Набор олигонуклеотидных зондов, днк-микрочип, способ его получения, комплект для молекулярно-генетического исследования человека и их применение


 


Владельцы патента RU 2551985:

Общество с ограниченной ответственностью "Центр Генетики и Регенеративной Медицины Института Стволовых Клеток Человека" (RU)

Изобретение относится к области биохимии, в частности к набору олигонуклеотидных зондов для диагностики популяции людей, проживающих на территории РФ, на наследственные моногенные заболевания, путем выявления мутаций и/или полиморфизмов. Также заявлены способ получения ДНК-микрочипа, набор для исследования популяции людей, а также способ детекции ассоциированных с наследственными моногенными заболеваниями мутаций и/или полиморфизмов, в которых используется указанный набор олигонуклеотидных зондов. Изобретение позволяет повысить информативность, точность и сократить сроки исследования. 4 н.п. ф-лы, 3 табл., 3 пр.

 

Область техники

Изобретение относится к биотехнологии, а именно к молекулярно-генетическим исследованиям человека для диагностики наследственных заболеваний, предрасположенности к мультифакторным заболеваниям, имеющим генетическую составляющую, и персональной генетически-детерминированной реакции на фармацевтические препараты.

Приблизительно половина всех случаев наследования болезней происходит, когда мать и отец не страдают наследственными заболеваниями, однако являются скрытыми носителями поврежденных генов. Если ребенок наследует от каждого родителя такой поврежденный ген, это приведет к развитию болезни. Риск рождения больного ребенка у родителей-носителей составляет 25%, что с медико-генетической точки зрения характеризуется как высокий. Руководствуясь информацией о собственных генетических особенностях, полученной с помощью молекулярно-генетических исследований, а также используя современные возможности репродуктивной медицины, будущие родители смогут избежать рисков зачатия ребенка, больного тяжелым или смертельным наследственным заболеванием, и родить здорового ребенка.

Описание уровня техники

Известен способ скрининга новорожденных на такие наследственные заболевания, как муковисцидоз, врожденный гипотиреоз, галактоземия, фенилкетонурия за один анализ крови. Присутствие или отсутствие мутаций ДНК определяют с помощью гибридизации полученных фрагментов на специализированном олигонуклеотидном биочипе. Для этого используют амплификацию PAH, CFTR, PAX8, GALT генов и получение одноцепочного флюоресцентно меченного продукта методом ник-трансляции и рестрикции, приготавливают биочип для скрининга новорожденных на заболевания, содержащий набор иммобилизованных определенных олигонуклеотидов. Интерпретацию результатов гибридизации осуществляют путем сравнения интенсивности флюоресцентных сигналов, полученных при совершенной и несовершенной гибридизации. Несмотря на то что такое исследование позволяет получить новый ускоренный метод массового скрининга новорожденных на наличие предрасположенности к моногенным заболеваниям, он обладает ограниченной информативностью.

Известен принцип отбора полиморфизмов, описанный в EP 2463384. Однако авторами изучались и отбирались полиморфизмы, определяющие возникновение внезапной сердечной смерти без учета их территориальной распространенности.

Описание сущности изобретений

Задачей настоящей разработки является создание метода исследования ДНК человека на наличие большого количества мутаций и/или полиморфизмов с использованием биочипа.

Еще одна задача состоит в разработке и применении уникального набора олигонуклеотидных зондов, позволяющих определять мутации и/или полиморфизмы, включенного в диагностикум (биочип), который может быть использован для диагностики наиболее часто встречающихся мутаций и полиморфизмов, ассоциированных с наиболее частыми для популяций людей (этнических групп), населяющих определенную географическую территорию, наследственными и мультифакторными заболеваниями с наследственной составляющей.

Основной отличительной особенностью микрочипа является первый этап его разработки - определение мутаций и/или полиморфизмов, которые могут быть выявлены с его помощью. На данном этапе, исходят из генетических особенностей популяций, населяющих определенную территорию: в диагностикум (микрочип) входят только наиболее частые мутации и/или полиморфизмы, ассоциированные с наиболее частыми на данной территории наследственными и мультифакторными заболеваниями с наследственной составляющей. Таким образом, эффективность и информативность диагностики на конкретной территории с помощью такого диагностикума увеличивается по сравнению с прямыми аналогами, за счет способа подбора выявляемых мутаций, а не за счет увеличения их количества.

Состав мутаций, выявляемых с помощью микрочипа, оптимизирован и строго специфичен для этнических групп, населяющих заданную территорию на протяжении долгого времени. Таким образом, эффективность и информативность генетической диагностики наследственных заболеваний с применением данного набора гораздо выше, чем с применением имеющихся аналогов.

Под частотой встречаемости мутации или полиморфизма подразумевается ее распространенность в заданной популяции или у заданных этнических групп из расчета количества случаев ее гомозиготного носительства на 1000 человек. При этом под общемировой частотой подразумевается ее усредненная частота среди изученных популяций планеты. Данные об общемировых частотах встречаемости мутаций и/или полиморфизмов и частотах встречаемости в заданной популяции получаются из научной литературы.

В одном аспекте изобретение относится к набору олигонуклеотидных зондов, позволяющему детектировать комплекс (набор) мутаций и/или полиморфизмов для молекулярно-генетического исследования (скрининга) человека, при этом:

(a) не менее 10% (от 10% до 95%) от общего количества мутаций и/или полиморфизмов, которые могут быть определены, должно иметь частоту встречаемости у этнических групп, проживающих на выбранной территории в течение долгого времени, или в выбранной популяции людей, превышающую в среднем общемировую встречаемость не менее чем в два раза (соотношение частоты встречаемости у населения, проживающего на выбранной территории, или в выбранной популяции к среднемировой частоте составляет >2);

(b) нe менее 5% (от 5% до 90%) мутаций и/или полиморфизмов не должны встречаться у этнических групп, проживающих на выбранной территории в течение долгого времени, или в выбранной популяции людей, отличных от выбранной;

(c) не более 10% (от 0% до 10%) мутаций и/или полиморфизмов, имеющих среднемировую частоту встречаемости, более чем в два раза превышающую частоту встречаемости у этнических групп, проживающих на выбранной территории в течение долгого времени, или в выбранной популяции людей (соотношение среднемировой частоты к частоте встречаемости у населения, проживающего на выбранной территории, или в выбранной популяции >2);

(d) не более 5% (от 0% до 5%) мутаций и/или полиморфизмов, не встречающихся у этнических групп, проживающих на выбранной территории в течение долгого времени, или в выбранной популяции;

(e) остальное содержание (от 0-85%) мутаций и/или полиморфизмов, встречающихся у этнических групп, проживающих на выбранной территории, или в выбранной популяции может быть равно в среднем общемировой или не может превышать ее более чем в два раза (соотношение частоты встречаемости у населения, проживающего на выбранной территории, или в выбранной популяции к среднемировой частоте составляет ≤2).

В ходе исследований было установлено, что именно с отбором исследуемых мутаций связана эффективность и информативность диагностики на конкретной территории, которые увеличиваются за счет того, что для диагностики взяты самые распространенные и специфичные для этой территории мутации.

В другом аспекте изобретение относится к способу получения ДНК-микрочипа.

ДНК-микрочипы получают методом печати олигонуклеотидных зондов, содержащих участки ДНК, позволяющие детектировать выбранные мутации и/или полиморфизмы на стеклянной пластине, покрытой аминосиланом (см. WO 2004073988).

Отличительной особенностью разработанного нами способа является этап предварительного отбора мутаций по установленному нами алгоритму. Способ позволяет получить уникальный микрочип для молекулярно-генетической диагностики человека, принадлежащего к этнической группе, проживающей на определенной географической территории в течение долгого времени, и повысить точность и информативность исследования.

Способ получения ДНК-микрочипа для молекулярно-генетического исследования человека, проживающего на выбранной территории или в выбранной популяции, включает:

I) отбор мутаций и/или полиморфизмов, предусматривающий:

(a) отбор не менее 10% (от 10% до 95%) от общего количества мутаций и/или полиморфизмов, которые могут быть определены, имеющих частоту встречаемости у этнических групп, проживающих на выбранной территории в течение долгого времени, или в выбранной популяции людей, превышающую в среднем общемировую встречаемость не менее чем в два раза (соотношение частоты встречаемости у населения, проживающего на выбранной территории, или в выбранной популяции к среднемировой частоте составляет >2);

(b) отбор не менее 5% (от 5% до 90%) мутаций и/или полиморфизмов не должен встречаться у этнических групп, проживающих на выбранной территории в течение долгого времени, или в выбранной популяции людей, отличных от выбранной;

(c) отбор не более 10% (от 0% до 10%) мутаций и/или полиморфизмов, имеющих среднемировую частоту встречаемости, более чем в два раза превышающую частоту встречаемости у этнических групп, проживающих на выбранной территории в течение долгого времени, или в выбранной популяции людей (соотношение среднемировой частоты к частоте встречаемости у населения, проживающего на выбранной территории, или в выбранной популяции >2);

(d) Отбор не более 5% (от 0% до 5%) мутаций и/или полиморфизмов, не встречающихся у этнических групп, проживающих на выбранной территории в течение долгого времени, или в выбранной популяции;

(e) отбор остальных мутаций и/или полиморфизмов (от 0-85%), встречающихся у этнических групп, проживающих на выбранной территории, или в выбранной популяции может быть равен в среднем общемировой или не может превышать ее более чем в два раза (соотношение частоты встречаемости у населения, проживающего на выбранной территории, или в выбранной популяции к среднемировой частоте составляет ≤2);

II) получение олигонуклеотидных зондов, содержащих ДНК-участки, позволяющие детектировать отобранные мутации и/или полиморфизмы;

III) нанесение олигонуклеотидных зондов на стеклянную пластину, покрытую аминосиланом или другим адгезивом нуклеиновых кислот, при этом одна из сторон пластины обработана таким образом, что распространение в ней лазерного луча происходит за счет эффекта полного внутреннего отражения.

Предпочтительно, чтобы зонды были подобраны таким образом, чтобы точно детектировать мутацию или полиморфизм, указанный как по смысловой, так и по антисмысловой цепи ДНК.

Для детекции мутаций и полиморфизмов зонды отбирают согласно следующим критериям:

- отсутствие внутренней вторичной структуры;

- способность участвовать в специфичной элонгации фрагментов генов, содержащих участки, позволяющие в дальнейшем идентифицировать мутации и полиморфные варианты генов.

Настоящее устройство микрочип может использоваться в составе комплекта для молекулярно-генетической диагностики на основе реакции элонгации праймеров на ДНК-микроматрицах.

Разработанный ДНК-микрочип в составе комплекта позволяет единовременно выявлять носительство мутаций и/или полиморфизмов, ассоциированных с наследственными заболеваниями, и применяется для молекулярно-генетической диагностики наследственных заболеваний; предрасположенности к мультифакторным заболеваниям, имеющим генетическую составляющую, и персональной генетически-детерминированной реакции на фармацевтические препараты.

Комплект для молекулярно-генетического исследования человека, проживающего на выбранной территории или в выбранной популяции, включает:

- Набор ферментов и реактивов для подготовки матрицы реакции элонгации праймеров на микрочипе (англ. Arrayed Primer Extention - APEX), состоящий из ДНК-полимеразы, раствора магния, растворов дизоксинуклеотидов, урацил-N-гликозилазы, щелочной фосфатазы креветки.

- Праймеры для реакции ПЦР мультиплексные

- Набор для очистки продуктов ПЦР

- Набор для реакции APEX: ДНК-полимеразы, раствора магния, растворов флуоресцентно меченных дидезоксинуклеотидов для элонгации цепи

- ДНК-микрочип, адаптированный для молекулярно-генетического исследования людей, проживающих на определенной географической территории.

Применение наборов на основе технологии APEX описано в US 20070134691.

В качестве метода анализа ДНК-микрочипа был выбран способ, описанный в EP 1088214, что позволяет повысить точность, упростить методику генетической диагностики и сделать ее экономически выгодной.

Способ молекулярно-генетического исследования человека, принадлежащего к этносу, проживающему на выбранной территории в течение долгого времени, или в выбранной популяции, предусматривает использование нового комплекта для диагностики и регистрацию результатов анализа путем сравнения интенсивности флуоресцентных сигналов, при облучении ДНК-микрочипа лазерами различной длины волны.

Осуществление изобретений

Осуществление заявленной группы изобретений приведено на примере разработки средств для диагностики и ее осуществления для популяции людей, проживающих на территории Российской Федерации, однако данный принцип может быть применен к любой территории или государству.

Перечень и последовательность зондов, содержащих участки, позволяющие в дальнейшем идентифицировать мутации и полиморфные варианты генов, указанные в Таблице 1, представлена в Таблице 2.

В качестве мутаций, относящихся к категории (a) алгоритма отбора, можно привести следующие:

Ген Нуклеотидная замена Заболевание
CFTR c.489+1G>T Муковисцидоз
PAH c.1222C>T Фенилкетонурия
BTD c.98_104delGCGGCTGinsTCC Дефицит биотинидазы

В качестве мутаций, относящихся к категории (b) алгоритма отбора, можно привести следующие:

Ген Нуклеотидная замена Заболевание
TCIRG1 c.807+5G>A Аутосомно-рецессивный остеопетроз
VHL c.598A>C Аутосомно-рецессивный эритроцитоз
GJB1 c.259C>G Болезнь Шарко-Мари-Тута, тип 1A

В качестве мутаций, относящихся к категории (с) алгоритма отбора, можно привести следующие:

Ген Нуклеотидная замена Заболевание
IKBKAP c.IVS20+6T>C Семейная дисаутономия
DHCR7 c.278С>T Синдром SLOS
HEXA c.805+1G>A Болезнь Тея-Сакса

В качестве мутаций, относящихся к категории (d) алгоритма отбора, можно привести следующие:

Ген Нуклеотидная замена Заболевание
SLC26A4 c.2168A>G Синдром Пендреда
SLC26A4 IVS7AS, A-G, -2 Синдром Пендреда
NPHS1 c.3325C>T Нефротический синдром финского типа

В качестве мутаций, относящихся к категории (e) алгоритма отбора, можно привести следующие:

Ген Нуклеотидная замена Заболевание
MEFV c.2080A>Т Периодическая болезнь
MTND1 c.3460G>A Атрофия зрительного нерва Лебера
GJB2 c.35delG Нейросенсорная тугоухость

Микрочип отличается нуклеотидной последовательностью зондов, закрепленных на ДНК-микрочипе для прохождения реакции элонгации праймеров на чипе (англ. Arrayed Primer Extention - APEX). В ходе реакции амплифицированные и фрагментированные участки генома, содержащие анализируемые мутации, денатурируются и наносятся на ДНК-микрочип.

Заявленный ДНК-микрочип используется в составе комплекта (см. таблицу 3) для диагностики наследственных заболеваний, осуществляемой в несколько этапов:

1) Получение геномной ДНК человека непосредственно из клинического образца (цельной периферической или пуповинной крови, или эритроцитарной массы или другого биологического образца).

2) Амплификация участков ДНК, содержащих мутации и полиморфизмы с использованием специфично подобранных праймеров.

3) Очистка продуктов ПЦР.

4) Фрагментация продуктов ПЦР.

5) Гибридизация полученных одноцепочечных фрагментов на ДНК-микрочипе с последующим достраиванием зондов на один специфично-меченный флуоресцентным маркером нуклеотид в месте мутации. При этом в качестве матрицы используются образцы анализируемой ДНК.

6) Регистрация результатов анализа путем сравнения интенсивности свечения флуоресцентных сигналов, при облучении ДНК-микрочипа лазерами различной длины волны.

Проведение ПЦР и фрагментации ДНК

Полимеразная цепная реакция (ПЦР) используется для амплификации (увеличения копийности) участков геномной ДНК, несущих целевые мутации или однонуклеотидные полиморфизмы (SNP).

Часть дТТФ заменяется в ПЦР-миксе на дУТФ, что обеспечивает возможность дальнейшей фрагментации с помощью Урацил N-Гликозилазы (UNG). Продукты ПЦР объединяют, концентрируют и очищают от не встроившихся дНТФ с помощью щелочной фосфатазы креветок (SAP). После обработки SAP и UNG образцы нагревают для инактивации ферментов и расщепления ДНК в месте встройки урацила. Фрагментация длинных продуктов ПЦР обеспечивает лучшую гибридизацию с комплементарными олигонуклеотидами, иммобилизованными на стекле.

Проведение реакции APEX

Непосредственно перед реакцией элонгации праймеров на чипе (англ. Arrayed Primer Extention - APEX) фрагментированные продукты ПЦР денатурируют и переносят в реакционной смеси на разработанный чип (массив олигонуклеотидов на стекле). Реакционная смесь содержит буфер, одноцепочечные ДНК, термостабильную ДНК-полимеразу и четыре различных, индивидуально меченных флуорофорами терминаторных нуклеотидов.

Матрицезависимая ДНК полимеразная реакция проводится при постепенно увеличивающейся температуре для того, чтобы минимизировать образования олигонуклеотидами нежелательных вторичных структур, кроме того, обеспечить эффективную гибридизацию с целевыми фрагментами ДНК и поддержать на высоком уровне активность полимеразы. После инкубации свободный и не присоединенный ковалентными связями материал отмывается, что обеспечивает наилучшее соотношение сигнал-шум.

Детекция

Обработанные слайды, несущие на себе массив олигонуклеотидов, прошедших реакцию APEX, сканируют в микрочиповом сканере Genorama® QuattroImager™ (см. EP 1088214). Четыре лазера (поодиночке) используют для возбуждения разных красителей. Четыре хорошо спектрально разделенных красителя возбуждают с помощью полного внутреннего отражения лазерного луча в толще стеклянного слайда, работающего как световод. Свет, излучаемый флуорофорами в ответ на возбуждение, регистрируют с помощью ПЗС-камеры.

Поскольку для каждой реакции используют четыре различных красителя, для каждого микрочипа снимают четыре различных изображения излученного света. Каждый снимок соответствует своему красителю, соответственно отражает паттерн встраивания на чипе одного из четырех терминаторных нуклеотидов.

Анализ изображений и информации.

Сканирование сопровождается анализом с помощью Genorama® Genotyping Software™ («лазерный диск для генотипирования») для перевода информации о паттерне флуоресценции в нуклеотидную последовательность. Сначала нормируются интенсивности сигналов соответствующих красителей нуклеотидов-терминаторов. Сравниваются интенсивности сигналов в каждой точке расположения олигонуклеотидов во всех четырех изображениях, и наиболее интенсивный сигнал интерпретируется как соответствующий нуклеотид. В зависимости от того, встраивание какого нуклеотида произошло в точке мутации, делают вывод о статусе ее носительства у конкретного пациента.

Таким образом, уникальный набор мутаций и полиморфизмов может быть генотипирован с помощью разработанного микрочипа.

Обеспечена высокая специфичность (98%) и чувствительность (96%) при использовании в составе комплекта данного микрочипа для генетической диагностики при помощи реакции элонгации праймеров на ДНК-микроматрицах.

Данный микрочип позволяет детектировать мутации и полиморфизмы, а также ассоциированные с ними наследственные моногенные заболевания и предрасположенности к мультифакторным заболеваниям, включая муковисцидоз в одном исследовании, приведенные в таблице 1. ДНК-микрочип сфокусирован на популяцию России и предназначен для диагностики наиболее частых мутаций, ассоциированных с наследственными заболеваниями, и наиболее частых полимофризмов, ассоциированных с предрасположенностью к мультифакторным болезням и распространенных на территории Российской Федерации.

Клинические примеры

Клинический пример 1.

Больная Р-ва. Материалом для скринингового исследования служил образец эритроцитарной массы пуповинной крови.

Нами было проведено молекулярно-генетическое типирование с помощью заявляемого ДНК-микрочипа на 216 мутаций.

С помощью предлагаемого ДНК-микрочипа у больной Р-вой была выявлена ассоциированная с галактоземией мутация в гомозиготной форме с.-119 del/del в гене GALT.

Клинический пример 2.

Больная К-ва. Материалом для скринингового исследования служил образец периферической крови.

Нами было проведено молекулярно-генетическое типирование с помощью заявляемого ДНК-микрочипа на 216 мутаций.

С помощью предлагаемого ДНК-микрочипа у больной К-вой была выявлена ассоциированная с наследственной нейропатией зрительного нерва Лебера мутация в митохондриальном геноме. m. 1527A в гене MTCYB.

Клинический пример 3.

Больной С-ян. Материалом для скринингового исследования служил образец эритроцитарной массы пуповинной крови.

Нами было проведено молекулярно-генетическое типирование с помощью заявляемого ДНК-микрочипа на 216 мутаций.

С помощью предлагаемого ДНК-микрочипа у больного С-яна была выявлена ассоциированная с периодической болезнью мутация в гомозиготной форме c.442C/C в гене MEFV.

ДНК-микрочип может применяться для молекулярно-генетической диагностики в больницах, клинико-диагностических лабораториях и научно-исследовательских институтах. Данные исследования позволят здоровым людям получить информацию о своих генетических особенностях для поддержания собственного здоровья, а также предупредить рождение в их семье детей с тяжелой наследственной патологией.

Таблица 1
Ген Мутация (тривиальное название) Нуклеотидная замена (по номенклатуре HGVS) Аминокислотная замена (по номенклатуре HGVS) Заболевание
CFTR 394deltt c.262_263deltt p.Leu88Ilefs*22 Муковисцидоз
CFTR 621+1G->T c.489+1G>T Муковисцидоз
CFTR R334W c.1000C>T p.Arg334Trp Муковисцидоз
CFTR G551D c.1652G>A p.Gly551Asp Муковисцидоз
CFTR 2184dela c.2052dela р. Lys684Asnf*38 Муковисцидоз
CFTR 2183AA->G c.2051_2052delaai nsg p.Lys684Serfs*38 Муковисцидоз
CFTR 2184insa c.2052_2053insa p.Gln685Thrfs*4 Муковисцидоз
CFTR S1196X c.3587C>G p.Ser1196* Муковисцидоз
CFTR 3849+10kbc->T c.3717+12191C>T Муковисцидоз
CFTR N1303K c.3909C>G p.Asn1303Lys Муковисцидоз
CFTR I1005R c.3014T>G p.Ile1005Arg Муковисцидоз
PAH c.1222C>T p.Arg408Trp Фенилкетонурия
PAH c.842C>T p.Pro281Leu Фенилкетонурия
PAH IVS12+1g->a c.1315+1G>A Фенилкетонурия
PAH c.473G>A p.Arg158Gln Фенилкетонурия
PAH c.754C>T p.Arg252Trp Фенилкетонурия
PAH c.1045T>C p.Ser349Pro Фенилкетонурия
PAH c.1242A>G p.Tyr414Cys Фенилкетонурия
PAH IVS10nt546 IVS10-11G>A Фенилкетонурия
PAH IVS4+5G>T Фенилкетонурия
PAH c.143T>C p.Leu48Ser Фенилкетонурия
PAH c.1206C>T p.Ala403Val Фенилкетонурия
PAH c.929C>T p.Arg243* Фенилкетонурия
PAH c.781C>T p.Arg261* Фенилкетонурия
PTS C.95A>G C.94A>G p.Ser32Gly Фенилкетонурия III типа
PTS C.216Т>A C.216T>A p.Asn72Lys Фенилкетонурия III типа
PTS c.318C>T C.317C>T p.Thr106Met Фенилкетонурия III типа
GALT c.584Т>С c.584T>C p.Leu195Pro Галактоземия
GALT c.384A>G c.855G>T p.Lys285Asn Галактоземия
GALT -119_-116delgtca c.-119_-116delgtca Галактоземия
GALT IVS2-2A>G c.253-2A>G Галактоземия
FKRP c.341C>G p.Ala114Gly Поясно-конечностная мышечная дистрофия тип 2I
CAPN3 C.550dela p.Thr184fs* Поясно-конечностная мышечная дистрофия тип 2A
CAPN3 c.598-612del15 p.Phe200_Leu204del Поясно-конечностная мышечная дистрофия тип 2A
SGCG c.87 dupt p.Gly30Trpfs*30 Поясно-конечностная мышечная дистрофия тип 2С
SGCG c.525delt p.Phe175Leufs*20 Поясно-конечностная мышечная дистрофия тип 2C
SGCG c.848G>A p.Cys283Tyr Поясно-конечностная мышечная дистрофия тип 2C
SGCB c.377_384dupca gtagga c.377_384dup8 p.Gly129Glnfs*2 Поясно-конечностная мышечная дистрофия тип 2E
SGCA c.229C>T p.Arg77Cys Поясно-конечностная мышечная дистрофия тип 2D
SGCA c.850C>T p.Arg284Cys Поясно-конечностная мышечная дистрофия тип 2D
MFN2 C.280C>T p.Arg94Trp Нейропатия Шарко-Мари-Тута 2A
LMNA c.398G>T p.Arg133Leu Нейропатия Шарко-Мари-Тута2 B1
LMNA c.892C>T p.Arg298Cys Нейропатия Шарко-Мари-Тута2 B1
LMNA c.l411C>T p.Arg471Cys Нейропатия Шарко-Мари-Тута2 B1
LMNA c.1579C>T p.Arg527Cys Нейропатия Шарко-Мари-Тута2 B1
GJB1 c.259C>G p.Pro87Ala Нейропатия Шарко-Мари-Тута IX
GJB1 c.425G>A p.Arg142Gln Нейропатия Шарко-Мари-Тута IX
GJB1 c.67C>T c.64C>T p.Arg22* Нейропатия Шарко-Мари-Тута IX
GJB1 c.277A>G p.Met93Val Нейропатия Шарко-Мари-Тута IX
GDAP1 C.715C>T p.Leu239Phe
SH3TC2 c.3325C>T p.Arg1109* Нейропатия Шарко-Мари-Тута 2H
FIG4 c.122T>C p.Ile41Thr Нейропатия Шарко-Мари-Тута 4J
FGD4 c.893T>G p.Met298Arg Нейропатия Шарко-Мари-Тута 4H
FGD4 c.893T>C p.Met298Thr Нейропатия Шарко-Мари-Тута 4H
IKBKAP c.IVS20+6T>C c.2204+6T>C Семейная дисаутономия
IKBKAP c.2087G>С p.Arg696Pro Семейная дисаутономия
BSCL2 Asn88Ser c.455A>G p.Asn152Ser Спастическая параплегия Сильвера
TOR1A (DYT1) IVS4+5g->t c.748+5G>T Торсионная дистония ДОФА-независимая
PNKD c.66C>T c.20C>T p.Ala7Val Пароксизмальная некинезиогенная дискинезия
PNKD c.72C>T c.26C>T p.Ala9Val Пароксизмальная некинезиогенная дискинезия
CLCN1 Gly190Ser c.568_569GG>TC p.Gly190Ser Миотония Томсена
CLCN1 Ala493Glu c.1478C>A p.Ala493Glu Миотония Томсена
CLCN1 c.2680C>T p.Arg894* Миотония Томсена
CLCN1 c.180+3A>T Миотония Томсена
CLCN1 c.1261C>T p.Arg421Cys Миотония Томсена
CLCN1 C1649c>T p.Thr550Met Миотония Томсена
PEX7 c.875A>Т p.Leu292* Точечная хондродисплазия
SCN4A c.3938C>T p.Thr1313Met Гиперкалиемический периодический паралич
SCN4A c.2111C>T p.Tyr704Met Гиперкалиемический периодический паралич
SCN4A c.2023C>G p.Arg675Gly Нормокалиемический периодический паралич
SCN4A c.2006G>A p.Arg669His Гипокалиемический периодический параличи
NF1 c.1070T>C p.Leu357Pro Нейрофиброматоз I типа
NF1 c.2970delaat c.2970del3 p.Met991del Нейрофиброматоз I типа
ATP7B c.3207C>A p.H1069Q Болезнь Вильсона-Коновалова
ATP7B c.2906G>A p.R969Q Болезнь Вильсона-Коновалова
ATP7B c.2299insc c.2304insc p.m769fs Болезнь Вильсона-Коновалова
ATP7B c.3532dela p.t1178fs* Болезнь Вильсона-Коновалова
TCIRG1 c.807+5G>A Аутосомно-рецессивный остеопетроз
VHL c.598C>T Arg200Trp Аутосомно-репессивный эритроцитоз
LAMA3 c.151insg c.152dupg Ларинго-онихо-кутанный синдром
NPHS1 Arg1109X c.3205C>T p.Arg1069X Нефротический синдром финского типа
MEFV c.2080A>T p.Met694Leu Периодическая болезнь
MEFV c.1437C>G p.Phe479Leu Периодическая болезнь
MEFV c.2282G>A p.Arg761His Периодическая болезнь
DHCR7 c.278C>T p.Thr93Met Синдром SLOS
DHCR7 c.453G>A p.Trp151* Синдром SLOS
DHCR7 c.452G>A p.Trp151* Синдром SLOS
DHCR7 c.976G>T p.Val326Leu Синдром SLOS
ACADM c.985A>G p.Glu304Lys Дефицит MCAD
GBA IVS2+1G>A c.115+1G>A Болезнь Гоше
GAA IVS1AS-13T>G c.-32-13T>G Болезнь Помпе
GAA c.271G>A p.Asp91Asn Болезнь Помпе
IDUA c.296C>Т c.208C>T p.Gln70* Болезнь Гурлера
HEXA Ex11, 4bp INS c.1278instatc p.Tyr427fs Болезнь Тея-Сакса
HEXA IVS12+1G>C c.1421+1G>C Болезнь Тея-Сакса
HEXA IVS9+1G>A c.1073+1G>A Болезнь Тея-Сакса
HEXA c.1444G>A p.Gly482Lys Болезнь Тея-Сакса
SERPINA1 E342K, (Z mut) c.1096G>A p.Glu366Lys Дефицит альфа-1-аминотрипсина
SERPINA1 c.792 A>T (S mut) c.863A>T p.Glu288Val Дефицит альфа-1-аминотрипсина
SERPINA1 p.Met358Arg c.1145T>G p.Met382Arg Дефицит альфа-1-аминотрипсина
RYR1 c.1840C>T p.Arg614Cys Злокачественная гипертермия
RYR1 c.1021G>A p.Gly341Arg Злокачественная гипертермия
RYR1 c.6502G>A p.Val2168Met Злокачественная гипертермия
CACNA1 c.3333G>A p.Arg1086His Злокачественная
S гипертермия
ASPA c.854A>C p.Glu285Ala Болезнь Кэнаван
SMPD1 p.Arg496Leu c.1487C>T p.Arg498Leu Болезнь Нимана-Пика AB
SMPD1 Leu302Pro c.911T>C p.Leu304Pro Болезнь Нимана-Пика AB
SMPD1 c.1267C>T p.His423Tyr Болезнь Нимана-Пика AB
LCT c.-13910C>T c.1917+326C>T Непереносимость лактозы
POLG c.2243G>C p.Trp748Ser Синдром истощения митохондриально и ДНК
POLG c.752C>T p.Thr251Ile Синдром истощения митохондриально и ДНК
SURF1 c.845-846 delct p.Ser282fs Синдром Лея
SURF1 326insAT delTCTGCCAGCC c.311-321del10ins2 p.Leu105* Синдром Лея
MTTL1 c.3252A>G c.3252A>G Синдром MELAS
MTND5 c.13730A c.13730A Атрофия зрительного нерва Лебера
MTND1 c.3460G>A c.3460G>A Атрофия зрительного нерва Лебера
MTND4 c.11778G>A c.11778G>A Атрофия зрительного нерва Лебера
MTND4L c.10663T>C c.10663T>C Атрофия зрительного нерва Лебера
MTND6 c.14459G>A c.14459G>A Атрофия зрительного нерва Лебера
MTCO3 c.9438G>A c.9438G>A p.Gly78Ser Атрофия зрительного нерва Лебера
MTCO3 c.9804G>A c.9804G>A p.Ala200Thr Атрофия зрительного нерва Лебера
ABCA4 (ABCR) c.2588G>C p.Gly863Ala Болезнь Штаргардта 1 типа
ABCA4 (ABCR) c.3113C>T p.Ala1038Val Болезнь Штаргардта 1 типа
ABCA4 (ABCR) c.5882G>A p.Gly1961Glu Болезнь Штаргардта 1 типа
OPA1 c.1334G>A p.Arg445His Атрофия зрительного нерва с глухотой
OPA1 Tyr582Cys c.1756A>G Tp.yr619cys Атрофия зрительного нерва с глухотой
COCH c.208C>T p.Pro51Ser Аутосомно-доминантная глухота
GJB2 35delg c.31_35delg p.Gly12fs Наследственная тугоухость
GJB2 IVS1+1G>A (-3201G>A) c.-23+1G>A Наследственная тугоухость
GJB2 312_325del14 c.313_326del14 p.Arg104fs Наследственная тугоухость
SLC26A4 c.1246A>C p.Thr416Pro Синдром Пендреда
SLC26A4 c.2168A>G p.His723Arg Синдром Пендреда
SLC26A4 IVS7AS, A-G, -2 c.919-2A>G Синдром Пендреда
SLC26A4 c.1151A>G p.Glu384Gly Синдром Пендреда
ADA c.631C>T p.Arg211Cys Дефицит аденозин-дезаминазы
HBB c.25_26delaa p.Lys9fs* Бета-талассемия
HBB IVS-II-1 (G->A) c.315+1G>A Бета-талассемия
HBB IVS-I-110 (G->A) c.93-21G>A Бета-талассемия
HBB IVS-I-6 (T->C) c.92+6T>C Бета-талассемия
HBB Codon 44 (-C) c.135delc p.Ser45fs* Бета-талассемия
HBB IVS-II-745 (C->G) c.316-106C>G Бета-талассемия
HBB Codons 8/9(+G) c.27_28insg Бета-талассемия
HBB IVS-I-1 (G->A) c.92+1G>A Бета-талассемия
ABCD1 c.1411_12insa p.Gln472fs*555 Адренолейкодистрофия
ABCD1 Arg617His c.1520G>A p.Arg617His Адренолейкодистрофия
ABCD1 c.1553G>A p.Arg518Gln Адренолейкодистрофия
ABCD1 c.1661G>A p.Arg554His Адренолейкодистрофия
ABCD1 Arg660Trp c.19780Т p.Arg660Trp Адренолейкодистрофия
HMBS c.499C>T p.Arg167Trp Острая перемежающаяся порфирия
HMBS c.518G>A p.Arg173Gln Острая перемежающаяся порфирия
HMBS c.331G>A p.Gly111Arg Острая перемежающаяся порфирия
KCNQ1 IVS1+1G>A 386+1G>A LQT синдром
PRNP c.598G>A p.Glu200Lys Наследственные прионные болезни
SLC26A2 c.835C>T p.Arg279Trp Диастрофическая дисплазия
FLG 4-BP DEL, 2282CAGT c.2282 del4 p.Val762fs* Ихтиоз вульгарный
PKHD1 c.107C>T p.Thr36Met Поликистоз почек аутосомно-рецессивный
LMNA c.1445G>A p.Arg482Gln Семейная частичная липодистрофия, тип Данниган
LMNA c.1445G>T p.Arg482Leu Семейная частичная липодистрофия, тип Данниган
LMNA c.1751G>A p.Arg584His Семейная частичная липодистрофия, тип Данниган
AGT c.803T>C p.Met268Thr Предрасположенность к поздним гестозам
FGB c.-467G>A c.-463G>A Предрасположенность к инсульту
FGB c.-156C>T Предрасположены ость к инсульту
F2 c.*97G>A G.25313G>A Предрасположенность к тромбофилии
F5 c.1601G>A p.Arg534Gln Предрасположенность к тромбофилии
MTHFR c.665C>T p.Ala222Val Предрасположенность к тромбофилии
MTR c.2756A>G p.Asp919Gly Предрасположенность к тромбофилии
CALCR Pro447Leu c.1442T>C p.Leu481Pro Предрасположенность к остеопорозу
GSTP1 c.313A>G p.Ile105Val Регуляция детоксикации ксенобиотиков
NAT-2 c.341T>C p.Ile114Thr Регуляция детоксикации ксенобиотиков
NAT-2 c.481C>T p.Leu161Leu Регуляция детоксикации ксенобиотиков
NAT-2 c.590G>A p.Arg197Gln Регуляция детоксикации ксенобиотиков
CYP2C9 c.817dela p.Lys273fs* Регуляция метаболизма варфарина
CYP4F2 c.1297G>A p.Val433Met Регуляция метаболизма варфарина
GGCX c.2084+45G>C Регуляция метаболизма варфарина
NOD2 c.2722G>C p.Gly908Arg Болезнь Крона
NOD2 c.3019_3020insc p.Leu1007fs* Болезнь Крона
DLG5 c.419G>A p.Arg140Gln Болезнь Крона
ALDH2 c.1510G>A p.Glu504Lys Регуляция метаболизма алкоголя
ADH1B c.143A>G p.His48Arg Регуляция метаболизма алкоголя
OPRM1 c.118A>G p.Asn40Asp Регуляция метаболизма опиатов
ANKK1 c.2137G>A p.Glu713Lys Регуляция метаболизма опиатов
HFE c.187C>G p.His63Asp Гемохроматоз
HFE C.845G>A p.Cys282Tyr Гемохроматоз
CSTB (STFB) Болезнь Унферрихта-Лундборга
FGFR2 c.1025G>A p.Cys342Tyr Синдром Крузона
FGFR2 c.758C>G p.Pro253Arg Синдром Пфайфера
BTD c.98_104delGCGGCTGINSTCC c.98_104delGCGGCTGinsTCC p.Cys33fs* Дефицит биотинидазы
BTD C.16120Т p.Arg538Cys Дефицит биотинидазы
BTD c.511G>A p.Ala171Thr Дефицит биотинидазы
PPT1 c.364A>T p.Arg122Trp Нейрональный цероидный липофусциноз 1 типа
DYSF c.855+1delg Поясно-конечностная мышечная дистрофия тип 2B
DYSF c.937+1G>A Поясно-конечностная мышечная дистрофия тип 2B
DYSF c.1566C>G p.Tyr522* Поясно-конечностная мышечная дистрофия тип 2B
DYSF c.3373delg p.Glu1125Lysfs*9 Поясно-конечностная мышечная дистрофия тип 2B
DYSF c.4872_4876delins cccc p.Glu1624Aspfs*9 Поясно-конечностная мышечная дистрофия тип 2B
DYSF c.5979dupa p.Glu1994Argfs*3 Поясно-конечностная мышечная дистрофия тип 2B
DYSF c.6124C>T p.Arg2042Cys Поясно-конечностная мышечная дистрофия тип 2B
DYSF c.200_201delinsat p.Val67Asp Поясно-конечностная мышечная дистрофия тип 2B
CFTR c.276G>C p.Glu92Asp Поясно-конечностная мышечная дистрофия тип 2B
CSTB (STFB) c.del313-314 c.del313-314 Болезнь Унферрихта-Лундборга
CCR5 Delta_32 Delta_32 Регуляция проникновения ВИЧ в клетку
CCR5 c.303T>A c.303T>A p.Cys101* Регуляция проникновения ВИЧ в клетку
CCR5 c.-22459A>G c.-22459A>G Регуляция проникновения ВИЧ в клетку
SRY1 (sy14) del SY14 Мужское бесплодие
AZFC Sy254 del SY254 Мужское бесплодие
AZFA Sy84 del SY84 Мужское бесплодие
AZFB Sy1237 del SY1237 Мужское бесплодие
AZFB SY1235 del SY1235 Мужское бесплодие
AZFB SY1302 del SY1302 Мужское бесплодие
AZFA SY1316 del SY1316 Мужское бесплодие
AZFC Sy1196 del SY1196 Мужское бесплодие
AZFC Sy1191 del SY1191 Мужское бесплодие
AZF SRY1-6 del SY1-6 Мужское бесплодие
AZFC Sy1125 del SY1125 Мужское бесплодие
AZFC Sy1206 del SY1206 Мужское бесплодие
Таблица 2
Последовательность зондов, закрепленных на ДНК-микрочипе.
Ген Нуклеотидная замена (по номенклатуре HGVS) Смысловой зонд для реакции APEX Антисмысловой зонд для реакции APEX
CFTR c.262_263delTT ATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTT TGAATGTACAAATGAGATCCTTACCCCTAAATATAAA
CFTR c.489+1G>T CAGATGAGAATAGCTATGTTTAGTTTGATTTATAAGAAG ATGGGGCCTGTGCAAGGAAGTATTA
CFTR c.1000C>T CCAAGTTTGCAGAGAAAGACAATATAGTTCTT AATGAGATGGTGGTGAATATTTTCC
CFTR c.1652G>A GAAGGTGGAATCACACTGAGTGGAG TGCTAAAGAAATTCTTGCTCGTTGA
CFTR c.2052delA CTGTCTCCTGGACAGAAACAAAAAA CAAACTCTCCAGTCTGTTTAGAAGATTG
CFTR c.2051_2052delA AinsG GCTCCTGTCTCCTGGACAGAAACAAAAA CAAACTCTCCAGTCTGTTTAAAAGATTG
CFTR c.2052_2053insA TGTCTCCTGGACAGAAACAAAAAAA CTCTCCAGTCTGTTTAAAAGATTGTTTTTTT
CFTR c.35870G CAACTCTCGAAAGTTATGATTATTGAGAATT CCAGATGTCATCTTTCTTCACGTGT
CFTR c.3717+12191C>T TCCATCTGTTGCAGTATTAAAATGG CATTTCCTTTCAGGGTGTCTTACTC
CFTR c.3909C>G GAAAGTATTTATTCTTTCTGGAACATTTAGAAAAAA CACTCCACTGTTCATAGGGATCCAA
CFTR c.3014T>G TTGTTATTAATTGTGATTGGAGCTA GGGTTCTAAAACTGCGACAACTGCT
PAH c.1222C>T TAGGAACTTTGCTGCCACAATACCT GTCGTAGCGAACTGAGAAGGGCC
PAH c.842C>T GATTTCTTGGGTGTCCTGGCCTTCC GTCTGATGTACTGTGTGCTGTGGAAGACT
PAH c.1315+1G>A GCTTAAGATTTTGGCTGATTCCATTAACA GAGTGGCCTCGTCAGGTGTAAATTACTTA
PAH c.473G>A AAAGATCCTGTGTACCGTGCAAGAC GTAGGCAATGTCAGCAAACTGCTTC
PAH c.754C>T TGGCTGGCCTGCTTTCCTCT CACGCCACCCAAGAAATCCC
PAH c.1045Т>С GGATATGGTGCTGGGCTCCTG GGTCATACCTGTAATTCACCAAAGGATG
PAH c.1242A>G TCGGCCCTTCTCAGTTCGCT AATCCTTTGGGTGTATGGGTCG
PAH IVS10-11G>A TGATCCTGATTTAACAGTGATAATAACTTTTCACTT TTCTCTGATAAGCAGTACTGTAGGCCC
PAH IVS4+5G>T GCAAGACGGAAGCAGTTTGCTGGTGA ATCTCATCCTACGGGCCATGGA
PAH c.143Т>С CTCACTCAAAGAAGAAGTTGGTGCAT CTCAAATAAGCGCAATACTTTGGCC
PAH c.1206C>T CATGAAAAGTACTGTGGCTACCATGAA AGGGCCGAGGTATTGTGGCA
PAH c.929C>T CCCAGCTTGCACTGGTTTCCGCCTC GAGGAAAGCAGGCCAGCTACAGGTC
PAH c.781C>T TTCTTGGGTGTCCTGGCCTTC TGATGTACTGTGTGCAGTGGAAGACTC
PTS c.94A>G TGACTTTTTTTTTTTTTTTTGGTCAGTAAATTTCTA CCAAACAGTTTCAAGTTTTCTTCATCAC
PTS c.216Т>A CCTGCTACGGGAATGGTTATGAA ACGTCCATATATTTTTTGAGATCAGCCAG
PTS c.317C>T TTTTTTTTGTTTTTGTTTTTTTTTCTTATAGCA TCCCACATATAAACAGCTACATTTTCAGTC
GALT c.584T>C ACAGGTATGGGCCAGCAGTTTCC CCTCACACTGGGCAATATCTGGC
GALT c.855G>T CCATCATGAAGAAGCTCTTGACCAA GAAAGGACGTCTCAAAGAGGTTGTCATA
GALT c.-119_-116delGTCA CAGGGCAGCCCAGTCAGTCA TGACCAGCCGCCAGCACG
GALT c.253-2A>G GTGCTTCTAGCCTATCCTTGTCGGT GTGCTATCGTACTGGGGATTCACC
FKRP c.341C>G TGAACCGGCCAGCCGCAG TAGGTCTCCGGGCGCGAG
TGGACCGGCAAGCCGCAG
CAPN3 c.550delA GTGGTTATAGATGACTGCCTGCCA GGTGAAAACCAGTTGATTGTTGTACGT
CAPN3 c.598-612del15 CAAGTCCAACCACCGCAATGAG GCTTACTTAGCATAAGCCTTCTCCAGC
SGCG c.87 dupT TTTTGTTTAGGGCCTGAAGGGGCTCTTTT CAAGGGGTGTCTCCACTGAATGTTCAAAA
SGCG c.525delT GAGAATCAGTATGTCTACAAAATTGGCATTTAT AGACAGCGCTTTCTCCAGCCA
SGCG c.848G>A CCGGTGTGAGCACCACGT CAGATGTGGTTGTGCTCCTGG
SGCB c.377_384dup8 ATCCACCCTGTTTATAAAAGCACAGTAGGA AATTTTCATTTCGCCTTCCTCCTACTGT
SGCA c.229C>T GACCTGCCCCGGTGGCTC GGCTGCGGTGGGTGTAGC
SGCA c.850C>T ACCCACTGAGGCCCCAGAC CCAGAGCATCCACCAAGAAGTCAC
MFN2 c.280C>T AGAAGCATCAGTGAGGTGCTGGCTC AAACCCACTTTCATGTGCCTCC
LMNA c.398G>T TGACCTGATAGCTGCTCAGGCTC AGACCCTCCAGGTCCTTCAGC
LMNA c.892C>T CTGCAGCAATCGCGCATC GCCAGAGAGGCTGTCGATGC
LMNA c.1411C>T CATGGGGAATTGGCAGATCAAG CAAGGGATCATCTCCATTCTGGC
LMNA c.1579C>T GGGCTGCGGGAAAAGCCTG CAGTGGAGTTGATGAGAGCCGTAC
GJB1 c.259C>G TGCAGCTCATCCTAGTTTCCACC CATGGCGACGAGGAGAGCTG
GJB1 c.425G>A CTATGTCATCAGCGTGGTGTTCC ATGAAGACGTCCTCAAACAACAGC
GJB1 c.64C>T CGGCATTCTACTGACATTGGC GATGAAGATGACCGAAAGCCATACTC
GJB1 c.277A>G CCAGCTCTCCTCGTGGCC GCTGGTGAGCCACGTGCA
GDAP1 c.715C>T GAAGAGGGCGAGCAACCTTGG AGGGTGAAGGATTCACCGCAGA
SH3TC2 c.3325C>T ACAGGCATCATGCAGTCGAGTACTAC GCAAACTGCACAGCTTGCACTTACTC
FIG4 c.122T>C GCAGAAACGAAATATCGTGTGTTGAAGA TGACCAAATCTTTTGGTTCTGTTCTATCA
FGD4 c.893T>G TCAGAAATTGGCACCATTCCTTAAGA GCATTATCAAATCCTTTCACATATTCTCCATAC
FGD4 c.893T>C TCAGAAATTGGCACCATTCCTTAAGA GCATTATCAAATCCTTTCACATATTCTCCATAC
IKBKAP c.2204+6T>C ATTCGGAAGTGGTTGGACAAGTAAG AACTAGTCGCAAACAGTACAATGGC
IKBKAP c.2087G>C CTGCGGAAAGTGGAGAGGGGTTCAC GTCCTGGGGCACAACAGTGACAATC
BSCL2 c.455A>G TCTGCTCCTTCCCTGTTGCCA GTCCACCCTTAGTCAGCGAGACA
TOR1A (DYT1) c.748+5G>T GTGTCGGTTTTGAATAACAAGAACAGTGA CAGGCGGTGGATGGCCCTA
PNKD c.20C>T CATGGTGGCGGTGGTAGCTG CGGCCCTTCAGCGCCGTA
PNKD c.26C>T CGGCGTTGGTAGCTGCTACGG GCCCCCCGGACCTTCAGC
CLCN1 c.568_569GG>TC CACATAATCTTTCAACGCTTTTAGGCTCT GATGTATTGTCTTCATTTCGGGGATT
CLCN1 c.1478C>A CTTCCTTTTATCTTCCCTCTAGGAGCTG CATGATTTCTCCTACCAGCCTTCCAAAT
CLCN1 c.2680C>T AGCTTCCGGAACACGACTTCAACT GCAGGTGCCCCGGTACTCTTTC
CLCN1 c.180+3A>T AACGTCCAGCCCACACAGGT CTCCCCTCTCCCCTTAGAGCACTT
CLCN1 c.1261C>T CTTCCTCTCCCAGTTGATGCCC GTCAAACAAAGTACTGATGGCTTCGC
CLCN1 c1649C>T CACAGCTGTGATTTGCATCGAATTAA CAGCATGTGAGCAATCTGACCC
PEX7 c.875A>T TGGAGCATCATACAGAGTTTACTTGTGGTT TGAGTGGGGCTCTGAATACTGAAGTCT
SCN4A c.3938C>T TACTTAGGGGGGAAAGACATCTTTATGA TCATGTCGTTATAGTATTTCTTCTGTTCCTCC
SCN4A c.2111C>T GGGGCGCTGGGTAACCTGA AACACGATGATAGCCAGCACCAGC
SCN4A c.2023C>G CCTCCCTGCTTGGCAGCTG CGACTTGACCAGCTTGAAGACCC
SCN4A c.2006G>A CCAACATACAGGGACTGTCTGTGCTAC GGTTTTGTGTACCAGACGGAAGGAG
NF1 c.1070T>C TTTTCTGTTGGGGTTTTTATAGAACCTGC CCTCTTGAGAATGGCTTACTTGGATTAAAA
NF1 c.2970del3 CATCTAGGGCAAGCTAGCATTGAAAC AGTAGAATGCTTACCTGACCAGATTTAACATC
ATP7B c.3207C>A GACTGCGGAGGCCAGCAGTGAACA TGGTGACTGCCACGACCAAGGG
ATP7B c.2906G>A CACATCTCCCAGACAGAGGTGATCATCC CGTGATGGACGTCTGGAAAGCAAAC
ATP7B c.2304insC ACATTCTTCGACACGCCCCCC AATGAACACAAAGAGCATGGGGGG
ATP7B c.3532delA GACAGACCACGAGATGAAAGGACAG GTCAATAGCCACAAGGATGGCTG
LAMA3 c.152dupG GTCAAAGTCAACTGCAAGCGAGTTATG GTTACCTGGCTGGGTCTAAACTCCAC
NPHS1 c.3205C>T TCATCCTGGAAGGTTGGAAGAGGAC GGCTCTCCTCATATTCGTTCCTGACTC
MEFV c.2080A>T GAATGGCTACTGGGTGGTGATAATG GACGCCTGGTACTCATTTTCCTTCA
MEFV c.1437C>G ACTTCCTGGAGCAGCAAGAGCATTT CCACGTCCTCCAGTGAGGCCACAAA
MEFV c.2282G>A CAACCTATCTTCAGCCCTGGGACAC AGGAGCTGTGTTCTTCCCTCCATCA
DHCR7 c.278C>T ATCTGGGCCAAGACTCCACCTATAA GGTATAGATCTGGGCGGCTTTCCTC
DHCR7 c.453G>A ATTAGATCAATGGCCTGCAAGCCTG AAACCAGAGCAGGTGCGTGAGGAG
DHCR7 c.452G>A TATCAGATCAACGGCCTGCAAGCCT AACCAGAGCAGGTGCGTGAGGAGC
DHCR7 c.976G>T GCCCCCTAGGGTCTGTACTTG CAGCTGCACGGGGTGGTACA
ACADM c.985A>G ATTTATGCTGGCTGAAATGGCAATG CTCTCTGGTAACTCATTCTAGCTAGTTCAACTT
GBA c.115+1G>A CTTCAGGCAGTGTCGTGGGCATCAG CCTCCCCACTGCCTTGACTCACTCA
GAA c.-32-13T>G CTCCCTGCTGAGCCCGCTT TCCTACAGGCCTGCGGGAGAAG
GAA c.271G>A CCCCCCCAACAGCCGCTTC GCCTTGTCAGGGGCGCAAT
IDUA c.208C>T TGACCAGTACTTCCTCAGCTGGGAC CACATAGGCGAGGTTGAGCTGCT
HEXA c.1278insTATC GCCCCCTGGTACCTGAACCGTATATC TCCTTCCAGTCAGGGCCATAGGATA
HEXA c.1421+1G>C ACACAAACCTGGTCCCAAGGCTCTG CCACCTCCCCCCCGAAAACCCTTA
HEXA c.1073+1G>A AGCTGGAGTCCTTCTACATCCAGAC GACCCCACCCACCCTCCTTCCTTCCTCA
HEXA c.1444G>A CCAGAGCAGGTGCTGTTGCC GTCTACTTGTTGCTCCACAGCCTTT
SERPINA1 c.1096G>A TGCATAAGGCTGTGCTGACCATCGAC CCCCAGCAGCTTCAGTCCCTTTCT
SERPINA1 c.863A>T TGATGAGGGGAAACTACAGCACCTGG TTGGTGATGATATCGTGGGTGAGTTCATTT
SERPINA1 c.1145T>G GCCATGTTTTTAGAGGCCATACCCA GAACTTGACCTCGGGGGGGATAGAC
RYR1 c.18400T CAGTGTGTGTGTAATGGTGTGGCTGTA AGTTCTCAGTAATAAGATCTTGGTTGGAGC
RYR1 c.1021G>A TGGGCCCCCCTGAGATCAAGTAC CTGCACCAAGCACAGTGACTCCC
RYR1 c.6502G>A CAAATCCGCTCGCTGCTCATC TCCTGGGGGCCCATCTGCA
CACNA1S c.3333G>A ACCTGTCCTCTTGTATGTGTCACAGC CTTTCAGGGCATACTGTACACATTGG
ASPA c.854A>C ACCGTGTACCCCGTGTTTGTGAATG TTCTTTCTTTTCGTAATATGCGGCC
SMPD1 c.1487C>T CAGCCCCACATCCTTGCAAGTTACC GGAGTAGTTTCCATCTATTTGGTACACA
SMPD1 c.911T>C GGCCCTGACCACCGTCACAGCAC CACTGGCCCCAGGAACTTCCTCACA
SMPD1 c.1267C>T TGATTACGATCCTTAATTCTCCCTACTAGGTG CCTGGGGGAATGTGGCCAATTATAT
LCT c.1917+326C>T TGCGCTGGCAATACAGATAAGATAATGTAG GAGGAGAGTTCCTTTGAGGCCAGGG
POLG c.2243G>C GACGTGGACATCCCTGGCTGCT ACCTTGTGAGGCAGCTTGAAAAAC
POLG c.752C>T CCTCATCCCCCTGGAGGTCCCTA GGGTGGGGCTGCTTGCACCA
SURF1 c.845-846 delCT TTGCTTTCAACCCCTAGGTATGGACTCT AAACCACAGGTAGGATGTAGCTGCAGAG
SURF1 c.311-321del10ins2 GAGTTCTGGCTGAGCCTGTCCC GGGGCAGCCATGCACTCACTC
MTTL1 c.3252A>G TTTGTTAAGATGGCAGAGCCCGGTA ACCTGTGACTGTAAAGTTTTAAGTTTTATGCGA
MTND5 c.13730A CAGCCGGAAGCCTATTCGCAG CGGGGGAAATGTTGTTAGTAATGAGAAAT
MTND1 c.3460G>A GGGCTACTACAACCCTTCGCTGAC GGGGCTCTTTGGTGAAGAGTTTTATGG
MTND4 c.11778G>A AAACTCAAACTACCAACGCACTCACAGTC TTTGAAGTCCTTGAGAGAGGATTATGATG
MTND4L c.10663Т>С TAGCCAATATTGTGCCTATTGCCATACTAG TGTTTCGCAGGCGGCAAAG
MTND6 c.14459G>A ATGCCTCAGCATACTCCTCAATAGCCATC GGAATGATGGTTGTCTTTGGATATACTACAG
МТСО3 c.9438G>A ACCACACACCACCTGTCCAAAAA TAATAAATAGGATTATCCCGTATCGAAGGC
МТСО3 c.9804G>A GCATCTCCGGCTCAACATTTTTTGTA TGAAGTCCGTGGAAGCCTGTGG
ABCA4 (ABCR) c.2588G>C CGTTCGACTTTCTCTGTTTATTTGTCTCTATTTTTAG CCAAGGAAGTGGGGTTCCATAGTCT
ABCA4 (ABCR) c.3113C>T CCCAGCTGAAAGGAAAGTCCCAGGAGGAGG CAACATGGCTTCCATCTCAAGCTGG
ABCA4 (ABCR) c.5882G>A CCAGCCCAGCAGTGGAGAGGCTGTGTGTCG AGTACCCACCTCTCCAGGGCGAACT
OPA1 c.1334G>A TCAAATGGATCTGTGGATGCTGAAC ATTTGCCTGACCAAGTCTGTAACAATACTG
OPA1 c.1756A>G TTTTAACCTTGAAACTGAATGGAAGAATAACT TCAAGTTACCGCAGGCGAGGA
TCIRG1 c.807+5G>A AGCTAGGAGCTGCAGGAGGTGG TCCGGAAGGCCGGGGGCA
VHL c.598C>T CCAAATGTGCAGAAAGACCTGGAG AATGCGCTCCTGTGTCAGCC
СОСН c.208C>T GGAAAGAGAAAACAGATGTCCTCTGC CCTCAAGAGGGAAGCCCCCTG
GJB2 c.31_35delG GGCACGCTGCAGACGATCCTGGGGG GTGGAaTGTTTGTTCACACCCCC
GJB2 c.-23+1G>A CCGCCaCGCTTCCTCCCGACGCAG GCAGTCCGGGGCCGGCGGGCTCA
GJB2 c.313_326del14 CTACCGGAGACATGAGAAGAAGAGG GATGTCCTTAAATTCACTCTTTATCTCCCC
SLC26A4 c.1246A>C CCGCACaGCCGTCCAGGAGAGC GTTCCTACCTGTGTCTTTCCTCCAG
SLC26A4 c.2168A>G GAAAGGACACATTCTTTTTGACGGTCC CACTTGGTTCTGTAGATAGAGTATAGCATCA
SLC26A4 c.919-2A>G GAGTTTTTAACATCTTTTGTTTTATTTC TATGAAATGGCAGTAGCAATTATCGTC
SLC26A4 c.1151A>G CGTTGTCATCCAGTCTCTTCCTTAGG TGCTGATCCCAAAGGCAATGAAT
ADA c.631C>T AGGCTTTGAAGAGCGGCATTCAC CCTCCCCGGCGTGGACAGTAC
HBB c.25_26delAA TGGTGCATCTGAATCCTGAGGAG CCCACAGGGCAGTAACGGCAGAC
HBB c.315+1G>A GCACGTGGATCTTGAGAACTTCAGG AAACATCAAGGGTCCCATAGACTCA
HBB c.93-21G>A GCACTGACTCTCTCTGCCTATT GCAGCCTAAGGGTGGGAAAATAGAC
HBB c.92+6T>C GGTGGTGAGGCACTGGGCAGGTTGG CTTAAACCTGTCTTGTAACCTTGAT
HBB c.135delC CTTGGACCCAGAGGTTCTTTGAGTC ATCAGGAGTGGACAGATCCCCAAAG
HBB c.316-106C>G TTCATATTGCTAATAGCAGCTACAATCCAG TCCCAACCATAAAATAAAAGCAGAATGGTA
HBB c.27_28insG ACCATGGTGCACCTGACTCCTGAGGAGAAG ACCTTGCCCCACAGGGCAGTAACGGCAGAC
HBB c.92+1G>A AAGTTGGTGGTGAGGCCCTGGGCAG ACCTGTCTTGTAACCTTGATACCAA
ABCD1 c.1411_12insA GGCCAGGTGGTGGATGTGGAA TGTTCTCGCAGATGATCCCCTGTT
ABCD1 c.1520G>A AAGCAGAGAATCGGCATGGCCC GGAGTGCTCACCTGTGGTAGAACATG
ABCD1 c.1553G>A TGCAGCAAGAGCTCCCTGTTCC GCCAGAGCCCACCCAGGATC
ABCD1 c.1661G>A CCTACATGTCTGTGGGCTCCCTGC GAGTCCGGGTAGATCACCTGGTCA
ABCD1 c.1978C>T GCCCTGCTCTCCATCACCCAC GCACCTACCACAGGGAGGGCC
HMBS c.499C>T CTGTGGTCTTTAGCAACTCTCCACAG GCCGTGTGTTGAGGTTTCCCC
HMBS c.518G>A CAGCGGAGAAACCTCAACACCC CTGCTCGTCCAGTTTCCGAAGC
HMBS c.331G>A TGCTTCCTCCTGGCTTCACCATC GCAAGACTCTTACTTGCAGATGGCTC
KCNQ1 386+1G>A TGCTTCGTTTACCACTTCGCCGT TCGCCGGTGGCGATACTCA
PRNP c.598G>A CACCAAGGGGGAGAACTTCACC CGCTCCATCATCTTAACGTCGGTCT
SLC26A2 c.835C>T CAAATATCTTCTTGGGCTCAACCTTCCT ATGAGTGAGCCCACACCATTAGTCC
FLG c.2282 del4 GGGACATTCAGAAGACTCAGACACACAGT AGCCTGTCTATGGCCTGACACTG
PKHD1 c.107C>T AAGAAGGTAGCCTTGCAGGGGGAA CCTACCATCAAAAATGACTGTGATCCAC
LMNA c.1445G>A GAATGTAGATGATCCCTTGCTGACTTACC TCAGGGTGAACTTTGGTGGGAAC
LMNA c.1445G>T GAATGTAGATGATCCCTTGCTGACTTACC TCAGGGTGAACTTTGGTGGGAAC
LMNA c.1751G>A GCTGAGTACAACCTGCGCTCGC AGGTCCCGCACAGCACGGTG
AGT c.803T>C TGGAAGACTGGCTGCTCCCTGA GGTGCTGTCCACACTGGCTCCC
FGB c.-463G>A GATAAACACATGATGATATAACATTACTATTGATTTTAAT ACAATGACATAATTCTATTTCAAAAGGGGC
FGB c.-156C>T AGACCAACAAAGAATAATAGTTGTATGACAAGTAAATAAG TCATTTAAGCAACATCTTCCCAGCAAA
F2 g.25313G>A TATGGTTCCCAATAAAAGTGACTCTCAGC GAATAGCACTGGGAGCATTGAGGCT
F5 c.1601G>A TGTAAGAGCAGATCCCCGGACAGGC TTACTTCAAGGACAAAACACCTGTATTCCT
MTHFR c.665C>T TTGAAGGAGAAGGTGTCTGCGGGAG CAAAGAAAAGCTGAGTGATGATGAAATCG
MTR c.2756A>G AAATCATGGAAGAATATGAAGATATTAGACAGG CTACCACTTACCTTGAGAGACTCATAATGG
CALCR c.1442T>C CCAATTTACATCTGCCATCAGGAGC TTGGTTGTTGGCTGGTTCATTCCTC
GSTP1 c.313A>G GGAGGACCTCCGCTGCAAATAC TCACATAGTTGGTGTAGATGAGGGAGA
NAT-2 c.341T>C TCACCTTCTCCTGCAGGTGACCA CGACAATGTAATTCCTGCCGTCA
NAT-2 c.481C>T TGCTTGACAGAAGAGAGAGGAATCTGGTAC ACTGCTCTCTCCTGATTTGGTCCA
NAT-2 c.590G>A CACCAAAAAATATACTTATTTACGCTTGAACCTC AGGTATGTATTCATAGACTCAAAATCTTCAATTGTT
CYP2C9 c.817delA GATTGCTTCCTGATGAAAATGGAGA GCGGTCACATAACTAAGCTTTTGTTTACATTTTACCT
CYP4F2 c.1297G>A CGGAACCCATCACAACCCAGCT ACCTCAGGGTCCGGCCACA
GGCX c.2084+45G>C TTGTCATTGACATCATATGTTGGCAA CTCTCCCCAGGGGAAAGTTACCAAG
NOD2 c.2722G>C GACTCTTTTGGCCTTTTCAGATTCTGG CCCTCGTCACCCACTCTGTTGC
NOD2 c.3019_3020insC AAGCCCTCCTGCAGGCCC GATGGTGTCATTGCTTTCAAGGG
DLG5 c.419G>A CACCACCCCTCCTCACTGACC GGTTCTCCACCTTCTCATTCACTTGC
ALDH2 c.1510G>A GAGTACGGGCTGCTGGCATACACT AGGTCCCACACTCACAGTTTTCACTT
ADH1B c.143A>G TCTGTAGATGGTGGCTGTAGGAATCTGTC TGCCACTAACCACGTGGTCATCTGTG
OPRM1 c.118A>G GGGTCAACTTGTCCCACTTAGATGGC GATCGCATGGGTCGGACAGGT
ANKK1 c.2137G>A ACAGCCATCCTCAAAGTGCTGGTC GTCCAGCTGGGCGCCTGCCT
HFE c.187C>G TGACCAGCTGTTCGTGTTCTATGAT CGGGGCTCCACACGGCGACTCTCAT
HFE c.845G>A CCTGGGGAAGAGCAGAGATATACGT ATCTAGGCCTGGGTGCTCCACCTGG
CSTB (STFB) GCGACGAGGACTTCGTACACCTG GTTTTCATGATGGAGAGATTGGAACACTC
FGFR2 c.1025G>A TTTGAGGACGCTGGGGAATATACGT TATCCCAATAGAATTACCCGCCAAG
FGFR2 c.758C>G CCTCTCTCCACCAGAGAGATCGC CTTGGAGGATGGGCCGGTGA
BTD c.98_104delGCGGCTGinsTCC AGCCAAAAGTAAGCTTGCTCTTTTCCTCT CTCCCAGGGCAACCACGTAA
BTD c.1612C>T GTGACGGCGGCTCTCTATGGG CACACTTTTCCTAGTCCCTCTCATACAAGC
BTD c.511G>A CATCAGGGGAGATATGTTCTTGGTG CAAGGCTCCTTTGTCTCAAGATTGG
PPT1 c.364A>T AATGGCATCTCTGAGCCACTGCCC CGGAGCTAAAACTCTCTTTTATTCCGTAGG
DYSF c.855+1delG TGTTTGATGAGCCCATCTTTATCACG CGGAGAACACTTTGACTGCTGAGACATAC
DYSF c.937+1G>A TGTGCACCATTTACAGAGAGCCCC TACGGCCAAAGTGGAGAGAACTCA
DYSF c.1566C>G TCCCCACTTTTGGGCCCTGCTA CTCTGGGACTGCCATAGAGGTTGAT
DYSF c.3373delG CGGCGTGATGGATGACAAGAGT AAGGTGGAGACGGACATGGAATCTT
DYSF c.4872_4876delinsCCCC AACTACATCCCCTGCACGCTGGA CCAAGATGCCCCAATTTACTTTCCAAATA
DYSF c.5979dupA TGGAAATGACCTTGGAGATTGTAGCA CCGCTCCTCATGCTCACTCTCT
DYSF c.6124C>T CATGAAGTTCATCCTGTGGCGG AGGATGATGGCCCACCGGAAAC
DYSF c.200_201delinsAT TGGACCAGGGCTCTGAGCTTCATG CCCATCTTCTCATGGTCTTTGACCAC
CFTR c.276G>C ATTTCTCTGTTTTTCCCCTTTTGTAGGA GTAAGAGAGGCTGTACTGCTTTGGTGAC
CSTB (STFB) c.del313-314 GACCTATTTCTGATCCTGACTTTGGACA TTTGTCAGTCTTCTGGCTGAAGGGC
CCR5 Delta_32 TACACCTTCAGCTCTCATTTTCCATACA CCAGCCCCAAGATGACTATCTTTAATGT
CCR5 c.303T>A CCCTGTGGGACTTTGGAAATACAATGTG AAGCCTATAAAATAGAGCCCTGTCAAGAGTTG
CCR5 c.-22459A>G ATACGGGGAGAGTGGAGAAAAAGGG ATCCTGGACTTCAGATTAACCCTGTGT
SRY1 (sY14) DEL AAGATGGCTCTAGAGAATCCCAGAATG CCAGCTGCTTGCTGATCTCTGAGTTTC
AZFc DEL TTTGACCCATAGGTACTAAAAATATCTTTGACA CCCGAATGACCAGCAGCCCT
AZFa DEL CTTAATCTGCACGAAACATGGGCTG ACACTAAAGAAAGGGTCCCACTGAATCT
AZFb DEL CTGGTGAAGCTAGTGAAGAAAGTTTATTTTCAG TTCCGTTGTTAGAGGCATATTTAAATTTTTAGAG
AZFb DEL CAGTGAAACTGCAGCTGTCAAATGA TCCCACCTCGTGTCTCTTATCAATTC
AZFb DEL CCAAATATCAGATCTGTGAGCCTTCCTAA GGCTCTGCCTGTAGCATTTTCCTCTG
AZFa DEL AAAATTATCTGGGCATCAGCATGTGG TTCATTTGGGCTAAAAACTAGTCCTAATGC
AZFc DEL TTCGCCTTCCGACGAGGACGATACT ACCTCTTAAGCTAGGAGCTCTAACCAATTAC
AZFc DEL ACTTTTTACCATTTTTATACACTTTTATGCAAATC TACCGTTATAACAGGTAATTAAAACTGCTAAACAT
AZF DEL TCGGCTTCAGTAAGCATTTTCCACT AGAGATCAGCAAGCAGCTGGGATAC
AZFc DEL TTCTCTGTCTTACGGTGGAAGACAGAAC GGAATTAAAATTAGACTTTTGTCTACACTACACTG
AZFc DEL CTTGGTTCCCCCGCTTGCTGT TTTGACCAAATTTTTCTAACCAACGTAGAG
Таблица 3
Комплект для диагностики.
Наименование
1 Набор для подготовки матрицы APEX:
1.1. ДНК-полимераза с «горячим стартом» (10 ед/мкл)
1.2. 10Х Буфер для реакции ПЦР с (NH4)2SO4
1.3. 25 mM MgCl2
1.4. 2,5 mM смесь dNTP (20% dUTP)
1.5. Урацил-N-Гликозилаза (UNG) (1 ед/мкл)
1.6. 10x UNG реакционный буфер
1.7. Щелочная фосфатаза креветки (sAP) 1 ед/мкл
2 Набор для реакции APEX
2.1. Смесь для реакции APEX
2.2. Антифэйд
3 Набор для очистки продуктов ПЦР
3.1. Колонки для очистки и пробирки для сбора
3.2. Связывающий буфер
3.3. Отмывочный буфер
3.4. Элюирующий буфер
4 ДНК-чипы для диагностики наследственных заболеваний, включая муковисцидоз
5 Покровное стекло «Лифтэр Слипс»
6 Порошок «Alcanox»
7 Покровное стекло
8 Праймеры для реакции ПНР мультиплексные

1. Набор олигонуклеотидных зондов, содержащих ДНК-участки, представленных в табл.2, для диагностики популяции людей, проживающих на территории РФ, на наследственные моногенные заболевания, путем выявления мутаций и/или полиморфизмов, подобранных таким образом, что:
(a) не менее 10% мутаций и/или полиморфизмов имеют частоту встречаемости у выбранной этнической группы и/или популяции людей, превышающую общемировую встречаемость не менее чем в два раза;
(b) не менее 5% мутаций и/или полиморфизмов не встречаются у этнических групп и/или популяций людей, отличных от выбранной;
(c) не более 10% мутаций и/или полиморфизмов имеют частоту встречаемости, более чем в два раза превышающую частоту встречаемости у выбранной этнической группы и/или популяции людей;
(d) не более 5% мутаций и/или полиморфизмов не встречаются у выбранной этнической группы и/или популяции людей;
(e) остальные мутации и/или полиморфизмы имеют частоту встречаемости у выбранной этнической группы и/или популяции людей, равную общемировой частоте встречаемости или не превышающую ее более чем в два раза.

2. Способ получения ДНК-микрочипа для диагностики популяции людей, проживающих на территории РФ, на наследственные моногенные заболевания, путем выявления мутаций и/или полиморфизмов, включающий:
I) получение олигонуклеотидных зондов, содержащих ДНК-участки, представленные в табл.2, позволяющие детектировать мутации и/или полиморфизмы из перечня, включающего:
(a) не менее 10% мутаций и/или полиморфизмов с частотой встречаемости у выбранной этнической группы и/или популяции людей, превышающей общемировую встречаемость не менее чем в два раза;
(b) не менее 5% мутаций и/или полиморфизмов, не встречающихся у этнических групп и/или популяций людей, отличных от выбранной;
(c) не более 10% мутаций и/или полиморфизмов с частотой встречаемости, более чем в два раза превышающей частоту встречаемости у выбранной этнической группы и/или популяции людей;
(d) не более 5% мутаций и/или полиморфизмов, не встречающихся у выбранной этнической группы и/или популяции людей;
(e) остальные мутации и/или полиморфизмы с частотой встречаемости у выбранной этнической группы и/или популяции людей, равной общемировой частоте встречаемости или не превышающей ее более чем в два раза;
II) нанесение олигонуклеотидных зондов на стеклянную пластину, покрытую адгезивом нуклеиновых кислот, при этом одна сторона пластины обработана таким образом, что распространение в ней лазерного луча происходит за счет эффекта полного внутреннего отражения.

3. Набор для исследования популяции людей, проживающих на территории РФ, на наследственные моногенные заболевания, путем выявления мутаций и/или полиморфизмов, включающий:
a) набор для подготовки матрицы реакции элонгации праймеров на ДНК-микрочипе
(APEX);
b) праймеры для реакции ПЦР мультиплексные;
c) набор для очистки продуктов ПЦР;
d) набор для реакции APEX по п.1;
e) ДНК-микрочип, полученный способом по п.2.

4. Способ детекции мутаций и/или полиморфизмов, ассоциированных с наследственными моногенными заболеваниями у популяции людей, проживающих на территории РФ, предусматривающий:
1) получение геномной ДНК человека, проведение ПЦР,
2) очистку и фрагментацию продуктов ПЦР,
3) проведение реакции APEX на ДНК-микрочипе, охарактеризованном в п. 2,
4) детекция мутаций и/или полиморфизмов путем сравнения интенсивности свечения флюоресцентных сигналов, при облучении ДНК-микрочипа лазерами различной длины волны.



 

Похожие патенты:
Изобретение относится к области биотехнологии и касается способа выявления и генотипирования бактерии Pasteurella multocida. Предложенный способ включает проведение ПЦР с электрофоретической детекцией результатов, перенос продукта амплификации на гель и оценку проведения реакции.
Изобретение касается набора олигонуклеотидных праймеров и зондов для идентификации и субтипирования ДНК бактерии Pasteurella multocida серотипов А, B, D, E, F методом ПЦР в режиме реального времени.

Изобретение относится к биотехнологии, а именно к способу идентификации микобактерий туберкулеза кластера Beijing B0/W148. Применяют полимеразную цепную реакцию для амплификации фрагментов ДНК М.

Изобретение относится к биотехнологии, а именно к способу детекции нуклеиновокислотной последовательности-мишени из ДНК или смеси нуклеиновых кислот с использованием праймера, генерирующего сигнал от мишени (TSG-праймера).

Изобретение касается набора флуоресцентно-меченых олигонуклеотидных зондов для типирования штаммов Burkholderia mallei. Входящие в состав набора зонды имеют структуру «шпильки» с флуорофором и гасителем флуоресценции на концах и обладают комплементарностью к продуктам реакции амплификации с праймерами.

Изобретение относится к биотехнологии, а именно к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации Burkholderia mallei и дифференциации его от Burkholderia pseudomallei.

Изобретение относится к биотехнологии и представляет собой ДНКазу или ее ферментативно активный фрагмент, способы удаления загрязняющей нуклеиновой кислоты из реакции обратной транскрипции, в которых используется данная ДНКаза, нуклеиновую кислоту, кодирующую указанную ДНКазу, и наборы или композиции, содержащие указанную ДНКазу.

Изобретение относится к области биотехнологии, а именно к способу воздействия на пролиферативный статус клеток. Предложенное изобретение может быть использовано в медицине в области лечения онкологических заболеваний, в иммунологии, в геронтологии и косметологии.

Изобретение относится к биотехнологии, а именно к cпособу дифференциации типичных и атипичных штаммов Yersinia pestis основного подвида средневекового биовара. Способ предусматривает проведение в двух реакционных смесях ПЦР с гибридизационно-флуоресцентным учетом результатов с использованием соответствующих олигонуклеотидных праймеров и зондов на ДНК-мишени «Med24» и «pCKF» следующего состава: праймеры прямой Med24 RealTime-S GCCAGTGTGTGTCTAAA, обратный Med24 RealTime-As CAACATTCGTCGCAAAG и зонд Med24 Zond FAM-ACATTGTGCTGGACTCACAGCCCC-BHQ1, праймеры прямой pCKF RealTime-S AACCGCCTAAGCACTTTAT, обратный pCKF RealTime-As CGTCAGGAACTCAACGAA и зонд pCKF Zond FAM-ATCAGAGAGCATTTGAGCGGTTG-BHQ1.

Группа изобретений относится к области биотехнологии и касается синтетических олигонуклеотидных праймеров и способа их использования. Предложенный способ выявления и дифференциации генома вакцинного штамма В-82 от полевых изолятов вируса миксомы кроликов включает: выделение ДНК из биологического материала, постановку мультиплексной полимеразной цепной реакции с использованием синтезированных праймеров, комплементарных участкам генов M130R и M151R вируса миксомы кролика и имеющих следующий нуклеотидный состав: амплификацию ДНК вируса и оценку проведения реакции.

Изобретение относится к области биохимии, в частности к способу выявления устойчивых к пиразииамиду изолятов Mycobacterium tuberculosis, путем определения наличия мутаций в гене pncA, ассоциированных с формированием устойчивости к пиразинамиду, посредством проведения ПЦР в режиме «реального времени» с использованием HRM-анализа. При этом проводят амплификацию на смеси равного количества тестируемой ДНК и ДНК дикого типа с использованием праймеров: Pnc18U: 5'-TACGCTCCGGTGTAGGCAC-3' и Pnc15R: 5'-GAAGCGGCGGACTACCATC-3', формируют гетеродуплексы за счет одновременной коамплификации ДНК дикого типа и тестируемой ДНК, при этом на первом этапе ПЦР проводят уравнивание концентрации с помощью количественной ПЦР с использованием той же пары праймеров (Pnc18U/Pnc15R) с построением калибровочной кривой и использованием регрессионного уравнения. Изобретение благодаря высокой специфичности и чувствительности позволяет надежно и быстро определить тип мутаций в гене pncA, ассоциированных с возникновением устойчивости к пиразинамиду.1 ил.

Группа изобретений относится к области биотехнологии, в частности к микроматричной геномной селекции (MGS). Устройство содержит:(a) по меньшей мере одну реакционную зону, содержащую микроматрицу, одну или более единиц контроля и регуляции температуры для контроля и регуляции температуры внутри реакционной зоны; (b) по меньшей мере одну нереакционную зону, содержащую одну или более единиц контроля и регуляции температуры для контроля и регуляции температуры внутри нереакционной зоны, которая соединена с возможностью переноса жидкости с реакционной зоной; и (c) по меньшей мере одно средство переноса, способное генерировать и/или регулировать поток жидкости между указанной реакционной зоной (а) и указанной нереакционной зоной (b). Устройство может быть использовано для специфического отбора нуклеиновых кислот, при этом повышается интенсивность связывания и флуоресценции. 3 н. и 11 з.п. ф-лы, 13 ил., 1 пр.
Изобретение относится к области медицины и предназначено для диагностики вагинита у женщин репродуктивного возраста. Во влагалищных соскобах измеряют уровни экспрессии мРНК генов TNF, IL18, GATA3 и TLR4. Определяют индексы отношений уровня экспрессии мРНК генов TLR4/GATA3 и TNF/IL18 и на основании значений пороговых циклов определяют вероятность вагинита по формуле. В случае если значение Р≤57% для небеременных женщин или Р≤68,5% для беременных женщин, делается заключение об отсутствии вагинита. Если значение Р≥57% для небеременных женщин или Р≥68,5% для беременных женщин, ставят диагноз вагинит. Изобретение обеспечивает эффективную диагностику вагинита у женщин репродуктивного возраста. 3 табл., 5 пр.

Изобретение относится к биотехнологии, а именно к способу анализа соматических мутаций в генах EGFR, KRAS и BRAF. Способ включает амплификацию фрагментов генов EGFR, KRAS и BRAF с помощью LNA-блокирующей мультиплексной «гнездовой» ПЦР, в которой в качестве матрицы для амплификации используется образец опухолевой ДНК. Получают одноцепочечный флуоресцентно меченый ПЦР-продукт. Получают биочип для идентификации соматических мутаций в генах EGFR, KRAS и BRAF. Проводят гибридизацию флуоресцентно меченого ПЦР-продукта на биочипе. Регистрируют и интерпретируют результаты гибридизации на биочипе. Предложенное изобретение позволяет провести анализ в короткий срок и с небольшими материальными затратами. 2 н. и 2 з.п. ф-лы, 2 ил., 4 табл., 4 пр.

Изобретение относится к области биотехнологии, конкретно к лентивирусной доставке апоптина в опухолевые ткани, и может быть использовано в медицине. Способ включает получение лентивирусного конструкта, экспрессирующего модифицированный апоптин, слитый с секреторным сигналом лактотрансферрина и трансдукторным сигналом (ST-CTP-апоптин), с последующим получением рекомбинантных лентивирусных частиц, дефектных по репликации и несущих модифицированный апоптин, которые затем вводятся в Т-лимфоциты (TILs), полученные при хирургическом удалении опухоли или в процессе получения биопсии, которые обладают способностью проникать в опухолевые ткани. Далее полученные TILs аутотрансплантируют указанному пациенту. Изобретение позволяет повысить способность апоптина проникать в опухолевые клетки и оказывать онколитический эффект в отношении всех клеток опухоли. 2 ил., 3 пр.
Изобретение относится к области биохимии, в частности к способу подвидовой дифференциации штаммов возбудителя чумы. Способ предусматривает выделение ДНК, проведение ПЦР с применением синтезированных праймеров для амплификации фрагментов межгенных участков wzyE-dapF и YPDF_0064-YPDSF_0065 исследуемого штамма. Дифференциацию осуществляют путем сравнения размеров полученных ампликонов исследуемого штамма с размерами аналогичных фрагментов, характерных для штаммов основного (151 п.н. и 374 п.н.), кавказского (185 п.н. и 434 п.н.), алтайского и гиссарского (202 п.н. и 374 п.н.), а также улегейского (185 п.н. и 374 п.н.) подвидов. Изобретение позволяет эффективно проводить подвидовую дифференциацию штаммов Y. pestis и значительно сократить время выполнения анализа. 4 пр.

Изобретение относится к области биохимии, в частности к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации вируса лихорадки долины Рифт методом обратно транскриптазной полимеразной цепной реакции в реальном времени. Изобретение позволяет эффективно идентифицировать вирус лихорадки долины Рифт. 2 ил., 2 табл., 2 пр.

Изобретение относится к области биотехнологии, а именно к паре синтетических олигонуклеотидных праймеров, применяемых для выделения ДНК провируса и РНК вируса иммунодефицита кошек, и к способу диагностики вирусного иммунодефицита кошек с использованием данных праймеров. Пара праймеров имеет следующую структуру - PF: 5′-TGGAGAAGGGAATTTCAGATGGG-3′ и PR: 5′-TTTGGGTCAAGTGCTACATATTGTGG-3′. Способ включает проведение ПЦР с детекцией полученных результатов методом горизонтального электрофореза в 1,5%-ном агарозном геле. Амплификацию проводят в следующем режиме: тотальная денатурация при 95°С в течение 5 мин, цикл денатурация при 95°С в течение 20 или 60 сек, отжиг при 56°С в течение 20 или 60 сек, элонгация при 72°С в течение 40 или 60 сек. Цикл денатурация - отжиг - элонгация повторяется 35 раз. Проводят заключительную элонгацию при 72°С в течение 5 мин. В случае наличия амплифицируемого фрагмента нуклеотидной последовательности длиной 366 п.н. судят о наличии FIV в организме кошки. Предложенное изобретение позволяет провести диагностику вирусного иммунодефицита кошек с высокой эффективностью. 2 н.п. ф-лы, 6 ил., 3 табл., 3 пр.

Изобретение относится к области кардиологии и касается набора синтетических олигонуклотидов. Представленный набор используется для выявления мутаций кодирующей части генов NKX2.5, CFC1, GATA4, ассоциированных с орфанной моногенной патологией, лежащей в основе семейных форм врожденных пороков сердца. Мутации выявляют путем определения полной нуклеотидной последовательности кодирующей части генов NKX2.5, CFC1, GATA4. Осуществляют амплификацию кодирующей части генов NKX2.5, CFC1, GATA4 с помощью 15 пар синтетических олигонуклеотидов при одной температуре и времени отжига с последующим секвенированием полученных продуктов амплификации с помощью одной пары универсальных праймеров. Предложенное изобретение позволяет чувствительно и специфично определять мутации генов NKX2.5, CFC1, GATA4, при этом сокращаются время реакции амплификации, количество манипуляций, время внесения реактивов для реакции секвенирования и снижается вероятность ошибки при постановке реакции. 2 з.п. ф-лы, 1 ил., 4 табл.

Изобретения относятся к области биотехнологии и касаются олигонуклеотидных праймеров и способа выявления ДНК Mycobacterium avium с их использованием. Охарактеризованные олигонуклеотидные праймеры комплементарны специфичной области mig-гена Mycobacterium avium и имеют следующий нуклеотидный состав: 5'-CGT CAA AAG CGA ACT GCA-3' и 5'-ТАА ТТС GTT GCC CGA СТС-3'. Способ выявления ДНК Mycobacterium avium выключает выделение ДНК, проведение амплификации ДНК с использованием олигонуклеотидных праймеров, перенос продукта амплификации на гель с последующим детектированием результатов анализа на трансиллюминаторе. В случае положительной реакции синтезируется фрагмент, соответствующий размеру 157 п.н. Представленные изобретения могут использоваться в ветеринарных диагностических и научно-практических лабораториях для выявления генетического материала Mycobacterium avium в пробах. 2 н.п. ф-лы, 1 ил., 4 пр.
Наверх