 7,55 (1Н, br s), 7,77 (1Н, d, J=9,0 Гц), 7,95 (1Н, s), 11,30 (1Н, br s). LC/MS (M+1): m/z=465.

В155(h): (S)-4-{5-[(1S,2S)-1,2-дигидроксипропил]-3-фторпиридин-2-ил}-N-(5-фторбензо[d]тиазол-2-ил)-2-метилпиперазин-1-карбоксамид. 1H ЯМР (CDCl3) δ: 1,16 (3H, d, J=6,3 Гц), 1,31 (3H, d, J=6,7 Гц), 2.97-2.92 (1Н, m), 3.11-3.16 (2H, m), 3,39 (1Н, dt, J=3,5, 12,6 Гц), 3.89-4.01 (4Н, м), 4.40-4.42 (3H, m), 6,99 (1Н, dt, J=2,4, 8,8 Гц), 7,30-7,34 (2H, m), 7,65 (1Н, dd, J=5,2, 8,5 Гц), 7,98 (1Н, с), 9,31 (1Н, br s). LC/MS (M+1): m/z=465.

B155(j): (R)-4-{5-[(1S,2S)-1,2-дигидроксипропил]-3-фторпиридин-2-ил}-N-(5-фторбензо[d]тиазол-2-ил)-3-метилпиперазин-1-карбоксамид. 1Н-ЯМР (ДМСО-d6) 5δ: 0,87 (3H, d, J=6,3 Гц), 1,07 (3H, d, J=6,4 Гц), 3.10-3.44 (3H, m), 3.76-3.52 (2H, m), 4,04 (1Н, d, J=13,9 Гц), 4.13-4.26 (2H, m), 4.29-4.38 (1Н, m), 4.61-4.69 (1Н, m), 5,28 (1Н, d, J=4,3 Гц), 7,02 (1Н, td, J=9,1, 2,4 Гц), 7,25-7,35 (1Н, m), 7,41 (1Н, dd, J=14,3, 1,5 Гц), 7,81 (1Н, dd, J=5,5, 8,7 Гц), 7,95 (1Н, s), 11,60 (1Н, br s). LC/MS (M+1): m/z=465.

В155(o): (R)-4-{5-[(1R,2R)-1,2-дигидроксипропил]-3-фторпиридин-2-ил}-N-(5-фторбензо[d]тиазол-2-ил)-3-метилпиперазин-1-карбоксамид. 1H-ЯМР (ДМСО-d6) δ: 0,87 (3H, d, J=6,3 Гц), 1,07 (3H, d, J=6,6 Гц), 3.08-3.47 (3H, m), 3.56-3.74 (2H, m), 4,04 (1Н, d, J=12,7 Гц), 4.27-4.13 (2H, m), 4,34 (1Н, d, J=5,0 Гц), 4,66 (1Н, br s), 5,27 (1Н, br s), 6,98 (1Н, td, J=2,2, 9,0 Гц), 7,26 (1Н, dd, J=2,1, 10,1 Гц), 7,41 (1Н, dd, J=1,3, 14,4 Гц), 7,77 (1Н, dd, J=5,6, 8,5 Гц), 7,95 (1Н, s). LC/MS (M+1): m/z=465.

B158(j): (R)-N-(5,6-дифторбензо[d]тиазол-2-ил)-4-{5-[(1S,2S)-1,2-дигидроксипропил]-3-фторпиридин-2-ил}-3-метилпиперазин-1-карбоксамид. 1Н-ЯМР (ДМСО-d6) δ: 0,87 (3H, d, J=6,3 Гц), 1,06 (3H, d, J=6,4 Гц), 3.04-3.42 (4Н, м), 3.51-3.76 (2H, m), 3.97-4.10 (1Н, m), 4.11-4.25 (1Н, m), 4,30-4,38 (1Н, m), 4,65 (1Н, d, J=4,3 Гц), 5,27 (1Н, d, J=4,6 Гц), 7.35-7.51 (2H, m), 7.80-7.98 (2H, m), 11,52 (1Н, br s). LC/MS (M+1): m/z=483.

В158(о): (R)-N-(5,6-дифторбензо[d]тиазол-2-ил)-4-{5-[(1R,2R)-1,2-дигидроксипропил]-3-фторпиридин-2-ил}-3-метилпиперазин-1-карбоксамид. 1Н-ЯМР (ДМСО-d6) δ: 0,87 (3H, d, J=6,3 Гц), 1,06 (3H, d, J=6,6 Гц), 3.06-3.44 (3H, m), 3.52-3.74 (2H, m), 3.94-4.08 (1Н, m), 4.10-4.26 (2H, m), 4.29-4.40 (1Н, m), 4.58-4.72 (1Н, m), 5.19-5.34 (1Н, m), 7,34-7,52 (2H, m), 7.81-7.99 (2H, m), 11,49 (1Н, br s). LC/MS (M+1): m/z=483.

С4(r): 1H-ЯМР (ДМСО-d6) δ: 0,89 (3H, d, J=6,2 Гц), 3,24-3,31 (4Н, м), 3.69-3.73 (5Н, м), 4,40 (1Н, д d, 7=4,4 Гц), 4,67 (1Н, br s), 5,34 (1Н, br s), 7,14 (1H, dt, J=8,6, 1,7 Гц), 7,47 (1Н, dd, J=8,6, 4,6 Гц), 7,67-7,71 (2Н, m), 8,15 (1Н, d, J=1,7 Гц), 11,52 (1Н, br s). LC/MS (М+1): m/z=466.

С123(r): N-(6-хлорбензо[d]тиазол-2-ил)-4-(5-((1S,2S)-1,2-дигидроксипропил)-3фторпиридин-2-ил)пиперазин-1-карбоксамид. 1H-ЯМР (ДМСО-d6) δ: 0,88 (3H, d, J=6,4 Гц), 3,40 (4Н, м), 3,70 (5Н, м), 4,37 (1Н, t, J=4,8 Гц), 4,65 (1Н, d, J=6,8 Гц), 5,28 (1Н, d, J=4,7 Гц), 7,39 (1Н, d, J=7,5 Гц), 7,44 (1Н, d, J=14,3 Гц), 7,63 (1Н, br s), 7,97 (1Н, с), 8,03 (1Н, br s), 11,40 (1Н, br s). LC/MS (M+1): m/z=466.

С125(r): 4-(5-((1S,2S)-1,2-дигидроксипропил)-3-фторпиридин-2-ил)-N-(6-фторбензо[d]тиазол-2-ил)пиперазин-1-карбоксамид. 1Н-ЯМР (ДМСО-d6) δ: 0,88 (3H, d, J=6,4 Гц), 3,39 (4Н, m), 3,69 (5Н, m), 4,37 (1Н, t, J=4.82Hz), 4,66 (1Н, d, J=4,6 Гц), 5,28 (1Н, d, J=4,6 Гц), 7,22 (1Н, t, J=9,4 Гц), 7,44 (1Н, d, J=14,2 Гц), 7,64 (1Н, br s), 7,81 (1Н, br s), 7,97 (1Н, s), 11,33 (1Н, br s). LC/MS (M+1): m/z=450.

C170(r): 4-(5-((1S,2S)-1,2-дигидроксипропил)-3-фторпиридин-2-ил)-N-(5,6-диметилбензо[d]тиазол-2-ил)пиперазин-1-карбоксамид. 1Н-ЯМР (ДМСО-d6) δ: 0,88 (3H, d, J=6,4 Гц), 2,28 (6Н, d, J=5,7 Гц), 3,38 (4Н, m), 3,70 (5Н, m), 4,36 (1Н, d, J=5,5 Гц), 4,66 (1Н, br s), 5,28 (1Н, br s), 7,44 (1Н, d, J=12,7 Гц), 7,46 (1Н, br s), 7,56 (1Н, br s), 7,97 (1Н, s), 11,17 (1Н, br s). LC/MS (M+1): m/z=460.

5.3 Пример 3: Получение соединения ВВ

Используя методики, подобные тем, которые описаны выше в примере 1, получили соединение ВВ.

ВВ: (S)-4-{5-[(1S,2S)-1,2-дигидроксипропил]-3-фторпиридин-2-ил}-N-(6-фторбензо[d]тиазол-2-ил)-2-метилпиперазин-1-карбоксамид. 1Н-ЯМР (ДМСО-d6) δ: 0,86 (3H, d, J=6,1 Гц), 1,24 (3H, d, J=6.6 Гц), 2,85 (1Н, t, J=11,6 Гц), 3,05 (1Н, d, J=11,6 Гц), 3.24-3.33 (1Н, m), 3.65-3.73 (1Н, m), 3,77 (1Н, d, J=12,9 Гц), 3,93 (1Н, d, J=12,3 Гц), 4,16 (1Н, br s), 4,36 (1Н, t, J=4,6 Гц), 4,57 (1Н, br s), 4,66 (1Н, d, J=4,8 Гц), 5,29 (1Н, d, J=4,6 Гц), 7,21 (1Н, t, J=8,8 Гц), 7,43 (1Н, d, J=14,3 Гц), 7,64 (1Н, br s), 7,79 (1Н, br s), 7,95 (1Н, s), 11,30 (1Н, br s). LC/MS (M+1): m/z=464.

5.4 Пример 4: Получение соединения А155(а)

2-Хлор-3-фтор-5-винилпиридин (112)

К раствору 101 (5,00 г, 23,8 ммоль) и 4,4,6-триметил-2-винил-1,3,2-диоксаборинана (111, 3,29 г, 21,39 ммоль, Sigma-Aldrich) в смеси TBAF (30,0 мл) и THF (64,0 мл) в атмосфере аргона добавили катализатор бис(трифенилфосфин)дихлорпалладий (II) (Pd(PPh3)2Cl2, 1,33 г, 1,90 ммоль, Sigma-Aldrich) и K2CO3 (8,20 г, 59,4 ммоль). Полученную реакционную смесь нагревали до 60°С и выдерживали в течение 16 часов в герметичном флаконе. Смесь охлаждали до температуры около 25°С, разбавляли водой и экстрагировали EtOAc. Органический слой отделяли, промывали насыщенным солевым раствором и концентрировали. Остаток хроматографировали на колонке с силикагелем при элюировании смесью EtOAc:гексаны с получением 3,2 г соединения 112 в виде бесцветного масла (выход 85%). 1H ЯМР (CDCl3) δ: 5,48 (1Н, d, J=10.97Hz), 5,83 (1H, d, J=17.62Hz), 6,68 (1H, dd, J=10,97, 17.62Hz), 7,52 (1H, d, J=1.60Hz), 8,20 (1H, d, J=1.60Hz). LC/MS(M+1): m/z=158.

(S)-1-(6-Хлор-5-фторпиридин-3-ил)этан-1,2-диол (113)

К раствору 112 (5,00 г, 31,75 ммоль) в воде (162 мл) и трет-бутаноле (162 мл), охлажденному до 0°С на ледяной бане, добавляли AD-mix α (54,6 г, Sigma-Aldrich) с образованием реакционной смеси. С оставленным в бане льдом реакционную смесь оставляли нагреваться до температуры около 25°С. Через 16 часов добавляли избыток твердого сульфита натрия (60 г) и полученную суспензию оставляли перемешиваться при температуре около 25°С в течение 30 мин. Смесь дважды экстрагировали EtOAc. Органические части объединяли, промывали солевым раствором, сушили (Na2SO4) и концентрировали при пониженном давлении. Полученную смесь хроматографировали на колонке с силикагелем, элюируя градиентом от 50:50 EtOAc:гексаны до 100% EtOAc с образованием 5,39 г соединения 113 в виде белого твердого вещества (выход 89%). 1H ЯМР (CDCl3) δ: 2,16 (1Н, t, J=5.60Hz), 2,88 (1H, d, J=3.54Hz), 3,66 (1H, m), 3,84 (1H, m), 4,91 (1H, m), 7,59 (1H, dd, J=1,61, 8.73Hz), 8,29 (1H, d, J=1.88Hz). LC/MS (M+1): m/z=192.

(S)-2-хлор-5-(2,2-диметил-1,3-диоксолан-4-ил)-3-фторпиридин (114)

Суспензию 113 (5,39 г, 28,2 ммоль) в 2,2-диметоксипропане (58 мл, Sigma-Aldrich) охлаждали на бане со льдом. Моногидрат пара-толуолсульфокислоты (PTSA, 0,54 г, 2,82 ммоль, Sigma-Aldrich) добавляли с образованием реакционной смеси. Баню со льдом удаляли и реакционную смесь перемешивали при температуре около 25°С в течение 16 часов. После этого смесь охлаждали на бане со льдом, обрабатывали насыщенным водным раствором бикарбоната натрия и экстрагировали этилацетатом. Органический слой отделяли, промывали насыщенным солевым раствором, сушили (Na2SO4) и концентрировали с получением 5,65 г соединения 114 в виде масла (выход 87%). 1Н ЯМР (CDCl3) δ: 1,48 (3H, s), 1,54 (3H, s), 3,71 (1H, m), 4,37 (1H, m), 5,11 (1H, t, J=6.76Hz), 7,53 (1H, dd, J=1,93, 8.63Hz), 8,18 (1H, d, J=1.88Hz). LC/MS (M+1): m/z=232.

(S)-трет-бутил-4-{5-[(S)-2,2-диметил-1,3-диоксолан-4-ил]-3-фторпиридин-2-ил}-2-метилпиперазин-1-карбоксилат (116)

К раствору 114 (1,60 г, 6,91 ммоль) в толуоле (21,1 мл) в атмосфере аргона добавляли (S)-трет-бутил-2-метилпиперазин-1-карбоксилат (115, 1,38 г, 6,91 ммоль, AK Scientific, Inc., Union City, CA), трет-бутоксид натрия (0,73 г, 7,60 ммоль, Sigma-Aldrich) и 2-дициклогексилфосфино-2',4',6'-триизопропилбифенил (то есть "X-Phos", 0.49 г, 1,04 ммоль, Sigma-Aldrich). Смесь дегазировали в атмосфере аргона и затем добавляли трис(дибензилиденацетон)палладий (Pd2(DBA)3, 0,63 г, 0,69 ммоль, Sigma-Aldrich) с образованием реакционной смеси. Реакционную смесь нагревали в масляной бане при температуре в диапазоне от 80°С до 85°С, перемешивали в течение 1,5 часов. После этого смесь охлаждали до температуры около 25°С, выливали в холодную воду и экстрагировали этилацетатом. Органический слой отделяли, промывали насыщенным солевым раствором и концентрировали до масла, которое хроматографировали на колонке с силикагелем при элюировании смесью от 10:90 EtOAc:гексаны до 20:80 EtOAc:гексаны с получением 1,71 г соединения 116 в виде твердого вещества (выход 63%). 1Н ЯМР (CDCl3) δ: 1,25 (3H, d, J=6.80Hz), 1,46 (3H, s), 1,48 (9H, s), 1,53 (3H, s), 2,89 (1H, dt, J=3,29, 13.59Hz), 3,09 (1H, dd, J=3,73, 12.06Hz), 3,23 (1H, dt, J=2,85, 13.59Hz), 3,69 (1H, t, J=7.89Hz), 3,83 (1H, d, J=12.72Hz), 3,92 (1H, d, J=13.81Hz), 4,01 (1H, d, J=12.90Hz), 4,27 (1Н, t, J=6.14Hz), 4,31 (1H, br s), 5,01 (1H, t, J=7.24Hz), 7,30 (1H, d, J=1.97Hz), 7,95 (1H, s). LC/MS (M+1): m/z=396.

(S)-1-{5-фтор-6-[(S)-3-метилпиперазин-1-ил]пиридин-3-ил}этан-1,2-диол (117)

К раствору 116 (1,71 г, 4,33 ммоль) в DCM (9,60 мл) и МеОН (1,50 мл) добавляли 4N HCl в диоксане (6,49 мл) с образованием реакционной смеси. Реакционную смесь перемешивали при температуре около 25°С в закрытом сосуде в течение 16 часов. После этого полученную суспензию перемешивали в диэтиловом эфире. Твердый осадок собирали на фильтровальной бумаге и промывали несколько раз диэтиловым эфиром с получением 1,25 г соединения 117 в виде рыжевато-коричневого твердого вещества (выход 88%), которое, с чистотой, составляющей более 99%, как было проанализировано с помощью LC/MS, непосредственно использовали на следующей стадии.

(S)-4-{5-[(S)-1,2-Дигидроксиэтил]-3-фторпиридин-2-ил}-N-(5-фторбензо[d]тиазол-2-ил)-2-метилпиперазин-1-карбоксамид (соединение А155(а))

Суспензию 117 (0,18 г, 0,40 ммоль) и N-(5-фторбензо[d]тиазол-2-ил)-2-метилпиперазин-1-карбоксамида (118, 0,105 г, 0,40 ммоль) в DCM (5 мл) охлаждали на бане со льдом. DIEA (1,0 мл) добавляли с образованием реакционной смеси. Реакционную смесь перемешивали при температуре около 25°С в течение около 16 часов. Смесь разбавляли DCM (100 мл), промывали насыщенным водным раствором NaHCO3, дважды промывали солевым раствором, сушили и концентрировали. Полученный остаток хроматографировали на колонке с силикагелем, элюируя градиентом от 100% дихлорметана до 10:90 MeOH:DCM с получением 0,095 г соединения А155(а) в виде белой пены (выход 53%). 1Н-ЯМР (ДМСО-d6) δ: 1,24 (3H, d, J=6.80Hz), 2,86 (1H, dt, J=3,51, 12.50Hz), 3,05 (1H, dd, J=3,29, 12.24Hz), 3,30 (1H, t, J=12.28Hz), 3,41 (1H, m, J=6.14Hz), 3,48 (1H, m, J=5.26Hz), 3,77 (1H, d, J=12.94Hz), 3,93 (1H, d, J=11.62Hz), 4,19 (1H, d, J=12.28Hz), 4,52 (1H, Qt, J=5.48Hz), 4,61 (1H, br s), 4,77 (1H, t, J=6.14Hz), 5,36 (1H, d, J=4.60Hz), 7,09 (1H, t, J=9.21Hz), 7,36 (1H, br s), 7,47 (1H, d, J=14.25Hz), 7,88 (1H, m), 7,97 (1H, s), 11,67 (1H, br s). LC/MS (M+1): m/z=450.

Соединение 118, N-(5-фторбензо[d]тиазол-2-ил)-1H-имидазол-1-карбоксамид, было получено аналогично соединению 108, за исключением того, что вместо 6-метилбензо[d]тиазол-2-амина был использован 5-фторбензо[d]тиазол-2-амин (Sigma-Aldrich).

5.5 Пример 5: Получение соединения А122(а)

2-Хлор-3-фтор-5-винилпиридин (112)

К раствору 101 (5,00 г, 23,8 ммоль) и 4,4,5,5-тетраметил-2-винил-1,3,2-диоксаборолана (119, 21,39 ммоль, Sigma-Aldrich) в смеси EtOH (30,0 мл) и THF (64,0 мл) в атмосфере аргона добавляли Pd(PPh3)2Cl2 (1,33 г, 1,90 ммоль) и K2CO3 (8,20 г, 59,4 ммоль). Полученную реакционную смесь нагревали до 60°С и выдерживали в течение 16 часов в герметичном флаконе. Смесь охлаждали до температуры около 25°С, разбавляли водой и экстрагировали EtOAc. Органический слой отделяли, промывали насыщенным солевым раствором и концентрировали. Остаток хроматографировали на колонке с силикагелем при элюировании смесью EtOAc:гексаны с получением соединения 112 в виде бесцветного масла (выход 85%). 1Н ЯМР (CDCl3) δ: 5,48 (1Н, d, J=10.97Hz), 5,83 (1H, d, J=17.62Hz), 6,68 (1H, dd, J=10,97, 17.62Hz), 7,52 (1H, d, J=1.60Hz), 8,20 (1H, d, J=1.60Hz). LC/MS(M+1): m/z=158.

После этого соединение А122(а) получали аналогично соединению А155(а) в примере 4, за исключением того, что вместо соединения 118 использовали соединение 120.

А122(а): (S)-N-(бензо[d]тиазол-2-ил)-4-(5-((S)-1,2-дигидроксиэтил)-3-фторпиридин-2-ил)-2-метилпиперазин-1-карбоксамид. 1Н-ЯМР (ДМСО-d6) δ: 1,24 (3H, d, J=6,6 Гц), 2,85 (1H, t, J=11,0 Гц), 3,04 (1H, d, J=12,9 Гц), 3,29 (1H, m), 3,41 (1H, m, J=5,5 Гц), 3,48 (1H, m, J=5,5 Гц), 3,77 (1H, d, J=12,7 Гц), 3,93 (1H, d, J=12,5 Гц), 4,21 (1H, br s), 4,52 (1H, d, J=5,0 Гц), 4,61 (1H, br s), 4,76 (1H, t, J=6,1 Гц), 5,34 (1H, d, J=4,6 Гц), 7,20 (1H, t, J=6,8 Гц), 7,36 (1H, t, J=7,5 Гц), 7,46 (1H, dd, J=1,8, 14,3 Гц), 7,55 (1H, br s), 7,82 (1H, br s), 7,97 (1H, s), 11,37 (1H, br s). LC/MS (M+1): m/z=432.

Соединение 120, N-(бензо[d]тиазол-2-ил)-1H-имидазол-1-карбоксамид, был получен аналогично соединению 108, за исключением того, что вместо 6-метилбензо[d]тиазол-2-амина использовали бензо[d]тиазол-2-амин (Sigma-Aldrich).

1. 5.6 Пример 6: Получение соединений A122(b), A122(c), A122(e), А123(е), A125(b), A125(e), A126(a), A126(e), A155(b), A155(d), A155(e), и А158(а)

Используя методики, аналогичные описанным в примерах 4 и 5 выше, получали следующие соединения формулы (I).

А122(b): (R)-N-(бензо[d]тиазол-2-ил)-4-(5-((S)-1,2-дигидроксиэтил)-3-фторпиридин-2-ил)-3-метилпиперазин-1-карбоксамид. 1Н-ЯМР (ДМСО-d6) δ: 1,08 (3H, d, J=6,4 Гц), 3.11-3.70 (6Н, m), 4.35-3.93 (3H, m), 4,51 (1H, d, J=5,3 Гц), 4,75 (1Н, t, J=5,6 Гц), 5,33 (1Н, d, J=4,4 Гц), 7,20 (1Н, t, J=7,5 Гц), 7,35 (1Н, t, J=7,8 Гц), 7,44 (1Н, d, J=14,3 Гц), 7,54 (1Н, br s), 7,81 (1Н, br s), 7,98 (1Н, s), 11,32 (1Н, br s). LC/MS (M+1): m/z=433.

A122(c): (S)-N-(бензо[D]тиазол-2-ил)-4-{5-[(S)-1,2-дигидроксиэтил]-3-фторпиридин-2-ил}-3-метилпиперазин-1-карбоксамида. 1H-ЯМР (ДМСО-d6) δ: 1,08 (3H, d, J=6,6 Гц), 3.23-3.63 (6Н, m), 3.90-4.21 (3H, m), 4,50 (1Н, t, J=5,9 Гц), 7,19 (1Н, t, J=7,5 Гц), 7,35 (1Н, t, J=7,5 Гц), 7,44 (1Н, dd, J=1,8, 14,3 Гц), 7,52 (1Н, br s), 7,80 (1Н, br s), 7,98 (1Н, s), 11,26 (1Н, br s). LC/MS (М+1): m/z=433.

A122(e): (R)-N-(бензо[d]тиазол-2-ил)-4-(5-((R)-1,2-дигидроксиэтил)-3-фторпиридин-2-ил)-2-метилпиперазин-1-карбоксамид. 1Н-ЯМР (CD3OD-d4) δ: 1,36 (3H, d, J=6,4 Гц), 2,95 (1Н, m), 3,12 (1Н, d, J=13,6 Гц), 3,41 (1Н, m), 3,63 (2H, m), 3,89 (1Н, d, J=12,0 Гц), 4,03 (1Н, d, J=11,0 Гц), 4,67 (1Н, m), 7,23 (1Н, m), 7,37 (1Н, m), 7,48 (2H, d, J=14,0 Гц), 7,69 (1Н, br s), 8,00 (1Н, с). LC/MS (M+1): m/z=432.

A123(e): (R)-N-(6-хлорбензо[d]тиазол-2-ил)-4-(5-((R)-1,2-дигидроксиэтил)-3-фторпиридин-2-ил)-2-метилпиперазин-1-карбоксамид. 1H-ЯМР (CD3OD-d4) δ: 1,15 (3H, d, J=6,8 Гц), 2,73 (1Н, t, J=10,0 Гц), 2,91 (1Н, d, J=14,0 Гц), 3,22 (1Н, m), 3,42 (2H, m), 3,67 (1Н, d, J=14,0 Гц), 3,81 (1Н, d, J=12,0 Гц), 4,00 (1Н, m), 4,45 (1Н, t, J=5,2 Гц), 7,13 (1Н, dt, J=2,0, 8,4 Гц), 7,25 (2H, dd, J=1,6, 14,0 Гц), 7,55 (1Н, m), 7,79 (1Н, c). LC/MS (M+1): m/z=466.

A125(b): (R)-4-{5-[(S)-1,2-дигидроксиэтил]-3-фторпкридин-2-ил}-N-(6-фторбензо[d]тиазол-2-ил)-3-метилпиперазин-1-карбоксамид. 1H-ЯМР (ДМСО-d6) δ: 1,08 (3H, d, J=6,5 Гц), 3.14-3.68 (6Н, m), 4,02 (1Н, d, J=11,9 Гц), 4.26-4.10 (2H, m), 4,51 (1Н, dd, J=5,6, 10,7 Гц), 4,74 (1Н, t, J=5,7 Гц), 5,32 (1Н, d, J=4,5 Гц), 7,21 (1Н, td, J=2,6, 9,1 Гц), 7,39-7,49 (1Н, m), 7,51-7,60 (1Н, m), 7,78 (1Н, dd, J=2,4, 8,8 Гц), 7,98 (1Н, s), 11,37 (1Н, br s). LC/MS (M+1): m/z=451.

А125(е): 1Н-ЯМР (CD3OD-d4) δ: 1,26 (3H, d, J=6,8 Гц), 2,85 (1Н, dt, J=3,2, 13,0 Гц), 3,02 (1Н, dd, J=3,6, 13,0 Гц), 3,32 (1Н, m), 3,53 (2H, m), 3,78 (1Н, d, J=12,0 Гц), 3,92 (1Н, d, J=12,0 Гц), 4,12 (1Н, m), 4,56 (1Н, t, J=6,0 Гц), 7,02 (1Н, dt, J=2,8, 12,0 Гц), 7,35 (1Н, dd, J=1,6, 14,0 Гц), 7,41 (2H, m), 7,89 (1Н, s). LC/MS (M+1): m/z=450.

A126(a): (S)-4-(5((S)-1,2-дигидроксиэтил)-3-фторпиридин-2-ил)-метил-N-(6-метилбензо[d]тиазол-2-ил)пиперазин-1-карбоновой кислоты. 1Н-ЯМР (ДМСО-d6) δ: 1,23 (3H, d, J=6,8 Гц), 2,37 (3H, s), 2,84 (1Н, t, J=11,0 Гц), 3,03 (1Н, dd, J=3,5, 12,1 Гц), 3,28 (1Н, m), 3,41 (1Н, m, J=5,5 Гц), 3,48 (1Н, m, J=5,5 Гц), 3,77 (1Н, d, J=12,7 Гц), 3,93 (1Н, d, J=11,6 Гц), 4,19 (1Н, br s), 4,52 (1Н, d, J=5,3 Гц), 4,59 (1Н, br s), 4,75 (1Н, t, J=5,3 Гц), 5,34 (1Н, d, J=4,6 Гц), 7,17 (1Н, d, J=7,0, Гц), 7,46 (1Н, d, J=13,6 Гц), 7,61 (2H, br s), 7,97 (1Н, s), 11,23 (1Н, br s). LC/MS (M+1): m/z=446.

A126(е): (R)-4-(5-((R)-1,2-дигидроксиэтил)-3-фторпиридин-2-ил)-2-метил-N-(метилбензо[d]тиазол-2-ил)пиперазин-1-карбоновой кислоты. 1Н-ЯМР (CD3OD-d4) δ: 1,36 (3H, d, J=6,8 Гц), 2,43 (3H, s), 2,95 (1Н, t, J=13 Гц), 3,12 (1Н, dd, J=3,6, 13,0 Гц), 3,42 (1Н, m), 3,64 (2H, m), 3,88 (1Н, d, J=13,0 Гц), 4,02 (1Н, d, J=13,0 Гц), 4,2 (1Н, m), 4,67 (1Н, t, J=6,0 Гц), 7,19 (1Н, d, J=9,2 Гц), 7,34 (1Н, m), 7,46 (1Н, dd, J=2,4, 14,0 Гц), 7,50 (1Н, m), 8,00 (1Н, с). LC/MS (M+1): m/z=446.

A155(b): (R)-4-{5-[(S)-1,2-дигидроксиэтил]-3-фторпиридин-2-ил}-N-(5-фторбензо[d]тиазол-2-ил)-3-метилпиперазин-1-карбоксамид. 1Н-ЯМР (ДМСО-d6) δ: 1,08 (4Н, d, J=6,7 Гц), 3.13-3.67 (6Н, m), 3.94-4.07 (1Н, m), 4.07-4.28 (2H, m), 4,50 (1Н, d, J=5,2 Гц), 4,75 (1Н, t, J=5,7 Гц), 5,33 (1Н, d, J=4,4 Гц), 7,00-7,15 (1Н, m), 7,38-7,50 (2H, m), 7.85-8.02 (2H, m), 11,39 (1Н, br s). LC/MS (M+1): m/z=451.

A155(d): (S)-4-{5-[(R)-1,2-дигидроксиэтил]-3-фторпиридин-2-ил}-N-(5-фторбензо[d]тиазол-2-ил)-3-метилпиперазин-1-карбоксамид. 1Н-ЯМР (ДМСО-d6) δ: 1,25 (3H, d, J=6,6 Гц), 2.83-2.93 (1Н, m), 3,04 (1Н, dd, J=13,0, 3,4 Гц), 3.25-3.48 (3H, m), 3,77 (1Н, d, J=13,0 Гц), 3,92 (1Н, d, J=13,0 Гц), 4,19 (1Н, d, J=13,0 Гц), 4.57-4.69 (3H, m), 5,33 (1Н, s), 7,08 (1Н, td, J=1,5, 8,5 Гц), 7,34 (1Н, d, J=8,5 Гц), 7,45 (1Н, dd, J=1,5, 14,2 Гц), 7,86 (1Н, dd, J=5,5, 8,5 Гц), 7,97 (1Н, s), 11,63 (1Н, br s). LC/MS (M+1): m/z=451.

A155(e): (R)-4-(5-((R)-1,2-дигидроксиэтил]-3-фторпиридин-2-ил}-N-(5-фторбензо[d]тиазол-2-ил)-3-метилпиперазин-1-карбоксамид. 1H-ЯМР (ДМСО-d6) δ: 1,24 (3H, d, J=6,7 Гц), 2,86 (1Н, td, J=12,7, 3,3 Гц), 3,05 (1Н, dd, J=12,7, 3,3 Гц), 3,25-3,48 (3H, m), 3.74-3.79 (1Н, m), 3,93 (1Н, d, J=12,7 Гц), 4,19 (1Н, d, J=12,7 Гц), 4,58-4,70 (3H, m), 5,34 (1Н, s), 7,08 (1Н, dt, J=2,3, 9,1 Гц), 7,35-7,48 (2H, m), 7.84-7.96 (2H, m), 11,66 (1Н, br s). LC/MS (M+1): m/z=451.

А158(а): (S)-N-(5,6-дифторбензо[d]тиазол-2-ил)-4-(5-((S)-1,2-дигидроксиэтил)-3-фторпиридин-2-ил)-2-метилпиперазин-1-карбоксамид. 1Н-ЯМР (ДМСО-d6) δ: 1,24 (3H, d, J=6,6 Гц), 2,87 (1Н, t, J=12,9 Гц), 3,06 (1Н, d, J=10,1 Гц), 3,31 (1Н, m), 3,46 (2H, m), 3,76 (1H, d, J=12,9 Гц), 3,92 (1Н, d, J=12,9 Гц), 4,14 (1Н, d, J=12,1 Гц), 4,54 (2H, m), 4,76 (1Н, m), 5,35 (1Н, d, J=4,2 Гц), 7,46 (1Н, dd, J=1,5, 14,0 Гц), 7,71 (1Н, t, J=10,5 Гц), 7,97 (1Н, s), 8,07 (1Н, t, J=8,6 Гц), 11,40 (1Н, br s). LC/MS (M+1): m/z=468.

5.7 Пример 7: Получение соединения АЕ

Используя методики, аналогичные описанным в примерах 4 и 5 выше, было получено соединение АЕ.

АЕ: 1Н-ЯМР (ДМСО-d6) δ: 1,08 (3H, d, J=6,6 Гц), 3.12-3.68 (6Н, m), 4,00 (1Н, d, J=12,4 Гц), 4.08-4.30 (2H, m), 4,51 (1Н, d, J=5,3 Гц), 4,75 (1Н, t, J=5,7 Гц), 5,33 (1Н, d, J=4,6 Гц), 7,44 (1Н, dd, J=1,8, 14,3 Гц), 7,64 (1Н, dd, J=7.6, 10,8 Гц), 7.94-7.99 (1Н, m), 8,04 (1Н, dd, J=8,0, 10,3 Гц), 11,49 (1Н, br s). LC/MS (M+1): m/z=469.

5.8 Пример 8: Получение соединения А155(ad)

Следующее соединение, соединение A155(ad), которое представляет собой рацемическую смесь (R)-1,2-дигидроксиэтил- и (S)-1,2-дигидроксиэтил-энантиомеров, получали тем же способом, как в примере 4 выше, за исключением стадии 2, на которой OsO4 и НМО использовали как окислительные реагенты вместо AD-mix альфа.

A155(ad) (2S)-4-(5-(1,2-дигидроксиэтил)-3-фторпиридин-2-ил)-N-фторбензо[d]тиазол-2-ил)-3-метилпиперазин-1-карбоксамид. 1H-ЯМР (ДМСО-d6) δ: 1,24 (3H, d, J=6,6 Гц), 2.84-2.87 (1Н, m), 3.03-3.06 (1Н, m), 3.25-3.52 (3H, m), 3,76 (1Н, d, J=12,8 Гц), 3,92 (1Н, d, J=12,8 Гц), 4,19 (1Н, d, J=12,8 Гц), 4.53-4.75 (3H, m), 5,34 (1Н, d, J=4,1 Гц), 7,08 (1Н, t, J=8,8 Гц), 7.24-7.50 (2H, m), 7,86 (1Н, шир), 7,96 (1Н, s), 11,57 (1Н, br s). LC/MS (M+1): m/z=450.

5.9 Пример 9: Определение оптической чистоты для соединения А155(е) % ее определяли для соединения А155(е), как показано ниже:

Хиральную высокоэффективную жидкостную хроматографию использовали для определения % ее для соединения А155(е). Использовали колонку CHIRALPAK 1A (Daicel Chemical, Токио, Япония). Площади пиков для основных и второстепенных энантиомеров были определены, и 94% ее было рассчитано с помощью уравнения в разделе 4.3.

При желании также может быть использован метод протонного ядерного резонанса (1Н ЯМР). Для определения методом 1Н ЯМР для интересующего соединения(й), например, соединения А155(е), получали бис-сложноэфирные производные Мошера способом, известным в данной области техники. Определение % ее осуществляли добавлением избытка хлорингидрида Мошера к интересующему соединению (около 0,6 мг) в пиридине -d5 (около 0,530 мл) при температуре около 25°С в ЯМР-пробирку. 1H ЯМР проводили через 20 ч после добавления хлорингидрида Мошера. Соответствующий пик был выбран для бис-эфира Мошера с δ, находящейся в интервале от около 7,00 миллионных долей (м.д.) до около 6,60 м.д. Важно отметить, наблюдаются ли 13C-сателлитные сигналы в сторону увеличения или в сторону уменьшения поля относительно выбранного пика. Пики 1H ЯМР для второстепенных и основных энантиомеров интегрировали, 13C-сателлитные сигналы вычитаются, и % ее рассчитывали, используя уравнение, упомянутое выше.

5.10 Пример 10: Объединение соединения формулы (I) и фумаровой кислоты

К 20 мг свободного основания соединения А155(а), в 0,3±0,1 мл метанола во флаконе объемом 4 мл при температуре около 25°С добавляли 1,1 эквивалента фумаровой кислоты (AK Scientific). Полученную суспензию перемешивали магнитной мешалкой в течение около 32 часов. После этого суспензию упаривали досуха с использованием центробежного испарителя (НТ-8 Series II, Genevac Inc, Gardiner, NY). Продукт анализировали с помощью 1Н ЯМР, DTA, PXRD, 13C ЯМР и 15N ЯМР.

Растворение продукта с последующим 1Н ЯМР-анализом полученного раствора для каждого компонента показали, что среднее молярное соотношение соединения А155(а) к фумаровой кислоте составляло около 1:0,5±0,2, со значениями из нескольких определений в пределах от 1:0,4 до 1:0,7.

DTA (дифференциально-термический анализ) продукта, со скоростью 10°С/мин, дал точку начала плавления при 176,8°С, определяемую температурой, при которой экстраполированная эндотерма плавления отклонилась от экстраполированной базовой линии, и точку плавления при 182,9°С, определяемую температурой, соответствующей максимуму эндотермы плавления. В противоположность этому, для соединения А155(а), которое было аналогично закристаллизовано из МеОН в виде безводных кристаллов, но в отсутствие фумаровой кислоты, точка начала плавления, определенная с помощью DTA, составляла 185,7°С, а температура плавления, определенная с помощью DTA, составляла 189,4°С.

Данные по интенсивности порошковой дифракции рентгеновских лучей были собраны в аппарате Bruker D8 Discover с использованием излучения CuKα (λ=1,5418 Å). Диапазон сканирования составлял от 3,0° до 40°2θ. Опубликованные значения 2θ равны ±0,2°2θ. На фигуре 1 представлен образец порошковой рентгенограммы и в таблице 4 сведены значения максимумов, наблюдавшихся для продукта, полученного с фумаровой кислотой, как описано выше, в то время как в таблице 5 сведены значения максимумов, наблюдавшихся для кристаллического безводного (т.е. свободное основание) соединения А155(а). Для каждой таблицы относительная интенсивность максимума обозначается следующим образом: VS обозначает "очень сильная", S обозначает "сильная", М обозначает "средняя" и W обозначает слабая.

Таблица 4: Результаты порошковой рентгеновской дифракции для продукта

Таблица 5: Результаты порошковой дифракции рентгеновских лучей для соединения А155(а)

Все определения с помощью твердотельного ЯМР с использованием кросс-поляризации и вращения под магическим углом (CP/MAS) проводили на спектрометре ЯМР Varian NMR System 600MHz (Varian ЯМР, Inc, Palo Alto, CA) с зондом, имеющим внешний диаметр, равный 3,2 мм, на частоте 150,8 МГц для 13C и 60,79 МГц для 15N. Температуру образца поддерживали при 10°С±0,2°С. Спектры 15N были измерены при следующих условиях: ширина спектра составляла 24,510 Гц, время считывания сигнала составляло 40 мс, время задержки между измерениями составляло от 5 секунд до 15 секунд, контактное время составляло 2 мс, длины 15N π/2-импульса составляли 4.2 мкс, длины 1H π/2-импульса составляли 2.2 мкс. В качестве эталона использовали 15N глицин со значением δ, равным -347,54. Спектры 13C были измерены при следующих условиях: ширина спектра 43103 Гц, время считывания сигнала 40 мс, время задержки между измерениями составляло 10 с, контактное время составляло 3 мс, длины 13C π/2-импульса составляли 2.0 мкс, длины 1H π/2-импульса составляли 2,2 мкс. В качестве эталона использовали 13C метиленовый пик адамантана со значением δ, равным 38,52. Для целей анализов 13C ЯМР и 15N ЯМР неводородные атомы из соединения А155(а) определяются следующим образом:

15N ЯМР CP/MAS-спектры продукта, приготовленного с соединением А155(а) и фумаровой кислотой, дигидрохлорид-соли соединения А155(а) и свободного основания соединения А155(а) показаны на фигуре 2. Значительные различия в формах и/или химических сдвигах N-3 и N-25 пиков можно отметить между спектром свободного основания соединения А155(а) и дигидрохлорид-соли соединения А155(а), которые, как полагают, обусловлены ионной природой соли, образованной с каждым из данных атомов азота в дигидрохлорид-соли. В противоположность этому, формы и/или химические сдвиги N-3 и N-25 пиков в спектрах свободного основания соединения А155(а) и продукта, приготовленного с соединением А155(а) и фумаровой кислотой, гораздо более похожи, причем химические сдвиги отличаются только менее чем около 12 м.д. Считается, что отсутствие существенной ионизации N-3 и N-25 атомов азота в продукте, приготовленном с соединением А155(а) и фумаровой кислотой, свидетельствует о его сокристаллическом характере.

13С ЯМР CP/MAS спектр продукта, приготовленного с соединением А155(а) и фумаровой кислотой, показан на фигуре 3. Химические сдвиги в данном спектре явно отличаются от химических сдвигов свободного основания соединения А155(а) (не показано). Кроме того, очевидны новые пики (при около 171,5, 170,3 и/или 135.6 м.д.), связанные с наличием фумарата сокристалла, которые отличаются от пиков фумаровой кислоты в свободной форме; данные новые пики обозначены пятиконечными звездами на фигуре 3 и, как считается, свидетельствуют о сокристаллическом характере продукта.

В одном варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет точку начала плавления от около 175°С до около 179°С при измерении с использованием DTA со скоростью 10°С/мин. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет точку начала плавления от около 175,5°С до около 178,5°С при измерении с использованием DTA со скоростью 10°С/мин. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет точку начала плавления от около 176°С до около 178°С при измерении с использованием DTA со скоростью 10°С/мин. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет точку начала плавления около от 176,4°С до около 177,2°С при измерении с использованием DTA со скоростью 10°С/мин. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет точку начала плавления при около 176,8°С при измерении с использованием DTA со скоростью 10°С/мин.

В одном варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет температуру плавления от около 181°С до около 185°С при измерении с использованием DTA со скоростью 10°С/мин. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет температуру плавления от около 181,5°С до около 184,5°С при измерении с использованием DTA со скоростью 10°С/мин. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет температуру плавления от около 182°С до около 184°С при измерении с использованием DTA со скоростью 10°С/мин. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет температуру плавления от около 182,5°С до около 183,3°С при измерении с использованием DTA со скоростью 10°С/мин. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет температуру плавления около 182,9°С при измерении с использованием DTA со скоростью 10°С/мин.

В одном варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет рентгеновскую порошковую дифрактограмму, содержащую пик на каждом из 6,5°, 12,5°, 16,8°, 25,3° и 2θ±0,2°2θ при измерении с использованием излучения CuKα. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет рентгеновскую порошковую дифрактограмму, содержащую пик при каждом из 6,5°, 12,5°, 16,8°, 23,2°, 25,3°, 38,5° и 2θ±0,2°2θ при измерении с использованием излучения CuKα. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет рентгеновскую порошковую дифрактограмму, содержащую пик при каждом из 6,5°, 8,6°, 12,5°, 14,0°, 16,8°, 18,7°, 25,3° и 2θ±0,2°2θ при измерении с использованием излучения CuKα. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет рентгеновскую порошковую дифрактограмму, содержащую пик при каждом из 6,5°, 8,6°, 12,5°, 14,0°, 16,8°, 18,7°, 20,4°, 21,3°, 22,0°, 23,2°, 25,3°, 38,5° и 2θ±0,2°2θ при измерении с использованием излучения CuKα.

В одном варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет спектр 13С-СР/MAS-ЯМР, содержащий пики с химическим сдвигом 170,3±0.2 м.д., 130,0±0.2 м.д. и 72,2±0.2 м.д.. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет спектр 13C-CP/MAS-HMP, содержащий пики с химическим сдвигом 171,5±0.2 м.д., 170,3±0.2 м.д., 130,0±0.2 м.д. и 72,2±0,2 м.д. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет спектр 13С-CP/MAS-ЯМР, содержащий пики с химическим сдвигом 171,5±0.2 м.д., 170,3±0.2 м.д., 130,0±0.2 м.д., 72,2±0.2 м.д. и 15,1±0.2 м.д.. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет спектр 13С-CP/MAS-ЯМР, содержащий пики с химическим сдвигом 170,3±0.2 м.д., 135,6±0.2 м.д. и 72,2±0.2 м.д.. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет спектр 13С-СР/MAS-ЯМР, содержащий пики с химическим сдвигом 171,5±0.2 м.д., 170,3±0.2 м.д. и 135,6±0.2 м.д.. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет спектр 13С-СР/MAS-ЯМР, содержащий пики с химическим сдвигом 171,5±0.2 м.д., 170,3±0.2 м.д., 135,6±0.2 м.д. и 72,2±0,2 частей на миллион. В другом варианте осуществления продукт, полученный с соединением А155(а) и фумаровой кислотой, имеет спектр 13С-СР/MAS-ЯМР, содержащий пики с химическим сдвигом 171,5±0.2 м.д., 170,3±0.2 м.д., 135,6±0.2 м.д., 72,2±0.2 м.д. и 15,1±0.2 м.д.

Альтернативно, 1,0 г свободного основания соединения А155(а) в 20 мл МеОН при температуре около 25°С перемешивали на магнитной мешалке. Затем добавляли 1,1 эквивалента фумаровой кислоты, полученную суспензию перемешивали на магнитной мешалке до завершения растворения, добавляли затравочный кристалл продукта, полученного из соединения А155(а) и фумаровой кислоты, и перемешивание продолжали до образования осадка. После этого осадок отфильтровывали и сушили при пониженном давлении с получением продукта, который, как показал анализ PXRD, дал по существу одинаковые результаты PXRD, как показано на фигуре 1 и в таблице 4.

5.11 Пример 11: Объединение соединения формулы (I) и соляной кислоты

К 0,3±0,1 мл МеОН во флаконе объемом 4 мл, содержащим также агент сушки (молекулярные сита), добавляли 1,1 эквивалента концентрированной соляной кислоты. Полученную смесь перемешивали на магнитной мешалке в течение около 1 часа. Молекулярные сита отфильтровывали. После этого добавляли 20 мг соединения формулы (I). Полученную суспензию перемешивали на магнитной мешалке в течение около 32 часов. После этого суспензию упаривали досуха с использованием центробежного испарителя (НТ-8 Series II, Genevac Inc, Gardiner, NY). Остаточный продукт анализировали с помощью 1H ЯМР, DTA и PXRD, как описано в примере 10.

5.12 Пример 12: Объединение соединения формулы (I) и винной кислоты

К 20 мг соединения формулы (I) в 0,3±0,1 мл МеОН во флаконе объемом 4 мл добавляли 1,1 эквивалента винной кислоты, то есть 2,3-дигидроксиянтарной кислоты (Sigma-Aldrich). Полученную суспензию перемешивали на магнитной мешалке в течение около 32 часов. После этого суспензию упаривали досуха с использованием центробежного испарителя (НТ-8 Series II, Genevac Inc, Gardiner, NY). Остаточный продукт анализировали с помощью 1Н ЯМР, DTA и PXRD, как описано в примере 10.

5.13 Пример 13: Объединение соединения формулы (I) и бензолсульфокислоты

К 20 мг соединения формулы (I) в 0,3±0,1 мл МеОН во флаконе объемом 4 мл добавляли 1,1 эквивалента бензолсульфоновой кислоты (Sigma-Aldrich). Полученную суспензию перемешивали на магнитной мешалке в течение около 32 часов. После этого суспензию упаривали досуха с использованием центробежного испарителя (НТ-8 Series II, Genevac Inc, Gardiner, NY). Остаточный продукт анализировали с помощью 1Н ЯМР, DTA и PXRD, как описано в примере 10.

5.14 Пример 14: Объединение соединения формулы (I) и толуолсульфоновой кислоты

К 20 мг соединения формулы (I) в 0,3±0,1 мл МеОН во флаконе объемом 4 мл добавляли 1,1 эквивалента толуолсульфоновой кислоты, т.е. 4-метилбензолсульфокислоты (Sigma-Aldrich). Полученную суспензию перемешивали на магнитной мешалке в течение около 32 часов. После этого суспензию упаривали досуха с использованием центробежного испарителя (НТ-8 Series II, Genevac Inc, Gardiner, NY). Остаточный продукт анализировали с помощью 1H ЯМР, DTA и PXRD, как описано в примере 10.

5.15 Пример 15: Связывание соединений формулы (I) с TRPV1

Способы анализа соединений, способных ингибировать TRPV1, известны в данной области техники, например, способы, раскрытые в патенте США №6239267, выданном Duckworth et al., патенте США №6406908, выданном McIntyre et al., или патенте США №6335180, выданном Julius et al. Результаты данных анализов продемонстрируют, что соединения формулы (I) связываются с и модулируют активность TRPV1.

ПРОТОКОЛ 1

Клонирование человеческого рецептора TRPV1:

Использовали РНК спинного мозга человека (коммерчески доступна от Clontech, Palo Alto, CA). Обратную транскрипцию проводили на 1,0 мкг суммарной РНК с использованием обратной транскриптазы Thermoscript (коммерчески доступна от Invitrogen, Carlsbad, CA) и олиго(дТ)праймеров, как описано в описании продукта. Реакционные смеси для обратной транскрипции инкубировали при 55°С в течение 1 ч, инактивировали нагреванием при 85°С в течение 5 мин и подвергали обработке РНКазой Н при 37°С в течение 20 мин.

Последовательность кДНК человеческого рецептора TRPV1 получали сравнением человеческой геномной последовательности, до аннотации, с опубликованной последовательности крысы. Интронные последовательности удаляли и фланкирующие экзонные последовательности соединяли для генерации гипотетической кДНК человека. Праймеры, фланкирующие кодирующую область человеческого TRPV1, составлены следующим образом: прямой праймер GAAGATCTTCGCTGGTTGCACACTGGGCCACA (SEQ ID NO:1) и обратный праймер GAAGATCTTCGGGGACAGTGACGGTTGGATGT (SEQ ID NO:2).

Используя данные праймеры, выполняли ПЦР TRPV1 с одной десятой реакционной смеси для обратной транскрипции с использованием полимеразы Expand Long Template Polymerase и буфера Expand Buffer 2 в конечном объеме 50 мкл в соответствии с инструкциями изготовителя (Roche Applied Sciences, Indianapolis, IN). После денатурации при 94°С в течение 2 мин ПЦР-амплификацию проводили в течение 25 циклов при 94°С в течение 15 сек, при 58°С в течение 30 сек и при 68°С в течение 3 мин с последующей конечной инкубацией при 72°С в течение 7 мин для завершения амплификации. Продукт ПЦР размером около 2,8 т.п.н. выделяли в геле с использованием 1,0% агарозного трис-ацетатного геля, содержащего 1,6 мкг/мл кристаллического фиолетового, и очищали с помощью набора S.N.A.P. UV-Free Gel Purification Kit (коммерчески доступный от Invitrogen). Продукт ПЦР TRPV1 клонировали в вектор pIND/V5-His-TOPO (коммерчески доступный от Invitrogen) в соответствии с инструкциями изготовителя, чтобы получить конструкт TRPV1-pIND. Препараты ДНК переваривание рестрикционными ферментами и предварительное секвенирование ДНК выполняли в соответствии со стандартными протоколами. Секвенирование полной длины подтверждает идентичность человеческого рецептора TRPV1.

Генерация индуцибельных клеточных линий:

Если не указано иное, реагенты для культуры клеток приобретены у Life Technologies of Rockville, MD. Клетки HEK293-ECR, экспрессирующие рецептор экдизона (коммерчески доступны от Invitrogen) культивировали в ростовой среде (модифицированная среда Dulbecco's Modified Eagles Medium, содержащая 10% эмбриональной бычьей сыворотки (коммерчески доступна от Hyclone, Logan, UT)), 1× пенициллин/стрептомицин, 1× глутамин, 1 мМ пирувата натрия и 400 мкг/мл Zeocin (коммерчески доступный от Invitrogen)). Конструкции TRPV1-pIND трансфицировали в клеточной линии HEK293-EcR с использованием реагента для трансфекции Fugene (коммерчески доступен от Roche Applied Sciences, Базель, Швейцария). Через 48 ч клетки переносили в селективную среду (ростовая среда, содержащая 300 мкг/мл G418 (коммерчески доступный от Invitrogen)). Около 3 недели спустя отдельные колонии, резистентные к Zeocin/G418, изолировали и разращивали. Чтобы идентифицировать функциональные клоны, несколько колоний высевали в 96-луночные планшеты и индуцировали экспрессию в течение 48 ч с использованием селективной среды, дополненной 5 мкМ понастерона А ("PonA") (коммерчески доступный от Invitrogen). В день анализа клетки загружали Fluo-4 (кальций-чувствительный краситель, который коммерчески доступен от Molecular Probes, Eugene OR) и измеряли САР-опосредованной приток кальция с использованием планшетного ридера Fluorescence Imaging Plate Reader ("FLIPR") как описано ниже. Функциональные клоны повторно анализировали, разращивали и криоконсервировали.

Анализ на основе рН:

За два дня до проведения данного анализа клетки высевали на покрытые поли-D-лизином 96-луночные черные планшеты с прозрачным дном (коммерчески доступны от Becton-Dickinson) при 75000 клеток/лунку в питательной среде, содержащей 5 мкМ PonA (коммерчески доступный от Invitrogen) для индукции экспрессии TRPV1. В день анализа планшеты промывали 0,2 мл сбалансированного солевого раствора Хенкса (1×) (коммерчески доступный от Life Technologies), содержащего 1,6 мМ CaCl2 и 20 мМ HEPES, рН 7,4 ("промывочный буфер") и загружали с помощью 0,1 мл промывочного буфера, содержащего Fluo-4 (конечная концентрация 3 мкМ, коммерчески доступный от Molecular Probes). Через 1 ч клетки дважды промывали 0,2 мл промывочного буфера и снова суспендировали в 0,05 мл сбалансированного солевого раствора Хенкса (1×) (коммерчески доступный от Life Technologies), содержащего 3,5 мМ CaCl2 и 10 мМ цитрата, рН 7,4 ("аналитический буфер"). Затем планшеты переносили в FLIPR для анализа. Тестируемое соединение разбавляли в буфере для анализа, 50 мкл полученного раствора добавляли в планшеты с клетками, и раствор контролировали в течение двух минут. Конечную концентрацию тестируемого соединения регулировали в диапазоне от около 50 пикомоль до около 3 мкМ. Агонист-буфер (промывочный буфер титровали 1N HCl, чтобы получить раствор с рН 5,5 при смешивании в соотношении 1:1 с буфером для анализа) (0,1 мл) затем добавляли в каждую лунку, и планшеты инкубировали в течение 1 дополнительной минуты. Данные собирали на протяжении всего времени и анализировали с помощью Excel и Graph Pad Prism для определения IC50.

Анализ на основе капсаицина:

За два дня до проведения данного анализа клетки высевали на покрытые поли-D-лизином 96-луночные черные планшеты с прозрачным дном (50000 клеток/лунку) в питательной среде, содержащей 5 мкм PonA (коммерчески доступный от Invitrogen), чтобы индуцировать экспрессию TRPV1. В день анализа планшеты промывали 0,2 мл сбалансированного солевого раствора Хенкса (1×) (коммерчески доступный от Life Technologies), содержащего 1 мМ CaCl2 и 20 мМ HEPES, рН 7,4, и клетки загружали с помощью 0,1 мл промывочного буфера, содержащего Fluo-4 (конечная концентрация 3 мкМ). Через один час клетки дважды промывали 0,2 мл промывочного буфера и снова суспендировали в 0,1 мл промывочного буфера. Планшеты переносили в FLIPR для анализа. 50 мкл тестируемого соединения, разбавленного аналитическим буфером (сбалансированный солевой раствор Хенкса (1×), содержащий 1 мМ CaCl2 и 20 мМ HEPES, рН 7,4) добавляли в планшеты с клетками и инкубировали в течение 2 мин. Конечную концентрацию тестируемого соединения регулировали в диапазоне от около 50 пикомоль до около 3 мкМ. Человеческий TRPV1 активировали добавлением 50 мкл капсаицина (400 нм), и планшеты инкубировали в течение дополнительных 3 минут. Данные собирали на протяжении всего времени и анализировали с помощью Excel и Graph Pad Prism для определения IC50.

ПРОТОКОЛ 2

Для протокола 2 использовали клеточную линию яичника китайского хомячка (Chinese Hamster Ovary (CHO)), которая был разработана для конституитивной экспрессии рекомбинантного TRPV1 человека (клетки TRPV1/CHO). Клеточную линию TRPV1/CHO генерировали, как описано ниже.

Клонирование человеческого рецептора TRPV1:

КДНК человеческого рецептора TRPV1 (hTRPV1) амплифицировали с помощью ПЦР (ДНК-полимераза KOD-Plus, ToYoBo, Japan) из библиотеки кДНК человеческого мозга (BioChain) с использованием праймеров, сконструированных, чтобы окружать открытую рамку считывания полной hTRPV1 (прямой 5'-GGATCCAGCAAGGATGAAGAAATGG (SEQ ID NO:3) и обратный 5'-TGTCTGCGTGACGTCCTCACTTCT (SEQ ID NO:4)). Полученные ПЦР-продукты очищали от агарозного геля с использованием набора для очистки Gel Band Purification Kit (GE Healthcare Bioscience) и субклонировали в ПЦР-векторе Blunt (Invitrogen). Клонированную кДНК полностью секвенировали с использованием реагента флуоресцентного красителя-терминатора (BigDye Terminator ver3.1 Cycle Sequencing Kit, Applied Biosystems) и анализатора ABI Prism 3100 genetic analyzer (Applied Biosystems). Вектор ПЦР-Blunt, содержащий кДНК hTRPV1, подвергали рестрикции с EcoR1. Рестрикционный фрагмент субклонировали в вектор экспрессии pcDNA3.1(-) (Invitrogen) и назвали плазмидой pcDNA3.1(-)-HVR1. Последовательность кДНК, кодирующая TRPV1, доступна в генетическом банке GenBank под номером доступа AJ277028.

Генерация клеточной линии TRPV1/CHO:

Клетки СНО-K1 поддерживали в среде роста, состоящей из α-МЕМ, 10% FBS (Hyclone) и смешанного раствора 100 МЕ/мл пенициллин-100 мкг/мл стрептомицин (Nacalai Tesque, Япония) при 37°С в атмосфере увлажненного 95% воздуха и 5% CO2. Клетки трансфицировали плазмидой pcDNA3.1(-)-HVR1 с использованием FuGENE6 (Roche) в соответствии с протоколом производителя. Через 24 часа после трансфекции неомицин-резистентные клетки отбирали с использованием 1 мг/мл G418 (Nacalai Tesque). Через 2 недели собирали отдельные колонии, рассевали и проводили скрининг на экспрессию hTRPV1 анализом индуцированного капсаицином притока Са2+ (см. ниже) с FLIPR (Molecular Devices). Клон с самым большим Са2+-ответом на капсаицин был выбран и повторно клонирован по той же методике. Клетки, экспрессирующие hTRPV1, культивировали в ростовой среде, дополненной 1 мг/мл G418. Приблизительно через 1 месяц стабильная экспрессия функциональных рецепторов TRPV1 в выбранной клеточной линии была подтверждена проверкой Ca2+-ответов с капзацепином или без него (Sigma, при от 1 нМ до 10 мкМ) капсаициновом анализом.

Анализ индуцированного капсаицином притока Са2+ для выбора клетки:

Следующий анализ проводили для идентификации клеток с экспрессией hTRPV1. СНО-K1-клетки, трансфицированные плазмидой pcDNA3.1(-)-HVR1, высевали в 384-луночные планшеты с черными стенками и прозрачным дном (Corning) и выращивали в ростовой среде (см. выше) в течение 1 дня. В день эксперимента культуральную среду заменяли на аналитический буфер (20 мМ HEPES, 137 мМ NaCl, 2,7 мМ KCl, 0,9 мМ MgCl22, 5,0 мМ CaCl2, 5,6 мМ D-глюкозы, 2,5 мМ пробенецида, рН 7,4), содержащий 4 мкМ Fluo-3-AM (Dojin, Japan). После инкубации при 37°С в течение 1 часа каждую лунку промывали 3 раза аналитическим буфером с использованием устройства для промывки планшетов EMBLA 384 (Molecular Devices) и заполняли аналитическим буфером. Планшеты инкубировали при температуре около 25°С в течение 10 мин. Затем планшеты вставляли в FLIPR и добавляли в каждую лунку 1,5 мкМ раствор капсаицина (Sigma), приготовленный в буфере для анализа (конечная концентрация составляла 500 нм). Клеточные ответы наблюдали в течение 5 мин.

Культура клеток:

1. Клеточная культуральная среда

1. Альфа-МЕМ (Gibco, CAT: 12561-056, LOT: 1285752): 450 мл.

2. Фетальная сыворотка теленка (FBS), термоинактивированная (Gibco, CAT: 16140-071, LOT: 1276457): 50 мл.

3. Раствор HEPES-буфера, исходный раствор 1 М (Gibco, CAT: 15630-080): 10 мл (конечная концентрация 20 мм).

4. Генетицин, 50 мг/мл исходный раствор (Gibco, CAT: 10135-035): 10 мл (конечная концентрация 1 мг/мл).

5. Смешанный раствор противогрибковых антибиотиков, (100×) исходный раствор (Nacalai Tesque, CAT: 02892-54): 5 мл.

Вышеупомянутые компоненты от 1 до 5 объединяли в указанных количествах и хранили при 4°С. Перед использованием клеточную культуральную среду нагревали до около 37°С. По желанию, компонент 5 может быть заменен на раствор пенициллин-стрептомицин (например, Gibco 15140-122 или Sigma P-0781).

2. Размораживание клеток

Клетки TRPV1/CHO замораживали в CELLBANKER™ (Juji-Field, Inc., Japan, CAT: BLC-1) и хранили при -80°С. Использовали оптимизированный раствор для криоконсервации, содержащий диметилсульфоксид и FBS.

Флаконы, содержащие клетки TRPV1/CHO, хранили при -80°С. После удаления от -80°С флакон немедленно переносили на водяную баню при 37°С для оттаивания в течение приблизительно от 1 до 2 минут. После полного размораживания содержимое флакона (1 мл/флакон) переносили в стерильную пробирку объемом 15 мл и медленно добавляли 9 мл теплой культуральной среды. Пробирку затем центрифугировали при 1000 оборотов в минуту в течение 4 мин при температуре около 25°С. Надосадочную жидкость удаляли и осадок ресуспендировали в 10 мл культуральной среды. Клеточную суспензию переносили в стерильную пластиковую 75 см2-колбу и инкубировали в увлажненной атмосфере 5% CO2/95% воздуха при 37°С Для контроля жизнеспособности клетки визуально контролировали и/или подсчитывали, начиная с приблизительно 1 часа после инкубации.

3. Пассирование клеток

Клетки в колбе были близки к слиянию в момент пассирования. Клеточную культуральную среду удаляли из культуральной колбы и добавляли 10 мл стерильного PBS(-), и колбу осторожно встряхивали. PBS удаляли из колбы и добавляли 2 мл раствора трипсин/ЭДТА (0,05% трипсина с ЭДТА-4МА; Gibco, CAT: 25300-054), и колбу осторожно встряхивали. Колбу инкубировали при 37°С в течение около 2 мин. Затем в колбу добавляли 8 мл культуральной среды и колбу встряхивали, чтобы гарантировать, что все клетки находятся в растворе. Клеточную суспензию затем переносили в стерильную пластиковую пробирку объемом 15 мл или 50 мл, центрифугировали при 1000 оборотах в минуту в течение 4 мин при температуре около 25°С. Надосадочную жидкость удаляли и осадок ресуспендировали в объеме около 5 мл культуральной среды. Количество клеток измеряли с использованием гемоцитометра Burker-Turk.

Клетки высевали в стерильную пластиковую 75 см2-колбу в количестве, составляющем около 0,8×105 клеток/мл, в течение 72 часов и инкубировали в увлажненной атмосфере 5% CO2/95% воздуха при 37°С.

4. Замораживание клеток

Процедура до измерения количества клеток была такой же, как в разделе, озаглавленном "Пассирование клеток" выше. Затем клеточную суспензию центрифугировали при 1000 оборотах в минуту в течение 4 мин при температуре около 25°С. Надосадочную жидкость удаляли, а осадок ресуспендировали в растворе CELLBANKER™, чтобы получить конечную концентрацию, составляющую от 5×105 до 5×106 клеток/мл. Клеточную суспензию переносили в соответственно помеченные криопробирки объемом 1 мл и затем помещали в морозильник на -80°С.

Анализ на основе рН:

Следующий анализ проводили для определения концентрации серной кислоты, которая привела бы к рН, который индуцирует Ca2+-ответ, оптимальный для проверки влияния тестируемых соединений на TRPV1.

1. Клетки

Клетки TRPV1/CHO высевали в 96-луночный планшет с черными стенками и прозрачным дном (Nunc) при плотности от 1×104 до 2×104 клеток/лунку и культивировали в 100 мкл культуральной среды (альфа-МЕМ с добавлением 10% FBS, 20 мМ HEPES, 1 мг/мл генетицина и 1% исходного раствора смешанных противогрибковых антибиотиков) в течение от 1 до 2 дней до эксперимента.

2. Определение рН-чувствительности и дозы агониста

2.1. Раствор с агонистическим действием

Семь различных растворов с агонистическим действием с концентрацией серной кислоты, равной 15,0, 15,5, 16,0, 16,5, 17,0, 17,5 и 18,0 мМ, получали разбавлением 1 М серной кислоты измерительным буфером (см., например, фигуру 1 публикации заявки на патент США №2009 США/0170868 А1). Различные концентрации серной кислоты в растворах с агонистическим действием были выбраны таким образом, что разведение 1:4 приводило к окончательной концентрации серной кислоты, составляющей 3.0, 3.1, 3.2, 3.3, 3.4, 3.5 и 3.6 мМ, обозначаемой от "В" до "Н", соответственно. Также использовали буфер без серной кислоты, обозначенный "А".

2.2. Анализ

Определяли рН-зависимые Са2+-ответы в клетках TRPV1/CHO, культивированных в 96-луночном планшете (см., например, фигуру 2 из патентной заявки США № США 2009/0170868 А1). В частности, определяли приток Са2+ в клетки TRPV1/CHO в ответ на низкий рН, измеренный по флуоресценции Fura-2 AM. Клетки стимулировали с помощью 3,0 мМ (номера лунок от В1 до В6), 3,1 мМ (от С1 до С6), 3,2 мМ (от D1 до D6), 3,3 мМ (от Е1 до Е6), 3,4 мМ (от F1 до F6), 3,5 мМ (от G1 до G6) или 3,6 мМ (от H1 до Н6) H2SO4 или измерительным буфером рН 7,2 без H2SO4 (от А1 до А6).

(1) Культуральную среду удаляли с использованием 8-канальной пипетки (Rainin, США) из 96-луночного планшета, и лунки снова заполняли 100 мкл загрузочного буфера (20 мМ HEPES, 115 мМ NaCl, 5,4 мМ KCl, 0,8 мМ MgCl2, 1,8 мМ CaCl2 13,8 мМ D-глюкозы, 2,5 мМ пробенецида, рН 7,4), содержащего 5 мкМ Fura-2 AM (Dojin, Japan).

(2) 96-луночный планшет инкубировали при 37°С в течение 45 мин.

(3) Загрузочный буфер удаляли из каждой лунки. Затем клетки дважды промывали 150 мкл измерительного буфера (20 мМ HEPES, 115 мМ NaCl, 5,4 мМ KCl, 0,8 мМ М MgCl2, 5,0 мМ CaCl2, 13,8 мМ D-глюкозы, 0,1% BSA, рН 7,4) (без пробенецида). Лунки затем снова заполняли 80 мкл измерительного буфера.

(4) После инкубации при 4°С в течение 15 мин 96-луночный планшет переносили в планшетный ридер модели FDSS-3000 (Hamamatsu Photonics K.K., Япония).

(5) Интенсивность флуоресценции Fura-2 контролировали на длине волны 340 нм и при 380 нм, соответственно, со скоростью 0,5 Гц, в течение, в общей сложности, 240 секунд. После 16 временных точек (32 сек) детекции базовой линии в каждую лунку добавляли 20 мкл раствора с агонистическим действием. Конечный объем составлял 100 мкл/лунку.

(6) Коэффициент интенсивности флуоресценции означает отношение величины интенсивности флуоресценции при 340 нм к величине интенсивности флуоресценции при 380 нм в определенный момент времени. Базовая линия была установлена как среднее значение отношений интенсивностей флуоресценции в течение первых 16 временных точек перед добавлением раствора с агонистическим действием. Максимальный ответ представлял собой самое высокое значение отношения интенсивностей флуоресценции в течение 60 временных точек после добавления раствора с агонистическим действием.

(7) Максимальные отношения сигналов из каждой лунки рассчитывали как выходные данные, используя программу анализа FDSS-3000. Данные были проанализированы с помощью программного обеспечения Excel (Microsoft) и XLfit (idbs).

2.3. Определение рН

После обнаружения Ca2+-ответов буфер каждой дорожки 96-луночного планшета (50 мкл/лунку, от 8 до 20 лунок/планшет) последовательно собирали из лунок и измеряли значения рН с использованием портативного рН-метра (Shindengen, Япония).

Ca2+-ответы в дорожках D и Е были промежуточными и поэтому оптимальными для изучения влияния соединений на кальциевый канал TRPV1 (см., например, фигуру 2 из публикации заявки на патент США № США 2009/0170868 А1). Конечные концентрации серной кислоты в лунках данных дорожек составляли 3,2 мМ и 3,3 мМ, соответственно. Данные конечные концентрации серной кислоты были получены с использованием растворов с агонистическим действием с концентрацией серной кислоты, составляющей 16,0 М и 16,5 мМ, соответственно (дорожки D и Е). Значение рН, полученное с использованием данных концентраций серной кислоты, составляло от около 5,0 до около 5.1.

Таким образом, растворы с агонистическим действием с концентрациями серной кислоты, составляющими 16,0 мМ и 16,5 мМ, соответственно (полосы D и Е), были отобраны для экспериментов, описанных ниже в разделе 3.

3. Анализ рН

3.1. Агонист

В "планшете с агонистом" два различных раствора с агонистическим действием с различной концентрацией H2SO4 были использованы для анализа рН (см., например, фигуру 3А публикации заявки на патент США № США 2009/0170868 А1). Для первой половины 96-луночного планшета использовали один раствор с агонистическим действием; для второй половины использовали другой раствор с агонистическим действием. Растворы с агонистическим действием были получены разбавлением серной кислоты (1 М H2SO4) измерительным буфером. Концентрации для двух растворов с агонистическим действием были определены, как описано выше в разделе 2 протокола 2.

Концентрации серной кислоты между растворами с агонистическим действием отличалась на 0,5 мМ. В эксперименте, описанном в разделе 2 протокола 2, концентрации серной кислоты в растворах с агонистическим действием были определены как 16 мМ и 16,5 мМ, соответственно. После разбавления растворов с агонистическим действием в соотношении 1:4 конечная концентрация серной кислоты составила 3,2 мМ и 3,3 мМ, соответственно. Полученное значение рН для анализа рН составляло от 5,0 до 5.1.

3.2. Тестируемые соединения

Тестируемые соединения растворяли в ДМСО с получением 1 мМ исходных растворов. Исходные растворы дополнительно разбавляли, используя ДМСО в серийных разведениях 1:3 с 6 точками (1000, 250, 62,5, 15,625 3,9062 и 0,977 мкМ). Полученные таким образом растворы дополнительно разводили в измерительном буфере (1:100) в виде серийных разведении 10-кратного исходного раствора с концентрацией ДМСО, равной 1%. 10 мкл 10-кратного исходного раствора добавляли в каждую лунку "планшета с агонистом" (см. стадию 3.3. (4) ниже). Таким образом, конечные концентрации антагонистов был следующими: 0,977, 3,906, 15,63, 62,5, 250 и 1000 нМ, содержащих 0,1% ДМСО (см., например, фигуру 3B публикации заявки на патент США № США 2009/0170868 А1).

3.3. Анализ

Стадии (1) и (2) данного анализа были такими же, что и стадии 2.2.(1) и 2.2.(2), соответственно, из протокола 2.

(3) Клетки промывали дважды 150 мкл измерительного буфера (упомянутого в стадии 2.2.(3) протокола 2, без пробенецида). Лунки затем наполняли 70 мкл измерительного буфера.

(4) 10 мкл измерительного буфера или 10 мкл серийного разведения 10-кратного исходного раствора тестируемого соединения (описанного в пункте 3.2. выше) наносили в каждую лунку. Как правило, испытывали только одно тестируемое соединение на 96-луночный планшет. Для определенного агониста в определенной концентрации число повторов на 96-луночный планшет составляло 2×7, поскольку, как описано для "планшета с агонистом", использовали две различные концентрации серной кислоты на 96-луночный планшет, и использовали семь дорожек (от А до С, от Е до Н) на 96-луночный планшет (N равен 2×7).

Стадия (5) была такой же, как и стадия 2.2.(4), описанная выше.

(6) Интенсивность флуоресценции Fura-2 контролировали, как описано на стадии 2.2.(5) выше. После 16 временных точек детекции базовой линии 20 мкл раствора с агонистическим действием (измерительный буфер титровали H2SO4, чтобы получить значение рН в интервале от около 5,0 до около 5,1 при смешивании в соотношении 1:4 с измерительным буфером, содержащим тестируемое соединение) добавляли в каждую лунку (конечный объем 100 мкл/лунку).

Стадии (7) и (8) были такими, как описано в стадиях 2.2.(6) и 2.2.(7) выше, соответственно.

3.4. Проверка рН

(1) Значения рН буфера в лунках от А1 до H1 и от А7 до Н7 измеряли одно за другим с помощью портативного рН-метра.

(2) Когда подтверждалось, что значение рН в лунке составляло от около 5,0 до около 5,1, то проверяли следующие пять лунок справа от нее (например, для лунки В1, лунки от В2 до В6) одну за другой.

(3) Для расчета IC50 использовали только данные из лунок со значениями рН от 5,0 до 5,1. Количество лунок, прошедших тестирование на их рН, варьировало среди планшетов (от 16 до 60 лунок/планшет). Число зависело от результатов стадии 3.4.(1), описанной выше, и от Ca2+-ответов.

Анализ на основе капсаицина:

За день до анализа клетки TRPV1/CHO высевали в 96-луночные черные планшеты с прозрачным дном (20000 клеток/лунку) в питательной среде. В день эксперимента клетки промывали 0,2 мл сбалансированного солевого раствора (1×) Хенкса (Life Technologies), содержащего 1,6 мМ CaCl2 и 20 мМ HEPES, рН 7,4 ("промывочный буфер"). Затем клетки загружали инкубацией в 0,1 мл промывочного буфера, содержащего Fluo-4 с конечной концентрацией, равной 3 мкМ. Через 1 час клетки дважды промывали 0,2 мл промывочного буфера и снова суспендировали в 0,1 мл промывочного буфера. Затем планшеты переносили в планшетный ридер Fluorescence Imaging Plate Reader (Molecular Devices). Интенсивность флуоресценции контролировали в течение 15 секунд, чтобы установить базовую линию. Затем тестируемые соединения, разведенные в аналитическом буфере (сбалансированный солевой раствор Хенкса (1×), содержащий 1 мМ CaCl2 и 20 мМ HEPES, рН 7,4), содержащем 1% ДМСО, добавляли к планшету с клетками и контролировали флуоресценцию в течение 2 минут. Конечную концентрацию соединения доводили до диапазона от 100 мкМ до 1,5625 мкМ. Если тестируемое соединение было особенно сильным антагонистом, конечную концентрацию соединения доводили до диапазона от 10 мкМ до 1,5625 нМ. Человеческий TRPV1 затем активировали добавлением 50 мкл капсаицина (конечная концентрация 100 нМ), и планшеты инкубировали дополнительно в течение 3 мин. Данные собирали на протяжении всего времени и анализировали с помощью Excel и формулы аппроксимации кривых GraphPad Prism.

Результаты анализов протокола 2 приведены в таблице 6.

Анализ человеческого TRPV1 на основе теплового воздействия:

Были использованы клетки СНО, стабильно экспрессирующие человеческий TRPV1 (hTRPV1). Функциональная оценка индуцированной теплом активации hTRPV1 проводилась анализом потока Са2+ в клетках с использованием ABI7500 Fast Real-Time PCR System, как описано в публикации Reubish et al., "Functional assessment of temperature-gated ion-channel activity using a real-time PCR machine," www.BioTechmques.com 47(3):iii-ix (2009), которая включена сюда посредством ссылки. Вкратце, клетки hTRPV1/СНО культивировали в питательной среде в чашке для культуры ткани при 37°С в СО2-инкубаторе. В день анализа культуральную среду удаляли и клетки затем разделяли с использованием 0,05% трипсина при 37°C с 5% CO2, в течение 90 с. Отдельные клетки центрифугировали (1000 оборотов в минуту, 4 мин) для удаления содержащего трипсин супернатанта и ресуспендировали в аналитическом буфере (115 мм NaCl, 5,4 мМ KCl, 0,8 мМ MgCl2⋅6H2O, 1,8 мМ CaCl2⋅2H2O, 13,8 мМ D-глюкозы и 20 мМ HEPES). Затем клетки загружали 5 мМ Fluo-4, репортерным красителем Са2+, в присутствии 2,5 мМ пробенецида при 37°C с 5% CO2, в течение 45 мин. После этого клетки дважды промывали измерительным буфером (аналитический буфер с добавлением 0,1% BSA и 3,2 мМ CaCl2) и затем переносили в планшет Fast 96-well Reaction Plate (0,1 мл) (Part no. 4346907, MICROAMP, Applied Biosystems, Foster City, CA). Плотность клеток составляла 100000 клеток/24 мкл/лунку. Раствор тестируемого соединения (6 мкл/лунку) добавляли в каждую лунку 96-луночного планшета. Таким образом, объем реакционной смеси на лунку составлял 30 мкл.

Планшеты помещали внутри прибора ABI7500 Fast Real-Time PCR (Applied Biosystems) для считывания значений флуоресценции при различных температурах с использованием программного обеспечения 7500, версии 2.0.2 (Applied Biosystems). Начальная температура была установлена на уровне 25°С в течение 1 мин. с последующим режимом линейного изменения температуры до 45°С за 100 с, чтобы нагреть клетки. Ответ [Са2+]i клеток hTRPV1/СНО на тепло определяли как:

[значение флуоресценции, считанное при 45°С - значение флуоресценции, считанное при 25°С].

Кривые зависимости ответов от концентрации соединения и значения IC50 были проанализированы с использованием программного обеспечения GraphPad Prism 4 (GraphPad Software, La Jolla, CA).

Данные IC50, представленные в таблице 6, показаны в виде среднее значение±стандартная ошибка среднего значения; количество испытаний, проведенных для каждого анализа, показано в скобках, за исключением только для одного испытания, где число испытаний не указано в скобках. Результаты, приведенные в таблице 6 в графической части, показывают, что многие соединения формул (I) и/или (II) являются мощными антагонистами TRPV1.

5.16 Пример 16: Анализы in vivo для профилактики или лечения боли

Подопытные животные: В каждом эксперименте используются крысы массой от 200 г до 260 г в начале эксперимента. Крысы были размещены группами и имели свободный доступ к пище и воде в любое время, за исключением момента перед пероральным введением соединения формулы (I), когда пищу удаляли за 16 часов перед введением дозы. Контрольная группа служила для сравнения с крысами, обработанными соединением формулы (I). Контрольной группе вводили носитель соединения формулы (I). Объем носителя, вводимого в контрольной группе, был такой же, как и объем носителя и соединения формулы (I), вводимого в опытной группе.

Острая боль: Для оценки действия соединения формулы (I) для лечения или профилактики острой боли может быть использован тест на реакцию отдергивания хвоста крысой. Крыс мягко удерживают рукой, и хвост подвергают воздействию сфокусированного луча теплового излучения в точке на расстоянии от кончика, равном 5 см, используя блок для изучения реакции отдергивания хвоста (модель 7360, коммерчески доступный от Ugo Basile Италии). Время задежки в отдергивании хвоста (латентность) определяется как интервал между началом теплового стимула и движением хвоста. Животные, не реагирующие в течение 20 секунд, удаляются из блока для изучения реакции отдергивания хвоста, и им приписываются времена задержки, равные 20 секундам. Латентность отдергивания хвоста измеряют непосредственно перед (предварительная обработка) и через 1, 3 и 5 часов после введения соединения формулы (I). Данные выражают как латентность отдергивания хвоста(ов), и процент максимального возможного эффекта (МРЕ), то есть 20 секунд, рассчитывали следующим образом:

Тест на реакцию отдергивания хвоста крысой описывается у D'Amour et al., "A Method for Determining Loss of Pain Sensation," J. Pharmacol. Exp. Ther. 72:74-79 (1941).

Воспалительная боль: Для оценки действия соединения формулы (I) для лечения или профилактики воспалительной боли был использована модель воспалительной боли, индуцированной полным адъювантом Фрейнда (FCA). FCA-индуцированное воспаление задней лапы крысы связано с развитием стойкой воспалительной механической гипералгезии и обеспечивает надежное предсказание антигипералгезического действия применяемых в клинических целях анальгетиков (Bartho et al., "Involvement of capsaicin-sensitive neurons in hyperalgesia and enhanced opioid antinociception in inflammation," Naunyn-Schmiedeberg's Archives of Pharmacol. 342:666-670 (1990)). В правую заднюю лапу каждого самца 6-недельных крыс Jc1: Sprague-Dawley (SD) вводили 50 мкл 50% FCA в виде внутриподошвенной инъекции (Sigma-Aldrich). Через 24 час после инъекции животное оценивали на ответ на вредные механические раздражители определением PWT, как описано ниже. Затем крысам вводили одну инъекцию 0,1, 0,3, 1, 3 или 10 мг/кг либо продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, 20 мг/кг ибупрофена в качестве контроля (EMD Millipore Chemicals, Inc), или носителя в качестве контроля (0,5% масса/объем метилцеллюлозы (400 сР, Wako Pure Chemical Industries, Ltd, Осака, Япония)/водный раствор). Количество фумаровой кислоты (AK Scientific), сравнимое с таковым, присутствующим с продуктом, приготовленным с соединением А155(а) и фумаровой кислотой, как описано в примере 10, также присутствовало в каждом контроле. Ответы на вредные механические раздражители затем определяли через 1, 3, 5, и 7 часов после введения. Процент реверсирования гипералгезии для каждого животного определяли как:

За исключением контролей (т.е. ибупрофен, носитель), где был использован t-тест Стьюдента, для % реверсирования был проведен тест Даннета. В любом случае значения со значением p, составляющим менее 0,05, считали статистически значимыми. Результаты % реверсирования для введения продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, и соответствующие контроли представлены в таблице 7.

Как свидетельствуют результаты в таблице 7, оценки действий соединений формулы (I) показали, что данные соединения являются эффективными, например, продукт, полученный с соединением А155(а) и фумаровой кислотой, как описано в примере 10, значительно снижал FCA-индуцированное воспаление, со значениями ED50, составляющими от около 0,2 мг/кг до около 0,4 мг/кг, и максимальными значениями % реверсирования, составляющими от около 24% до около 100%. Например, % реверсирования FCA-индуцированного воспаления после введения дозы, равной 3 мг/кг, продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, составлял около 80% или выше, то есть 80,3% через 1 час после введения, 87,9% через 3 часа после введения, 86,6% через 5 часов после введения и 97,3% через 7 часов после введения продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10.

Даже при минимальной эффективной дозе, составляющей 0,1 мг/кг продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, % реверсирования FCA-индуцированного воспаления составлял около 24% или выше, то есть 31,9% через 1 час после введения, 37,8% через 3 часа после введения, 31,3% через 5 часов после введения и 23,6% через 7 часов после введения продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10. В противоположность этому, доза ибупрофена, составляющая 20 мг/кг, была гораздо менее эффективной, чем равная 0,3 мг/кг доза продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, в каждой тестируемой временной точке, то есть 28,6% по сравнению с 65,0% соответственно через 1 час после введения, 41,5% по сравнению с 60,2% соответственно через 3 часа после введения, 39,2% по сравнению с 54,1% соответственно через 5 часов после введения, и 32,5% по сравнению с 39,4% соответственно через 7 часов после введения. Делая такое сравнение, следует отметить, что доза введенного ибупрофена, составляющая 20 мг/кг, превышала более чем в 66 раз дозу продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, 0,3 мг/кг.

Остеоартритная боль: Для оценки действия соединения формулы (I) для лечения или профилактики остеоартритной боли была использована крысиная модель индуцированного мононатриевым йод-ацетатом (MIA, т.е. 2-иодацетат натрия) остеоартрита. Интраартикулярная инъекция MIA вызывает совместную дегенерацию, которая характеризуется остеолизом и отеком, со смещением коленной чашечки, и снижение содержания минеральных веществ в костях и минеральной плотности костной ткани (Pomonis et al., "Development and pharmacological characterization of a rat model of osteoarthritis pain," Pain 114:339-346 (2005)). Под изофлурановым наркозом вводили 2 мг MIA (Sigma-Aldrich) в 50 мкл физиологического раствора в виде внутрисуставной инъекции в инфрапателлярную связку коленного сустава правой задней лапы самцов 6-недельных крыс Cr1: CD (Sprague-Dawley (SD)). Контрольные крысы получали внутрисуставную инъекцию 50 мкл физиологического раствора в коленный сустав правой задней лапы. Левый коленный сустав всех крыс не обрабатывали. Через две недели после инъекции MIA крыс оценивали в отношении поведения, связанного с остеоартритной болью, непосредственно перед и через 1, 3, 5, 7 и 24 часа после перорального приема лекарственного средства в носителе (в 1-й день), определяя их способности в отношении весовой нагрузки посредством теста разности весовой нагрузки (weight bearing difference (WBD)) и их захватывающие способности посредством теста силы захвата, каждый, как описано ниже. Таким образом, в оценке облегчения остеоартритной боли посредством определений возможности захвата временной точкой 24 часа служило начало следующего дня, когда препарат в носителе вводили снова перорально (через 24 часа после предварительного введения) для некоторых доз. В дни 2, 3, и 4 ответ в отношении возможности захвата определяли через 3 и 24 часа после этого.

Дополнительно, 3 мг/кг целекоксиба (BioVision Inc., Milpitas, CA), высокоселективного ингибитора СОХ-2, принимаемого для купирования воспаления и боли, в носителе и только носитель (0,5% масса/объем метилцеллюлозы (400 сР, Wako Pure Chemical Industries, Ltd)/водный раствор) вводили перорально в качестве контроля. Количество фумаровой кислоты, сравнимое с таковым, присутствующим с продуктом, приготовленным с соединением А155(а) и фумаровой кислотой, как описано в примере 10, также присутствовало в каждом контроле.

Тест разности весовой нагрузки (Weight Bearing Difference Test) в качестве оценки боли, связанной с остеоартритом: Тест разности весовой нагрузки дает принятую оценку эффективности клинически применяемых анальгетиков в отношении боли, связанной с остеоартритом (см. Pomonis et al. (2005)). WBD оценивали с помощью прибора Linton Incapacitance Tester (Linton Instrumentation, Norfolk, UK). Крыс помещали на устройстве таким образом, чтобы они стояли на задних лапах, и давали возможность привыкнуть к устройству. При стационарном измерении весовую нагрузку, оказываемую на каждую лапу, измеряли в течение 3 с. Три значения получали для каждой крысы в каждой временной точке; среднее значение трех измерений использовали для анализа данных. WBD выражали как "% WR", то есть процент весовой нагрузки, оказываемой на правую заднюю лапу, в которую вспрыскивали MIA, по следующей формуле:

где WR представляет собой весовую нагрузку, оказываемую на правую заднюю лапу, и WL представляет собой весовую нагрузку, оказываемую на левую (необработанную) заднюю лапу. Значение 50% от % WR соответствует равному распределению весовой нагрузки на обе задние лапы. "% WRR", то есть процент реверсирования % WR задержки, происходящей после инъекции MIA, определяли для каждой дозы в каждый момент времени с использованием следующей формулы:

где (% WR)после лекарства представляет собой % WR, определяемый в каждой временной точке после перорального приема для каждой дозы каждого введенного вещества, (% WR)перед лекарством представляет собой % WR, определяемый для перорального приема для каждой дозы каждого введенного вещества, и (% WR)контрольная крыса представляет собой % WR, определяемый для контрольных крыс (получивших инъекцию физиологического раствора в коленный сустав правой задней лапы). За исключением контролей (то есть целекоксиб, носитель), где был использован t-тест Стьюдента, для %WRR был проведен тест Даннета. В любом случае значения с p, составляющим менее 0,05, считали статистически значимыми. Результаты % WRR для введения продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, представлены в таблице 8.

Таблица 8: Облегчение остеоартритной боли после приема продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, установленное тестом разности весовой нагрузки

Как свидетельствуют результаты в таблице 8, оценки действий соединений формулы (I) показали, что данные соединения являются эффективными, например, продукт, приготовленный с соединением А155(а) и фумаровой кислотой, как описано в примере 10, значительно снижает остеоартритную боль, как определено WBD, с максимальными значениями % реверсирования, составляющими от около 8,8% до около 56,9%. Например, % реверсирования остеоартритной боли после введения дозы, равной 20 мг/кг, продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, составлял около 20% или выше, то есть 41,9% через 1 час после введения, 56,9% через 3 часа после введения, 46,9% через 5 часов после введения, 35,6% через 7 часов после введения и даже 19,8% через 24 часов после введения продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10.

Даже при минимальной эффективной дозе, равной 1 мг/кг, продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, %WR составлял около 9% или выше, то есть 15,2% через 1 час после введения, 28,8% через 3 часа после введения, 16,1% через 5 часов после введения и 8,8% через 7 часов после введения продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10. В противоположность этому, доза целекоксиба, равная 3 мг/кг, была менее эффективна, чем дозы, равная 1 мг/кг, продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, в каждой тестируемой временной точке, составляющей менее чем 24 часа, т.е. 10,2% против 15,2%, соответственно, через 1 час после введения, 27,8% против 28,8%, соответственно, через 3 часа после введения, 14,1% против 16,1%, соответственно, через 5 часов после введения, и 6,0% против 8,8%, соответственно, через 7 часов после введения. Делая такое сравнение, следует отметить, что доза введенного целекоксиба, 3 мг/кг, была в 3 раза выше, чем доза продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, 1 мг/кг.

Тест силы захвата (Grip Force Test) в качестве оценки боли, связанной с остеоартритом:

Тест силы захвата дает принятую оценку эффективности клинически применяемых анальгетиков в отношении боли, связанной с остеоартритом (Chandran et al., "Pharmacological modulation of movement-evoked pain in a rat model of osteoarthritis," Eur. J. Pharmacol. 613:39-45 (2009); Chu et al., "TRPV1-related modulation of spinal neuronal activity and behavior in a rat model of osteoarthritic pain," Brain Res. 1369:158-166 (2011)). Силу захвата (grip force (GF)) задних лап оценивали с помощью прибора Animal Grip Strength System (San Diego Instruments, San Diego, CA). Крыс мягко удерживали и позволяли схватить тензометрический датчик проволочной сетки задними лапами. Животных затем передвигали в рострально-каудальном направлении, пока они не отпускали датчик. Усилие (в г), при котором крыса отпускала датчик, было зафиксировано. Каждое животное тестировали дважды с приблизительно 3-10-минутными интервалами в каждой временной точке, и среднее значение двух измерений использовали для GF в анализе данных.

Силу захвата, нормализованную для учета массы каждого животного, выражали как "GF/B", то есть отношение GF к массе тела, где GF представляет собой силу сжатия в граммах и В представляет собой массу тела животного в кг. "% GFR", то есть процент реверсирования задержки (нормированной) силы захвата, произошедшего после инъекции MIA, определяли для каждой дозировки в каждый момент времени по следующей формуле:

где (GF/B)Лекарство представляет собой отношение GF/B, определенное в каждой временной точке после перорального введения для каждой дозы каждого вещества, вводимого животным, которым вводили МИА, (GF/B)Носитель представляет собой отношение GF/B, определенное в каждой временной точке после перорального введения для контроля-носителя, вводимого животным, которым вводили МИА, и (GF/B)Контрольная крыса представляет собой отношение GF/B, определяемое для контрольных крыс (животных, которым делали солевые инъекции, получавших только перорально вводимый носитель). За исключением контролей (то есть целекоксиб, носитель), где был использован t-тест Стьюдента, для % GFR был проведен тест Даннета. В любом случае значения с p, составляющим менее 0,05, считали статистически значимыми. Результаты % GFR для введения продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, представлены в таблице 9.

Таблица 9: Облегчение остеоартритной боли после приема продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, по оценке теста силы сжатия (Grip Force Test)

Как свидетельствуют результаты в таблице 9, одноразовое введение продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, (0,3, 1, 3, 10 или 20 мг/кг) и введение один раз в день продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, (1, 3 или 10 мг/кг) в течение четырех дней показали статистически значимые эффекты против МИА-индуцированной остеоартритной боли у крыс. После однократного введения максимальный обезболивающий эффект продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, при 1 и 3 мг/кг (и 10 и 20 мг/кг) был больше, чем эффект целекоксиба при 3 мг/кг. Таким образом, соединения формулы (I) эффективны в облегчении остеоартритной боли in vivo.

В частности, однократное введение продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, продемонстрировало обезболивающее действие в МИА-индуцированной модели остеоартритной боли. После дозировки, составляющей 20 мг/кг, продукт, полученный с соединением А155(а) и фумаровой кислотой, как описано в примере 10, оказывал значительные обезболивающие эффекты через 1, 3, 5, и 7 часов после введения. Максимальная анальгетическая эффективность, наблюдаемая с продуктом, приготовленным с соединением А155(а) и фумаровой кислотой, как описано в примере 10, составляла 65,1% реверсирования, достигаемая через 3 часа после введения. Аналогичным образом, после дозировки, составляющей 1, 3 и 10 мг/кг, продукт, полученный с соединением А155(а) и фумаровой кислотой, как описано в примере 10, оказывал значительные обезболивающие эффекты через 1, 3, 5, и 7 часов после введения. Дополнительно, даже после дозировки в 0,3 мг/кг, продукт, полученный с соединением А155(а) и фумаровой кислотой, как описано в примере 10, оказывал значительные обезболивающие эффекты через 3 и 5 часов после введения. Максимальная анальгетическая эффективность при 0,3, 1, 3 и 10 мг/кг продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, составляла 21,1%, 45,2%, 53,6% и 55,6% реверсирования, соответственно, каждое значение через 3 часа после введения. Данные результаты показывают, что был достигнут дозозависимый значительный обезболивающий эффект.

Результаты повторного введения в течение 4 дней продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, также продемонстрировали дозозависимый значительный обезболивающий эффект. На 2-ой день введения дозы продукт, полученный с соединением А155(а) и фумаровой кислотой, как описано в примере 10, продемонстрировал дозозависимый значительный обезболивающий эффект через 3 часа после введения. Анальгетическая эффективность после дозировки в 1, 3, и 10 мг/кг продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, составляла 43,1%, 50,5% и 57,5% реверсирования, соответственно. На 3-й день введения дозы 1, 3, и 10 мг/кг продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, продемонстрировали дозозависимые значительные обезболивающие эффекты с 38,0%, 45,0% и 51,6% реверсирования, соответственно. На 4-й день введения дозы 1, 3, и 10 мг/кг продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, продемонстрировали дозозависимые значительные обезболивающие эффекты с 40,1%, 45,6% и 52,2% реверсирования, соответственно.

Кроме того, данные результаты показывают, что имеется, желательно, отсутствие развития толерантности с повторным введением. Например, дозировка в 10 мг/кг продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, оказывала примерно сопоставимую максимальную анальгетическую эффективность через 3 часа после каждого введения, 55,6%, 57,5%, 51,6%, и 52,2% реверсирования, соответственно, после 1-го, 2-го, 3-го и 4-го дня введения.

Пероральное одноразовое дозирование целекоксиба, положительный контроль, также производило обезболивающие эффекты в МИА-индуцированной модели остеоартритной боли. После введения дозы в 3 мг/кг целекоксиб показал значительные обезболивающие эффекты через 1, 3 и 5 часов после введения. Однако максимальная анальгетическая эффективность, наблюдаемая с целекоксибом, составлявшая 30,0% реверсирования через 3 часа после введения в 1-й день дозы в 3 мг/кг, составляла только около 66,4% и 56,0%, соответственно, от 45,2% реверсирования при дозе в 1 мг/кг (то есть треть дозы целекоксиба) и 53,6% реверсирования при дозе в 3 мг/кг, каждое значение достигалось через 3 часа после введения в 1-й день продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10.

Нейропатическая боль: Для оценки действия соединения формулы (I) для лечения или профилактики невропатической боли могут быть использованы модель Зельцер (Seltzer) или модель Чанг (Chung).

В модели Зельцер модель нейропатической боли, индуцированной частичным дотированием седалищного нерва, использовали для получения нейропатической гипералгезии у крыс (Seltzer et al., "A Novel Behavioral Model of Neuropathic Pain Disorders Produced in Rats by Partial Sciatic Nerve Injury," Pain 43:205-218 (1990)). Частичное лигирование левого седалищного нерва проводили под ингаляционной анестезией смесью изофлуран/O2. После индукции анестезии выбривали левое бедро 6-7-недельного самца крысы Jc1: SD. Седалищный нерв открывали на уровне верхней части бедра через небольшой разрез и тщательно очищали от окружающей соединительной ткани на участке вблизи вертела бедренной кости, расположенном дистально по отношению к точке, в которой ветви заднего нерва двуглавой и полусухожильной мышцы отходят от общего седалищного нерва. Шелковую шовную нить 7-0 вводили в нерв с изогнутой, обращенной резки мини-иглой 3/8 и плотно лигировали так, что дорзально от 1/3 до ½ толщины нерва держалось внутри лигатуры. Рану зашивали одним мышечным швом (нейлон 4-0 (Vicryl)) и обрабатывали тканевым клеем vetbond. Область раны затем посыпали порошком антибиотика. Фиктивная обработка включала в себя аналогичную хирургическую процедуру за исключением того, что седалищный нерв не манипулировали или лигировали.

После операции животных взвешивали и помещали на теплую подстилку до тех пор, пока они не оправлялись от анестезии. Животные затем возвращали в клетки до тех пор, пока не начинали поведенческое тестирование. Животное оценивали в отношении ответа на вредные механические раздражители определением PWT для задней лапы животного, как описано ниже, до операции (исходное состояние), затем непосредственно перед и через 1, 3, 5, 7 и 24 часа после перорального введения препарата в носителе (в 1-й день). Таким образом, 24-часовой временной точкой служило начало следующего дня, когда препарат в носителе снова вводили перорально (через 24 часа после момента перед введением). На 2-ой и 3-й дни ответ PWT определяли через 1, 3 и 24 часа, соответственно. Процент реверсирования невропатической гипералгезии в каждый из указанных моментов времени после введения определяли как:

Дополнительно, 10 мг/кг прегабалина (Kemprotec, Ltd., Middlesbrough, UK), противосудорожное средство, принимаемое для облегчения определенной нейропатической боли, в носителе и только носитель (0,5% масса/объем метилцеллюлозы (400 сР, Wako Pure Chemical Industries, Ltd)./водный раствор) вводили перорально в качестве контроля. Количество фумаровой кислоты сравнимое с таковым, присутствующим с соединением А155(А), также присутствовало в каждом контроле. Десять крыс, которым была наложена частичная лигатура левого седалищного нерва, использовали для каждой обрабатываемой группы. Тест Даннета проводили для % реверсирования; значения с p, составляющим менее 0,05, считались статистически значимыми. Результаты введения продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, представлены в таблице 10.

Таблица 10: Облегчение нейропатической боли после приема продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10

Дополнительно, в качестве контроля крысы подвергались фиктивной операции, в которой последовала аналогичная хирургическая процедура в отношении правого бедра, но седалищный нерв не был ни манипулировал, ни лигирован.

Как свидетельствуют результаты в таблице 10, одноразовое введение продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, (1, 3 или 10 мг/кг) в течение трех дней показало статистически значимые эффекты против механической гипералгезии у крыс, подвергнутых частичному лигированию седалищного нерва в модели нейропатической боли Зельцер. После однократного введения или многократного введения в течение 3 дней максимальный анальгетический эффект продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, в дозе 10 мг/кг был больше, чем эффект прегабалина в дозе 10 мг/кг. Таким образом, соединения формулы (I) эффективны в облегчении нейропатической боли in vivo.

В частности, однократное введение продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, продемонстрировало обезболивающее действие в модели Зельцер. После дозировки в 10 мг/кг продукт, полученный с соединением А155(а) и фумаровой кислотой, как описано в примере 10, оказывал значительные обезболивающие эффекты через 1, 3, 5, и 7 часов после введения. Максимальная анальгетическая эффективность, наблюдаемая с продуктом, приготовленным с соединением А155(а) и фумаровой кислотой, как описано в примере 10, составляла 34,17% реверсирования, достигаемого через 3 часа после введения. Аналогичным образом, после дозировки в 1 и 3 мг/кг продукт, полученный с соединением А155(а) и фумаровой кислотой, как описано в примере 10, оказывал значительные обезболивающие эффекты через 3 и 5 часов после введения. Максимальная анальгетическая эффективность при 1 и 3 мг/кг продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, составляла 17,04% и 18,39% реверсирования, соответственно. Данные результаты показывают, что был достигнут дозозависимый значительный анальгетический эффект.

Результаты повторного введения в течение 3 дней продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, также продемонстрировали дозозависимый значительный обезболивающий эффект. На 2-ой день введения дозы продукт, полученный с соединением А155(а) и фумаровой кислотой, как описано в примере 10, продемонстрировал дозозависимый значительный анальгетический эффект через 1 и 3 часа после введения. Максимальная анальгетическая эффективность после введения дозы в 1, 3 и 10 мг/кг продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, составляла 12,84%, 17,14% и 29,12% реверсирования, соответственно, каждый на момент времени три часа. На 3-й день введения дозы 3 и 10 мг/кг продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, продемонстрировали дозозависимые значительные обезболивающие эффекты с максимальными значениями, составляющими 17,34% реверсирования при 3 мг/кг и 28,91% реверсирования при 10 мг/кг, каждый на момент времени три часа.

Кроме того, данные результаты показывают, что имеется, желательно, отсутствие развития толерантности с повторным введением. Например, введение дозы в 3 мг/кг продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10, оказывало примерно сопоставимую максимальную анальгетическую эффективность через 3 часа после каждого введения, 18,39%, 17,14% и 17,34% реверсирования, соответственно, после 1-го, 2-го, 3-го и 4-го дня введения.

Пероральное одноразовое дозирование прегабалина, положительный контроль, также производило обезболивающие эффекты в модели Зельцер. После введения дозы в 10 мг/кг прегабалин показал значительные обезболивающие эффекты через 1, 3, 5, и 7 часов после введения. Однако максимальная анальгетическая эффективность, наблюдаемая с прегабалином, 24.73% реверсирования через 3 часа после 1-го дня введения дозы в 10 мг/кг, составляла только около 72% от 34,17% реверсирования, достигаемого через 3 часа после 1-го дня введения дозы в 10 мг/кг продукта, приготовленного с соединением А155(а) и фумаровой кислотой, как описано в примере 10.

В модели Чанг модель невропатической боли, индуцированной лигированием спинномозгового нерва, использовали для получения механической гипералгезии, термической гипералгезии и тактильной аллодинии у крыс. Операцию проводили под ингаляционной анестезией смесью изофлуран/O2. После индукции анестезии делали разрез размером 3 см и левые параспинальные мышцы отделяли от остистого отростка на уровнях L4-S2. Поперечный отросток L6 осторожно удаляли небольшими костными кусачками для визуального выявления спинномозговых нервов L4-L6. Левый L5 (или L5 и L6) спинной(ые) нерв(ы) изолировали и туго лигировали шелковой нитью. Подтверждали полный гемостаз и зашивали рану с использованием нерассасывающихся нитей, таких как нейлоновые шовные нити или скобы из нержавеющей стали. Фиктивно обработанных крыс подвергали аналогичной хирургической процедуре за исключением того, что не манипулировали спинномозговым(и) нервом(ами). После операции животных взвешивали, вводили подкожно (s.c.) инъекцию физиологического раствора или лактата Рингера, область раны посыпали порошком антибиотика, и их держали на теплой подстилке до тех пор, пока они не оправлялись от анестезии. Затем животные возвращались в клетки до тех пор, пока не начинали поведенческое тестирование. Животные оценивались в отношении ответа на вредные механические раздражители определением PWT для задней лапы животного, как описано ниже, до операции (исходное состояние), затем непосредственно перед и через 1, 3 и 5 часов после введения соединения формулы (I) в левую заднюю лапу животного. Животное также могло быть оценено в отношении ответа на вредные термические раздражители или в отношении тактильной аллодинии, как описано ниже. Модель Чанг для нейропатической боли описана у Kim, "An Experimental Model for Peripheral Neuropathy Produced by Segmental Spinal Nerve Ligation in the Rat," Pain 50(3):355-363 (1992).

Ответ на механические стимулы в качестве оценки механической гипералгезии: Анализ давления на лапу был использован для оценки механической гипералгезии. Для данного теста пороговые значения для отдергивания задней лапы (paw withdrawal thresholds (PWT)) в ответ на вредные механические стимулы определяли с помощью анальгезиметра (модель 37215, коммерчески доступна от Ugo Basile of Italy), как описано у Stein, "Unilateral Inflammation of the Hindpaw in Rats as a Model of Prolonged Noxious Stimulation: Alterations in Behavior and Nociceptive Thresholds," Pharmacol. Biochem. and Behavior 31:451-455 (1988). Максимальная масса, которая может быть приложена к задней лапе, была установлена на уровне 250 г, и за конечную точку принимали полное отдергивание лапы. PWT определяли один раз для каждой крысы в каждый момент времени и тестировали либо только подвергшуюся воздействию (ипсилатеральную) лапу, либо как ипсилатеральную, так и контралатеральную (неповрежденную) лапу.

Ответ на термические раздражители в качестве оценки термической гипералгезии: Подошвенный тест может быть использован для оценки тепловой гипералгезии. Для данного теста определяли задержки отдергивания задних лап в ответ на вредный тепловой раздражитель с помощью тестового подошвенного аппарата (имеется в продаже от Ugo Basile of Italy) согласно методике, описанной у Hargreaves et al., "A New and Sensitive Method for Measuring Thermal Nociception in Cutaneous Hyperalgesia," Pain 32(1):77-8 8 (1988). Максимальное время экспозиции устанавливали на 32 секундах, чтобы избежать повреждения ткани, и любое направленное отдергивание лапы от источника тепла брали в качестве конечной точки. Три величины задержки определяли в каждый момент времени и усредняли. Тестировали либо только подвергшуюся воздействию (ипсилатеральную) лапу, либо как ипсилатеральную, так и контралатеральную (неповрежденную) лапу.

Оценка тактильной аллодинии: Для оценки тактильной аллодинии крыс помещали в прозрачные отсеки из оргстекла с полом из проволочной сетки и давали привыкнуть в течение по меньшей мере 15 минут. После приучения серию волосков фон Фрея (von Frey) прикладывали к подошвенной поверхности левой (прооперированной) стопы каждой крысы. Серия волосков фон Фрея состоит из шести волосков увеличивающегося диаметра, с волоском наименьшего диаметра, применяемым первым. Пять испытаний проводили с каждым волоском, с интервалом в приблизительно 2 минуты между испытаниями. Каждая испытание длилось в течение от 4 до 8 секунд или до пор, пока не наблюдалось ответное ноцицептивное отдергивание. Вздрагивание, отдергивание лапы или лизание лапы считаются ноцицептивными поведенческими реакциями.

Тест индуцированного капсаицином протирания глаза: Для оценки эффекта соединений формулы (I) на боль, опосредованную рецептором TRPV1, использовали тест индуцированного капсаицином протирания глаза (Gavva et al., "AMG 9810 [(E)-3-(4-t-Butylphenyl)-N-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)acrylamide], a Novel Vanilloid Receptor 1 (TRPV1) Antagonist with Antihyperalgesic Properties", J. Pharmacol. Exp. Ther. 313:474-484 (2005)). Тест протирания глаза является надежным высокопропускным тестом эффекта антагонистов TRPV1. Крысам делали одну инъекцию 1, 3, 10 или 30 мг/кг либо соединения формулы (I), 30 мг/кг контроля, выбранного из Celebrex, индометацина, ибупрофена или напроксена, или носителя. Через 1, 3 или 5 часов после приема препарата 3 мкл раствора 100 мкМ капсаицина (в 10% EtOH/PBS) закапывали в один глаз каждого животного с помощью пипетки. Количество движений передних конечностей (трогающих или протирающих обработанный капсаицином глаз) подсчитываются на протяжении 2-минутного периода времени после инстилляции капсаицина в глаз.

5.17 Пример 17: In vivo анализ повышения температуры тела

Гипертермальное или нежелательное повышение температуры тела животного, как известно, является нежелательным побочным эффектом, сопровождающим введение некоторых антагонистов TRPV1 (Gawa, "Body-temperature maintenance as the predominant function of the vanilloid receptor TRPV1," Trends Pharmacol. Sci. 29(11):550-557 (2008)). Соединения формул (I) и/или (II) способны облегчить нежелательный побочный эффект повышенной температуры тела, который может возникнуть при введении in vivo, как показано в данном примере.

Испытуемые животные: Отбор крыс (крысы CRL/SD, 7 недель, самцы) был основан на ректальной температуре тела, измеренной в течение утра в день введения дозы, как описано ниже. Кроме того, чтобы свести к минимуму спонтанные, вызванные стрессом повышения температуры тела, крыс приучали заранее как к процедуре ректального измерения, так и к обработке и введению дозы. Животные содержались и тестировались в специализированных лабораториях по уходу за животными с постоянной температурой в комнатах и влажностью. Крысы могли свободно передвигаться и потреблять пищу и воду. Каждую крысу кодировали цветной линией на хвосте, держали в отдельной клетке с возможностью нормального передвижения. Непосредственно перед каждым измерением температуры тела крысу переносили в измерительную клетку. Чтобы уменьшить стресс, который мог повлиять на температуру тела, каждую крысу накрывали полотенцем во время измерения. Зонд с термистором затем осторожно вводили в прямую кишку каждой крысы и оставляли на месте, пока температура, считываемая на цифровом дисплее, не стабилизировалась, данное значение фиксировалось.

Анализ: За день до дозирования ректальную температуру тела измеряли в 9:00, 10:00, 11:00, 12:30, 13:30, 14:30 и 15:30 часов, чтобы ознакомить крыс с процедурой измерения до введения тестируемых или контрольных препаратов. Крысам также вводили желудочный зонд без носителя в 12:30 часов, чтобы приучить и ознакомить их с процедурой введения дозы.

В день введения дозы только крысы с ректальной температурой тела в диапазоне от 37,0°С до 37,7°С были отобраны для исследования. Ректальные температуры тела измеряли в 9:00, 10:00 и 11:00 часов. Крысы были исключены из исследования, если либо их ректальная температура тела превышала 37,9°С в 10:00 часов или находилась вне диапазона от 37,0°С до 37,7°С в 11:00 часов. Выбранные крысы были разделены на несколько групп в зависимости от их ректальных температур тела, измеренных в 11:00 часов. Ректальные температуры тела выбранных крыс снова измеряли в 12:30 часов, и любая крыса с ректальной температуры тела, равной 38,0°С или выше, также была исключена из исследования.

После отнесения крыс к испытуемой или контрольной группе, им вводили тестируемое соединение или контрольное вещество. Каждое тестируемое соединение растворяли в носителе, представляющем собой 0,5% водный раствор метилцеллюлозы, и конечную концентрацию тестируемого соединения доводили до 1 мг/мл. Каждое тестируемое соединение вводили перорально один раз в дозе 10 мл/кг. Такой же объем контроля (только носитель) вводили один раз в контрольной группе. Ректальные температуры тела измеряли в следующих временных точках: 0,5, 1 и 2 часа после введения.

Повышение температуры тела (ΔTb) для каждого тестируемого соединения рассчитывали вычитанием, в каждый момент времени, значения средней температуры в контрольной группе из значения средней температуры группы, которой вводили данное тестируемое соединение. Наибольшее ΔTb, полученное для каждого тестируемого соединения в любой из моментов времени, приведено в таблице 11 в графической части, вместе с ΔTb контроля.

Как свидетельствуют приведенные выше данные, соединения формул (I) и/или (II) способны к предотвращению нежелательного побочного эффекта увеличения температуры тела, который может возникнуть при in vivo введении соединения, которое модулирует рецептор TRPV1. Например, увеличение температуры тела после введения соединений формул (I) и/или (II) составляло менее 0,7°С в одном варианте осуществления, 0,6°С или менее в другом варианте осуществления, менее 0,6°С в другом варианте осуществления, 0,5°С или менее в другом варианте осуществления, менее 0,5°С в другом варианте осуществления, 0,4°С или менее в другом варианте осуществления, менее 0,4°С в другом варианте осуществления, 0,3°С или менее в другом варианте осуществления, менее 0,3°С в другом варианте осуществления или 0,2°С или менее в другом варианте осуществления.

В частности, было установлено, что увеличение температуры тела после введения соединений формул (I) и/или (II) составляло менее 0,5°С, в некоторых случаях намного меньше, чем 0,5°С, например, 0,1°С для соединений A125(b), A155(d), A155(e) и B158(j), 0,2°С для соединений А126(а), А155(а) и С170(r), и 0,3°С для соединений С4(r) и С125(r). Кроме того, соединения формул (I) и/или (II), например, соединение А155(а), показали значительное разделение между дозами, эффективными в болевых моделях, и дозами, при которых повышение температуры тела наблюдалось как у крыс, так и у обезьян. Дозы, которые повышали температуру тела, превышали более чем в 100 раз значения ED80 в FCA-модели некоторых случаев воспалительной боли.

В противоположность этому, было установлено, что повышение температуры тела после введения других соединений составляет более 0,5°С, в некоторых случаях намного больше, чем 0,5°С, например, 0,8°С для соединений DI, DN и АА; 0,9°С для соединений DA, DH, DJ, DL, DM и ВА; 1.0°С для соединений DC, DD и DG; 1,1°C для соединений DB и DO; 1.2°C для соединения DP; и 1.3°C для соединения DE; в некоторых случаях данные соединения индуцировали гипертермию в дозах, которые были меньше, чем те, которые необходимы для проявления эффективности в болевых моделях, показывая отсутствие разделения между эффективностью и побочным эффектом гипертермии.

Настоящее изобретение не должно быть ограничено в объеме определенными вариантами осуществления, раскрытыми в примерах, которые предназначены в качестве иллюстраций нескольких задач изобретения, и любые варианты осуществления, которые функционально эквивалентны, находятся в пределах объема настоящего изобретения. Действительно, различные модификации изобретения в дополнение к показанным и описанным в настоящем раскрытии, станут очевидными специалистам в данной области техники и предназначены для того, чтобы подпадать под объем прилагаемой формулы изобретения. Был назван ряд ссылок, полные раскрытия которых включены в настоящее описание посредством ссылки для всех целей.

1. Соединение формулы (I):

или его фармацевтически приемлемое производное, в котором:

R1 представляет собой -гало или -CF3;

R4 представляет собой -Н или -CH3;

каждый из R8 и R9 независимо представляет собой -Н, -гало, -СН3 или -ОСН3

каждый гало независимо представляет собой -F, -Cl, -Br или -I; и

m означает целое число 0 или 1;

(1) при условии, что если R4 представляет собой -Н, то m означает 1; и

(2) при условии, что если R4 представляет собой -Н и атом углерода в положении а связи а-b находится в (S)-конфигурации, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу;

(3) при условии, что если R4 представляет собой -Н, атом углерода в положении а связи а-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой -гало, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу;

(4) при условии, что если R4 представляет собой -Н, атом углерода в положении а связи а-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу; и

(5) при условии, что если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи а-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н, R9 представляет собой -гало, и m означает 1, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу;

причем фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль.

2. Соединение по п. 1 или его фармацевтически приемлемое производное, в котором R1 представляет собой -F, -Cl или -CF3.

3. Соединение по п. 2 или его фармацевтически приемлемое производное, в котором R1 представляет собой -F.

4. Соединение по п. 1 или его фармацевтически приемлемое производное, в котором R9 представляет собой -Н, -F, -Cl, -Br, -СН3, или -ОСН3.

5. Соединение по п. 4 или его фармацевтически приемлемое производное, в котором R9 представляет собой -Н.

6. Соединение по п. 1 или его фармацевтически приемлемое производное, в котором R8 представляет собой -Н, -F или -СН3.

7. Соединение по п. 6 или его фармацевтически приемлемое производное, в котором R8 представляет собой -F или -СН3.

8. Соединение по п. 1 или его фармацевтически приемлемое производное, в котором

(i) R4 представляет собой -СН3, и каждый из атомов углерода в положениях а и с связи а-b и связи c-d находится в (S)-конфигурации; или

(ii) R4 представляет собой -СН3, и каждый из атомов углерода в положениях а и с связи а-b и связи c-d находится в (R)-конфигурации; или

(iii) R4 представляет собой -Н и атом углерода в положении а связи а-b находится в (S)-конфигурации; или

(iv) R4 представляет собой -Н и атом углерода в положении а связи а-b находится в (R)-конфигурации.

9. Соединение по п. 1 или его фармацевтически приемлемое производное, в котором m означает 1 и метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу.

10. Соединение по п. 1, где фармацевтически приемлемое производное представляет собой гидрохлоридную соль, натриевую соль, калиевую соль, соль п-толуолсульфоновой кислоты или соль фумаровой кислоты.

11. Соединение по п. 10, в котором фармацевтически приемлемое производное представляет собой соль фумаровой кислоты.

12. Соединение по п. 8 по подпунктам (i) или (ii) или его фармацевтически приемлемое производное, в котором m означает 0.

13. Соединение по п. 12 или его фармацевтически приемлемое производное, которое представляет собой

или

14. Соединение по п. 12, представляющее собой

(i) соль фумаровой кислоты; или

(ii) свободное основание.

15. Соединение формулы (II):

или его фармацевтически приемлемое производное, в котором:

R4 представляет собой -Н или -СН3;

R8 представляет собой -Н или -F;

R9 представляет собой -Н, -гало или -СН3; и

каждый гало независимо представляет собой -F, -Cl, -Br или -I;

(1) при условии, что если R4 представляет собой -Н и атом углерода в положении а связи а-b находится в (S)-конфигурации, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу, (S)-3-метильную группу или (R)-3-метильную группу;

(2) при условии, что если R4 представляет собой -Н, атом углерода в положении а связи а-b находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой -гало, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (R)-3-метильную группу;

(3) при условии, что если R4 представляет собой -Н, атом углерода в положении а связи а-b находится в (S)-конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-2-метильную группу или (S)-3-метильную группу, и

(4) при условии, что если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи а-b и связи c-d находится в (S)-конфигурации, R8 представляет собой -Н и R9 представляет собой -гало, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой (S)-3-метильную группу или (R)-3-метильную группу;

причем фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль.

16. Соединение по п. 15 или его фармацевтически приемлемое производное, в котором

(i) R4 представляет собой -СН3 и каждый из атомов углерода в положениях а и с связи а-b и связи c-d находится в (S)-конфигурации; или

(ii) R4 представляет собой -СН3 и каждый из атомов углерода в положениях а и с связи а-b и связи c-d находится в (R)-конфигурации.

17. Соединение по п. 15 или его фармацевтически приемлемое производное, в котором R4 представляет собой -Н и атом углерода в положении а связи а-b находится в (S)-конфигурации.

18. Соединение по п. 15 или его фармацевтически приемлемое производное, в котором R4 представляет собой -Н и атом углерода в положении а связи а-b находится в (R)-конфигурации.

19. Соединение по п. 15 или его фармацевтически приемлемое производное, в котором метильная группа, соединенная с пиперазиновым кольцом, представляет собой

(i) (S)-3-метильную группу,

(ii) (S)-2-метильную группу или

(iii) (R)-3-метильную группу.

20. Соединение по п. 15 или его фармацевтически приемлемое производное, в котором R9 представляет собой -Н и/или R8 представляет собой -F.

21. Соединение по п. 15, где фармацевтически приемлемое производное представляет собой

(i) гидрохлоридную соль, натриевую соль, калиевую соль, соль п-толуолсульфоновой ксилоты или соль фумаровой кислоты; или

(ii) соль фумаровой кислоты.

22. Соединение по п. 15 или его фармацевтически приемлемое производное, которое представляет собой

или

23. Соединение по п. 22, которое представляет собой

(i) соль фумаровой кислоты; или

(ii) свободное основание.

24. Соединение, которое представляет собой

или его фармацевтически приемлемое производное; причем фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль и/или сокристалл фумаровой кислоты.

25. Соединение по п. 24, в котором фармацевтически приемлемое производное представляет собой

(i) соль фумаровой кислоты, сокристалл фумаровой кислоты или их комбинацию.

26. Соединение по п. 24, где фармацевтически приемлемое производное представляет собой гидрохлоридную соль, натриевую соль, калиевую соль, соль п-толуолсульфоновой кислоты, соль фумаровой кислоты или сокристалл фумаровой кислоты.

27. Соединение по п. 24, где фармацевтически приемлемое производное представляет собой сокристалл фумаровой кислоты.

28. Продукт, содержащий соединение, которое представляет собой

и фумаровую кислоту, причем продукт характеризуется рентгеновской порошковой дифрактограммой, содержащей пики 6.5°±0.2°, 12.5°±0.2°, 16.8°±0.2° и 25.3°±0.2° 2θ при измерении с использованием излучения CuKα.

29. Продукт, содержащий соединение, которое представляет собой

и фумаровую кислоту, причем продукт характеризуется рентгеновской порошковой дифрактограммой, содержащей пики 6.5°±0.2°, 8.6°±0.2°, 12.5°±0.2°, 14.0°±0.2°, 16.8°±0.2°, 18.7°±0.2° и 25.3°±0.2° 2θ при измерении с использованием излучения CuKα.

30. Продукт, содержащий соединение, которое представляет собой

и фумаровую кислоту, причем продукт характеризуется рентгеновской порошковой дифрактограммой, содержащей пики 6.5°, 8.6°, 12.5°, 14.0°, 16.8°, 18.7°, 20.4°, 21.3°, 22.0°, 23.2° и 25.3° 2θ±0.2° 2θ при измерении с использованием излучения CuKα.

31. Соединение, которое представляет собой

или его фармацевтически приемлемое производное; причем фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль.

32. Фармацевтическая композиция, ингибирующая TRPV1 функцию в клетке, содержащая эффективное количество (i) соединения по любому из пп. 1, 15 и 31 или его фармацевтически приемлемого производного и фармацевтически приемлемый носитель или наполнитель; причем фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль; или (ii) соединения по п. 24 или его фармацевтически приемлемого производного и фармацевтически приемлемый носитель или наполнитель, причем фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль и/или сокристалл фумаровой кислоты.

33. Способ лечения боли, боли, связанной с остеоартритом, остеоартрита, недержания мочи (UI), язвы, воспалительного заболевания кишечника (IBD) или синдрома раздраженного кишечника (IBS) у животного, включающий введение животному, нуждающемуся в этом, эффективного количества (i) соединения по любому из пп. 1, 15 и 31 или его фармацевтически приемлемого производного; причем фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль; или (ii) соединения по п. 24 или его фармацевтически приемлемого производного, причем фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль и/или сокристалл фумаровой кислоты.

34. Способ ингибирования функции TRPV1 в клетке, включающий приведение в контакт клетки, способной экспрессировать TRPV1, с эффективным количеством (i) соединения по любому из пп. 1, 15 и 31 или его фармацевтически приемлемого производного, причем фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль; или (ii) соединения по п. 24 или его фармацевтически приемлемого производного, причем фармацевтически приемлемое производное представляет собой фармацевтически приемлемую соль и/или сокристалл фумаровой кислоты.

35. Продукт объединения соединения по любому из пп. 1, 15 или 24, с фумаровой кислотой, в котором молярное соотношение (соединение) : (фумаровая кислота) в продукте составляет около 1:0,5.

36. Фармацевтическая композиция, ингибирующая TRPV1 функцию в клетке, содержащая эффективное количество продукта по п. 30 или 35 и фармацевтически приемлемый носитель или наполнитель.

37. Способ лечения боли, боли, связанной с остеоартритом, остеоартрита, недержания мочи (UI), язвы, воспалительного заболевания кишечника (IBD) или синдрома раздраженного кишечника (IBS) у животного, включающий введение животному, нуждающемуся в этом, эффективного количества продукта по п. 30 или 35.

38. Способ ингибирования функции TRPV1 в клетке, включающий приведение в контакт клетки, способной экспрессировать TRPV1, с эффективным количеством продукта по п. 30 или 35.



 

Похожие патенты:

Изобретение относится к соединениям общей формулы (I) где: R1 и R2, которые могут быть одинаковыми или разными, независимо выбраны из группы, состоящей из: - (С1-С6)алкила, возможно замещенного (С3-С7)циклоалкилом; - (С1-С6)галогеналкила; - (С3-С7)циклоалкила и - (С3-С7)гетероциклоалкила, содержащего гетероатом О; R3 представляет собой водород, (С1-С6)алкил или (С1-С3)алкилтио(С1-С6)алкил; А представляет собой частично ненасыщенную или ненасыщенную бициклическую кольцевую систему, состоящую из двух конденсированных моноциклических кольцевых систем В и С, изображенную в п.1 формулы, где кольцо С представляет собой моноциклическую арильную или моноциклическую гетероарильную кольцевую систему, кольцо В представляет собой 5- или 6-членную гетероциклоалкильную группу, ноль Y групп присоединено к кольцу С, n групп Y присоединено к кольцу В, и n представляет собой целое число от 1 до 3; и где кольцо В и С возможно содержит дополнительные гетероатомы в количестве от 1 до 4, выбранные из N, О или S; p представляет собой целое число от 0 до 3; Y представляет собой группу оксо; K выбран из группы, состоящей из: - (С1-С6)алкила, возможно замещенного одной (С3-С7)циклоалкильной группой; - (С3-С6)гетероциклоалкил(С1-С4)алкила, содержащего 1 или 2 гетероатома, выбранных из N или О; - (С3-С6)гетероциклоалкила, содержащего 1 или 2 гетероатома, выбранных из N или О, возможно замещенного одной или более чем одной (C1-С6)алкильной группой; - (С1-С4)галогеналкила; - OR4, где R4 выбран из группы, состоящей из: - Н; - (С1-С6)алкила, возможно замещенного (С3-С7)циклоалкилом или гетероарилом; - атомов галогена; - CN; - NO2; - NR5R6, где R5 и R6, которые могут быть одинаковыми или разными, независимо выбраны из группы, состоящей из: - Н; - ОН; - (C1-C4)алкил-NR7R8, где R7 и R8, которые могут быть одинаковыми или разными, независимо выбраны из группы, состоящей из: Н; (С1-С6)алкила, возможно замещенного (С1-С6)алкоксилом; и (C1-C6)алкил-NR9R10, где R9 и R10, которые могут быть одинаковыми или разными, представляют собой Н или (C1-С6)алкил; или они образуют вместе с атомом азота, к которому они присоединены, (С3-С6)гетероциклоалкильное кольцо, содержащее 1 или 2 гетероатома, выбранные из N, О или S, возможно замещенное (С1-С6)алкилом или (С1-С6)алкилкарбонильной группой; - (С1-С6)алкила, возможно замещенного (С1-С6)алкоксилом или гетероарилом, (С3-С6)гетероциклоалкилкарбонилом, содержащим 1 или 2 гетероатома, выбранные из N или О, гетероарилкарбонилом, причем все из них возможно дополнительно замещены одной или более чем одной (C1-С6)алкильной, (С1-С6)галогеналкильной или (С1-С6)алкоксильной группами, которые являются одинаковыми или разными и выбраны независимо; - SO2R11, где R11 представляет собой (С1-С6)алкил; - C(O)R12, где R12 представляет собой (С1-С6)алкил, возможно замещенный (С1-С6)алкоксилом; - (C1-C4)алкил-NR13R14, где R13 и R14, которые могут быть одинаковыми или разными, независимо выбраны из группы, состоящей из групп: - SO2(C1-С6)алкил, Н, (С1-С6)алкил и (С3-С7)гетероциклоалкил(С1-С4)алкил, содержащий 1 или 2 гетероатома, выбранных из N или О; и - SO2NR15R16, где R15 и R16, которые могут быть одинаковыми или разными, независимо представляют собой Н или (С1-С6)алкил; где группы с R4 по R16 имеют одинаковые или разные значения в каждом случае, если они присутствуют в более чем одной группе; и где гетероарил представляет собой моно- или бициклические кольцевые системы с 5-10 кольцевыми атомами, содержащими 1 или 2 гетероатома, выбранные из N, О или S; или его пиридин-N-оксиды, фармацевтически приемлемые соли или сольваты.

Изобретение относится к соединениям формулы I или их фармацевтически приемлемым солям, обладающих антибактериальным действием в которой R1a представляет собой Н или карбокси и R1b представляет собой Н, или R1a и R1b представляют собой совместно или группу *-C(O)-NH-S-# или группу *-C(OH)=N-S-# в которой “*” представляет собой точку присоединения R1a и “#” представляет собой точку присоединения R1b; R2 представляет собой Н, (С1-С3)алкил, гидрокси-(С1-С3)алкил, бензил или (С3-С5)циклоалкил; R3 представляет собой Н или галоген; U представляет собой N или CR4; причем R4 означает Н или (С1-С3)алкокси; А представляет собой СН, В представляет собой NH и m представляет собой 1 или 2 и n представляет собой 1 или 2; или А представляет собой N, В отсутствует, m представляет собой 2 и n представляет собой 2; Y представляет собой СН или N; и Q представляет собой О или S.

Настоящее изобретение касается новых соединений общих формул II, III, IV и V, где значения радикалов указаны в описании, или их фармацевтически приемлемой соли, которые могут использоваться в качестве ингибиторов PDK1.

Изобретение относится к соединению N-(6-((1-((2-этилпиримидин-5-ил)метил)пиперидин-4-ил)метил)пиридин-2-ил)-5-метилтиазол-2-амина или его фармацевтически приемлемой соли, сольвату или гидрату.

Изобретение относится к соединению формулы I или его фармацевтически приемлемой соли, где R1 - это водород или (С1-С10)алкильная группа; R2 - это Н, галоген, СООН, (С1-С6)алкил, необязательно замещенный группой -NR10R11, ОН или (С1-С4)алкокси, необязательно замещенным ОН; (С1-С6)алкокси, необязательно замещенный ОН, (С1-С4)алкокси или группой -NR12R13; группа -OR14, где R14 означает 5- или 6-членный гетероциклоалкил, содержащий 1 или 2 атома азота; группа -CONR15R16, где R15 и R16 каждый независимо друг от друга означает Н или (С1-С4)алкил, необязательно замещенный (С1-С4)алкокси или 5- или 6-членным гетероциклоалкилом, содержащим 1 или 2 гетероатома, выбираемых из О и N; группа -NR17R18, где R17 означает Н или (С1-С4)алкил и R18 означает Н, (C1-С4)алкил, необязательно замещенный (С1-С4)алкокси, или 5- или 6-членный гетероарил, содержащий 1-3 гетероатома, выбираемых из О, S и N; группа -NR19COR20, где R19 означает Н и R20 означает (С1-С4)алкил, необязательно замещенный амино, (С1-С4)алкиламино или ди(С1-С4)алкиламино или 5- или 6-членным гетероциклоалкилом, содержащим 1 или 2 атома азота, указанный гетероциклоалкил является необязательно замещенным 1-3 (С1-С4)алкилами; или 5- или 6-членный гетероциклоалкил или гетероарил, содержащий 1 или 2 атома азота, указанный гетероциклоалкил или гетероарил является необязательно замещенным оксогруппой; R3 - это водород, галоген, циано, (С1-С10)алкильная группа или (С1-С10)алкокси группа, CF3; Q представляет собой О или S; W представляет собой N или CR21; X представляет собой N или CR25, где R25 - это Н; CN; (С1-С4)алкил; или группу -СОО(С1-С4)алкил; и А означает 5- или 6-членный гетероциклоалкил или гетероарил, содержащий 1-3 атома азота, указанный гетероциклоалкил или гетероарил является необязательно замещенным 1-3 заместителями, выбираемыми из оксогруппы; галогена; (С1-С4)алкила, необязательно замещенного амино, (С1-С4)алкиламино, ди(С1-С4)алкиламино или 5- или 6-членным гетероциклоалкилом, содержащим 1 или 2 атома азота.

Изобретение относится к химической промышленности, а именно к способу получения N1,N3-бис(5-амино-3-алкил-1,3,4-тиадиазол-2-илиден)-2Н-изоиндол-1,3-диаминов, где в качестве алкильных заместителей выступают пентильный, децильный и додецильный радикалы.

Изобретение относится к соединению формулы IA или его фармацевтически приемлемой соли, где R4 представляет собой -CO2R4a, -C(O)NH2 или -СН2ОН; где R4a выбран из группы, состоящей из Н и СН3; R5 представляет собой Н или фтор; R6 выбран из группы, состоящей из: (i) С1-С4 алкила; (ii) С1-С3 фторалкила; (iii) -О-(C1-С6 алкила); (iv) -R6a, где R6a выбран из группы, состоящей из: (a) С3-С6 циклоалкила, (b) группы формулы (1b), где R6a1 представляет собой Н или -CH2CH2NH2; и (c) 5-членного гетероарила, содержащего 1-3 гетероатома, выбранных из группы, состоящей из N, О и S; где R6a является незамещенным или замещен 1-3 фрагментами R6a2, выбранными из группы, состоящей из галогена и С1-С3 алкила; (v) -O-R6b; где R6b выбран из группы, состоящей из: (a) С3-С6 циклоалкила; и (b) группы формулы (2b), где p равно 1 или 2 и q равно 1 или 2; где R6b является незамещенным; и R7 представляет собой Н или галоген.

Изобретение относится к соединению формулы (I) его фармацевтически приемлемой соли или сложному эфиру. Соединения формулы (I) модулируют активность каннабиноидного рецептора 2 (СВ2). В формуле (I) R1 представляет собой галогенофенил или С3-С6-циклоалкил-С1-С6-алкокси; R2 представляет собой С3-С6-циклоалкил, азетидинил или дифторазетидинил; один из R3 и R4 представляет собой водород, а другой представляет собой -(CR5R6)-R7 или -A-R7; или R2 представляет собой С3-С6-циклоалкил, a R3 и R4 вместе с атомом азота, к которому они присоединены, образуют пиперидиниламин; R5 и R6 независимо выбраны из водорода, С1-С6-алкила, галоген-С1-С6-алкила, С3-С6-циклоалкила, С3-С6-циклоалкил-С1-С6-алкила, фенила, фенил-С1-С6-алкила и галогенофенила; или R5 и R6 вместе с атомом углерода, к которому они присоединены, образуют С3-С6-циклоалкил или оксетанил; R7 представляет собой циано, карбокси, 5-метил-[1,2,4]оксадиазол-3-ил, 5-амино-[1,2,4]оксадиазол-3-ил, тиазолил, С1-С6-алкилтиазолил, пиридинил, С1-С6-алкиламинокарбонил, гидрокси-С1-С6-алкил, С1-С6-алкокси-С1-С6-алкил, аминокарбонил, С1-С6-алкоксикарбонил, ди-С1-С6-алкиламинокарбонил, фенил-С1-С6-алкил, пиридинил-С1-С6-алкил, галоген-С1-С6-алкиламинокарбонил, 5-фенил-2-метил-оксазол-4-ил-алкил, аминокарбонил-С1-С6-алкил или галоген; и А представляет собой циклогексил или тиофенил, при условии, указанном в формуле изобретения.

Данное изобретение относится к применению производных дигидропиразолонов формулы (I), в которой радикалы и символы определены в п.1 формулы изобретения, для изготовления лекарственного средства для лечения и/или профилактики заболеваний сердечного кровообращения, сердечной недостаточности, анемий, хронических заболеваний почек и почечной недостаточности, а также к лекарственному средству, содержащему указанное производное дигидропиразолона, и к способу лечения и/или профилактики указанных выше заболеваний у человека и животных.

Изобретение относится к соединению формулы (I), где каждый из n и m независимо равен 1; R1 представляет собой галоген или группу, выбранную из прямого или разветвленного (C1-C8)алкила и гетероциклила, выбранного из пиперидинила и тетрагидропиранила, где пиперидинил необязательно замещен (C1-C6)алкилом и (С3-С6)циклоалкилом; или R1 представляет собой NR7R8, где каждый из R7 и R8 независимо представляет собой водород или группу, выбранную из прямого или разветвленного (C1-C8)алкила, гетероциклила, выбранного из пиперидинила и необязательно замещенного метилом; или, взятые вместе с атомом азота, с которым они связаны, R7 и R8 могут образовывать необязательно замещенный 3-8-членный гетероциклил, необязательно содержащий один дополнительный гетероатом или гетероатомную группу, выбранные из О, N и NH, необязательно замещенный галогеном; каждый из R2 и R3 независимо представляет собой водород, галоген или необязательно замещенную группу, выбранную из прямого или разветвленного (C1-C8)алкила и гетероциклила, выбранного из имидазолидина, замещенного -СОСН3, -С=O, -СН2-ОСН3, -СН3; или каждый из R2 и R3 независимо представляет собой NR17R18, где R17 и R18 независимо представляют собой водород или необязательно замещенную группу, выбранную из прямого или разветвленного (С1-С8)алкила, необязательно замещенного -NH-СОСН3, -NHCOOCH3, -N(CH3)2; или R17 представляет собой водород и R18 представляет собой COR22, где R22 представляет собой OR23 или необязательно замещенную группу, выбранную из прямого или разветвленного (C1-C8)алкила, где R23 представляет прямой или разветвленный (С1-С8)алкил, каждый из R4 и R5 независимо представляет собой водород или галоген; Rx представляет собой водород; R6 представляет собой фенил, необязательно замещенный галогеном; или его фармацевтически приемлемой соли.

Группа изобретений относится к медицинской технике, а именно к средствам для физиотерапии в комплекте с физиотерапевтическими жидкостями. Электромагнитный терапевтический прибор имеет каркас и лечебное ложе.

Изобретение относится к фармацевтической композиции для перорального введения, содержащей ядро, включающее гидрокортизон и носитель, и слой полимера отсроченного высвобождения, находящийся в контакте с указанным ядром.
Изобретение относится к медицине, а именно к стоматологии, и может быть использовано при лечении заболеваний пародонта больных сахарным диабетом II типа. Для этого данным пациентам вводят противовоспалительный препарат.

Изобретение относится к новому соединению формулы I или его фармацевтически приемлемой соли, которые обладают свойствами ингибитора тирозинкиназы Брутона. Соединения могут быть использованы в качестве терапевтически активного вещества для лечения воспалительного и/или аутоиммунного состояния, выбранного из ревматоидного артрита и астмы.
Изобретение относится к медицине и может быть использовано для профилактики постторакотомического болевого синдрома (далее - ПТБС) в онкохирургии. Для этого за сутки до операции назначают перорально антиконвульсант прегабалин по 75 мг 2 раза/сутки и 75 мг за 2 часа до операции.

Настоящее изобретение относится к соединению общей формулы I, приведенной ниже, или к его фармацевтически приемлемой соли. В соединении формулы I X представляет собой галоген; Y представляет собой Н или низший алкил; R представляет собой -R1-R2-R3; R1 представляет собой пиридил; R2 представляет собой -С(=O) или отсутствует; R3 представляет собой морфолинил или пирролидинил, возможно замещенный низшим алкилом.

Изобретение относится к медицине. Описана трансдермальная система, включающая адгезивный слой, составленный из трансдермального препарата на подложке, причем трансдермальный препарат включает a) от 10 до 40 мас.% неводного материала основы на основании общей массы трансдермального препарата, b) от 1 до 10 мас.% нестероидного противовоспалительного лекарственного средства на основании общей массы трансдермального препарата и c) полиэтиленгликолевый компонент, составленный из от 0,3 до 5 мас.% полиэтиленгликоля с низкой молекулярной массой на основании общей массы трансдермального препарата, и от 1 до 10 мас.% полиэтиленгликоля с высокой молекулярной массой на основании общей массы трансдермального препарата.

Предложен способ лечения или регулирования заболевания или нарушения, такого как рак, включающий введение пациенту 5-замещенного хиназолинонового соединения формулы (I) или его фармацевтически приемлемой соли, сольвата или стереоизомера.

Изобретение относится к соединениям фармацевтического назначения, а именно к новому сокристаллу дифлунисала с изониазидом, пригодным для производства фармацевтических препаратов.

Изобретение относится к соединению, выбранному из формулы I, или его стереоизомерам, или фармацевтически приемлемым солям, где R1 представляет собой необязательно замещенный C1-С3 алкил; R2, R3 и R4 независимо выбраны из Н, F, Cl; R5 выбран из (i) необязательно замещенного C6-С20 арила, выбранного из фенила; (ii) необязательно замещенного С5-С20 гетероарила, выбранного из пиразолила, пиридинила, пиримидинила, тетрагидроизохинолинила, 4,5,6,7-тетрагидропиразоло[1,5-а]пиразинила, 6,7-дигидро-4Н-пиразоло[5,1-с][1,4]оксазинила, 4,6,7-тригидропиразоло[3,2-с][1,4]оксазинила, 5,6,7,8-тетрагидро-1,6-нафтиридинила, 2,3-дигидро-1Н-изоиндолила, 4,5,6,7-тетрагидротиазоло[5,4-с]пиридинила; (iii) необязательно замещенного -(C6-С20 арил)-(C3-С20 гетероциклила), где гетероциклил выбран из азетидинила, пиперидинила, морфолино, пиперазинила; (iv) необязательно замещенного -(С5-С20 гетероарил)-(C3-С20 гетероциклила), где гетероарил выбран из пиридинила и пиридазинила и гетероциклил выбран из азетидинила, пирролидинила, пиперидинила, пиперазинила, 1,4-диазепанила, 2,6-диазаспиро[3.3]гептанила, 7,9-диазабицикло[3.3.1]нонанила, гексагидропирроло[3,4-с]пирролила, морфолино; (v) необязательно замещенного -(C5-С20 гетероарил)-(C1-С6 алкила), где гетероарил выбран из пиразолила и пиридинила; или (vi) необязательно замещенного -(C5-С20 гетероарил)-С(=O)-(C3-С20 гетероциклила), выбранного из (пиридинил)-С(=O)-(морфолино); R6 представляет собой Н или C1-С3 алкил; Y1 и Y2 независимо выбраны из CR6 и N; где C1-С3 алкил, C3-С20 гетероциклил, C6-С20 арил и C5-С20 гетероарил необязательно замещены от одной до трех групп, независимо выбранных из D, F, Cl, Br, I, -СН3, -СН2СН3, -СН2СН(СН3)2, -СН2ОН, -СН2СН2ОН, -С(СН3)2ОН, -CH2F, -ОС(O)СН3, -СОСН3, -NHCH3, -N(CH3)2, =O, -ОН, -ОСН3, -OCH2CH2N(CH3)2, -ОР(O)(ОН)2, -СН2ОСН3, циклопропила, азетидинила, 1-(метилазетидин-3-ил)окси, N-метил-N-оксетан-3-иламино, азетидин-1-илметила, оксетанила и морфолино; где группа (а), образованная Z1, Z2, Z3, Z4, Z5, X и NC(O), образует структуры, приведенные в формуле изобретения, и при этом волнистая линия указывает на место присоединения.

Изобретение относится к области органической химии, а именно к хинолинкарбоксамидным производным указанных ниже структур. Также изобретение относится к фармацевтической композиции на основе одного из указанных соединений, применению указанных соединений для лечения заболевания или нарушения, опосредованного mGluR2, таких как болезнь Альцгеймера, когнитивное нарушение, шизофрения, расстройства настроения, болевые расстройства и расстройства сна.

Изобретение относится к соединению формулы или его фармацевтически приемлемой соли, в котором R1 представляет собой -гало или -CF3; R4 представляет собой -Н или -CH3; каждый из R8 и R9 независимо представляет собой -Н, -гало, -СН3 или -ОСН3, каждый гало независимо представляет собой -F, -Cl, -Br или -I; и m означает целое число 0 или 1; при условии, что если R4 представляет собой -Н, то m означает 1; и при условии, что если R4 представляет собой -Н и атом углерода в положении а связи а-b находится в -конфигурации, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой -2-метильную группу, -3-метильную группу или -3-метильную группу; при условии, что если R4 представляет собой -Н, атом углерода в положении а связи а-b находится в -конфигурации, R8 представляет собой -Н и R9 представляет собой -гало, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой -3-метильную группу; при условии, что если R4 представляет собой -Н, атом углерода в положении а связи а-b находится в -конфигурации, R8 представляет собой -F и R9 представляет собой -F, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой -2-метильную группу или -3-метильную группу; и при условии, что если R4 представляет собой -СН3, каждый из атомов углерода в положениях а и с связи а-b и связи c-d находится в -конфигурации, R8 представляет собой -Н, R9 представляет собой -гало, и m означает 1, то метильная группа, соединенная с пиперазиновым кольцом, представляет собой -3-метильную группу или -3-метильную группу. Изобретение также относится к соединению формулы или его фармацевтически приемлемой соли, конкретному соединению формулы или его фармацевтически приемлемой соли иили сокристаллу фумаровой кислоты. Также изобретение относится к конкретным соединениям формулы или его фармацевтически приемлемой соли. Соединения по изобретению предназначены для ингибирования TRPV1 функции в клетке и для лечения боли, боли, связанной с остеоартритом, остеоартрита, недержания мочи, язвы, воспалительного заболевания кишечника или синдрома раздраженного кишечника у животного. Технический результат – соединения, обладающие сродством к рецептору TRPV1. 14 н. и 24 з.п. ф-лы, 11 табл., 3 ил., 16 пр. ,,,

Наверх