Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека



Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека
Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека

 

C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2558294:

Общество с ограниченной ответственностью "НекстГен" (RU)

Изобретение относится к генной инженерии, а также к медицине, а именно к нейрохирургии и травматологии. Описана геннотерапевтическая конструкция, кодирующая эндотелиальный сосудистый фактор роста (VEGF) и фактор роста фибробластов (FGF-2). В основе геннотерапевтической конструкции, кодирующей оба фактора, используется кодон-оптимизированная рекомбинантная плазмида. Введение геннотерапевтической конструкции может осуществляться как непосредственно в поврежденный нерв, так и в параневральные ткани, как интраоперационно, так и в послеоперационном периоде. Изобретение может быть использовано для стимуляции регенерации нервов. Изобретение значительно улучшает результаты реконструктивного лечения повреждений периферических нервов. 3 н.п. ф-лы, 15 ил.

 

Предшествующий уровень техники

По разным данным, частота встречаемости повреждений периферических нервов различной этиологии составляет 3-10% [1-3]. Актуальность разработки дополнительных методов лечения, способных повысить качество стандартных, обусловлена длительностью восстановительного периода (год и более) и значительным снижением качества жизни пациентов трудоспособного возраста и высокой частотой инвалидизации. Травма периферического нерва является частой причиной потери профессии. Выбор способа восстановления целостности периферического нерва обусловлен рядом особенностей повреждения в каждом конкретном случае: механизм травмы, время, прошедшее от момента получения травмы до выполнения хирургического пособия, протяженность дефекта периферического нерва и т.д. Одним из видов реконструктивного лечения является сшивание культей пересеченного нерва за счет создания анастомоза конец-в-конец. Однако часто травма периферического нерва сопровождается образованием дефекта различной протяженности, вследствие чего такой подход невозможен. В этой ситуации "золотым стандартом" восстановления целостности нерва является использование аутонервной вставки для устранения протяженного дефекта. В качестве аутовставки может быть использован функционально менее значимый нерв. В качестве альтернативы могут быть использованы различные кондуиты, которые представляют собой тубулированные структуры, предназначение которых заключается в устранении протяженного дефекта тканей и создании благоприятных условий для регенерации периферического нерва.

Степень восстановления функции иннервируемой конечности после хирургического восстановления целостности периферического нерва зависит от множества факторов: время, прошедшее с момента травмы до операции, протяженность дефекта, расстояние от места травмы периферического нерва до иннервируемой области и т.д. Однако, несмотря на развитие техники восстановления целостности нерва, даже при самых благоприятных условиях, как правило, происходит лишь частичное восстановление функции иннервируемой конечности. Это побуждает к поиску новых методов лечения, которые позволили бы улучшить результаты стандартного реконструктивного лечения и качество жизни пациентов в целом.

Одним из таких направлений является применение факторов роста с целью индукции регенерации периферического нерва. Данная концепция появилась в результате накопления данных о значимой роли факторов роста в естественном процессе регенерации периферических нервов [4].

Одним из наиболее хорошо изученных факторов роста, влияющих на восстановление периферических нервов, является сосудистый эндотелиальный фактор роста (VEGF). VEGF является одним из основных регуляторов ангиогенеза и васкулогенеза. VEGF - это димерный 34-42 кДа дисульфид-связанный гликопротеин. VEGF-A является специфичным митогеном для эндотелиальных клеток (ЭК). VEGF индуцирует пролиферацию ЭК, их активацию, дифференцировку и формирование ими капиллярных трубочек, ремоделирующихся в дальнейшем в зрелые сосуды. Он также является мощным фактором повышения выживаемости ЭК, так как индуцирует экспрессию антиапоптозных белков. Делеции генов, кодирующих VEGF, приводят к серьезным дефектам и неправильному развитию сердечно-сосудистой системы, что несовместимо с жизнью.

Ген VEGF человека расположен в хромосомном локусе 6р21.3. Кодирующая область охватывает около 14 т.п.н. VEGF существует в нескольких изоформах: VEGF 121, VEGF 145, VEGF 148, VEGF 165, VEGF 183, VEGF 189, VEGF 206, образуемых в результате альтернативного сплайсинга мРНК, которая состоит из 8-ми экзонов. Каждой изоформе VEGF соответствует определенная внеклеточная локализация, основанная на их биохимических различиях в способности связывать гепарин- и гепаран-сульфат. Так, все транскрипты гена VEGF-A у человека содержат экзоны 1-5 и 8, различия же обусловлены альтернативным сплайсингом экзонов 6 и 7.

Долгое время после открытия VEGF фактор рассматривался лишь как индуктор ангиогенеза и потенциальный терапевтический агент для лечения различных заболеваний, сопровождающихся ишемией тканей. Однако с течением времени были получены данные о его нейропротективных свойствах в отношении как нейронов периферической нервной системы, так и центральной [5, 6]. VEGF индуцирует пролиферацию Шванновских клеток, астроцитов, микроглии, нейронов коры головного мозга [7-10]. На модели травмы с пересечением седалищного нерва у крысы было показано значительное увеличение экспрессии VEGF и Flt-1 (рецептор VEGF II типа) в спинном мозге на уровне поясничного отдела позвоночника в ответ на повреждение [11]. Таким образом, появились предпосылки для применения данного фактора роста в качестве дополнительного терапевтического компонента реконструктивного лечения повреждений периферических нервов. Применение VEGF в составе матригеля, заполняющего кондуит, индуцирует спрутинг аксонов, что проявляется увеличением количества аксонов в кондуите на единицу площади поперечного среза [12]. Использование гранул полимолочной кислоты с VEGF в графте, выполненном из аутовены, на модели травмы с протяженным дефектом малоберцового и большеберцового нервов, достоверно улучшает функциональный индекс нервов и увеличение количества миелиновых волокон в графте [13]. VEGF в эксперименте индуцирует деление и миграцию Шванновских клеток в графте в дистальном направлении, что коррелирует с увеличением количества капилляров и миелиновых волокон [14]. Введение VEGF в комбинации с BDNF в кавернозные тела, на модели травмы кавернозного нерва крысы, приводило к восстановлению утраченной иннервации и эректильной функции [15].

Другим фактором, обладающим свойствами индуктора нейрогенеза, является FGF. FGF индуцирует деление, пролиферацию и миграцию Шванновских клеток при травме периферического нерва [16]. В эксперименте на животных было показано, что блокирование рецепторов к FGF, Fgfr1 и Fgfr2, приводит к нейропатии немиелиновых сенсорных волокон и значительному снижению температурной чувствительности [17]. Применение стволовых клеток костного мозга на модели травмы периферического нерва демонстрировало увеличение экспрессии FGF, что, по мнению авторов, индуцировало миграцию и пролиферацию Шванновских клеток [18]. На модели травмы спинного мозга на уровне грудного отдела, использование FGF в составе графта, выполненного из седалищного нерва, способствовало восстановлению двигательной функции верхних конечностей [19]. Таким образом, основываясь на экспериментальных данных, можно предполагать, что использование данных факторов роста в составе комплексной терапии при реконструкции повреждений периферических нервов может быть эффективно.

Однако, как известно, применение факторов роста с терапевтической целью имеет ряд ограничений. При их введении в область повреждения они подвергаются быстрому разрушению, ввиду чего нет возможности поддержания постоянной концентрации для достижения желаемого терапевтического эффекта [20]. В связи с этим вырос интерес к применению генной терапии. По механизму трансфера гена, кодирующего терапевтический агент, можно выделить два основных направления - использование вирусных векторов и невирусных. Однако использование вирусных векторов в клинике, несмотря на высокую трансфекционную активность, ограничено ввиду опасности развития инсерционного мутагенеза, воспалительного ответа и токсичности. Более безопасным методом осуществления генного трансфера является применение плазмидной ДНК. На модели реконструкции кожно-мышечного нерва путем создания анастомоза конец-в-конец и конец-в-бок интраоперационное введение плазмиды, содержащей последовательность гена VEGF, в дистальную культю приводило к достоверному увеличению количества миелиновых волокон на единицу площади поперечного среза участка дистальнее места анастомоза, что коррелировало со значительным увеличением концентрации VEGF в Шванновских клетках [21]. Геннотерапевтическая конструкция может также вводиться параневрально. На модели травмы седалищного нерва plVEGF вводилась внутримышечно и использовалась в комбинации с пленками гиалуроновой кислоты, которыми покрывался анастомоз с целью уменьшения выраженности рубцового процесса. Внутримышечное введение препарата сопровождалось достоверным увеличением амплитуды мышечного ответа и увеличения количества миелиновых волокон дистальнее анастомоза относительно использования их по отдельности [22]. В исследовании Wang F. et al. был показан дозозависимый эффект plVEGF при введении геннотерапевтической конструкции интраневарально после сшивания культей седалищного нерва конец-в-конец. При применении большей дозировки был получен наиболее выраженный прирост нейрофизиологических показателей, меньшее снижение индекса массы икроножной мышцы [23]. Был выявлен синергизм в действии некоторых факторов. Так комбинированное применение плазмиды, кодирующей ген VEGF, и плазмиды, кодирующей ген C-CSF, на модели травмы седалищного нерва продемонстрировало более выраженное увеличение количества миелиновых волокон и капилляров в участке дистальнее анастомоза конец-в-конец, сохранение большего количества нейронов в спинномозговом ганглии, а также раннее восстановление двигательной функции [24]. Однако при использовании геннотерапевтических препаратов in vivo только часть клеток трансфицируется плазмидной ДНК. Вследствие этого шанс того, что клетка будет одновременно трансфицированна двумя разными геннотерапевтическими конструкциями, снижается. Таким образом, является целесообразным объединение генетических последовательностей двух факторов, обладающих синергизмом действия, в составе одной плазмиды. Эффективность использования данного подхода уже была продемонстрирована на животных с моделью контузионной травмы спинного мозга. В ходе данного эксперимента было показано, что на фоне прямого введения в спинной мозг 40 мкг плазмиды, содержащей гены VEGF и FGF2, определяется достоверное увеличение количества капилляров на срезах, сделанных на расстоянии 1,5 см от эпицентра травмы. Также по данным поведенческого теста определялось достоверное улучшение восстановления двигательной функции относительно животных группы сравнения, которые не получали плазмиду с генами VEGF и FGF2. На основании полученных результатов исследователями был сделан вывод, что применение данной двухкассетной плазмиды улучшает васкуляризацию спинного мозга и уменьшает площадь деструкции серого и белого вещества спинного мозга [25]. Однако данные результаты не дают никакого представления о возможной эффективности применения двухкассетной плазмиды с генами VEGF и FGF2 при повреждениях периферических нервов. Это обусловлено тем, что механизм контузионной травмы значительно отличается по патогенезу, степени тяжести от травмы, сопровождающейся невротмезисом, которая наиболее характерна для периферических нервов и преобладает в общей структуре их повреждений. Но самое главное отличие заключается в разном регенеративном потенциале спинного мозга и периферических нервов. Таким образом, необходимо определить, возможно ли применение плазмид с генами факторов роста для эффективного улучшения регенерации периферических нервов.

Перечень иллюстраций

Рис. 1. Повторный доступ. Визуализируется целостный седалищный нерв с аутонервной вставкой.

Рис. 2. Показан вид конечности до операции. По передней и заднебоковой поверхности нижней, средней и верхней трети правого плеча видны посттравматические и послеоперационные втянутые, неправильной формы рубцы.

Рис. 3. Приведен снимок, показывающий отсутствие активных движений в средних фалангах 2-5 пальцев кисти.

Рис. 4. Показано нарушение функции схвата всех пальцев кисти.

Рис. 5. Демонстрация выраженной гипотрофии мышц кисти в зоне иннервации срединного и локтевого нерва, возможность противопоставления 1 пальца только 2 пальцу.

Рис. 6. На фотографии демонстрируется введение рекомбинантной плазмиды рBud(Kan)-coVEGF-coFGF2 в реконструированный нерв (пояснения в тексте).

Рис. 7. На фотографии демонстрируется нанесение фибринового клея с целью избегания вытекания рекомбинантной плазмиды.

Рис. 8. На фотографии демонстрируется атрофия мышц кисти и предплечья.

в) изменения ногтей: гипопластическое;

г) секреторная функция (потоотделение): понижено.

Рис. 9. Захват крючок (ручка сумки).

Рис. 10. Захват в кулак.

Рис. 11. Кончиковый захват (I-III палец).

Рис. 12. Кончиковый захват (I-III палец).

Рис. 13. Кончиковый захват (I-IV палец).

Рис. 14. Приведена диаграмма, отражающая данные электромиографии по мышцам группы тенар.

Рис. 15. Данные электромиографии по мышцам группы гипотенар.

Подробное описание настоящего изобретения

Изобретение относиться к медицине, преимущественная область его применения - нейрохирургия и травматология, лечение травм периферических нервов.

Задачей настоящего изобретения является улучшение результатов реконструктивного лечения при помощи геннотерапевтической конструкции. Основным компонентом двухкассетной оптимизированной рекомбинантной плазмиды pBud(Kan)-coVEGF-coFGF2 является генетическая последовательность генов VEGF и FGF-2.

Сущность изобретения заключается в достижении заявленного технического результата, заключающегося в восстановлении двигательной и чувствительной функции поврежденного нерва при значительном сокращении сроков лечения, в том числе и на отдаленных сроках после травмы, за счет использования с целью индукции регенерации периферического нерва препарата кодон-оптимизированной рекомбинантной плазмиды pBud(Kan)-coVEGF-coFGF2, представленной на SEQ №1.

В качестве ближайшего аналога принят патент RU 3459630 С1 «Способ стимулирования нейрогенерации с помощью генетических конструкций», который описывает способ посттравматической регенерации спинного мозга крысы путем введения двухкассетной плазмиды pBud(Kan)-VEGF-FGF2. Настоящее изобретение направлено на защиту следующих объектов.

Кодон-оптимизированная рекомбинантная плазмида pBud(Kan)-coVEGF-coFGF2, содержащая гены, кодирующие VEGF и FGF2, отличающаяся последовательностью нуклеотидов, представленной SEQ №1, для регенерации периферического нерва;

Способ стимуляции регенерации периферического нерва путем введения интра-, пери- и параневрально кодон-оптимизированной рекомбинантной плазмиды pBud(Kan)-coVEGF-coFGF2, представленной последовательностью SEQ №1, интраоперационно или в послеоперационном периоде;

Способ лечения поврежденного нерва человека путем введения в поврежденный участок эффективного количества плазмиды pBud(Kan)-coVEGF-coFGF2 по п. 1.

Наша исследовательская группа, основываясь на опыте разработок геннотерапевтических препаратов, была нацелена на создание эффективного средства для лечения пациентов с повреждениями периферических нервов у человека. Для этого нами были разработаны различные геннотерапевтические конструкции, различающиеся между собой по количеству кодируемых трансгенов, по самим трансгенам, а также нуклеотидным последовательностям одних и тех же трансгенов.

Опыт применения геннотерапевтичеких конструкций с целью улучшения восстановления периферических нервов уже был представлен нами ранее [26]. При оценке эффективности применения плазмиды, кодирующей одновременно гены VEGF и FGF2, на модели травмы периферического нерва с диастазом препарат вводился непосредственно в дистальный, проксимальный конец, а также в аутонервную вставку в равном объеме в суммарной дозе 45 мкг. В качестве экспериментальных животных использовались крысы, которые были разделены на три группы: интактная, исследуемая группа, в которой использовалась геннотерапевтическая конструкция, а также группа сравнения, где вместо исследуемого препарата вводился фосфатный буферный раствор. В качестве критериев оценки динамики регенерации периферического нерва использовались нейрофизиологические показатели, такие как скорость проведения импульса и амплитуда мышечного ответа, а также данные гистологического исследования - количество миелиновых волокон и плотность капиллярной сети. На 56 сутки после введения плазмидной конструкции нейрофизиологические показатели в исследуемой группе были лучше, чем в группе сравнения, однако значительно хуже, чем у животных интактной группы. По данным гистологического исследования количество миелиновых волокон на единицу площади поперечного среза было достоверно больше в исследуемой группе, по сравнению с группой сравнения, однако, несмотря на это, эффективного восстановления функции конечности не наблюдалось. Результаты эксперимента свидетельствуют о том, что применение плазмидных конструкций, содержащих генетические последовательности факторов роста, оказывает стимулирующее влияние на регенерацию периферического нерва, однако выраженность эффекта недостаточна. По нашему мнению, это связано, в первую очередь, с недостатками самой плазмиды, используемой в представленном исследовании. С целью улучшения свойств геннотерапевтической конструкции был выполнен ряд важных изменений ее структуры. Во-первых, вектор был модифицирован: были удалены последовательности тэгов и заменен ген антибиотикоустойчивости на канамицин. Во-вторых, с целью увеличения эффективности экспрессии были использованы кодон-оптимизированные последовательности кДНК генов VEGF и FGF2 (SEQ №1). После этого нами вновь был проведен ряд экспериментальных исследований на модели травмы периферического нерва с применением кодон-оптимизированной плазмиды. Геннотерапевтические конструкции вводились интраневрально непосредственно после восстановления целостности периферического нерва. Результаты оценивались спустя 60 суток после проведения оперативного вмешательства и введения препарата (Рис. 1).

Из всех плазмидных ДНК, используемых нами, наилучшие результаты показала кодон-оптимизированная двухкассетная плазмида, содержащая генетические последовательности FGF-2 и VEGF.

Основываясь на доклинических данных об эффективности применения геннотерапевтических конструкций pBud(Kan)-VEGF-FGF2 с целью улучшения регенерации периферического нерва, нами был инициировано клиническое исследование, результаты которого представлены ниже.

Пациент Б., 1985 г.р., поступил в травмцентр РКБ МЗ РТ 04.04.11 г. с диагнозом: последствия повреждения срединного и локтевого нерва в средней трети правого плеча (Рис. 2).

Из анамнеза: в 2009 году пациент порезал стеклом плечо на уровне средней трети, при этом были повреждены срединный и локтевой нервы. Незамедлительно был выполнен прямой шов срединного и локтевого нервов, однако в ближайший послеоперационный период как двигательная, так и чувствительная функции полностью отсутствовали. Курс реабилитационной терапии видимых результатов не дал. Далее, спустя 7 месяцев, в 2010 году, в связи с отсутствием положительной динамики восстановления двигательной и чувствительной функций, был выполнен невролиз срединного и локтевого нервов. Наблюдение в послеоперационном периоде показало слабую динамику регенерации, а именно полное отсутствие чувствительности, однако наблюдалось появление двигательной функции, которая характеризовалась незначительным сгибанием пальцев и кисти, в связи с чем было решено выполнить оперативное лечение.

До операции, 21.04.2011 г., пациенту было проведено обследование со следующими результатами:

Трофические нарушения:

а) состояние кожных покровов: окраска обычная, температура пальцев снижена, повышенная зябкость;

б) атрофия мышц кисти и предплечья по сравнению со здоровой рукой: выраженная степень - больше 2 см (рис. 2-3);

в) изменение ногтей: гипопластическое;

г) секреторная функция (потоотделение): понижено.

Исследование двигательной функции

Исследование чувствительности у пациента в автономной зоне иннервации нерва:

Виды захватов кисти: все виды захватов кисти отсутствуют (рис. 3-4).

Диагноз: Повреждение срединного и локтевого нервов в средней трети плеча 2-летней давности. Состояние после шва и невролиза срединного и локтевого нервов (Рис. 5).

26.04.11 произведена операция: невролиз срединного и локтевого нервов с интраневральным введением плазмидной ДНК, кодирующей сосудистый эндотелиальный фактор роста (VEGF) и фактор роста фибробластов-2 (FGF2).

Ход операции: Под проводниковой анестезией, после трехкратной обработки операционного поля, произведен дугообразный разрез по внутренней поверхности правого плеча. С техническими трудностями выделены срединный и локтевой нервы. Найдены линии швов. Признаков невромы не обнаружено, однако нервы вовлечены в рубцовый процесс и спаяны с окружающей тканью. Инсулиновой иглой произведено интраневральное введение рекомбинантной плазмиды, содержащей VEGF и FGF-2 по 250 микрограмм в каждый нерв в физиологическом растворе, объемом 2,5 мл. Инъекция осуществлена в зону швов, а также проксимально и дистально на протяжении 10 см (рис. 6). После чего на выделенные нервы нанесен двухкомпонентный фибриновый клей «Тиссукол» объемом 2 мл (Рис. 7). Гемостаз. Ушивание раны. Установлены резиновые выпускники. Асептическая повязка. Наложена гипсовая лонгета. Через месяц после операции пациенту проведено повторное обследование.

Данные объективного исследования 25.05.2011 г.:

Трофические нарушения:

а) состояние кожных покровов: окраска обычная;

б) атрофия мышц кисти и предплечья по сравнению со здоровой рукой в см - выраженная степень - больше 2 см (рис.8);

в) изменения ногтей: гипопластическое;

г) секреторная функция (потоотделение): понижено.

Исследование чувствительности пациента в автономной зоне инерции нерва:

Исследование двигательной функции

Виды захватов кисти: все виды захватов кисти отсутствуют.

Через 6 месяцев после операции пациенту проведено очередное обследование. Данные объективного исследования 15.11.2012 г.:

Трофические нарушения:

а) состояние кожных покровов: окраска обычная;

б) атрофия мышц кисти и предплечья по сравнению со здоровой рукой в см - средней степени 1-2 см выраженная степень - больше 2 см;

в) изменения ногтей: соответствует норме;

г) секреторная функция (потоотделение): нормальное.

Исследование чувствительности пациента в автономной зоне иннервации нерва:

Исследование двигательной функции

Виды захватов кисти:

1) цилиндрический захват - ДА

2) сферический захват - ДА

3) захват крючок (ручка сумки) - ДА

4) захват в кулак - ДА

5) кончиковый захват

а) терминальная оппозиция - ДА,

б) (субтерминальная опозиция - Нет)

6) боковой захват

а) ключевой захват - Нет,

б) (ножничный захват - «сигарета») - Нет.

Через 1 год после операции пациенту проведено очередное обследование. Данные объективного исследования 20.04.2012 г.:

Трофические нарушения:

а) состояние кожных покровов: окраска обычная;

б) атрофия мышц кисти и предплечья по сравнению со здоровой рукой в см - средняя степень 1-2 см;

в) изменения ногтей: соответствует норме;

г) секреторная функция: соответствует норме.

Исследование чувствительности пациента в автономной зоне иннервации нерва:

Исследование двигательной функции

Виды захватов кисти:

1) цилиндрический захват - ДА

2) сферический захват - ДА

3) захват крючок - ДА (рис. 9)

4) захват в кулак - ДА (рис. 10)

5) кончиковый захват: (рис. 11-13)

а) терминальная оппозиция - ДА,

б) субтерминальная опозиция - ДА

6) боковой захват

а) ключевой захват - ДА,

б) ножничный захват - ДА.

Таким образом, результаты клинического исследования свидетельствуют о том, что функция конечности значимо улучшилась спустя год после проведения процедуры интраневрального введения геннотерапевтической конструкции. Улучшение функционального состояния конечности выражалось в снижении выраженности трофических нарушений, появлении всех видов чувствительности в зоне иннервации срединного и локтевого нервов, а также достоверном улучшении двигательной функции. По представленным результатам электромиографии амплитуда мышечного ответа группы мышц тенара в течение 1 года возросла с 0 мВ до 5 мВ и практически достигла показателя на контрлатеральной конечности (рис. 14 и 15).

Эффективность применения двухкассетной плазмиды обусловлена возможностью проведения одновременного трансфера двух генов, VEGF и FGF2, что позволяет эффективнее индуцировать регенерацию периферического нерва. Изменения, внесенные в структуру кодон-оптимизированной плазмиды, позволяют значительно увеличить экспрессию кодируемых генов, благодаря чему создается необходимая терапевтическая концентрация данных факторов роста в эпицентре травмы, что позволяет увеличить эффективность восстановления периферического нерва. Таким образом, мы предполагаем, что достигнутый клинический эффект при применении плазмиды pBud(Kan)-coVEGF-coFGF2 был достигнут благодаря комбинации этих двух факторов и оптимизации их кодонной последовательности.

К сожалению, на данном этапе мы не можем достоверно определить механизм индуцирования регенерации периферического нерва посредством вышеописанной геннотерапевтической конструкции, для этого нам необходимо проведение дальнейших исследований. Однако эффективность применения их с целью улучшения результатов оперативного лечения травм периферических нервов была выявлена и продемонстрирована в условиях эксперимента и клинического наблюдения.

Список ссылочной литературы

1. Hudso, A.R. Timing of peripheral nerve repair: important local and neuropathological factors / A.R. Hudson // Clinical Neurosurgery. - 1977. - Vol. 24. - C. 391-405.

2. Deitch, E.A. Experience with 112 shotgun wounds of the extremities/ E.A. Deitch, W.R. Grimes // J Trauma. - 1984. - Vol. 24. - P. 600-603.

3. Analysis of upper and lower extremity peripheral nerve injuries in a population of patients with multiple injuries / C.A. Munro // J. Trauma. - 1998. - Vol. 45. - P. 116-122.

4. Terenghi, G. Peripheral nerve regeneration and neurotrophic factors / G. Terenghi // J. Anat. - 1999. - Vol. 194. - P.

5. Vascular endothelial growthfactor has neurotrophic activity and stimulates axonal outgrowth, enhancing cell survival and Schwann cell proliferation in the peripheral nervous system / M. Sondell, M. Kanje. G. Lundborg // J Neurosci. - 1999. - Vol. 19, №14 - P. 5731-40.

6. VEGF-A165b is an endogenous neuroprotective splice isoform of vascular endothelial growth factor A in vivo and in vitro / N. Beazley-Long [et al.] // J Pathol. - 2013. - Vol. 183, №3 - P. 918-29.

7. Sondell, M. Vascular endothelial growth factor stimulates Schwann cell invasion and neovascularisation of acelular nerve grafts / M. Sondell, G. Lundborg, M. Kanje // Brain Res. - 1999. - Vol. 846 - P. 219-228.

8. Vascular, glial and neuronal effects of vascular endothelial growth factor in mesencephalic expiants cultures / W.F. Silverman [et al.] // Neuroscience. - 1999. - Vol. 90 - P. 1529-1541.

9. Forstreuter, F. Vascular endothelial growth factor induces chemotaxis and proliferation of microglial cells / F. Forstreuter, R. Lucius, R. Mentlein // J. Neuroimmunol. - 2002. - Vol. 132 - P. 93-98.

10. Zhu, Y. Vascular endothelial growth factor promotes proliferation of cortical neuron precursors by regulating E2F expression / Y. Zhu [et al.] // J FASEB. - 2003. Vol. 17 - P. 186-193.

11. Induction of VEGF and its Flt-1 receptor after sciatic nerve crush injury / R.R. Islamov [et al.] // Neuroreport. - 2004. Vol. 15, №13 - P. 2117-21.

12. Effects of vascular endothelial growth factor on nerve regeneration in acellular nerve grafts / J.M. Rovak [et al.] // J Reconstr Microsurg. - 2004. Vol. 20, №1 - P. 53-58.

13. Vascular endothelial growth factor-loaded poly (lactic-co-glycolic acid) microspheres-induced lateral axonal sprouting into the vein graft bridging two healthy nerves: nerve graft préfabrication using controlled release system / H. Karagoz [et al.] // J Microsurgery. - 2012. Vol. 32, №8 - P. 635-41.

14. Sondell, M. Vascular endothelial growth factor stimulates Schwann cell invasion and neovascularization of acellular nerve grafts // M. Sondell, G. Lundborg, M. Kanje // Brain Res. - 1999. Vol. 846, №2 - P. 219-28.

15. The effect of vascular endothelial growth factor and brain-derived neurotrophic factor on cavernosal nerve regeneration in a nerve-crush rat model / PS. Hsieh [et al.] // BJU Int. - 2003. Vol. 92, №4 - P. 470-5.

16. Grothe, C. Physiological function and putative therapeutic impact of the FGF-2 system in peripheral nerve regeneration-lessons from in vivo studies in mice and rats / K. Haastert, J. Jungnickel, C. Grothe // Brain Res Rev. - 2006. Vol. 51 - P. 293-299.

17. Furushol, M. Disruption of Fibroblast growth factor receptor signaling in non-myelinating Schwann cells causes sensory axonal neuropathy and impairment of thermal pain sensitivity / М. Furushol [et al.] // J Neurosci. - 2009. Vol. 29, №6 - P. 1608-1614.

18. Tulio, V.R. Bone marrow-derived fibroblast growth factor-2 induces glial cell proliferation in the regenerating peripheral nervous system / V.R. Tulio [et al.] // Molecular Neurodegeneration. - 2012. Vol. 7, №34 - P. 1-17.

19. Sciatic nerve grafting and inoculation of FGF-2 promotes improvement of motor behavior and fiber regrowth in rats with spinal cord transaction / F.P. Guzen, [et al.] // Restorative Neurology and Neuroscience. - 2012. Vol. 30 - P. 265-275.

20. Zeng, W. Ionically cross-linked chitosan microspheres for controlled release of bioactive nerve growth factor / W. Zeng [et al.] // Int J Pharm. - 2011. Vol. 421 - P. 283-290.

21. Enhancement of musculocutaneous nerve reinnervation after vascular endothelial growthfactor (VEGF) gene therapy / P. Haninec [et al.] // BMC Neuroscience. - 2012. Vol. 13, № 57 - P.

22. Effect of VEGF gene therapy and hyaluronic acid film sheath on peripheral nerve regeneration / F. Zor [et al.] // - 2014. Vol. 34, №3 - P. 209-16.

23. Favorable effect of local VEGF gene injection on axonal regeneration in the rat sciatic nerve / C. Fu [et al.] // J Huazhong University Scince Technology. - 2007. Vol. 2 - P. 186-9.

24. Double gene therapy with granulocyte colony-stimulating factor and vascular endothelial growth factor acts synergistically to improve nerve regeneration and functional outcome after sciatic nerve injury in mice / F. Pereira Lopes [et al.] // Neuroscience. - 2013. Vol. 230 - P. 184-97.

25. Пат. 2459630 РФ, МПК A61K 48/00, A61P 25/28, C12N 15/79, C1. Способ стимулирования нейрогенерации с помощью генетических конструкций / Ю.А. Челышев; Федеральное государственное автономное образовательное Учреждение высшего профессионального образования "Казанский (Приволжский) Федеральный Университет". - №2011116853/10; 27.04.2011; опубл. 27.10.2009, Бюл. №30. - 11 с.

26. Стимуляция посттравматической регенерации седалищного нерва крысы с помощью плазмиды, экспрессирующей сосудистый эндотелиальный фактор роста и основной фактор роста фибробластов. / Р.Ф. Масгутов [и др.] // Клеточные технологии и тканевая инженерия. - 2011. - 6(3): 67-70.

Последовательность двухкассетной плазмиды pBud(Kan)-coVEGF165-coFGF2 SEQ №1:

<110> ООО «НекстГен», OOO «NextGen»

<120> Кодон-оптимизированная рекомбинантная плазмида, способ стимуляции регенерации периферического нерва, способ лечения поврежденного нерва человека

<160> 1

<170> PatentIn version 3.5

<211> 5701

<212> DNA

<213> Artificial Sequence

<223> expression plasmid

gcgcgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattag 60
ttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggct 120
gaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgc 180
caatagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttgg 240
cagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaat 300
ggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtaca 360
tctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggc 420
gtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatggga 480
gtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccat 540
tgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggc 600
taactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggaga 660
cccaagcttacaagtttgtacaaaaaagcaggctcaccatggcagccgggagcatcacca 720
cgctgcccgccttgcccgaggatggcggcagcggcgccttcccgcccggccacttcaagg 780
accccaagcggctgtactgcaaaaacgggggcttcttcctgcgcatccaccccgacggcc 840
gagttgacggggtccgggagaagagcgaccctcacatcaagctacaacttcaagcagaag 900
agagaggagttgtgtctatcaaaggagtgtgtgctaaccgttacctggctatgaaggaag 960
atggaagattactggcttctaaatgtgttacggatgagtgtttcttttttgaacgattgg 1020
aatctaataactacaatacttaccggtcaaggaaatacaccagttggtatgtggcactga 1080
aacgaactgggcagtataaacttggatccaaaacaggacctgggcagaaagctatacttt 1140
ttcttccaatgtctgctaagagctgaacccagctttcttgtacaaagtggtgtttgatcc 1200
ccgggaattcagacatgataagatacattgatgagtttggacaaaccacaactagaatgc 1260
agtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccatta 1320
taagctgcaataaacaagttggggtgggcgaagaactccagcatgagatccccgcgctgg 1380
aggatcatccagccggcgtcccggaaaacgattccgaagcccaacctttcatagaaggcg 1440
gcggtggaatcgaaatctcgtagcacgtggtctgacgctcagtggaacgacgcgtaactc 1500
acgttaagggattttggtcatgagcttgcgccgtcccgtcaagtcagcgtaatgctctgc 1560
cagtgttacaaccaattaaccaattctgattagaaaaactcatcgagcatcaaatgaaac 1620
tgcaatttattcatatcaggattatcaataccatatttttgaaaaagccgtttctgtaat 1680
gaaggagaaaactcaccgaggcagttccataggatggcaagatcctggtatcggtctgcg 1740
attccgactcgtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggtta 1800
tcaagtgagaaatcaccatgagtgacgactgaatccggtgagaatggcaaaagtttatgc 1860
atttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaatcactcgca 1920
tcaaccaaaccgttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgctg 1980
ttaaaaggacaattacaaacaggaatcgaatgcaaccggcgcaggaacactgccagcgca 2040
tcaacaatattttcacctgaatcaggatattcttctaatacctggaatgctgtttttccg 2100
gggatcgcagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtc 2160
ggaagaggcataaattccgtcagccagtttagtctgaccatctcatctgtaacatcattg 2220
gcaacgctacctttgccatgtttcagaaacaactctggcgcatcgggcttcccatacaag 2280
cgatagattgtcgcacctgattgcccgacattatcgcgagcccatttatacccatataaa 2340
tcagcatccatgttggaatttaatcgcggcctcgacgtttcccgttgaatatggctcata 2400
acaccccttgtattactgtttatgtaagcagacagttttattgttcatgatgatattatt 2460
ttatcttgtgcaatgtaacatcagagattttgagacacgggccagagctgctcgtcgagc 2520
tagcttcgtgaggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccg 2580
agaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaa 2640
actgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgt 2700
atataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacac 2760
aggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcg 2820
tgccttgaattacttccacctggctccagtacgtgattcttgatcccgagctggagccag 2880
gggcgggccttgcgctttaggagccccttcgcctcgtgcttgagttgaggcctggcctgg 2940
gcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcga 3000
taagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaaga 3060
tagtcttgtaaatgcgggccaggatctgcacactggtatttcggtttttgggcccgcggc 3120
cggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcg 3180
gccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcct 3240
cgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgc 3300
gtgagcggaaagatggccgcttcccggccctgctccagggggctcaaaatggaggacgcg 3360
gcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctc 3420
agccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagtt 3480
ctggagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtt 3540
tccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctc 3600
gttggaatttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggt 3660
tcaaagtttttttcttccatttcaggtgtcgtgaacacgtggtcgcggccgcaagcttca 3720
ccatgaactttctgctgtcttgggtgcattggagccttgccttgctgctctacctccacc 3780
atgccaagtggtcccaggctgcacccatggcagaaggaggagggcagaatcatcacgaag 3840
tggtgaagttcatggatgtctatcagcgcagctactgccatccaatcgagaccctggtgg 3900
acatcttccaggagtaccctgatgagatcgagtacatcttcaagccatcctgtgtgcccc 3960
tgatgcgatgcgggggctgctgcaatgacgagggcctggagtgtgtgcccactgaggagt 4020
ccaacatcaccatgcagattatgcggatcaaacctcaccaaggccagcacataggagaga 4080
tgagcttcctacagcacaacaaatgtgaatgcagaccaaagaaagatagagcaagacaag 4140
aaaatccctgtgggccttgctcagagcggagaaagcatttgtttgtacaagatccgcaga 4200
cgtgtaaatgttcctgcaaaaacacagactcgcgttgcaaggcgaggcagcttgagttaa 4260
acgaacgtacttgcagatgtgacaagccgaggcggtgatctagagtttaaacccgctgat 4320
cagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgcctt 4380
ccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcat 4440
cgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagg 4500
gggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctg 4560
aggcggaaagaaccagtggcggtaatacggttatccacagaatcaggggataacgcagga 4620
aagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctg 4680
gcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcag 4740
aggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctc 4800
gtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcg 4860
ggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgtt 4920
cgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatcc 4980
ggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcc 5040
actggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtgg 5100
tggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagcca 5160
gttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagc 5220
ggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagat 5280
cctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggatt 5340
ttggtcatgacattaacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgt 5400
ttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgt 5460
ctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcggg 5520
tgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatata 5580
tgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgc 5640
cattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgcc 5700
a

Основные элементы вектора:

Ген устойчивости к канамицину- 1469-2511

кДНК гена FGF2 (оптимизированная по кодонному составу) - 699-1166

кДНК гена VEGF165 (оптимизированная по кодонному составу) - 3723-4297

Последовательность Козак - 695-698 и 3719-3722.

1. Кодон-оптимизированная рекомбинантная плазмида pBud(Kan)-coVEGF-coFGF2, содержащая гены, кодирующие VEGF и FGF2, отличающаяся последовательностью нуклеотидов, представленной SEQ №1, для регенерации периферического нерва.

2. Способ индукции регенерации периферического нерва путем введения интра-, пери- и параневрально кодон-оптимизированной рекомбинантной плазмиды pBud(Kan)-coVEGF-coFGF2, представленной последовательностью SEQ №1, интраоперационно или в послеоперационном периоде.

3. Способ лечения поврежденного нерва человека путем введения в поврежденный участок эффективного количества плазмиды pBud(Kan)-coVEGF-coFGF2 по п. 1.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к способам получения растения с повышенной устойчивостью к засухе и действию солей по сравнению с диким видом растения путем снижения экспрессии/функции белка-фактора транскрипции у растения.

Изобретение относится к области биохимии, в частности к кодон-оптимизированным последовательностям ДНК. Заявлены кодон-оптимизированные кДНК, кодирующие фактор стромальных клеток 1 альфа и сосудистый эндотелиальный фактор роста изоформы 165, а также содержащая их рекомбинантная плазмида.

Изобретение относится к области молекулярной биологии и может быть использовано в диагностике кардиомиопатий различной природы. Предложен набор синтетических олигонуклеотидов для выявления мутаций кодирующей части гена десмина (DES), ассоциированных с кардиомиопатиями.

Изобретение относится к области биохимии. Предложена конкатемерная молекула некодирующей нуклеиновой кислоты, содержащая по меньшей мере четыре одноцепочечных участка с неметилированными CG-мотивами, для модуляции активности иммунной системы человека и животного.

Изобретение относится к области биохимии, в частности к способу выявления устойчивых к пиразииамиду изолятов Mycobacterium tuberculosis, путем определения наличия мутаций в гене pncA, ассоциированных с формированием устойчивости к пиразинамиду, посредством проведения ПЦР в режиме «реального времени» с использованием HRM-анализа.

Изобретение относится к олигопептидам, содержащим последовательность NLSSAEVVV (SEQ ID NO:6), в которой одна или две аминокислоты могут быть замещены, имеющим индуцибельность цитотоксических Т-клеток, их фармацевтическим композициям и применению для изготовления противораковых вакцин.

Изобретение относится к биотехнологии и предоставляет собой способ получения полезных метаболитов с использованием бактерии семейства Enterobacteriaceae, в частности бактерии, принадлежащей к роду Escherichia, которая модифицирована таким образом, что она содержит генетическую экспрессионную систему, включающую транскрипционный аппарат, регулируемый белком типа LysR, и модифицированную таким образом, что самоиндуцируемая положительная регуляция по типу обратной связи указанной системы опосредована коиндуктором.

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела.

Изобретение относится к области биотехнологии и может быть использовано для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ММР9-1562 C>Т (rs3918242).

Изобретение относится к биохимии. Изобретение обеспечивает способ одновременной (мультиплексной) амплификации и флуоресцентного маркирования ДНК нескольких сегментов генома микобактерий туберкулезного комплекса (Mycobacterium tuberculosis, M.

Изобретение относится к области биотехнологии, конкретно к использованию антисмыслового олигонуклеотида ISIS 301012 для долгосрочного понижения уровней АроВ, и может быть использовано в медицине. Способ предусматривает введение субъекту ISIS 301012 в составе фармацевтической композиции, путем введения ISIS 301012 в фазе индукции в дозе 210 мг в неделю в течение по меньшей мере 13 недель, с последующей поддерживающей фазой, во время которой вводят ISIS 301012 в дозе 210 мг в неделю в течение такого периода времени, который является необходимым, эффективным и/или переносимым. При этом каждая индукционная доза и каждая поддерживающая доза независимо включают более двух инъекций. Изобретение позволяет ослабить побочные эффекты терапии, а именно уменьшить эритему в месте введения препарата. 13 з.п. ф-лы, 3 ил., 21 табл., 8 пр.

Настоящее изобретение относится к миметикам ПАР и способу их получения для создания новых медицинских препаратов общей формулы где Y - остаток нуклеозида, аминопроизводного алифатического соединения, флуоресцентного красителя; Z - остаток нуклеозида, (k+1)·m=1-200; X является О или S; R1 и R2 являются остатком дисахаридного нуклеозида или остаток формул где n=2-6; 2-6 или 1-4 соответственно, N=остаток нуклеозида, или -((CH2)nO)m-(P=X(OH))O-N-, где n=2-6, m=1-6, R3 представляет собой разветвитель формулы где N′- остаток дисахаридного нуклеозида, n число до 100, или остаток формул n=2-6; или n=2-6; или n=1-4 где В=аденин-9-ил, урацил-1-ил, цитозин-1-ил или гуанин-9-ил. Предложены новые миметики ПАР, сохраняющие все основные функциональные группы и расстояния между ними, необходимые для взаимодействий с белками, но модифицированные для облегчения их синтеза и увеличения стабильности. 2 н.п. ф-лы, 21 пр., 2 табл., 10 ил.

Изобретение относится к области молекулярной биологии, молекулярной генетики и клеточной биологии, в частности к применению ДНК-конструкции для индуцирования в мезенхимных стволовых клетках выраженного адаптивного ответа. Указанная генетическая конструкция включает CpG- и GC-богатую вставку транскрибируемой области рибосомного повтора человека (область от -515 до 5321 (HSU13369, GeneBank)) и вектор pBR322 в низких концентрациях (10-50 нг/мл). Изобретение позволяет повысить устойчивость МСК к действию агрессивных факторов среды. 4 ил., 3 пр.

Настоящее изобретение относится к области иммунологии. Предложен выделенный пептид, обладающий способностью индуцировать цитотоксические Т-лимфоциты (ЦТЛ) в присутствии антигенпредставляющих клеток (АПК), несущих HLA-A*2402, и представляющий собой фрагмент белка FOXM1. Также рассмотрены: выделенный полинуклеотид, кодирующий пептид по изобретению; композиция для индуцирования ЦТЛ и фармацевтическая композиция для лечения и/или профилактики рака, экспрессирующего FOXM1, и/или предупреждения его послеоперационных рецидивов, содержащие в качестве активного начала пептид по изобретению; способы индуцирования АПК и ЦТЛ; выделенная АПК со способностью индуцировать ЦТЛ; а также способ индуцирования иммунного ответа против рака, экспрессирующего FOXM1, у субъекта. Данное изобретение обеспечивает индуцирование иммунного ответа против клеток, экспрессирующих FOXM1, что может найти дальнейшее применение в терапии различных заболеваний, в том числе злокачественных, связанных с повышенной экспрессией белка FOXM1. 8 н. и 3 з.п. ф-лы, 3 ил., 2 табл.

Изобретение относится к генной инженерии, биохимии, биотехнологии и иммунологии. Описано получение синтетических генов D3S, D3E и D3D, оптимизированных для гетерологичной экспрессии в непатогенных лабораторных штаммах Escherichia coli. Указанные гены кодируют рецептор-связывающие домены III белка Ε оболочки вируса клещевого энцефалита (ВКЭ). На основе генов D3S, D3E и D3D получают рекомбинантные плазмиды pDBD2-D3S, pDBD2-D3E и pDBD2-D3D, которые кодируют бифункциональные рекомбинантные белки, различающиеся по аминокислотному составу в позициях 166, 170, 184, 211 и определяющие принадлежность к трем основным генетическим типам вируса. Изобретение также включает штаммы-продуценты химерных белков Е. coli M15 [pREP4, pDBD2-D3S], Ε. coli M15 [pREP4, pDBD2-D3E] и Ε. coli M15 [pREP4, pDBD2-D3D], а также способ иммобилизации, концентрирования и очистки полученных белков на декстрансодержащем сорбенте. Изобретение относится к рекомбинантным белкам DBD2-D3S, DBD2-D3E и DBD2-D3D, предназначенным для использования в качестве антигенов, иммобилизованных в лунках 96-луночного планшета или стрипах, в составе набора диагностических маркеров для выявления антител к ВКЭ в сыворотке крови и ликворе человека методом ИФА, а также к иммуногенной композиции, содержащей иммобилизованные на декстране рекомбинантные белки и направленной на специфическую активацию иммунитета и формирование иммунологической памяти в отношении вируса. Изобретение позволяет получать штаммы-продуценты, обеспечивающие высокий уровень продукции рекомбинантных белковых антигенов DBD2-D3S, DBD2-D3E и DBD2-D3D, с целью последующего использования для иммунопрофилактики ВКЭ, дифференциальной диагностики флавивирусных инфекций и оценки напряженности иммунитета. 7 н. и 7 з.п. ф-лы, 7 ил.

Настоящее изобретение относится к биотехнологии и представляет собой выделенный вариант субтилизина Bacillus, где указанный вариант субтилизина является зрелой формой, обладающей активностью субтилизина и содержащий замену в положениях 118 и 213, где нумерация положений соответствует аминокислотной последовательности субтилизина BPN′ В. Amyloliquefaciens с последовательностью SEQ ID NO: 1, где указанный субтилизин Bacillus представляет собой FNA, и где указанный вариант субтилизина дополнительно содержит комбинации замен. Изобретение относится также к способу очистки ткани с использованием указанного варианта субтилизина. Изобретение позволяет получать варианты субтилизина с увеличенным уровнем экспрессии белка. 5 н.п. ф-лы, 5 ил., 4 табл. 4 пр.

Изобретение относится к биотехнологии и представляет собой дипептид-продуцирующую бактерию рода Escherichia, которая модифицирована таким образом, что она содержит ДНК, кодирующую белок с дипептид-синтезирующей активностью. Изобретение относится также к способу получения дипептида или его соли с использованием такой бактерии или с использованием белка с дипептид-синтезирующей активностью. Изобретение позволяет эффективно получать дипептиды. 3 н. и 13 з.п. ф-лы, 28 ил., 12 табл., 14 пр.

Изобретение относится к биохимии. Представлен набор олигонуклеотидных праймеров, инициирующий амплификацию полной нуклеотидной последовательности СР-гена PVY методом ОТ-ПЦР. Набор представлен следующими праймерами - «PVY-CP-f1»: 5′-СТТАТGААGТАСАССАТСААG-3′ и «PVY-CP-r2»: 5′-TACAGGAAAAGCCAAAATACT-3′. Изобретение позволяет оценить полиморфизм концевых последовательностей гена оболочечного белка данного вируса. 4 ил., 2 табл.

Изобретение относится к области биохимии, в частности к соединениям и композициям для ослабления экспрессии гентингтина. Заявлены варианты одноцепочечного модифицированного олигонуклеотида, ингибирующего экспрессию гентингтина. Олигонуклеотид содержит гэп-сегмент из десяти дезоксинуклеозидов, 5′-фланкирующий сегмент из пяти нуклеозидов и 3′-фланкирующий сегмент из пяти нуклеозидов. Гэп-сегмент расположен между 5′- и 3′-фланкирующими сегментами, где все нуклеозиды фланкирующих сегментов содержат 2′-O-метоксиэтил-модифицированный сахар. Межнуклеозидные связи в гэп-сегменте, связи, соединяющие гэп-сегмент с 5′- или 3′-фланкирующим сегментом, и связи для самого крайнего с 5′-конца и самого крайнего с 3′-конца нуклеозидов каждого из фланкирующих сегментов являются фосфоротиоатными связями; межнуклеозидные связи, соединяющие остальные нуклеозиды обоих фланкирующих сегментов, являются фосфодиэфирными связями. Все цитозины являются 5-метилцитозинами. Также заявлены композиция и способы для лечения, профилактики, замедления или облегчения болезни Гентингтона или ее симптомов. Изобретение позволяет повысить ингибирующую активность в ингибировании экспрессии гентингтина. 10 ил., 95 табл., 21 пр.

Изобретение относится к области молекулярной биологии и генетической инженерии. Предложен способ получения представляющего интерес белка, включающему введение вектора экспрессии белка, который включает генный фрагмент, содержащий ДНК, кодирующую представляющий интерес белок, и ген селектируемого маркера, а также транспозонные Tol1 или Tol2 последовательности на обоих концах генного фрагмента, в суспензионную клетку млекопитающего СНО, адаптированную к суспензионному культивированию, или клетку PER.C6, клетки крысиной миеломы YB2/3HL.Р2.G11.16Ag.20 (или также называемой YB2/0), или клетку мышиной миеломы NS0, адаптированную к суспензионному культивированию; интегрирование генного фрагмента, вставленного между парой транспозонных последовательностей, в хромосому клетки млекопитающего для получения клетки млекопитающего, способной экспрессировать представляющий интерес белок; и суспензионное культивирование клетки млекопитающего; при этом суспензионная клетка млекопитающего способна экспрессировать представляющий интерес белок, а также предложены способ получения клетки млекопитающего, соответствующая рекомбинантная клетка и применение вектора экспрессии. 6 н. и 23 з.п. ф-лы, 8 ил., 3 табл., 6 пр.
Наверх