Способ выявления и генотипирования бактерии pasteurella multocida крупного рогатого скота серогрупп a, b, d, e, f в мультиплексной полимеразной цепной реакции


 


Владельцы патента RU 2551962:

Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") (RU)
Государственное научное учреждение Институт экспериментальной ветеринарии Сибири и Дальнего Востока Российской академии сельскохозяйственных наук (ГНУ ИЭВСиДВ Россельхозакадемии) (RU)

Изобретение относится к области биотехнологии и касается способа выявления и генотипирования бактерии Pasteurella multocida. Предложенный способ включает проведение ПЦР с электрофоретической детекцией результатов, перенос продукта амплификации на гель и оценку проведения реакции. При этом исследование каждой пробы проводят в двух реакциях с помощью праймеров. В первой реакции выявляют бактерию Pasteurella multocida и генотипируют серогруппы А и D, во второй реакции генотипируют серогруппы В, Ε и F. Способ позволяет выявлять и генотипировать штаммы и изоляты бактерии Pasteurella multocida пяти серогрупп - A, B, D, E, и F в чистых или смешанных культурах, а также непосредственно в пробах биологического материала от животных. Способ может быть использован в ветеринарной микробиологии для диагностики пастереллеза сельскохозяйственных животных. 4 табл., 4 пр.

 

Изобретение относится к биотехнологии, в частности к генетической инженерии, и может быть использовано в ветеринарной практике для диагностики пастереллеза сельскохозяйственных животных, а также для решения научно-исследовательских задач по изучению эпизоотологии пастереллеза, оценке эффективности профилактических или лечебных мероприятий.

Pasteurella multocida - условно-патогенная грамотрицательная бактерия, постоянно обитающая на слизистой оболочки верхних дыхательных путей животных и птиц. На основании строения капсульного антигена все штаммы бактерии делятся на 5 серогрупп.

Штаммы серогруппы А и D вызывают пневмонии у крупного рогатого скота, овец, свиней.

Штаммы бактерий серогрупп В и Ε - возбудители геморрагической септицемии крупного рогатого скота и буйволов, характеризующейся острой септицемией с высокой летальностью. Болезнь распространена в Азии, Африке и на ближнем Востоке. В Азии основным ее этиологическим агентом считается серовариант В2, в Африке - Е2. Различные сероварианты группы В выделяли от диких и домашних жвачных при септических состояниях в Европе, Северной и Южной Америке и на территории бывшего СССР.

Штаммы серогруппы F выделяли при пневмонии и перитоните у телят (Griffin, D. Bovine Pasteurellosis and Other Bacterial Infections of the Respiratory Tract / D. Griffin // Vet. Clin. Food. Anim. - 2010. №26. - P. 57-71.).

До настоящего времени за рубежом для типизации штаммов и изолятов P. multocida применяются серологические методы, основанные на реакции непрямой гемагглютинации или встречного иммуноэлектрофореза с использованием типоспецифических гипериммунных сывороток (Chengappa, М.М. Identification of type D Pasteurella multocida by counter immunoelectrophoresis. / M.M. Chengappa, G.R. Carter, W.E. Bailie // J. Clin. Microbiol. - 1986. - 24(5). - P. 721-723.).

К их недостаткам следует отнести необходимость получения чистых культур. Кроме этого в процессе культивирования P. multocida на питательных средах могут возникать спонтанные мутации, приводящие к появлению безкапсульных вариантов бактерии, что приводит к невозможности их типирования по данному способу.

В нашей стране нашли применение методы несерологического типирования. Так, для типирования P. multocida серогруппы А применяется тест на выявление гиалуроновой кислоты в капсуле бактерии, а серогруппы D - акрифлавиновая проба. Нетипируемые этими методами штаммы и изоляты относят к серогруппе В (Методические указания по лабораторной диагностике пастереллезов животных и птиц. Утверждены Главным управлением ветеринарии министерства сельского хозяйства РФ №22-7/82 от 20.08.1992 г.).

К недостаткам данного способа относятся необходимость получения чистых культур P. multocida, невозможность типирования бескапсульных вариантов бактерии, а также серогрупп Ε и F, низкая специфичность.

Близкими аналогами являются способы, основанные на выявлении фрагментов генов бактерии методом ПЦР, в частности идентификация бактерии Pasteurella multocida на основе генов, регулирующих транскрипцию (Liu, D. Specific PCR identification of Pasteurella multocida based on putative transcriptional regulator genes / D. Liu, M.L. Lawrence, F.W. Austi // Journal of Microbiological Methods. - 2004. - Vol. 58. - P. 263-267), и серогруппы A по гену, отвечающему за синтез гиалуроновой кислоты (Gautam R. Specific identification of Pasteurella multocida serogroup-A isolates by PCR assay / R. Gautam, A.A. Kumar, V.P. Singh, Vijendra P. Singh, Т.K. Dutta, S.B. Shivachandra // Res. in Vet. Science. - 2004. - Vol. 76. - P. 179-185.). Данные способы могут выявлять только вид или серогруппу A Pasteurella multocida.

Наиболее приемлемым, с точки зрения описанных недостатков и принятым за прототип, является способ, основанный на мультиплексной ПНР для типирования капсульных групп А, В, D, Е, F при помощи специфических праймеров: CAPA-F 5′- TGCCAAAATCGCAGTCAG- 3′, CAPA-R 5′- TTGCCATCATTGTCAGTG- 3′, CAPB-F 5′- CATTTATCCAAGCTCCACC- 3′, CAPB-R 5′- GCCCGAGAGTTTCAATCC- 3′, CAPD-F 5′- TTACAAAAGAAAGACTAGGAGCCC- 3′, CAPD-R 5′- CATCTACCCACTCAACCATATCAG- 3′, CAPE-F 5′- TCCGCAGAAAATTATTGACTC- 3′, CAPE-R 5′- GCTTGCTTGATTTTGTC- 3′, CAPF-F 5′- AATCGGAGAACGCAGAAATCA- 3′, CAPF-R 5′- TTCCGCCGTCAATTACTCTG- 3′ (Arumugam, N.D., Ajam, Ν., Blackall, P.J., Asiah, N.M., Ramlan, M., Maria, J., Yuslan, S. and Thong, K.L. Capsular serotyping of Pasteurella multocida from various animal hosts - a comparison of phenotypic and genotypic methods // Tropical Biomedicine. - 2011. - Vol. 28(1). - P.55-63).

Способ используется в качестве быстрого альтернативного метода типирования и, в отличие от серологических методов, позволяет определять принадлежность к серогруппе бескапсульных вариантов бактерии. Недостатком способа является отсутствие видоспецифичных для Pasteurella multocida праймеров, низкая чувствительность и он предназначен только для типирования чистых культур.

Задачей изобретения является разработка высокоспецифичного и чувствительного способа на основе мультиплексной полимеразной цепной реакции (ПЦР), позволяющего одновременно выявлять и генотипировать штаммы и изоляты бактерии Pasteurella multocida пяти серогрупп крупного рогатого скота в пробах патологического материала от больных животных, смешанных и чистых бактериальных культурах.

Поставленная задача решается тем, что в способе выявления и генотипирования бактерии Pasteurella multocida крупного рогатого скота серогрупп А, В, D, Е, F в мультиплексной полимеразной цепной реакции, включающем исследование каждой пробы в двух реакциях методом ПНР в мультиплексном варианте с электрофоретической детекцией результатов, согласно изобретения, используют специфические олигонуклеотидные праймеры комплементарные консервативному участку cap locus генома бактерии, выявление вида Pasteurella multocida осуществляют путем амплификации участка локуса с помощью праймеров SEQ ID NO:1/SEQ ID NO:2 на основе образования ампликона размером 211 п.н., генотипирование серогрупп: серогруппы А путем амплификации участка локуса с помощью праймеров SEQ ID NO:3/SEQ ID NO:4 и образования ампликона длиной 564 п.н., серогруппы D путем амплификации участка локуса с помощью праймеров SEQ ID NO:5/SEQ ID NO:6 и образования ампликона длиной 355 п.н., серогруппы В путем амплификации участка локуса с помощью праймеров SEQ ID NO:7/SEQ ID NO:8 и образования ампликона длиной 167 п.н., серогруппы Ε путем амплификации участка локуса с помощью праймеров SEQ ID NO:9/SEQ ID NO:10 и образования ампликона длиной 357 п.н., серогруппы F путем амплификации участка локуса с помощью праймеров SEQ ID NO:11/SEQ ID NO:12 и образования ампликона длиной 257 п.н., в первой реакции выявляют вид Pasteurella multocida и генотипируют серогруппы А и D, во второй реакции генотипируют группы В, Е, F. Изобретение иллюстрируется следующими примерами.

Пример 1. Получение синтетических олигонуклеотидных праймеров

На начальном этапе проводят анализ нуклеотидных последовательностей геномов серотипов А, В, D, Е, F бактерии P. multocida из базы данных NCBI (http://www.ncbi.nlm.nih.gov/) и определяют наиболее консервативные участки.

Таким образом для идентификации бактерии Р. multocida и генотипирования серогрупп методом ПЦР подбирают синтетические олигонуклеотидные праймеры, комплементарные консервативному участку cap locus, представленные в таблице 1. Анализ свойств олигонуклеотидных праймеров проводят с использованием программы Vector NTI 9.0.0 (InforMax).

Пример 2. Выявления и генотипирования бактерии Pasteurella multocida серогрупп А, В, D, Е, F при помощи специфических олигонуклеотидных праймеров в пробах патологического материала и культурах бактерий

Способ осуществляется в несколько этапов.

Этап 1. Подготовка проб патологического материала и бактериальных культур для исследования

Для исследования от павших или вынужденно убитых животных с признаками бронхопневмонии отбирают пробы внутренних органов (легких на границе нормального и измененного участка, бронхиальных и средостенных лимфатических узлов) не позднее 3-5 часов после гибели животного.

Пробы органов животных помещают в фарфоровые ступки, растирают с песком и разводят физиологическим раствором в соотношении 1/5-1/10, затем центрифугируют и надосадочную жидкость используют для выделения ДНК.

Бактериальные культуры инкубируют в термостате при температуре 37°С в атмосфере 5% СО2 на мясопептонный агар с добавлением 5% дефибрированной крови барана.

Через 24-48 часов инкубации просматривают чашки Петри с агаром на наличие типичных для пастерелл колоний (прозрачных, диаметром до 3 мм, округлых с ровными краями, слизистой консистенции, серого цвета, без гемолиза). Из этих колоний делают мазки на стекле и окрашивают их по Граму для предварительного типирования. При обнаружении в мазке грамотрицательных кокобактерий колонию отбирают для исследования в ПЦР.

Для этого отдельные колонии, не смешивая, снимают с поверхности агара, переносят в отдельные стерильные стеклянные пробирки, содержащие 200 мкл стерильной дистиллированной воды, перемешивают на вортексе. Взвесь бактерий разводят стерильной дистиллированной водой до концентрации 109 КОЕ/мл и используют для выделения ДНК.

Этап 2. Выделение ДНК из проб биоматериала или взвеси бактерий

Выделение ДНК проводят любым доступным способом, включающим лизис клеток, депротеинизацию лизата, осаждением ДНК из раствора, отмывку спиртами, высушивание и растворение ДНК в буферном растворе.

Этап 3. Постановка мультиплексной ПЦР для выявления и генотипирования бактерии Pasteurella multocida серогрупп А, В, D, Е, F

Полимеразная цепная реакция. Состав реакционной смеси: ПЦР-буфер (60 мM Tris-HCl [рН 8.5], 1,5 мМ MgCl2, 25 мM KCl, 10 мМ 2-меркаптэтанола, 0,1% Тритон Х-100), 0,2 мМ dNTP, по 0,2 мкг каждого праймера, 1.25 е.а. Taq-ДНК-полимеразы, 5 мкл выделенной ДНК.

Для первой реакции для приготовления реакционной смеси используют смесь праймеров SEQ ID NO: 1-6, для второй реакции - SEQ ID NO: 7-12.

Температурный режим проведения ПЦР: 95°С - 5 мин - 1 цикл; 95°С - 10 сек, 57°С - 15 сек, 72°С - 20 сек - 35 циклов; 72°С - 5 мин.

Этап 3. Определение размера продуктов ПЦР

Продукты ПЦР анализируют методом электрофореза в 2%-ном агарозном геле в стандартном трис-боратном буфере (рН 8,0) по стандартной методике.

Результаты электрофореза учитывают, просматривая гель в ультрафиолетовом свете с длиной волны 254 нм на приборе «Трансиллюминатор».

Используют маркер молекулярного веса 100 bp.

Результат ПЦР считают положительным, если продукт ПЦР соответствует размеру ампликонов, приведенных в таблице 1. Результаты генотипирования серогрупп учитывают только при выявлении вида бактерии P. multocida в первой реакции.

Таким образом, предлагаемый способ позволяет эффективно выявлять и генотипировать штаммы и изоляты бактерий P. multocida серотипов А, В, D, Е, F в пробах патологического материала от больных животных и бактериальных культурах.

Пример 3. Определение аналитической и диагностической чувствительности реакции по заявленному способу

Аналитическую чувствительность метода определяют постановкой ПЦР, где в качестве исследуемых образцов используют 10-кратные разведения положительных контрольных образцов (ΠΚΟ/P.m.-sp; ПКО/Р.m.-А, ΠΚΟ/P.m.-D, ΠΚΟ/P.m.-B, ΠΚΟ/P.m.-E и ΠΚΟ/P.m.-F), полученные путем трансформации компетентных бактериальных клеток Escherichia coli плазмидами pCR2.1, содержащими специфические ДНК вставки бактерии P. multocida.

Концентрацию плазмидной ДНК определяют с использованием набора реагентов Quant-iT dsDNA, HS (Invitrogen, США) и флуориметра QUBIT (Invitrogen, США).

Пересчет концентрации ДНК в количество копий проводят в программе-конвертере http://molbiol.ru/scripts/01_07.html по формулам:

m[g]=Q[mol] × Mwолиг[kDa] × 103

m[g]=Q[mol] × <Mw> [Da] × L[kb] × 103

N[штук]=Q[mol] × NA

c[M] × V[L]=Q[mol], где

m[g] - вес нуклеиновой кислоты;

Mwолиг [kDa] - молекулярный вес олигонуклеотида.

<Mw> [Da] - средний молекулярный вес одного/пары оснований.

base=324.5 Da

base pair=649 Da

ribo base=340.5 Da

Q [mol] - количество нукл. кислоты;

N [копий] - количество молекул нукл. кислоты;

с [М] - молярная концентрация нукл. кислоты;

V [L] - объем, в котором растворена нукл. кислота;

L [kb] - длина нукл. кислоты;

NA - Число Авогадро = 6.022045×1023 [1/моль]

За аналитическую чувствительность принимают последнее разведение ПКО, с которым результат ПЦР-анализа интерпретируется как положительный. Результаты проведенных экспериментов по оценке аналитической чувствительности метода приведены в таблице 2.

Таблица 2
Характеристика положительных контрольных образцов и аналитическая чувствительность реакции
ПКО Длина плазмидной, ДНК (п.н.) Концентрация , (мкг/мл) Количество копий ДНК , (ГЭ/мл) Аналитическая чувствительность , (ГЭ в реакции)
ПКО/P.m.-sp 4142 2,40 5,3×1011 5,3×10
ПКО/Р.m.-А 4157 1,10 2,4×1011 2,4×10
ПКО/Р.m.-В 4098 1,34 3,0×1011 3,0×10
ΠΚΟ/P.m.-D 4286 2,25 4,8×1011 4,8×10
ПКО/Р.m.-Е 3979 1,19 2,8×1011 2,8×102
ΠΚΟ/P.m.-F 3982 0,85 2,0×1011 2,0×102

Минимальное количество ДНК-матриц, выявляемых в ходе реакции, выраженное в ГЭ (геномных эквивалентах), в 30 мкл реакционной смеси составило 53 ГЭ на реакцию для бактерии P. multocida и от 24 до 280 ГЭ на реакцию для разных серогрупп бактерии.

Для определения диагностической чувствительности реакции по заявленному способу суточную культуру контрольных штаммов P. multocida «1231», «680», «Т-80», выращенных на мясопептонном агаре с добавлением 5% дефибрированной крови барана, переносят в бактериологическую пробирку, содержащую 1000 мкл стерильной дистиллированной воды или физиологического раствора, разводят до концентрации 1011 КОЕ/мл, титруют методом 10-кратных разведений до разведения 101 КОЕ/мл. Результаты определения диагностической чувствительности разработанной ПЦР представлены в таблице 3.

Таблица 3
Определение диагностической чувствительности реакции при выявлении и генотипировании P. multocida
№ п/п Серогруппа P. multocida Штамм Чувствительность, КОЕ/мл
P. multocida A В D Ε F
1 А 1231 103 103 отр отр отр отр
2 В 681 103 отр 103 отр отр отр
3 D Т-80 103 отр отр 103 отр отр

Таким образом, предлагаемый способ обладает высокой аналитической и диагностической чувствительностью, позволяет с одинаковой эффективностью выявлять и генотипировать штаммы и изоляты бактерий Р. multocida серотипов А, В, D, Е, F.

Пример 4. Определение специфичности и эффекивности реакции по заявленному способу

Для определения специфичности и эффективности реакции исследовали контрольные штаммы бактерий Mannheimia haemolytica тип A1 (штамм 16), Escherichia coli (штаммы F-50, АТСС 25922), культуры бактерий P. multocida, выделенные от больных животных, а также пробы внутренних органов телят с симптомами респираторных болезней.

Результаты опытов по определению специфичности и эффективности представлены в таблице 4.

Таблица 4

Примечание: «+» - положительный результат, «-» - отрицательный результат, «А», «В», «D» - положительный результат генотипирования в первой или второй реакции

Таким образом, предлагаемый способ обладает высокой специфичностью и эффективностью при выявлении и генотипировании бактерии Pasteurella multocida пяти серогрупп в пробах патологического материала, полученного от больных телят, культурах бактерий, выделенных на искусственных питательных средах.

Способ выявления и генотипирования бактерии Pasteurella multocida крупного рогатого скота серогрупп А, В, D, Е, F при помощи специфических олигонуклеотидных праймеров, включающий исследование каждой пробы в двух реакциях методом ПЦР в мультиплексном варианте с электрофоретической детекцией результатов, отличающийся тем, что используют специфические олигонуклеотидные праймеры, комплементарные консервативному участку cap locus генома бактерии, выявление вида Pasteurella multocida осуществляют путем амплификации участка локуса с помощью праймеров SEQ ID NO:1/SEQ ID NO:2 на основе образования ампликона размером 211 п.н.; генотипирование серогрупп: серогруппы А путем амплификации участка локуса с помощью праймеров SEQ ID NO:3/SEQ ID NO:4 и образования ампликона длиной 564 п.н.; серогруппы D путем амплификации участка локуса с помощью праймеров SEQ ID NO:5/SEQ ID NO:6 и образования ампликона длиной 355 п.н.; серогруппы В путем амплификации участка локуса с помощью праймеров SEQ ID NO:7/SEQ ID NO:8 и образования ампликона длиной 167 п.н.; серогруппы Ε путем амплификации участка локуса с помощью праймеров SEQ ID NO:9/SEQ ID NO:10 и образования ампликона длиной 357 п.н.; серогруппы F путем амплификации участка локуса с помощью праймеров SEQ ID NO:11/SEQ ID NO:12 и образования ампликона длиной 257 п.н.; в первой реакции выявляют вид Pasteurella multocida и генотипируют серогруппы А и D, во второй реакции генотипируют группы В, Е, F.



 

Похожие патенты:
Изобретение касается набора олигонуклеотидных праймеров и зондов для идентификации и субтипирования ДНК бактерии Pasteurella multocida серотипов А, B, D, E, F методом ПЦР в режиме реального времени.

Изобретение относится к биотехнологии, а именно к способу идентификации микобактерий туберкулеза кластера Beijing B0/W148. Применяют полимеразную цепную реакцию для амплификации фрагментов ДНК М.

Изобретение относится к биотехнологии, а именно к способу детекции нуклеиновокислотной последовательности-мишени из ДНК или смеси нуклеиновых кислот с использованием праймера, генерирующего сигнал от мишени (TSG-праймера).

Изобретение касается набора флуоресцентно-меченых олигонуклеотидных зондов для типирования штаммов Burkholderia mallei. Входящие в состав набора зонды имеют структуру «шпильки» с флуорофором и гасителем флуоресценции на концах и обладают комплементарностью к продуктам реакции амплификации с праймерами.

Изобретение относится к биотехнологии, а именно к набору олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации Burkholderia mallei и дифференциации его от Burkholderia pseudomallei.

Изобретение относится к биотехнологии и представляет собой ДНКазу или ее ферментативно активный фрагмент, способы удаления загрязняющей нуклеиновой кислоты из реакции обратной транскрипции, в которых используется данная ДНКаза, нуклеиновую кислоту, кодирующую указанную ДНКазу, и наборы или композиции, содержащие указанную ДНКазу.

Изобретение относится к области биотехнологии, а именно к способу воздействия на пролиферативный статус клеток. Предложенное изобретение может быть использовано в медицине в области лечения онкологических заболеваний, в иммунологии, в геронтологии и косметологии.

Изобретение относится к биотехнологии, а именно к cпособу дифференциации типичных и атипичных штаммов Yersinia pestis основного подвида средневекового биовара. Способ предусматривает проведение в двух реакционных смесях ПЦР с гибридизационно-флуоресцентным учетом результатов с использованием соответствующих олигонуклеотидных праймеров и зондов на ДНК-мишени «Med24» и «pCKF» следующего состава: праймеры прямой Med24 RealTime-S GCCAGTGTGTGTCTAAA, обратный Med24 RealTime-As CAACATTCGTCGCAAAG и зонд Med24 Zond FAM-ACATTGTGCTGGACTCACAGCCCC-BHQ1, праймеры прямой pCKF RealTime-S AACCGCCTAAGCACTTTAT, обратный pCKF RealTime-As CGTCAGGAACTCAACGAA и зонд pCKF Zond FAM-ATCAGAGAGCATTTGAGCGGTTG-BHQ1.

Группа изобретений относится к области биотехнологии и касается синтетических олигонуклеотидных праймеров и способа их использования. Предложенный способ выявления и дифференциации генома вакцинного штамма В-82 от полевых изолятов вируса миксомы кроликов включает: выделение ДНК из биологического материала, постановку мультиплексной полимеразной цепной реакции с использованием синтезированных праймеров, комплементарных участкам генов M130R и M151R вируса миксомы кролика и имеющих следующий нуклеотидный состав: амплификацию ДНК вируса и оценку проведения реакции.

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела.

Настоящее изобретение относится к биотехнологии, молекулярной медицине, в частности генной инженерии. Описаны искусственные ДНК-конструкции, демонстрирующие высокую активность транскрипционного промотора человека, с которого осуществляется экспрессия расположенной ниже произвольной нуклеотидной последовательности, транскрибируемой РНК-полимеразой II.

Изобретение относится к биотехнологии, а именно к способу детекции нуклеиновокислотной последовательности-мишени из ДНК или смеси нуклеиновых кислот с использованием праймера, генерирующего сигнал от мишени (TSG-праймера).

Изобретение относится к биохимии. Описан способ индукции апоптоза клеток злокачественной опухоли колоректального рака.

Изобретение относится к биотехнологии и представляет собой ДНКазу или ее ферментативно активный фрагмент, способы удаления загрязняющей нуклеиновой кислоты из реакции обратной транскрипции, в которых используется данная ДНКаза, нуклеиновую кислоту, кодирующую указанную ДНКазу, и наборы или композиции, содержащие указанную ДНКазу.

Изобретение относится к биотехнологии, а именно к новым IL-17-ингибирующим полипептидам, соответствующим слитым белкам, к композициям и применению их в медицинских целях.

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела.

Изобретение относится к области медицины, фтизиатрии и медицинской микробиологии и касается способа генотипирования штаммов Mycobacterium tuberculosis. Охарактеризованный способ основан на однонуклеотидном полиморфизме генов систем токсин-антитоксин II типа суперсемейств VapBC, HigAB и MazEF и характеризуется тем, что для идентификации проводят амплификацию с геномной ДНК с использованием набора олигонуклеотидных праймеров для 10 генов систем токсин-анатоксин.

Группа изобретений относится к области биотехнологии и медицины. Введение субъекту молекулы нуклеиновой кислоты при лечении волчаночного нефрита, которая способна связываться с MCP-1 и является антагонистом МСР-1, где молекула нуклеиновой кислоты содержит последовательность нуклеиновой кислоты SEQ ID NO:37 совместно с иммуносупрессивным средством, позволяет снизить дозу вводимого иммуносупрессивного средства.

Группа изобретений касается дискриминирующего мишень зонда (TD-зонду), способа его конструирования и способов детекции нуклеиновокислотной последовательности-мишени с его использованием.

Изобретение относится к области молекулярной биологии и биохимии. Предложена димерная наноструктура, способ её конструирования, способ детектирования аналита и набор для детектирования аналита.
Изобретение относится к биотехнологии и микробиологии. Питательная среда для культивирования лактобактерий содержит отвар капусты, глюкозу, кислотный гидролизат крови убойных животных, дрожжевой аутолизат и молочную сыворотку при заданном соотношении компонентов.
Наверх