Производные 5-пиперидин-8-цианохинолина



Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина
Производные 5-пиперидин-8-цианохинолина

Владельцы патента RU 2671496:

ЭЙСАЙ Ар ЭНД Ди МЕНЕДЖМЕНТ КО., ЛТД. (JP)

Изобретение относится к области органической химии, а именно к селективно замещенным соединениям хинолина формулы (I), в которой R8 представляет собой -Н или метил; R9 представляет собой -Н, метил или гидроксил; R10 представляет собой метил, гидроксил или NR11R12; и где R11 и R12 независимо выбирают, и где R11 представляет собой -H, метил или -СН2-С(O)CH2CH3; и R12 представляет собой -H, оксопирролидинил, диоксидотиопиранил, изопропилсульфонил, тетрагидропиранил, оксетанил, тетрагидрофуранил, диметиламинэтансульфонил, аминоэтансульфонил, диметиламинопропансульфонил, С16-алкил, который является линейным, разветвленным или циклическим, необязательно замещен метокси, -F, ≡N, метил оксетанилом, оксо-, метил имидазолилом, оксазолилом, необязательно замещенным метилом, пиразолилом, необязательно замещенным метилом или циано, C(O)R13, где R13 представляет собой C1-C7-алкил, который является циклическим, разветвленным или линейным, необязательно замещен NR13R14, где R13 и R14 независимо выбирают из метила и -Н; метокси, гидроксилом, метилтио, этилтио, метилсульфонилом, оксо-, тиазолидинилом, пиридинилом, пиразолопиридинилом, метил амино, тиазолилом, -F, морфолинилом, метилизоксазолилом, метил оксетанилом, аминооксетанилом, фенилом, необязательно замещенным гидроксилом, -C(O)NH2; пятичленным циклоалкилом, насыщенным или ненасыщенным, в котором 1 или 2 атома углерода заменены атомами азота, где циклоамин или циклодиамин необязательно замещен гидроксилом или метилом; или его фармацевтичеки приемлемой соли. Также изобретение относится к конкретным соединениям, способу лечения указанных заболеваний, способам антагонизации TLR7 и TLR8, фармацевтической композиции и фармацевтически приемлимым солям на основе соединения формулы (I). Технический результат: получены соединения, которые действуют в качестве антагониста или ингибитора для Толл-подобных рецепторов (TLR) 7 и 8 и эффективны для лечения системной красной, психоневрологической и кожной волчанки. 8 н. и 3 з.п. ф-лы, 37 ил., 5 табл.

 

УРОВЕНЬ ТЕХНИКИ

[0001] Область техники, к которой относится изобретение

[0002] Варианты осуществления раскрытия относятся к селективно замещенным соединениям хинолина и к фармацевтическим средствам, содержащим одно или более этих соединений в качестве активного ингредиента(ов). Более конкретно, варианты осуществления раскрытия относятся к тем соединениям, которые действуют в качестве антагониста или ингибитора для Толл-подобных рецепторов (TLR) 7 и 8, и к их применению в составе фармацевтической композиции, эффективной для лечения системной красной волчанки (СКВ) и волчаночного нефрита.

[0003] Описание предшествующего уровня техники

[0004] Системная красная волчанка (СКВ) и волчаночный нефрит являются аутоиммунными заболеваниями, характеризующимися воспалением и повреждением тканей. Например, СКВ может привести к повреждению кожи, печени, почек, суставов, легких, и центральной нервной системы. Страдающие СКВ могут испытывать общие симптомы, такие как крайняя усталость, болезненные и опухшие суставы, необъяснимая лихорадка, кожная сыпь и почечная дисфункция. Так как поражение органа отличается среди пациентов, симптомы могут различаться. СКВ преимущественно представляет собой болезнь молодых женщин, с пиком начала в возрасте между 15-40 годами и приблизительно в 10 раз большей распространенностью у женщин в сравнении с мужчинами.

[0005] Современные методы лечения СКВ обычно включают иммуномодулирующие препараты, такие как белимумаб, гидроксихлорохин, преднизолон, и циклофосфамид. Все эти препараты могут иметь дозоограничивающие побочные эффекты, и многие пациенты по-прежнему имеют слабо контролируемое заболевание.

КРАТКАЯ СУЩНОСТЬ ИЗОБРЕТЕНИЯ

[0006] Варианты осуществления раскрытия предоставляют соединения и способы применения для профилактики или лечения заболеваний или состояний, характеризующихся активацией Толл-подобных рецепторов 7 или 8 у пациентов. Один вариант осуществления характеризует соединение формулы (I):

[0007] Еще один вариант осуществления предоставляет соединение формулы (I):

в которой

R8 представляет собой Н или метил;

R9 представляет собой -Н, метил или гидроксил;

R10 представляет собой -H, метил, гидроксил или NR11R12; и

где R11 и R12 независимо выбирают, и где

R11 представляет собой -H, метил или -СН2-С(O)CH2CH3; и

R12 представляет собой

-H, оксопирролидинил, диоксидотиопиранил, изопропилсульфонил, тетрагидропиранил, оксетанил, тетрагидрофуранил, гидроксил, диметиламинэтансульфонил, аминоэтансульфонил, диметиламинопропансульфонил,

С16-алкил, который является линейным, разветвленным или циклическим, необязательно замещен

метокси, -F, ≡N, метил оксетанилом, этокси, оксо-, метил имидазолилом, метилтио

пиперазинилом, необязательно замещенным метилом или -CF3,

ацетамидилом, необязательно замещенным метилом или этилом,

оксазолилом, необязательно замещенным метилом,

пиразолилом, необязательно замещенным метилом, циано или гидроксилом,

C(O)R13, где

R13 представляет собой

C1-C7-алкил, который является циклическим, разветвленным или линейным, необязательно замещен

NR13R14, где R13 и R14 независимо выбирают из метила и -Н;

метокси, гидроксилом, метилтио, этилтио, метилсульфонилом, оксо-, тиазолидинилом, пиридинилом, пиразолопиридинилом, метил амино, тиазолилом, -F, морфолинилом, метилизоксазолилом, метил оксетанилом, аминооксетанилом,

фенилом, необязательно замещенным гидроксилом, -C(O)NH2;

пятичленным циклоалкилом, насыщенным или ненасыщенным, в котором 1 или 2 атома углерода заменены атомами азота, где циклоамин или циклодиамин необязательно замещен гидроксилом или метилом.

[0008] В еще одном варианте осуществления соединение представляет собой 5-((3R,5S)-3-амино-5-метилпиперидин-1-ил)хинолин-8-карбонитрил.

[0009] В еще одном варианте осуществления соединение или его фармацевтически эффективная соль соединения по предыдущим пунктам имеет IC50 меньше чем или равное 20 нМ против рецепторов TLR7 человека, экспрессируемых в клеточной линии НЕК-293. В дополнительном варианте осуществления соединение или его фармацевтически эффективная соль по предыдущему пункту настоящего раскрытия имеет IC50 меньше чем или равное 100 нМ против рецепторов TLR7 человека, экспрессируемых в клеточной линии НЕК-293. В дополнительном варианте осуществления IC50 против рецепторов TLR7 человека, экспрессируемых в клеточной линии НЕК-293, измеряется посредством (1) культивирования клеток клеточной линии НЕК-293, стабильно экспрессирующих TLR7, в модифицированной по способу Дульбекко среде Игла, содержащей 10% фетальной бычьей сыворотки при плотности 2,22×105 клеток/мл в 384-луночном планшете и инкубирования в течение 2 дней при 37°С, 5% СО2; (2) добавления соединения или его фармацевтически приемлемой соли и инкубирования клеток в течение 30 минут; (3) добавления CL097 (InvivoGen) при 3 мкг/мл и инкубирования клеток в течение приблизительно 20 часов; и (4) количественного определения NFNF-каппаB-зависимой активации гена-репортера путем измерения люминесценции.

[0010] В дополнительных вариантах осуществления раскрытия соединения имеют IC50 против рецепторов TLR7 человека, экспрессируемых в клеточной линии НЕК-293, меньше чем или равное 200 нм, меньше чем или равное 180 нм, меньше чем или равное 160 нМ, меньше чем или равное 140 нм, меньше чем или равное 120 нм, меньше чем или равное 100 нМ, меньше чем или равное 80 нМ, меньше чем или равное 60 нМ, меньше чем или равное 40 нМ или меньше чем или равное 20 нм. В дополнительных вариантах осуществления раскрытия соединения имеют IC50 против рецепторов TLR7 человека, экспрессируемых в клеточной линии НЕК-293, от 10 нМ до 30 нМ, от 10 нМ до 50 нМ, от 10 нМ до 100 нМ, от 30 нМ до 50 нМ, от 30 нМ до 100 нМ или от 50 нМ до 100 нМ. В дополнительных вариантах осуществления IC50 против рецепторов TLR7 человека, экспрессируемых в клеточной линии НЕК-293, измеряют посредством (1) культивирования клеток клеточной линии НЕК-293, стабильно экспрессирующих TLR7, в модифицированной по способу Дульбекко среде Игла, содержащей 10% фетальной бычьей сыворотки при плотности 2,22×105 клеток/мл в 384-луночном планшете и инкубирования в течение 2 дней при 37°С, 5% СО2; (2) добавления соединения или его фармацевтически приемлемой соли и инкубирования клеток в течение 30 минут; (3) добавления CL097 (InvivoGen) в концентрации 3 мкг/мл и инкубирования клеток в течение приблизительно 20 часов; и (4) количественного определения NFNF-каппаB-зависимой активации гена-репортера путем измерения люминесценции.

[0011] Дополнительные варианты осуществления предоставляют способы лечения волчанки, в том числе, но не ограничиваясь лечением системной красной волчанки, кожной волчанки, психоневрологической волчанки, блокады сердцебиения плода и антифосфолипидного синдрома, включающие введение фармацевтически эффективного количества соединения или фармацевтически приемлемой соли по раскрытию.

[0012] Дополнительные варианты осуществления предоставляют способы антагонизации TLR7, включающие введение фармацевтически эффективного количества соединения или фармацевтически приемлемой соли по раскрытию.

[0013] Дополнительные варианты осуществления предоставляют способы антагонизации TLR8, включающие введение фармацевтически эффективного количества соединения или фармацевтически приемлемой соли по раскрытию.

[0014] Дополнительные варианты осуществления предоставляют фармацевтические композиции, содержащие, по меньшей мере, одно соединение или фармацевтически приемлемую соль по раскрытию и, по меньшей мере, один фармацевтически приемлемый носитель.

[0015] Дополнительные варианты осуществления предоставляют способы лечения системной красной волчанки или волчанки, включающие введение фармацевтически эффективного количества соединения или фармацевтически приемлемой соли по раскрытию.

[0016] Дополнительные варианты осуществления предоставляют способы антагонизации TLR7, включающие введение фармацевтически эффективного количества соединения или фармацевтически приемлемой соли по раскрытию.

[0017] Дополнительные варианты осуществления предоставляют способы антагонизации TLR8, включающие введение фармацевтически эффективного количества соединения или фармацевтически приемлемой соли по раскрытию.

[0018] Дополнительные варианты осуществления предоставляют фармацевтические композиции, содержащие, по меньшей мере, одно соединение или фармацевтически приемлемую соль по раскрытию и, по меньшей мере, один фармацевтически приемлемый носитель.

[0019] Термин «необязательно замещенный», в контексте настоящего раскрытия, означает, что заявленная структура может включать, но не требуется, чтобы включала, один или несколько заместителей, независимо выбранных из низшего алкила, метокси, -OH, -NH2, -CH2-NH-CH2, -OCH2CH2CH3 или -OCH(CH3)2. Если необязательно замещенный остаток является циклическим, то необязательное замещение может представлять собой метиловый мостик между двумя атомами в кольце.

[0020] Символ «C(O)», в контексте настоящего раскрытия, относится к карбонильной группе, имеющей формулу C=O.

[0021] Если не указано иное, «а» и «an» в контексте настоящего раскрытия, включая формулу изобретения, означают «один или несколько».

[0022] В контексте настоящего раскрытия, «низший алкил» относится к линейным или, в случае трех- и четырех-углеродных групп, к линейным, разветвленным или циклическим насыщенным углеводородам, имеющим от одного до четырех атомов углерода.

[0023] В контексте настоящего раскрытия, термин «присоединенный через азот» при отнесении к гетероциклическим остаткам, содержащим азот, означает, что точка присоединения остатка к другой структуре осуществляется через атом азота, который является частью гетероцикла.

[0024] В контексте настоящего раскрытия, термин «TLR7/8» означает «TLR7 и TLR8» или «TLR7 или TLR8» или «TLR7 и/или TLR8». Конкретное значение может быть понято специалистом в данной области техники на основании контекста, в котором появляется «TLR7/8».

[0025] Гетероциклические остатки, перечисленные в данном раскрытии, включают азетидинил, пирролидинил, пиперидинил, метилазетидинил, пиразолил, пиперазинил, морфолинил, тиазолил, пирролопирролил, имидазолидинил и изотиазолинил. Когда гетероциклическая группа упоминается, если не указано иное, будет понятно, что гетероциклический атом(ы) в группе может быть в любом положении в группе. Далее будет понятно, что имидазолил, пиразолил, тиазолил и пирролил могут быть ненасыщенными или частично ненасыщенными. Вариант осуществления раскрытия может включать фармацевтическую композицию, которая содержит одно или несколько соединений по раскрытию с фармацевтически приемлемым наполнителем. Эти фармацевтические композиции могут быть использованы для лечения или профилактики заболевания или состояния, характеризующегося активацией TLR7/8 у пациента, обычно пациента-человека, который имеет или предрасположен иметь такое состояние или заболевание. Примеры заболеваний или состояний, характеризующихся активацией TLR7/8, включают системную красную волчанку (СКВ) и волчаночный нефрит.

[0026] В контексте настоящего раскрытия, «эффективное количество» соединения по варианту осуществления раскрытия представляет собой эффективное количество вышеуказанных соединений в количестве, достаточном для лечения или профилактики СКВ и волчаночного нефрита.

[0027] Варианты осуществления, представленные в настоящем раскрытии, могут включать асимметрические или хиральные центры. Варианты осуществления включают различные стереоизомеры и их смеси. Индивидуальные стереоизомеры соединений согласно вариантам осуществления раскрытия могут быть получены синтетически из коммерчески доступных исходных материалов, которые содержат асимметрические или хиральные центры, или путем получения смесей энантиомерных соединений с последующим разделением этих соединений. Подходящие способы разделения включают присоединение рацемической смеси энантиомеров, обозначенной (+/-), к хиральному вспомогательному веществу, разделение полученного диастереомера с помощью хроматографии или перекристаллизации и отделение оптически чистого продукта от вспомогательного вещества; или прямое разделение смеси оптических энантиомеров на хиральных хроматографических колонках.

[0028] Варианты осуществления раскрытия также включают фармацевтическую композицию, содержащую любое соединение по раскрытию, а также фармацевтически приемлемый эксципиент. Фармацевтические композиции могут быть использованы для лечения или профилактики СКВ и волчаночного нефрита. Поэтому варианты осуществления раскрытия могут также характеризовать способ лечения или профилактики СКВ или волчаночного нефрита у пациента-человека, имеющего или предрасположенного к наличию волчаночного нефрита или СКВ.

[0029] Варианты осуществления раскрытия включают фармацевтически приемлемые соли соединений, представленных в настоящем описании. Термин «фармацевтически приемлемая соль» относится к тем солям, которые являются, с медицинской точки зрения, пригодны для использования в контакте с тканями человека и животных без чрезмерной токсичности, раздражения или аллергической реакции. Фармацевтически приемлемые соли хорошо известны в данной области техники. Например, S. M. Berge с соавт. описывает фармацевтически приемлемые соли подробно в J. Pharmaceutical Sciences 66: 1-19, 1977. Соли могут быть получены in situ в процессе конечного выделения и очистки соединения или отдельно путем взаимодействия группы свободного основания с подходящей органической кислотой. Типичные кислотно-аддитивные соли включают ацетатные, адипатные, альгинатные, аскорбатные, аспартатные, бензолсульфонатные, бензоатные, бисульфатные, боратные, бутиратные, камфоратные, камфорсульфонатные, цитратные, циклопентилпропионатные, диглюконатные, додецилсульфатные, этансульфонатные, фумаратные, глюкогептонатные, глицерофосфатные, гемисульфатные, гептонатные, гексаноатные, гидробромидные, гидрохлоридные, гидроиодидные, 2-гидрокси-этансульфонатные, лактобионатные, лактатные, лауратные, лаурилсульфатные, малатные, малеатные, мономалеатные, малонатные, метансульфонатные, 2-нафталинсульфонатные, никотинатные, нитратные, олеатные, оксалатные, пальмитатные, памоатные, пектинатные, персульфатные, 3-фенилпропионатные, фосфатные, пикратные, пивалатные, пропионатные, стеаратные, сукцинатные, сульфатные, тартратные, тиоцианатные, толуолсульфонатные, трифторацетатные, ундеканоатные, валератные соли и тому подобное. Типичные соли щелочных или щелочноземельных металлов включают соли натрия, лития, калия, кальция, магния и тому подобное, а также нетоксичные катионы аммония, четвертичного аммония и аминовые, в том числе, но не ограничиваясь ими, аммоний, тетраметиламмоний, тетраэтиламмоний, метиламин, диметиламин, триметиламин, триэтиламин, этиламин и тому подобное. Термин «фармацевтически приемлемый сложный эфир», в контексте настоящего раскрытия, обозначает сложные эфиры, которые гидролизуются in vivo и включают те, которые легко распадаются в человеческом теле с сохранением исходного соединения или его соли. Подходящие сложноэфирные группы включают, например, те, которые получены из фармацевтически приемлемых алифатических карбоновых кислот, в частности алкановых, алкеновых, циклоалкановых и алкандиовых кислот, в которых каждая алкильная или алкенильная группа обычно имеет не более 6 атомов углерода. Примеры конкретных сложных эфиров включают формиаты, ацетаты, пропионаты, бутираты, акрилаты и этилсукцинаты.

[0030] В настоящей заявке энантиомеры обозначаются символами «R» или «S» или рисуются с помощью обычных значений с использованием жирной линии, определяющей заместитель над плоскостью страницы в трехмерном пространстве, и штрихованной или пунктирной линии, определяющей заместитель под плоскостью печатной страницы в трехмерном пространстве. Если никакого стереохимического обозначения не сделано, то определение структуры включает в себя оба стереохимических варианта. Если структура или химическое название включает в себя «ОТН» или «отн», то понимается, что структура указывает относительную стереохимию.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

[0031] Фиг. 1А по фиг. 1D показывают результаты воздействия с помощью ER-888840 (5-((3R,5S)-3-амино-5-метилпиперидин-1-ил)хинолин-8-карбонитрил) на пристановой модели DBA/1. Условные обозначения к фигуре: Самкам мышей DBA/1 в возрасте 10 недель делали внутрибрюшинную инъекцию 0,5 мл пристана или ФСБ. В возрасте 18 недель у животных брали кровь для определения исходного уровня титров аутоантител перед использованием препарата. Ежедневное пероральное введение дозы плацебо (Плац.; 0,5% метил-целлюлоза) или 11 мг/кг, 33 мг/кг или 100 мг/кг ER-888840 начинали в возрасте 18 недель, через 8 недель после инъекции пристана, и продолжали воздействие в течение 12 недель. В конце эксперимента брали образцы плазмы и титры анти-дцДНК и анти-гистона (фиг. 1A) и анти-Sm/РНП и анти-RiboP (фиг. 1B) определяли с помощью ИФА. (Фиг. 1С) Экспрессию ИФН-регулируемых генов в цельной крови измеряли с помощью панели кПЦР после 8 недель воздействия. Перечислены гены, экспрессия которых активируется обработкой пристана, и модулируется с помощью воздействия соединением на мышь, подвергнутую воздействию пристана. (Фиг. 1D) Показатели интерферона отдельных мышей рассчитывали (см. раздел Фармакологические Материалы и Методы для подробной информации о расчете показателя ИФН) и группы сравнивали с использованием критерия Манна-Уитни.

[0032] Фиг. 2А по фиг. 2Е показывают результаты воздействия с помощью ER-888840 на пристановой модели DBA/1. Условные обозначения к фигуре: Самкам мышей DBA/1 в возрасте 10 недель делали внутрибрюшинную инъекцию 0,5 мл пристана или ФСБ. В возрасте 12 у животных брали кровь для определения исходного уровня титров аутоантител. Ежедневное пероральное введение дозы плацебо (Плац.; 0,5% метил-целлюлоза) или 33 мг/кг, 100 мг/кг или 300 мг/кг ER-888840 начинали в возрасте 14 недель, через 4 недели после инъекции пристана, и продолжали воздействие в течение 8 недель лечения. В конце эксперимента брали образцы плазмы и титры анти-дцДНК (фиг. 2А), анти-RiboP (фиг. 2B), анти-гистона (фиг. 2C) и анти-Sm/РНП (фиг. 2D) определяли с помощью ИФА. (Фиг. 2Е). Экспрессию ИФН-регулируемых генов в цельной крови измеряли с помощью панели кПЦР после 12 недель воздействия, а также рассчитывали ИНФ-показатель профиля экспрессии генов ИФН (см. раздел Фармакологические Материалы и Методы для подробной информации о расчете показателя ИФН). Таблица показывает полный список 18 генов, экспрессия которых активируется обработкой пристана, в сравнении с контролем ФСБ. Показатели интерферона для отдельных животных в каждой группе, подвергающихся воздействию, отмечены на графике и сравнены с использованием критерия Манна-Уитни.

[0033] Фиг. 3А по фиг. 3BB, которые включают несколько страниц, демонстрируют структуры и соответствующие химические названия в соответствии с различными вариантами осуществления, представленными в данном документе. «ER-номер» представляет собой ссылочный номер, присваиваемый каждому соединению. Где это возможно, активность против клеточной линии НЕК, стабильно экспрессирующей человеческий TLR7, активность в отношении клеточной линии НЕК, стабильно экспрессирующей человеческий TLR9, данные ЯМР 1H, и данные масс-спектрометрии также включены.

ПОДРОБНОЕ ОПИСАНИЕ РАСКРЫТИЯ

[0034] I. Толл-подобные рецепторы и волчанка

[0035] В дополнение к их роли в качестве рецепторов врожденного иммунитета, способных обнаруживать экзогенные («не-свои») патоген-ассоциированные молекулярные паттерны (PAMPs - т.е., обнаружение бактериального ЛПС посредством TLR4), Толл -подобные рецепторы (TLR) млекопитающих также способны распознавать эндогенные стимулы (DAMPS), вырабатываемые после повреждения ткани хозяина или стресса. Kono, H. и K.L. Rock, How dying cells alert the immune system to danger. Nat Rev Immunol, 2008. 8(4): стр. 279-89. В последнее десятилетие возникло понимание связи между активацией TLR посредством эндогенных («своих») дистресс-ассоциированных молекулярных паттернов (DAMPS) и этиологией аутоиммунных заболеваний. В частности, TLR7 могут быть активированы одноцепочечной РНК (оцRNA), полученной как из млекопитающих, так и из вирусных источников, в то время как TLR9 могут быть активированы посредством ДНК, полученной из млекопитающих, вирусных и бактериальных источников.

[0036] Волчанка характеризуется аутоантителами, активными против своей двухцепочечной ДНК (дцДНК) и ассоциированных белков (гистонов), а также против широкого многообразия РНК-ассоциированных белков, таких как Ro, La, Smith (Sm), и U1 мяРНП. Kirou, K.A., с соавт., Activation of the interferon-alpha pathway identifies a subgroup of systemic lupus erythematosus patients with distinct serologic features and active disease. Arthritis Rheum, 2005. 52(5): стр. 1491-503. Вторым общим отличительным признаком волчанки, который, как было показано, непосредственно коррелирует с тяжестью заболевания, является неуправляемая экспрессия интерферонов (ИФН) типа 1, в частности ИФНα, и соответствующее повышение уровня большой группы ИФНальфа-регулируемых генов в МКПК пациентов с волчанкой (так называемый «профиль экспрессии генов ИФН типа-1»). Kirou, K.A., с соавт., см. выше. Основным источником ИФН в крови является специфическая иммунокомпетентная клетка, называемая плазмацитоидной дендритной клеткой (pDC), которая конститутивно экспрессирует как TLR7, так и TLR9.

[0037] Была предположена причинно-следственная связь между этими двумя характеристиками заболевания, аутоантителами и уровнями ИФН, когда ряд исследовательских групп в совокупности показал, что комплексы антител, выделенные от больных волчанкой, но не от здоровых доноров, способны управлять выработкой ИФН посредством pDC TLR7/9- и РНК/ДНК-зависимым образом. Means, T.K., с соавт., Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9. J Clin Invest, 2005. 115(2): стр. 407-17; Vollmer, J., с соавт., Immune stimulation mediated by autoantigen binding sites within small nuclear RNAs involves Toll-like receptors 7 and 8. J Exp Med, 2005. 202(11): стр. 1575-85; Savarese, E., с соавт., U1 small nuclear ribonucleoprotein immune complexes induce type I interferon in plasmacytoid dendritic cells through TLR7. Blood, 2006. 107(8): стр. 3229-34. Кроме того, ИФН стимулирует повышенную экспрессию TLR7/9 на В-клетках, тем самым повышая активацию TLR/BCR (рецептор В-клеток) аутореактивных В-клеток, чтобы дифференцироваться в плазматические клетки, продуцирующие антитела. Banchereau, J. and V. Pascual, Type I interferon in systemic lupus erythematosus and other autoimmune diseases. Immunity, 2006. 25(3): p. 383-92; Таким образом, уровни комплексов аутоантител, содержащих лиганды TLR7/9 нуклеиновых кислот, управляют провоспалительным циклом и прогрессированием болезни волчанка. Мы считаем вполне вероятным, что фармакологический антагонизм TLR7/8 окажет терапевтический эффект на пациентов с волчанкой путем нарушения этого провоспалительного цикла, снижения уровней ИФН и торможения процесса аутоиммунного заболевания, опосредованного pDC и В-клетками.

[0038] Несколько других линий доказательств указывают на роль TLR7 в этиологии человеческой волчанки и поддерживают идею о том, что рецепторы TLR являются важными целями для воздействия на заболевание. Специфические полиморфизмы в 3'-нетранслируемой области TLR7 были идентифицированы и показано, что они коррелируют как с повышенной экспрессией TLR7, так и увеличенным профилем экспрессии гена ИФН. Shen, N., с соавт., Sex-specific association of X-linked Toll-like receptor 7 (TLR7) with male systemic lupus erythematosus. Proc Natl Acad Sci U S A, 2010. 107(36): стр. 15838-43. Deng, Y. с соавт., MicroRNA-3148 modulates allelic expression of toll-like receptor 7 variant associated with systemic lupus erythematosus. PLOS Genetics, 2013. e1003336. Кроме того, являющиеся стандартом лечения (SOC) красной волчанки противомалярийные препараты, такие как хлорохин, нарушают эндосомную передачу сигнала TLR7/9, и ингибируют РВМС и/или выработку ИФНальфа pDC, индуцированную оцРНК-рибонуклеопротеидными комплексами или сывороткой пациентов с волчанкой. Кроме того, миелоидные DC и моноциты продуцируют ИЛ-12р40, ФНО альфа, и ИЛ-6, сопровождающий передачу сигнала своя-РНК/TLR8, свидетельствующий о дополнительном вкладе TLR8-зависимых провоспалительных цитокинов в этиологию человеческой волчанки в дополнение к TLR7-управляемому ИФН посредством pDC. Vollmer, см. выше; Gorden, K.B., с соавт., Synthetic TLR agonists reveal functional differences between human TLR7 and TLR8. J Immunol, 2005. 174(3): стр. 1259-68.

[0039] Мышиная модель свидетельствует также о существовании роли TLR в волчанке. Опубликованные исследования в совокупности показали, что как одинарная TLR7, так двойная TLR7/9 делеция гена, или двойное TLR7/9 фармакологическое ингибирование уменьшает тяжесть заболевания в четырех различных моделях волчанки. Nickerson, K.M., со соавт., TLR9 regulates TLR7- and MyD88-dependent autoantibody production and disease in a murine model of lupus. J Immunol, 2010. 184(4): стр. 1840-8; Fairhurst, A.M., с соавт., Yaa autoimmune phenotypes are conferred by overexpression of TLR7. Eur J Immunol, 2008. 38(7): стр. 1971-8; Deane, J.A., со соавт., Control of toll-like receptor 7 expression is essential to restrict autoimmunity and dendritic cell proliferation. Immunity, 2007. 27(5): стр. 801-10; Savarese, E., с соавт., Requirement of Toll-like receptor 7 for pristane-induced production of autoantibodies and development of murine lupus nephritis. Arthritis Rheum, 2008. 58(4): стр. 1107-15. Подчеркивая роль TLR7 как важнейшего фактора аутоиммунитета, трансгенная избыточная экспрессия TLR7 сама по себе приводит к спонтанной анти-РНК аутоактивности и нефриту в обычно резистентном штамме C57BL/6. Deane, см. выше.

[0040] С точки зрения безопасности, нет никаких сообщений о том, что, мыши, дефицитные по TLR7, 8 или 9-одинарному или 7/8- и 7/9-двойному гену являются иммунокомпрометированными до такой степени, что наблюдается инфекция из-за условно-патогенных микроорганизмов. Точно так же, SOC противомалярийными препаратами считается в основном безопасным и эффективным для долгосрочного использования у людей для контроля вспышки заболевания волчанки в дозах, рассчитанных, по меньшей мере, частично ингибировать передачу сигнала TLR7/9. Lafyatis, R., M. York, и A. Marshak-Rothstein, Antimalarial agents: closing the gate on Toll-like receptors? Arthritis Rheum, 2006. 54(10): стр. 3068-70; Costedoat-Chalumeau, N., с соавт., Low blood concentration of hydroxychloroquine is a marker for and predictor of disease exacerbations in patients with systemic lupus erythematosus. Arthritis Rheum, 2006. 54(10): стр. 3284-90. На самом деле, за исключением повышенной восприимчивости к грамположительным бактериальным инфекциям в детстве и в меньшей степени в зрелом возрасте, люди с существенно нарушенными сигнальными путями TLR и ИЛ-1R (MyD88- или IRAK-4-дефицит), тем не менее, являются здоровыми и поддерживают достаточные иммунологические защитные механизмы. Casanova, J.L., L. Abel, и L. Quintana-Murci, Human TLRs and IL-1Rs in Host Defense: Natural Insights from Evolutionary, Epidemiological, and Clinical Genetics. Annu Rev Immunol, 2010.

[0041] На основании этой и другой информации, мы считаем, что TLR7 является, в частности, хорошо подтвержденной целью в случае мышиных доклинических моделей СКВ. Как генетические, так и функциональные исследования на человеке подтверждают гипотезу, что антагонизм путей TLR7 и/или TLR8 будет обеспечивать терапевтическую пользу пациентам с волчанкой. Кроме того, как исследование делеции гена TLR на мышах, так и длительное применение противомалярийных препаратов на людях предполагают, что фармакологическое подавление TLR7, 8 и/или 9 может осуществляться без значительного ущерба для иммунной защиты организма.

[0042] Соединение, которое подавляет TLR7, TLR8 или как TLR7, так и TLR8, может поэтому, как ожидается, действовать в качестве терапевтического или профилактического средства для СКВ или волчаночного нефрита.

[0043] Мы нашли соединения, которые подавляют TLR 7 и/или 8, и поэтому, как ожидается, могут иметь профилактическое или терапевтическое воздействие на СКВ или волчаночный нефрит. Соединения и способы раскрытия описаны в данном документе.

[0044] II. Терапевтическое использование

[0045] Уровни дозировок активных ингредиентов в фармацевтических композициях по раскрытию могут варьироваться, чтобы получить количество активного соединения(ий), которое достигает требуемого терапевтического ответа для конкретного пациента, состава и способа введения. Выбранный уровень дозировки зависит от активности конкретного соединения, способа введения, тяжести состояния, подлежащего лечению, и состояния и предварительного медицинского анамнеза пациента, подлежащего лечению. Дозы определяются для каждого конкретного случая с использованием стандартных методов в соответствии с факторами, уникальными для пациента, включая возраст, вес, общее состояние здоровья, и другие факторы, которые могут влиять на эффективность соединения(ий) по раскрытию. В общем, в случае перорального введения соединение согласно настоящему раскрытию или его фармацевтически приемлемую соль вводят в дозе приблизительно 30 мкг до 100 мкг, в дозе 30 мкг до 500 мкг, в дозе 30 мкг до 10 г, в дозе 100 мкг до 5 г, или в дозе 100 мкг до 1 г на взрослого человека в день. В случае введения в виде инъекции, его вводят в дозе приблизительно 30 мкг до 1 г, в дозе 100 мкг до 500 мг, или в дозе 100 мкг до 300 мг на взрослого человека в день. В обоих случаях, дозу вводят один раз или разделяют на несколько введений. Дозировка может быть смоделирована, например, с помощью программы Simcyp®.

[0046] Не предполагается, что введение соединения по настоящему раскрытию млекопитающему, включая человека, ограничено конкретным способом введения, дозировкой или частотой дозирования. Настоящее раскрытие рассматривает все способы введения, включая пероральное, интраперитонеальное, внутримышечное, внутривенное, внутрисуставное, внутриочаговое, подкожное или любой другой путь, достаточный для обеспечения адекватной дозы для профилактики или лечения СКВ или волчаночного нефрита. Одно или несколько соединений по раскрытию могут быть введены в организм млекопитающего в виде однократной дозы или многократных доз. Когда вводят многократные дозы, дозы могут быть отделены друг от друга, например, несколькими часами, одним днем, одной неделей, одним месяцем или одним годом. Следует понимать, что, для любого конкретного субъекта конкретные режимы дозировки должны быть скорректированы по времени в соответствии с индивидуальной потребностью и профессиональной оценкой лица, назначающего или наблюдающего за введением фармацевтической композиции, которая содержит соединение по раскрытию.

[0047] Для клинического применения, соединение по настоящему раскрытию в целом могут быть введены внутривенно, подкожно, внутримышечно, в толстую кишку, назально, интраперитонеально, ректально, трансбуккально или перорально. Композиции, содержащие, по меньшей мере, одно соединение по раскрытию, которое пригодно для использования в медицине или ветеринарии, могут быть представлены в формах, допускающих введение с помощью подходящего пути. Эти композиции могут быть получены в соответствии с обычными способами, используя одно или несколько фармацевтически приемлемых вспомогательных веществ или эксципиентов. Вспомогательные вещества включают, помимо прочего, разбавители, стерильную водную среду и различные нетоксичные органические растворители. Приемлемые носители или разбавители для терапевтического применения хорошо известны в фармацевтической области, и описаны, например, в Remington: The Science and Practice of Pharmacy (20th изд.), ред. A. R. Gennaro, Lippincott Williams & Wilkins, 2000, Philadelphia, and Encyclopedia of Pharmaceutical Technology, ред. J. Swarbrick и J. C. Boylan, 1988, 1999, Marcel Dekker, Нью-Йорк. Композиции могут быть представлены в форме таблеток, пилюль, гранул, порошков, водных растворов или суспензий, растворов для инъекций, эликсиров или сиропов, и композиции могут необязательно содержать один или несколько агентов, выбранных из группы, включающей подсластители, ароматизаторы, красители и стабилизаторы для получения фармацевтически приемлемых препаратов.

[0048] Выбор основы и содержание активного вещества в основе, как правило, определяется в соответствии с растворимостью и химическими свойствами продукта, конкретного способа введения и условий, которые необходимо соблюдать в фармацевтической практике. Например, для изготовления таблеток могут быть использованы эксципиенты, такие как лактоза, цитрат натрия, карбонат кальция, и дикальцийфосфат, и разрыхлители, такие как крахмал, альгиновая кислота, и некоторые сложные силикаты в сочетании со скользящими веществами (например, стеарат магния, лаурилсульфат натрия и тальк). Чтобы изготовить капсулу, целесообразно использовать лактозу и высокомолекулярные полиэтиленгликоли. Когда используются водные суспензии, они могут содержать эмульгирующие агенты, которые облегчают получение суспензии. Разбавители, такие как сахароза, этанол, полиэтиленгликоль, пропиленгликоль, глицерин, хлороформ или их смеси могут также быть использованы.

[0049] Для парентерального введения используют эмульсии, суспензии, или растворы композиций по раскрытию в растительном масле (например, кунжутное масло, арахисовое масло, или оливковое масло), водно-органические растворы (например, вода и пропиленгликоль), инъецируемые органические сложные эфиры (например, этилолеат) или стерильные водные растворы фармацевтически приемлемых солей. Растворы солей композиций по раскрытию особенно полезны для введения путем внутримышечной или подкожной инъекции. Водные растворы, включающие растворы солей в чистой дистиллированной воде, могут быть использованы для внутривенного введения при условии, что (i) их рН соответственно регулируют, (ii), они надлежащим образом буферизированы и приведены в изотоническое состояние с помощью достаточного количества глюкозы или хлористого натрия и (iii) они стерилизованы нагреванием, облучением или микрофильтрацией. Подходящие композиции, содержащие соединение по раскрытию, могут быть растворены или суспендированы в подходящем носителе для использования в ингаляторе или в аэрозольной суспензии в аэрозольном растворе, или могут быть абсорбированы или адсорбированы на подходящем твердом носителе для использования в ингаляторе сухого порошка. Твердые композиции для ректального введения включают суппозитории, сформулированные в соответствии с известными способами и содержащие, по меньшей мере, одно соединение по раскрытию.

[0050] Лекарственные составы соединения по раскрытию, которые будут использоваться для терапевтического введения должны быть стерильными. Стерильность легко достигается путем фильтрации через стерильные мембраны (например, мембраны 0,2 микрометра) или с помощью других обычных способов. Составы обычно хранятся в лиофилизированной форме или в виде водного раствора. рН композиций по настоящему раскрытию в некоторых вариантах осуществления, например, может быть в пределах от 3 до 11, может быть в пределах от 5 до 9, или может быть в пределах 7 и 8, включительно.

[0051] В то время как один путь введения представляет собой пероральное введение дозы, могут быть использованы другие способы введения. Например, композиции могут быть введены подкожно, внутривенно, внутримышечно, в толстую кишку, ректально, назально или интраперитонеально в виде различных лекарственных форм, таких как суппозитории, имплантированные гранулы или маленькие цилиндры, аэрозоли, пероральные дозированные составы и местные составы, такие как мази, капли, и кожные пластыри. Соединения по вариантам осуществления раскрытия могут быть включены в формованные изделия, такие как имплантаты, в том числе, но не ограничиваясь ими, клапаны, стенты, трубки и протезы, которые могут использовать инертные материалы, такие как синтетические полимеры или силиконы (например, композиции Silastic®, силиконовый каучук или другие коммерчески доступные полимеры). Такие полимеры могут включать поливинилпирролидон, сополимер пирана, полигидрокси-пропил-метакриламид-фенол, полигидроксиэтил-аспартамид-фенол или полиэтиленоксид-полилизин, замещенный остатками пальмитоила. Кроме того, соединение по раскрытию может быть соединено с классом биоразлагаемых полимеров, полезных для достижения контролируемого высвобождения лекарственного средства, например, полимолочной кислотой, полигликолевой кислотой, сополимерами полимолочной и полигликолевой кислоты, полиэпсилонкапролактоном, полигидроксимасляной кислотой, полиортоэфирами, полиацеталями, полидигидропиранами, полицианоакрилатами и поперечно сшитыми или амфипатическими блок-сополимерами гидрогелей.

[0052] Соединение по раскрытию может также быть введено в форме систем доставки липосом, таких как небольшие моноламеллярные везикулы, большие моноламеллярные везикулы и многослойные везикулы. Липосомы могут быть образованы из различных липидов, таких как холестерин, стеариламин или фосфатидилхолины. Соединение по раскрытию может быть также доставлено с использованием антител, фрагментов антител, факторов роста, гормонов или других целевых фрагментов, к которым молекулы соединения присоединены (например, см. Remington: The Science and Practice of Pharmacy, см. выше), в том числе in vivo конъюгирование к компонентам крови соединения по варианту осуществления раскрытия.

[0053] III. Синтез

[0054] Общие и конкретные пути синтеза приведены только в том случае, когда мы нашли полезным для получения вариантов осуществления раскрытия. Специалисты в данной области техники могут понимать, что определенные вариации и модификации этих способов могут также привести к синтезу соединений согласно раскрытию. В некоторых ситуациях фраза «такие как» используется для перечисления различных альтернатив для более общих соединений или структур. Следует понимать, что «такие как» не следует истолковывать как ограничивающие, и что его значение находится в соответствии с «включая, например, но не ограничиваясь ими».

[0055] Определенные условия являлись общими для конкретных примеров, представленных ниже. Микроволновое нагревание осуществляли с использованием микроволнового реактора Biotage® Emrys Liberator или Initiator. Колоночную хроматографию проводили с использованием флэш-хроматографической системы Biotage® SP4. Удаление растворителя проводили с использованием либо роторного испарителя Büchii, либо центробежного испарителя Genevac®. ЯМР-спектры записывали при 400 МГц на спектрометре Varian Unity® с использованием дейтерированных растворителей. Химические сдвиги приведены относительно остаточного протонированного растворителя.

[0056] Тонкослойную хроматографию проводили на стеклянных пластинках Whatman®, предварительно покрытых 0,25 мм слоем силикагеля с использованием различных соотношений одного или нескольких из следующих растворителей: EtOAc, гептан, дихлорметан или МеОН.

[0057] Аналитическую ЖХ/МС проводили для многих примеров на системе Waters Acquity™ с использованием колонки XBridge™ C18 1,7 мкм 2,1×50 мм. Растворители А и В представляют собой вода масс./0,1% муравьиная кислота и ацетонитрил масс./0,1% муравьиная кислота, соответственно. Общее время процесса 5 минут с 5% B до 99% B в течение 4 минут с линейной скоростью потока 0,3 мл/мин. Масс-спектрометрические данные получали на Micromass ZQ™ от 100-2000 а.е.м. электрораспылением в положительном режиме.

[0058] В качестве альтернативы, подтверждение чистоты и массы проводили на системе Waters Autopurification с использованием колонки XBridge™ C8 3,5 мкм 4,6×50 мм. Растворители А и В представляют собой вода масс./0,1% муравьиная кислота и ацетонитрил масс./0,1% муравьиная кислота, соответственно. Общее время процесса 6 минут с 10% B до 95% B в течение 5 мин с линейной скоростью потока 2,5 мл/мин. Масс-спектрометрические данные получали на Micromass ZQ™ от 130-1000 а.е.м. электрораспылением в положительном режиме.

[0059] Препаративную обращенно-фазовую ЖХ/МС проводили для многих примеров на системе Waters Autopurification с использованием колонки XBridge ™ C8 5 мкм, 19×100 мм. Растворители А и В представляют собой масс./0,1% муравьиная кислота и ацетонитрил масс./0,1% муравьиная кислота, соответственно. Общее время процесса 12 минут с 30% B до 95% B в течение 10 мин с линейной скоростью потока 20 мл/мин. Масс-спектрометрические данные получали на Micromass ZQ™ от 130-1000 а.е.м. электрораспылением в положительном режиме.

[0060] Разделение препаративной ВЭЖХ рацемических соединений проводили для многих примеров с использованием одной из следующих хиральных колонок: Chiralpak® IA (5 см × 50 см или 2 см × 25 см), Chiralpak® AD (2 см × 25 см) или Chiralcel® OD (2 см × 25 см). Соотношения энантиомеров очищенных соединений определяли методом ВЭЖХ на колонке 0,45 см × 25 см, состоящей из той же стационарной фазы (IA, AD или OD).

[0061] Общие методы и эксперименты для получения соединений по настоящему раскрытию представлены ниже. В некоторых случаях, конкретное соединение описано в качестве примера. Тем не менее, следует понимать, что в каждом случае получали серии соединений по настоящему раскрытию в соответствии со схемами и экспериментами, описанными ниже. Для тех соединений, где ЯМР и/или данные масс-спектрометрии доступны, данные представлены на фиг. 3.

[0062] Следующие сокращения используются в настоящем описании:

Определения: Следующие аббревиатуры имеют указанные значения:

АсОН: уксусная кислота
безв.: безводный
водн.: водный
Bn: бензил
Вос: трет-бутоксикарбонил
CSA: камфорсульфокислота
д: день(дни)
DAMP: дистресс-ассоциированные молекулярные паттерны
ДБУ: 1,8-диазобицикло[5.4.0]ундец-7-ен
ДХЭ: 1,2-дихлорэтан
ДХМ: дихлорметан
ДИПЭА: N,N-диизопропилэтиламин
ДМА: N,N-диметилацетамид
ДМАП: 4-диметиламинопиридин
ДМФ: N,N-диметилформамид
ДМСО: диметилсульфоксид
дцДНК: двухцепочечная ДНК
EDC: 1-(3-диметиламинопропил)-3-этилкарбодиимида гидрохлорид
ee: энантиомерный избыток
EtOAc: этилацетат
EtOH: этанол
ч: час(ы)
HATU: N,N,N',N'-тетраметил-O-(7-азабензотриазол-1-ил)урония гексафторфосфат
HCl: соляная кислота
HCQ: гидроксихлорохин
гепт.: н-гептан
HEPES: 4-(2-гидроксиэтил)-1-пиперазинэтансульфоновая кислота
ВЭЖХ: высокоэффективная жидкостная хроматография
ИФН: интерферон
ИПС: изопропиловый спирт или изопропанол
K2CO3: карбонат калия
МеОН: метанол
MgSO4: сульфат магния (безводный)
мин: минута(ы)
МТБЭ: метил-трет-бутиловый эфир
Na2CO3: карбонат натрия
Na2SO4: сульфат натрия (безводный)
NaBH4: боргидрид натрия
NaCl: хлорид натрия
NaH: 60% гидрид натрия, диспергированный в масле
NaHCO3: бикарбонат натрия
NaOH: гидроксид натрия
NBS: N-бромсукцинимид
NH4Cl: хлорид аммония
NH4Cl: хлорид аммония
NH4OH: гидроксид аммония
NMP: N-метилпирролидон
Ns: нозил или о-нитробензолсульфонил
°С: градусов по Цельсию
PAMP: патоген-ассоциированный молекулярный паттерн
РВМС: мононуклеарные клетки периферической крови
ФСБ: фосфатно-солевой буфер
PDC: плазмацитоидные дендритные клетки
PhNTf2: N-фенилтрифторметансульфонамид
КПЦР: количественная полимеразная цепная реакция
R848: резиквимод
кт: комнатная температура
нас.: насыщенный
SNAP: картридж для флэш-хроматографии марки BIOTAGE®
SOC: стандарт лечения
оцРНК: одноцепочечная РНК
T3P: пропилфосфоновый ангидрид
tBuOK: трет-бутоксид калия
ТЭА: триэтиламин
TEMPO: 2,2,6,6-тетраметилпиперидин-1-оксил
Тf: трифторметансульфонат
ТФУК: трифторуксусная кислота
ТГФ: тетрагидрофуран
TLDA: картридж низкой плотности TaqMan®
TLR: Толл-подобные рецепторы
TSA: п-толуолсульфокислота

[0063] Общие способы синтеза:

[0064] Соединения по изобретению были сделаны в соответствии с общими методами синтеза, показанными на следующих схемах:

[0065] Схема 1

[0066]

[0067] Получение, по меньшей мере, одного примера использует промежуточное соединение 3, которое может быть получено в соответствии с путем, изображенным на схеме 1. Коммерчески доступный 5-бромхинолин-8-карбальдегид 1 (Frédérieric de Montigny, Gilles Argouarch, Claude Lapinte, «New Route to Unsymmetrical 9,10-Disubstituted Ethynylanthracene Derivatives», Synthesis, 2006, 293-298.) обрабатывают гидрохлоридом гидроксиламина, чтобы получить оксим 2. 2 затем превращают в соответствующий нитрил 3 в присутствии каталитического количества ацетата меди, чтобы получить один из ключевых промежуточных соединений для данного изобретения. Промежуточное соединение 3 используется для получения соединений по данному изобретению путем замещения 5-положения 5-бромхинолин-8-карбальдегида с помощью соответствующих ароматических, гетероароматических и насыщенных гетероциклических соединений, таких как пиперидины, пиперазины и морфолины с использованием соответствующих условий, подробно описанных ниже.

[0068] Альтернативный способ для получения ключевого промежуточного соединения 3, показан на схеме 2, где триэтиламин для первой стадии синтеза заменен ацетатом натрия.

[0069] Схема 2

[0070]

[0071] Методология для другого набора примеров соединений для данного изобретения показана на схеме 3. Исходя из соответствующим образом замещенного, коммерчески доступного пиридина 48, свободный амин защищают, чтобы получить 49, после чего пиридиновый азот активируется с образованием 50. Восстановление соли пиридиния с использованием боргидрида или другого восстановителя дает ненасыщенный пиперидин 51 с последующими дополнительными восстанавливающими условиями с использованием водорода в присутствии палладиевого катализатора с получением дизамещенного пиперидина в виде рацемической смеси или 52 и 53. Разделение нужного энантиомера может быть выполнено через образование смеси диастереомерных солей с использованием одного эквивалента хиральной кислоты, такую как (2R,3R)-2,3-бис((4-метоксибензоил)окси)янтарная кислота, где в результате нужная диастереомерная соль кристаллизуются из раствора. Сбор, перекристаллизация, и обессоливание полученных в результате кристаллов позволяет получить необходимый энантиомер 53 с высоким ee. 53 затем подвергают сочетанию с 5-бромхинолином 3 с использованием соответствующего конденсирующего реагента, чтобы получить Boc-защищенное 54, защита которого легко удаляется с получением примера 55 или ER-888840. Спиртовой аналог 56 может быть легко получен путем подвергания амина 55 воздействию нитрита натрия.

[0072] Схема 3

[0073]

[0074] Дополнительные примеры соединений могут быть получены с использованием 54 или 55 в качестве ключевых промежуточных соединений, как показано на схеме 4 и схеме 5. Алкилирование 54 возможно путем депротонирования амидного протона с помощью сильного основания с последующим добавлением соответствующего активированного алкилирующего агента. Алкилирование 55 возможно посредством метода восстановительного аминирования с получением примеров, изображенных общей структурой 57. Алкилирование 55 возможно также при использовании соответствующего основания в присутствии соответствующего замещенного алкила, арила, группы, содержащие соответствующую уходящую группу (LG), дают смесь моно- и дизамещенных примеров с общей структурой 57 и 58, как изображено на схеме 4.

[0075] Схема 4

[0076]

[0077] Ацилирование 55 с использованием активированной кислоты или с использованием различных амидных или пептидных конденсирующих реагентов дает амиды общей структуры 59, как показано на схеме 5. Алкилирование 59 в основных условиях дает примеры, описанные в общей структуре 60. Сульфонамиды 55 также могут быть получены с использованием условий, знакомых специалистам в данной области техники, с использованием активированных алкильных или арильных сульфонильных реагентов с образованием примеров, изображенных общей структурой 61.

[0078] Схема 5

[0079] Получение примеров

[0080] Соединение 3 - Схема 1

[0081] К суспензии 5-бромхинолин-8-карбальдегида 1 (1,00 г, 4,24 ммоль) и гидроксиламина гидрохлорида (1,177 г, 16,94 ммоль) в ацетонитриле (110 мл) добавляли TEA (2,362 мл, 16,94 ммоль) с последующим нагреванием до температуры кипения с обратным холодильником в течение 3 ч с получением желтой суспензии. Полученную после завершения реакции реакционную смесь охлаждали до комнатной температуры, осадок отфильтровывали, и осадок на фильтре промывали с помощью ацетонитрила (50 мл). Сырой твердый продукт очищали через небольшой слой силикагеля (10 г), элюируя посредством EtOAc (300 мл) с получением альдоксима 2 в виде желтого твердого вещества.

[0082] Альдоксим 2 (1,001 г, 4,0 ммоль) и моногидрат ацетата меди (II) (84,6 мг, 0,424 ммоль) в безводном ацетонитриле (180 мл) перемешивали при нагревании с обратным холодильником в течение 12 ч. Полученную после завершения реакции реакционную смесь охлаждали до комнатной температуры, фильтровали, и осадок на фильтре промывали с помощью H2O с получением твердого вещества коричневого цвета. Сырой твердый продукт очищали через небольшой слой силикагеля (примерно 10 г), элюируя (ДХМ 100 мл) с получением 5-бромхинолин-8-карбонитрила, 3 (0,783 г, 3,4 ммоль, 79,3% выход за 2 стадии) в виде твердого вещества бело-бежевого цвета после концентрирования и сушки в вакууме элюированного продукта. См.: Frédérieric de Montigny, Gilles Argouarch, Claude Lapinte, Synthesis, 2006 , 293.

[0083] Соединение 3- Схема 2

[0084] К раствору тригидрата ацетата натрия (31,6 г, 0,232 моль) в EtOH (0,498 л) при 15°С добавляли 5-бромхинолин-8-карбальдегид (49,84 г, 0,211 моль) с последующим добавлением гидроксиламина гидрохлорида (15,55 г, 0,223 моль). Полученную смесь нагревали до 70°С в течение 3 ч, после чего реакционную смесь охлаждали до 35°С, а затем разбавляли водой (250 мл). Смесь частично концентрировали приблизительно до 250 мл, после чего добавляли воду (250 мл), 2-метокси-2-метилпропан (120 мл), и гептан (120 мл) с последующим повторным концентрированием смеси до примерно 250 мл. Полученную суспензию разбавляли водой (250 мл) и охлаждали до 0°С, после чего 1М NaOH в воде (211 мл) добавляли и конечную смесь энергично перемешивали в течение 10 мин. Суспензию фильтровали, промывали водой (498 мл) и осадок на фильтре сушили при 30°С в течение 18 ч с получением альдоксима 2 (49,75 г, 0,198 моль, выход 93,9%) в виде рыжевато-коричневого порошка.

[0085] К перемешиваемой суспензии 2 (48,21 г, 0,192 моль) в ацетонитриле (386 мл) при 15°С добавляли ацетат меди (II) (0,523 г, 2,9 ммоль) с последующим добавлением уксусной кислоты (13,1 мл, 0,229 моль). Полученную смесь нагревали до температуры кипения с обратным холодильником в течение 21 ч, после чего полученную после завершения реакции реакционную смесь охлаждали до 50°С. Добавляли воду (0,39 л), и смесь частично концентрировали с последующим разбавлением водой (290 мл) и охлаждали до 5°С. Добавляли 1М NaOH в воде (230 мл), и энергичное перемешивание продолжали в течение 10 мин. Суспензию фильтровали, осадок на фильтре промывали водой (500 мл) и сушили с получением соединения 3 (42,80 г, 0,183 моль, выход 95,6%) в виде темно-серого порошка.

[0086] Синтез ER-888840 с использованием Схемы 3

[0087] Соединение 50: К перемешиваемому раствору коммерчески доступного 5-метилпиридин-3-амина 48 (17,52 г, 162,01 ммоль) в EtOAc (52,6 мл) при 17°С добавляли ДМАП (0,990 г, 8,10 ммоль), и смесь нагревали до 30°С, после раствор ди-трет-бутилдикарбоната (39,5 мл, 170,11 ммоль) в EtOAc (35,0 мл) медленно добавляли к исходной реакционной смеси в течение 1-часового периода, контролируя при этом выделение CO2 и температуру при <40°С. Полученную смесь перемешивали при 35-40°С в течение дополнительного 1 ч, затем нагревали с обратным холодильником в течение 18 ч. Конечную смесь охлаждали до комнатной температуры, разбавляли толуолом (175 мл) с последующим добавлением силикагеля (17,52 г). Полученную суспензию перемешивали при 20-23°С в течение 30 ч, затем фильтровали, и осадок на фильтре промывали смесью EtOAc (88 мл) и толуола (88 мл). Фильтрат частично концентрировали досуха с получением сырого трет-бутил (5-метилпиридин-3-ил)карбамата, 49, в виде оранжевого/коричневого твердого вещества.

[0088] К перемешиваемому раствору сырого 49 в ацетонитриле (175 мл) добавляли бензилбромид (19,85 мл, 167 ммоль) при 20°С с последующим нагреванием с обратным холодильником в течение 2 ч. Полученную после завершения реакции реакционную смесь охлаждали до комнатной температуры, разбавляли толуолом (315 мл), охлаждали до 0°С и перемешивали в течение 1 ч. Сырую смесь фильтровали, промывали толуолом (175 мл) и полученное твердое вещество сушили в вакууме при 45°С в течение 17 ч с получением 1-бензил-3-((трет-бутоксикарбонил)амино)-5-метилпиридин-1-ия бромида, 50 (35,59 г, 93,8 ммоль) в виде не совсем белого порошка. Фильтрат концентрировали и суспендировали в смеси EtOAc (150 мл) и этанола (15 мл) и полученное в результате твердое вещество фильтровали, промывали с помощью EtOAc (50 мл) и сушили в вакууме с получением дополнительного 50 (5,20 г, 13,7 ммоль, или 66,4% общий выход за 2 стадии).

[0089] Соединение 52 и 53: К перемешиваемому раствору 50 (9,85 г, 26,0 ммоль) в этаноле (89 мл) при -3°С добавляли охлажденный раствор (0°С) NaBH4 (3,013 г, 79,6 ммоль) в 0,10М NaOH (20 мл, 2,0 ммоль), поддерживая температуру при <3°C, после чего реакционную смесь перемешивали при 0-3°С в течение 3 ч. Полученную после завершения реакции реакционную смесь разбавляли МТБЭ (0,10 л) и водой (0,05 л), поддерживая температуру при <10°C с последующим добавлением 20% масс. лимонной кислоты (50 г), контролируя при этом выделение H2 и температуру при <10°C. Полученную смесь интенсивно перемешивали при температуре 5-10°C в течение 10 мин, затем частично концентрировали приблизительно до 50 мл. МТБЭ (100 мл) добавляли при интенсивном перемешивании, и смесь повторно концентрировали до приблизительно 50 мл. Полученную смесь экстрагировали с помощью МТБЭ (0,10 л × 2) и объединенные органические слои промывали водой (20 мл), 9% масс. NaHCO3 (3 г), концентрировали, и подвергали азеотропной перегонке два раза с этанолом (50 мл каждый раз). Полученную смесь разбавляли МТБЭ (50 мл) и фильтровали. Фильтрат концентрировали и разбавляли этанолом, чтобы установить общий вес 50,0 г сырого 51, который использовали на следующей стадии без дополнительной концентрации или очистки.

[0090] Образование 52 и 53 через гидрирование с помощью газообразного Н2: 5,0 г аликвоты 51 (10% от общего числа, указанного выше) разбавляли этанолом (10 мл) и подвергали гидрированию с помощью 10% масс. Pd-C (0,272 г) в атмосфере 1,04 бар газообразного H2. Через 24 ч реакционную смесь фильтровали через слой целита (2 г). Реактор и осадок на фильтре промывали этанолом (10 мл) и фильтрат концентрировали досуха с получением трет-бутил ((3S,5R)-5-метилпиперидин-3-ил)карбамата, 52 и трет-бутил ((3R,5S)-5-метилпиперидин-3-ил)карбамата, 53 (0,472 г, 2,21 ммоль, выход 85%, соотношение 52:53 1:5-6 посредством 1H-ЯМР) в виде белого твердого вещества.

[0091] Образование 52 и 53 через гидрирование с переносом водорода: 10 г аликвоты 51 (20% от общего числа, указанного выше) концентрировали и смешивали с водой (10 мл) с последующим добавлением формиата аммония (3,28 г, 52 ммоль) и этанола (20 мл). 5% масс. Pd-C (0,548 г) добавляли в атмосфере N2, после чего полученную смесь перемешивали при 25-30°С в течение 20 ч. Полученную после завершения реакции реакционную смесь фильтровали через слой целита 545 (4 г), осадок на фильтре промывали этанолом (20 мл), и фильтрат концентрировали досуха. Добавляли 1,0М NaOH (6 мл) и смесь дважды экстрагировали с помощью ДХМ (40 мл каждый раз). Объединенные органические слои промывали 25% масс. NaCl (6 мл), сушили над Na2SO4 (4 г), фильтровали и концентрировали с получением 52 и 53, в виде желто-белого твердого вещества (0,844 г, 3,94 ммоль, выход 75%, цис/транс 3:1).

[0092] Соединение 52 можно также получить в соответствии с описанным способом (заявка WO2010/009014, содержание которой включено в настоящую заявку посредством ссылки).

[0093] Разделение 53: Рацемическую смесь 52 и 53 (84 г, 0,392 моль) суспендировали в ацетоне/ИПСе 95:5 (1596 мл и 84 мл). (2R,3R)-2,3-бис((4-метоксибензолил)окси)янтарную кислоту (L-DATA; 164 г, 0,392 моль) добавляли при комнатной температуре и полученную в результате смесь перемешивали в течение ночи (20 ч). Белый осадок собирали фильтрованием, промывали предварительно охлажденным ацетоном (1600 мл), и сушили под вакуумом. Рекуперированную диастереомерную соль (dr=94,9:5,1) подвергали повторному суспендированию в ацетоне (1000 мл). Фильтрование с последующей сушкой давало 65 г 53 ½ соли L-DATA (dr=98,5:1,5, 0,15 моль, выход 39%). Условия хиральной ВЭЖХ: колонка Lux 3u Cellulose-4 (00G-4490-E0), подвижная фаза с использованием изократической смеси 90% А (MeCN+0,1% ДЭА) и 10% B (МеОН+0,1% ДЭА).

[0094] К перемешиваемой суспензии 53 ½ соли L-DATA (156 г, 0,368 моль) в ДХМ (1248 мл) добавляли 1,0М NaOH (624 мл, 0,624 моль) медленно при температуре окружающей среды. Через 1 ч слои разделяли. Водный слой экстрагировали с помощью ДХМ (1200 мл). Объединенные органические слои промывали водой (1500 мл) и концентрировали с получением 53 в виде белого твердого вещества (75 г, 0,350 моль, выход 95%).

[0095] Соединение 55 (ER-888840): К перемешиваемой суспензии 53 (2,52 г, 11,74 ммоль) и 3 (2,28 г, 9,78 ммоль) в ДМА (6.84 мл) добавляли ДИПЭА (3,42 мл) с последующим нагреванием и кипячением в течение 3 часов. Полученную после завершения реакции реакционную смесь охлаждали до комнатной температуры, распределяли между EtOAc/н-гептан 2:1 (180 мл) и 5% масс. NaCl (60 мл), и фильтровали через слой целита 545 (5 г). Органический слой промывали 5% масс. NaCl (60 мл), обрабатывали Флорисилом (7,7 г), фильтровали, промывали EtOAc (30 мл) и концентрировали. Сырой продукт, полученный таким образом, очищали на силикагеле (40 г, ступенчатое элюирование с помощью ДХМ/МеОН 19:1, 9:1 и 4:1) с получением трет-бутил ((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)карбамата, 54, в виде твердого вещества оранжевого цвета, которое непосредственно использовали в следующей реакции.

[0096] К раствору 54 в ДХМ (20 мл) медленно добавляли ТФУК (20 мл) и перемешивали в течение дополнительных 30 мин. Полученную после завершения реакции реакционную смесь концентрировали, распределяли между ДХМ (500 мл) и насыщенным раствором NaHCO3 (220 г). Органический слой промывали нас. раствором NaHCO3 (220 г) и концентрировали с получением сырого продукта в виде твердого вещества оранжевого цвета/масла, которое очищали на силикагеле (40 г, элюирование с помощью 100% EtOAc, затем ступенчато ДХМ/MeOH 4:1 и 7:3) с получением 55 (ER-888840, 1,401 г, 5,26 ммоль, выход 53% в пересчете на 47), в виде оранжевой пены.

[0097] ER-888840-HCl: 55 (33,3 мг, 0,125 ммоль) суспендировали в ИПСе (9,63 мл) и нагревали до 45°С с последующим добавлением 0,1М HCl (1,13 мл, 0,12 ммоль), поддерживая температуру 40-45°C. Полученную смесь охлаждали до комнатной температуры, перемешивание продолжали в течение 2 ч. Желтый осадок собирали фильтрацией, промывали ИПСом (2,0 мл), сушили в атмосфере N2/вакуума в течение 2 ч, а затем сушили в вакуумной печи при 45°С в течение 20 ч с получением ER-888840-HCl в виде желтого твердого вещества (14,5 мг, 0,048 ммоль, выход 38%).

[0098] ER-878921 (5,2 мг, 0,021 ммоль, выход 32,8%) получали аналогичным способом, что и ER-888840, исходя из соединения 3 (15 мг, 0,064 ммоль) и дигидрохлорида (R)пиперидин-3-амина (13,4 мг, 0,077 ммоль). Реакционную смесь проводили в микроволновом реакторе при 180°С в течение 3 ч и очищали способами, описанными для данной серии примеров.

[0099] Получение ER-896464 или соединения 56, схема 14: К перемешиваемой суспензии ER-888840 (175 мг, 0,657 ммоль) в уксусной кислоте (1 мл, 17,468 ммоль) добавляли нитрит натрия (91 мг, 1,314 ммоль) в 150 мкл воды по каплям в течение 3 мин. Полученную смесь перемешивали 40 мин при комнатной температуре, по прошествии этого времени ER-888840 еще оставался, как показывала ТСХ. Добавляли еще 1 экв нитрита натрия в 100 мкл воды, и смесь дополнительно перемешивали в течение 1 часа при комнатной температуре. Полученную после завершения реакции реакционную смесь концентрировали, и остаток растворяли в ДХМ (10 мл), промывали нас. раствором NaHCO3 (5 мл), сушили над MgSO4, фильтровали и концентрировали досуха. Остаток растворяли в этаноле (1 мл) и обрабатывали 10% водным раствором гидроксида натрия (100 мкл). После перемешивания в течение 90 мин при комнатной температуре смесь разбавляли метиленхлоридом и промывали водой, сушили над MgSO4, фильтровали и концентрировали досуха. Остаток очищали на силикагеле (Biotage, элюируя смесью EtOAc/гептаном от 0 до 70%) с получением 2 элюированных соединений, предварительно идентифицированных как цис- и транс-изомеры O-ацетата. Основной пик, элюированный смесью 70% EtOAc/гептан, идентифицирован как гидрокси эпимеры в виде смеси цис- к транс-изомеров 4:1-5:1. С цис-56 или ER-896464 (95 мг, 0,355 ммоль, выход 54,1%) в качестве основного диастереомера.

[0100] Получение ER-897184⋅HCl: К перемешиваемому раствору 54 (100 мг, 0,273 ммоль) в ДМФ (1,00 мл, 12,915 ммоль) добавляли гидрид натрия (60% дисперсия в масле, 12,01 мг, 0,30 ммоль). Полученную смесь перемешивали 30 мин при комнатной температуре, после чего добавляли метилиодид (0,020 мл, 0,327 ммоль). Конечную реакционную смесь перемешивали 2 ч при комнатной температуре, после чего полученную после завершения реакции реакционную смесь медленно гасили водным раствором хлорида аммония (5 мл). Смесь экстрагировали три раза с помощью EtOAc/гептана 1:1 (3 мл каждый раз), и объединенные органические экстракты промывали водой (3 мл), насыщенным раствором соли (3 мл), сушили над MgSO4, фильтровали и концентрировали. Сырой продукт очищали на силикагеле, элюируя смесью 40% EtOAc/гептан с получением трет-бутил ((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил) (метил)карбамата (96 мг, 0,252 ммоль, выход 92%).

[0101] К раствору трет-бутил ((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)(метил)карбамата (96 мг, 0,252 ммоль) в ДХМ (1,0 мл) добавляли ТФУК (1,00 мл, 12,98 ммоль). Смесь перемешивали при комнатной температуре в течение 1 ч, после чего всю реакционную смесь концентрировали досуха, остаток растворяли в МеОН (10 мл), и добавляли МР-карбонатную основную смолу (~ 250 мг). Полученную смесь перемешивали при комнатной температуре в течение 30 мин, после чего суспензию фильтровали, фильтрат концентрировали и сушили в вакууме. Амин обрабатывали с помощью 4,0М HCl в диоксане (0,037 мл) при комнатной температуре в течение 30 мин, после чего смесь подвергали азеотропной перегонке досуха два раза с толуолом (2 мл каждого) и сушили в вакууме с получением ER-897184-HCl (79,8 мг, 0,252 ммоль, выход 100,0%) в виде оранжевого твердого вещества.

[0102] ER-897275 (49 мг, 0,151 ммоль, выход 55,3%) получали аналогичным способом, что и ER-897184, исходя из 54-2HCl (100 мг, 0,273 ммоль) и 1-бром-2-метоксиэтана (37,9 мг , 0,273 ммоль). Вторичный амин выделяли без образования соли HCl.

[0103] Получение ER-899369⋅HCl через восстановительное аминирование соединения 55, схема 4:

[0104] К раствору трет-бутил (3-формилоксетан-3-ил)карбамата (47 мг, 0,234 ммоль) и 55 (81 мг, 0,304 ммоль) в ДХЭ (5 мл) добавляли триацетоксиборгидрид натрия (99 мг, 0,467 ммоль). Реакционную смесь перемешивали 18 ч при комнатной температуре, после чего полученную после завершения реакции реакционную смесь гасили с помощью 1н NaOH (5 мл). После перемешивания в течение 10 мин смесь разбавляли водой (5 мл) и EtOAc (10 мл). Водный слой дважды экстрагировали с помощью EtOAc (5 мл каждый раз), и объединенные органические слои промывали водой (5 мл) и насыщенным солевым раствором (5 мл), сушили над MgSO4, фильтровали и концентрировали. Сырой продукт очищали на силикагеле (20 г, элюирование с помощью 10-100% EtOAc/ДХМ) с получением Вос-защищенного промежуточного продукта, защиту которого удаляли и превращали в соединение ER-899369⋅HCl (60,1 мг, 0,155 ммоль, выход 66,4%), как описано для ER-897184-HCl.

[0105] ER-899075 (48,8 мг, 0,135 ммоль, выход 91%) получали аналогичным способом, что и ER-899369, исходя из с 55-2HCl (50,3 мг, 0,148 ммоль) и 3-метилоксетан-3-карбальдегида (22,5 мг, 0,225 ммоль). Удаление защиты не требовалась для этого примера. Соль HCl не образовывали.

[0106] ER-899506 (107 мг, 0,305 ммоль, выход 92%) получали аналогичным способом, что и ER-99075, исходя из 55-2HCl (50,3 мг, 0,148 ммоль) и тетрагидро-4Н-пиран-4-она (0,092 мл, 0,999 ммоль).

[0107] ER-899541 (11 мг, 0,034 ммоль, выход 17,8%) получали аналогичным способом, что и ER-99075, исходя из 55-2HCl (65 мг, 0,192 ммоль) и оксетан-3-она (0,025 мл, 0,384 ммоль) вместе с ДИПЭА (0,05 мл, 0,288 ммоль).

[0108] ER-899543 (11 мг, 0,034 ммоль, выход 17,8%) получали аналогичным образом, что и ER-99541, исходя из 55-2HCl (57 мг, 0,168 ммоль) и 5-(трифторметил)пиколинальдегида (58,8 мг, 0,336 ммоль).

[0109] ER-899544 (37 мг, 0,110 ммоль, выход 65,5%) получали аналогичным способом, что и ER-99541, исходя из 55-2HCl (57 мг, 0,168 ммоль) и дигидрофуран-3()-она (28,9 мг, 0,336 ммоль).

[0110] ER-899551 (23 мг, 0,066 ммоль, выход 32,6%) получали аналогичным способом, что и ER-99541, исходя из 55-2HCl (69 мг, 0,203 ммоль) и оксазол-2-карбальдегида (39,4 мг, 0,406 ммоль).

[0111] ER-899552 (24 мг, 0,067 ммоль, выход 32,6%) получали аналогичным способом, что и ER-99541, исходя из 55-2HCl (69 мг, 0,203 ммоль) и 1-метил--имидазол-4-карбальдегида (44,7 мг, 0,406 ммоль).

[0112] ER-899563 (8,8 мг, 0,021 ммоль, выход 12,3%) получали аналогичным образом, что и ER-99541, исходя из 55-2HCl (57 мг, 0,168 ммоль) и 6-(трифторметил)никотинальдегида (58,8 мг, 0,336 ммоль).

[0113] ER-899564 (17 мг, 0,049 ммоль, выход 12,3%) получали аналогичным способом, что и ER-99541, исходя из 55-2HCl (58 мг, 0,171 ммоль) и -пиразол-5-карбальдегида (33 мг, 0,342 ммоль).

[0114] ER-899565 (27 мг, 0,072 ммоль, выход 38,1%) получали аналогичным способом, что и ER-99541, исходя из 55-2HCl (64 мг, 0,189 ммоль) и 1,4-диметил-1H-пиразол-3-карбальдегида (46,9 мг, 0,378 ммоль).

[0115] ER-899566 (25 мг, 0,067 ммоль, выход 36,0%) получали аналогичным способом, что и ER-99541, исходя из 55-2HCl (63 мг, 0,186 ммоль) и 3,5-диметилизоксазол-4-карбальдегида (46,5 мг, 0,372 ммоль).

[0116] ER-899577 (18 мг, 0,052 ммоль, выход 31,8%) получали аналогичным способом, что и ER-99541, исходя из 55-2HCl (55 мг, 0,162 ммоль) и пирролидин-2,4-диона (32,1 мг , 0,324 ммоль).

[0117] ER-899602 (11 мг, 0,028 ммоль, выход 4,8%) получали аналогичным образом, что и ER-99541, исходя из 55-2HCl (201 мг, 0,592 ммоль) и 3-(метилтио)пропаналя (123 мг, 1,185 ммоль) с последующим растворением промежуточного тиола в ДХМ (3 мл), охлаждением до 0°С и добавлением 3-хлорпероксибензойной кислоты (255 мг, 1,48 ммоль). Реакционную смесь перемешивали при 0°С в течение 5 мин, нагревали до комнатной температуры и перемешивали дополнительно 3 ч. 3-хлорпероксибензойную кислоту (100 мг, 0,580 ммоль) добавляли после охлаждения реакционной смеси до 0°С с последующим перемешиванием при комнатной температуре в течение 1 ч. Полученную после завершения реакции реакционную смесь разбавляли с помощью ДХМ (10 мл) и промывали насыщенным раствором NaHCO3 (5 мл) и насыщенным солевым раствором (5 мл). Объединенные водные слои дважды экстрагировали с помощью ДХМ (5 мл каждый раз), после чего объединенные органические слои сушили над безводным Na2SO4, фильтровали и концентрировали досуха. Сырой остаток очищали на силикагеле (Biotage ultra, 10 г, элюируя градиентом от 0 до 20% МеОН в ДХМ) с последующим концентрированием целевых фракций и повторной очисткой на колонке ВЭЖХ с обращенной фазой (колонка X-Bridge C18 19 × 100 мм; элюирование возрастающим градиентом ацетонитрила в воде, содержащей 0,1% NH4OH), целевые фракции концентрировали и сушили в вакууме с получением ER-899602.

[0118] ER-899604 (18 мг, 0,050 ммоль, выход 25,0%) получали аналогичным способом, что и ER-99541, исходя из 55-2HCl (68 мг, 0,200 ммоль) и 2-оксоциклопентанкарбонитрила (43,7 мг, 0,401 ммоль).

[0119] ER-899607 (15 мг, 0,040 ммоль, выход 22,1%) получали аналогичным способом, что и ER-99541, исходя из 55-2HCl (62 мг, 0,183 ммоль) и 1-(пиридин-2-ил)этанона (0,041 мл, 0,365 ммоль).

[0120] ER-899621 (25 мг, 0,071 ммоль, выход 42,5%) получали аналогичным способом, что и ER-99541, исходя из 55-2HCl (57 мг, 0,168 ммоль) и дигидро--пиран-3()-она (33,6 мг, 0,336 ммоль).

[0121] ER-899633 (41,2 мг, 0,103 ммоль, выход 52,3%) получали аналогичным способом, что и ER-99541, исходя из 55-2HCl (67 мг, 0,197 ммоль) и дигидро--тиопиран-4()-она 1,1-диоксида (58,5 мг, 0,395 ммоль).

[0122] ER-899634 (20 мг, 0,052 ммоль, выход 30,9%) получали аналогичным способом, что и ER-99541, исходя из 55-2HCl (57 мг, 0,168 ммоль) и 1-(6-метилпиридин-2-ил)этанона (45,4 мг, 0,336 ммоль).

[0123] ER-899630 (12 мг, 0,033 ммоль, выход 8,7%) и ER-899631 (19 мг, 0,052 ммоль, выход 13,7%) получали аналогичным способом, что и ER-899541, исходя из 55-2HCl (129 мг , 0,380 ммоль) и 4-гидроксициклогексанона (87 мг, 0,76 ммоль), где оба диастереомера были выделены с помощью хроматографии на силикагеле. Примечание: стереохимия для обоих соединений произвольно задана и не была подтверждена.

[0124] ER-899632 (12 мг, 0,033 ммоль, выход 18,9%) получали путем окисления диастереомерной смеси ER-899630 и ER-899631 (64 мг, 0,176 ммоль) посредством добавления DMP (373 мг, 0,879 ммоль) в виде четырех порций в течение 1 ч на порцию при комнатной температуре в ДХМ (3 мл). Полученную после завершения реакции реакционную смесь разбавляли ДХМ (10 мл) и промывали насыщенным раствором NaHCO3 (5 мл), затем насыщенным солевым раствором (5 мл). Объединенные водные слои дважды экстрагировали с помощью ДХМ (5 мл каждый раз), после чего объединенные органические слои сушили над безводным Na2SO4, фильтровали и концентрировали досуха. Сырой остаток очищали на силикагеле (Biotage ultra, 10 г, элюирование от 0 до 20% МеОН в ДХМ) с последующим концентрированием целевых фракций и повторной очисткой на колонке ВЭЖХ с обращенной фазой ((колонка X-Bridge C18 19 × 100 мм; элюирование возрастающим градиентом ацетонитрила в воде, содержащей 0,1% NH4OH), целевые фракции концентрировали и сушили в вакууме с получением ER-899632.

[0125] ER-899508: К перемешиваемой суспензии 55 (85 мг, 0,251 ммоль) и карбоната калия (34,6 мг, 0,251 ммоль) в ДМФ (1 мл, 12,92 ммоль) добавляли 3,3,3-трифторпропил метансульфонат (0,052 мл, 0,376 ммоль). Реакционную смесь перемешивали при комнатной температуре в течение 24 ч, после чего реакционную смесь разбавляли с помощью EtOAc-гептана (~ 4:1) (10 мл) и воды (5 мл). Водный слой дважды экстрагировали с помощью EtOAc-гептана (~ 4:1) (5 мл каждый раз), и объединенные органические слои промывали насыщенным солевым раствором (5 мл), сушили над безводным Na2SO4, фильтровали и концентрировали при пониженном давлении. Сырой продукт очищали на силикагеле (12 г колонка, элюирование с помощью 25-100% EtOAc в гептане) с получением соединения ER-899508 (3,7 мг, 0,013 ммоль, выход 5,0%) в качестве побочного продукта после объединения целевых фракций, концентрирования и сушки в вакууме.

[0126] ER-899823: К перемешиваемому раствору оксалилхлорида (0,108 мл, 1.234 ммоль) в ДХМ (2 мл) при -78°С добавляли по каплям ДМСО (0,175 мл, 2.469 ммоль). После того, как добавление было завершено, смесь перемешивали 30 мин при -78°С, после чего добавляли по каплям раствор ER-896464 (220 мг, 0,823 ммоль) в ДХМ (2 мл) с последующим нагреванием до комнатной температуры и перемешивали в течение дополнительного 1 ч. ДИПЭА (0,719 мл, 4,115 ммоль) добавляли по каплям, перемешивали в течение 1 ч с последующим гашением водным раствором хлорида аммония (2 мл). Смесь экстрагировали три раза с помощью EtOAc (5 мл каждый раз). Объединенные органические слои промывали насыщенным солевым раствором (5 мл), сушили над MgSO4, фильтровали и концентрировали с получением сырого (S)-5-(3-метил-5-оксопиперидин-1-ил)хинолин-8-карбонитрила, который использовали на следующей стадии без дополнительной очистки.

[0127] К раствору (S)-5-(3-метил-5-оксопиперидин-1-ил)хинолин-8-карбонитрила (50 мг, 0,188 ммоль) и 2-аминопропан-1-ола (28,3 мг, 0,377 ммоль) в ДХЭ (2 мл, 25,384 ммоль) добавляли уксусную кислоту (10,79 мкл, 0,188 ммоль) и триацетоксиборгидрид натрия (160 мг, 0,754 ммоль) с последующим нагреванием при температуре 50°С в течение 24 ч. Полученную после завершения реакции реакционную смесь охлаждали до комнатной температуры, гасили с помощью 1н. NaOH (2 мл) и воды (5 мл). Смесь экстрагировали три раза с помощью EtOAc (5 мл каждый раз), и объединенные органические слои промывали насыщенным солевым раствором (5 мл), сушили над MgSO4, фильтровали и концентрировали. Сырой продукт очищали на силикагеле (10 г, элюирование с помощью от 0 до 10% МеОН в ДХМ) с получением ER-899823 (29 мг, 0,089 ммоль, выход 47,4%) после объединения целевых фракций, концентрирования и сушки в вакууме.

[0128] ER-899504 и ER-899505: К перемешиваемой суспензии ER-888840 (688 мг, 2,028 ммоль) и карбоната калия (423 мг, 3,061 ммоль) в ДМФ (3,00 мл) добавляли этиловый эфир бромуксусной кислоты (368 мкл, 3,305 ммоль). Реакционную смесь перемешивали при комнатной температуре в течение 14 ч, после чего полученную после завершения реакции реакционную смесь разбавляли нас. NaHCO3 (5 мл) и EtOAc (10 мл) и слои разделяли. Водный слой дважды экстрагировали EtOAc (5 мл каждый раз), и объединенные органические слои промывали насыщенным солевым раствором (5 мл), сушили над Na2SO4, фильтровали и концентрировали. Сырой продукт очищали с помощью обработки на силикагеле (10 г, элюирование с помощью от 0 до 100% EtOAc в гептане) с получением двух продуктов в виде желтых масел после отдельного объединения каждых целевых фракций, концентрирования и сушки в вакууме ER-899505 (382 мг, выход 0,871 ммоль, 43,0%) и ER-899504 (207 мг, 0,587 ммоль, выход 29,0%).

[0129] ER-899715: К перемешиваемому раствору ER-899541 (40 мг, 0,124 ммоль) в 37%-ном водном формальдегиде (1 мл, 0,124 ммоль) добавляли муравьиную кислоту (70 мкл, 1,825 ммоль) с последующим нагреванием при 100°С в течение 2 ч. Полученную после завершения реакции реакционную смесь разбавляли водным раствором NaHCO3 (5 мл) и трижды экстрагировали с помощью EtOAc (3 мл каждый раз). Объединенные органические слои промывали насыщенным солевым раствором (5 мл), сушили над MgSO4, фильтровали и концентрировали. Остаток растворяли в EtOAc (0,5 мл) с последующим добавлением уксусной кислоты (0,008 мл, 0,124 ммоль) и перемешивали 30 минут при комнатной температуре, после чего его концентрировали досуха в вакууме с получением ER-899715-HOAc (32 мг, 0,081 ммоль, выход 65,1%) без какой-либо необходимой дополнительной очистки.

[0130] ER-896310: К перемешиваемому раствору ER-888840 (100 мг, 0,375 ммоль) в ДХМ (1,0 мл, 15.542 ммоль) добавляли пиридин (0,091 мл, 1,126 ммоль) с последующим добавлением уксусного ангидрида (0,043 мл, 0,451 ммоль). Реакционную смесь перемешивали 2 ч при комнатной температуре, после чего полученную после завершения реакции реакционную смесь разбавляли с помощью ДХМ (5 мл) и промывали водным раствором NaHCO3 (2 мл). Органический слой сушили над MgSO4, фильтровали и концентрировали. Сырой продукт очищали на силикагеле (Biotage) с получением ER-896310 (97 мг, 0,315 ммоль, выход 84%) после отдельного объединения каждых целевых фракций, концентрирования и сушки в вакууме.

[0131] ER-898758 (17 мг, 0,047 ммоль, выход 15,9%) получали аналогичным способом, что и ER-896310, исходя из ER-888840-2HCl (100 мг, 0,295 ммоль) и трифторуксусного ангидрида (0,052 мл, 0,368 ммоль ).

[0132] ER-898912: К смеси ER-888840 (50 мг, 0,188 ммоль) и пиридина (0,046 мл, 0,563 ммоль) в ДХМ (2 мл) добавляли 5-метилизоксазол-3-карбонилхлорид (27,3 мг, 0,188 ммоль). Полученную смесь перемешивали 18 ч при комнатной температуре, с последующим добавлением ДМАП (23 мг, 0,188 ммоль), и оставляли реакционную смесь перемешиваться в течение 6 ч при комнатной температуре. Добавляли HATU (85,8 мг, 0,226 ммоль), и реакционную смесь перемешивали в течение 18 ч при комнатной температуре. Полученную после завершения реакции реакционную смесь разбавляли с помощью ДХМ (10 мл), а затем промывали 0,5М раствором лимонной кислоты (3 мл), водой (3 мл) и нас. NaHCO3 (3 мл). Органический слой сушили над MgSO4, фильтровали и концентрировали с последующей очисткой на силикагеле (10 г, элюирование с помощью 0-10% МеОН в ДХМ). Целевые фракции объединяли, концентрировали и сушили в вакууме с получением ER-898912 (51 мг, 0,136 ммоль, выход 72,4%).

[0133] ER-897272: К перемешиваемому раствору ER-888840 (50 мг, 0,188 ммоль), гидрохлорида 2-(диметиламино)уксусной кислоты (31,4 мг, 0,225 ммоль) и HBTU (85 мг, 0,225 ммоль) в ДХМ (2 мл) добавляли ТЭА (78 мкл, 0,563 ммоль). Реакционную смесь перемешивали в течение 18 ч при комнатной температуре, после чего полученную после завершения реакции реакционную смесь разбавляли с помощью EtOAc (5 мл), промывали водным раствором NH4Cl (2 мл), водой (2 мл) и насыщенным солевым раствором (2 мл). Органический слой сушили над MgSO4, фильтровали, концентрировали и очищали на силикагеле (Biotage, 10 г, элюирование с помощью 0-30% EtOAc в гептане) с получением ER-897272 (40 мг, 0,114 ммоль, выход 60,5%) после концентрирования и сушки в вакууме целевых фракций.

[0134] ER-897273 (43 мг, 0,127 ммоль, выход 67,6%) получали аналогичным способом, что и ER-897272, исходя из ER-888840 (50 мг, 0,188 ммоль) и 2-метоксиуксусной кислоты (20.29 мг, 0,225 ммоль).

[0135] ER-897274 (53 мг, 0,163 ммоль, выход 87,2%) получали аналогичным способом, что и ER-897272, исходя из ER-888840 (50 мг, 0,188 ммоль) и 2-((трет-бутоксикарбонил)амино)уксусной кислоты (39,5 мг, 0,225 ммоль) с последующим удалением защитной Вос-группы с использованием ТФУК и методов нейтрализации, описанных в предыдущих примерах.

[0136] ER-897607⋅HCl (47 мг, 0,121 ммоль, выход 64,9%) получали аналогичным способом, что и ER-897272, исходя из ER-888840 (50 мг, 0,188 ммоль) и 2-((трет-бутоксикарбонил)амино)-2-метилпропановая кислоты (45,8 мг, 0,225 ммоль) с добавлением EDC (54,0 мг, 0,282 ммоль) с последующим удалением защитной Вос-группы с использованием HCl в диоксане следуя методикам, описанным в предыдущих примерах.

[0137] ER-897608⋅HCl (40 мг, 0,107 ммоль, выход 71,2%) получали аналогичным способом, что и ER-897607, исходя из ER-888840 (40 мг, 0,150 ммоль) и 2-((трет-бутоксикарбонил)-(метил)амино)уксусной кислоты (34,1 мг, 0,18 ммоль).

[0138] ER-897971: К перемешиваемому раствору ER-888840-HCl (35,0 мг, 0,103 ммоль) в NMP (500,0 мкл) добавляли 2-гидроксиуксусную кислоту (11,0 мг, 0,145 ммоль), HBTU (43,0 мг, 0,113 ммоль) и ДИПЭА (45,0 мкл, 0,258 ммоль). Реакционную смесь перемешивали при 50°С в течение ночи с последующей непосредственной очисткой через колонку ВЭЖХ с обращенной фазой (колонка X-Bridge C18 19 × 100 мм; элюирование возрастающим градиентом ацетонитрила в воде, содержащей 0,1% NH4OH) Фракции, содержащие продукт, объединяли и концентрировали в вакууме с получением ER-897971 (16,9 мг, 0,052 ммоль, выход 50,5%).

[0139] ER-897972 (15,2 мг, 0,014 ммоль, выход 13,8%) получали аналогичным способом, что и ER-897971, исходя из ER-888840-HCl (35,0 мг, 0,103 ммоль) и (S)-2-гидрокси-3-метилбутановой кислоты (18,0 мг, 0,152 ммоль).

[0140] ER-897973 (5,2 мг, 0,039 ммоль, выход 38,1%) получали аналогичным способом, что и ER-897971, исходя из ER-888840-HCl (35,0 мг, 0,103 ммоль) и 3-гидроксибензойной кислоты (21,0 мг, 0,152 ммоль).

[0141] ER-897975 (4,7 мг, 0,012 ммоль, выход 11,8%) получали аналогичным способом, что и ER-897971, исходя из ER-888840-HCl (35,0 мг, 0,103 ммоль) и 4-гидроксибензойной кислоты (21,0 мг, 0,152 ммоль).

[0142] ER-897976 (15,9 мг, 0,045 ммоль, выход 43,5%) получали аналогичным способом, что и ER-897971, исходя из ER-888840-HCl (35,0 мг, 0,103 ммоль) и 2-(метилтио)уксусной кислоты (16,0 мг, 0,151 ммоль).

[0143] ER-897977 (16,7 мг, 0,045 ммоль, выход 43,9%) получали аналогичным способом, что и ER-897971, исходя из ER-888840-HCl (35,0 мг, 0,103 ммоль) и 2-(этилтио)уксусной кислоты (18,0 мг, 0,150 ммоль).

[0144] ER-897978 (12,6 мг, 0,033 ммоль, выход 31,6%) получали аналогичным способом, что и ER-897971, исходя из ER-888840-HCl (35,0 мг, 0,103 ммоль) и 2-(метилсульфонил)уксусной кислоты (21,0 мг, 0,152 ммоль).

[0145] ER-897979 (9,2 мг, 0,027 ммоль, выход 26,2%) получали аналогичным способом, что и ER-897971, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)пропановой кислоты (29,4 мг, 0,155 ммоль), с последующим удалением защитной Вос-группы с использованием ТФУК и методов нейтрализации, описанных в предыдущих примерах.

[0146] ER-897980 (12,6 мг, 0,033 ммоль, выход 32,0%) получали аналогичным способом, что и ER-897979, исходя из 54b (35,0 мг, 0,103 ммоль) и (R)-2-((трет-бутоксикарбонил)амино)пропановой кислоты (28,4 мг, 0,150 ммоль).

[0147] ER-897981 (12,8 мг, 0,037 ммоль, выход 35,9%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 1-((трет-бутоксикарбонил)амино)-циклопропанкарбоновой кислоты (30,7 мг, 0,153 ммоль).

[0148] ER-897982 (1,9 мг, 0,005 ммоль, выход 4,9%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (R)-2-((трет-бутоксикарбонил)амино)-3-гидроксипропановой кислоты (30,9 мг, 0,151 ммоль).

[0149] ER-897983 (5,6 мг, 0,015 ммоль, выход 14,6%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (R)-1-(трет-бутоксикарбонил)пирролидин-2-карбоновой кислоты (33,2 мг, 0,154 ммоль).

[0150] ER-897984 (0,3 мг, 0,001 ммоль, выход 1,0%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 2-(1-(трет-бутоксикарбонил)азетидин-3-ил)уксусной кислоты (33,0 мг, 0,153 ммоль).

[0151] ER-897985 (8,7 мг, 0,024 ммоль, выход 23,3%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 1-(трет-бутоксикарбонил)пирролидин-3-карбоновой кислоты (32,3 мг, 0,150 ммоль).

[0152] ER-897986 (12,5 мг, 0,034 ммоль, выход 33,0%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 2-((трет-бутоксикарбонил)амино)-3-метилбутановой кислоты (34,0 мг, 0,156 ммоль).

[0153] ER-897987 (2,8 мг, 0,008 ммоль, выход 7,8%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-3-метилбутановой кислоты (33,5 мг, 0,154 ммоль).

[0154] ER-897988 (9,9 мг, 0,027 ммоль, выход 26,2%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 5-((трет-бутоксикарбонил)амино)пентановой кислоты (33,1 мг, 0,152 ммоль).

[0155] ER-897989 (9,0 мг, 0,025 ммоль, выход 24,3%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)пентановой кислоты (32,7 мг, 0,151 ммоль).

[0156] ER-897990 (3,5 мг, 0,010 ммоль, выход 9,2%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-3-метилпропановой кислоты (33,0 мг, 0,151 ммоль).

[0157] ER-897991 (7,1 мг, 0,019 ммоль, выход 18,4%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (2R,3S)-2-((трет-бутоксикарбонил)амино)-3-гидроксибутановой кислоты (33,9 мг, 0,155 ммоль).

[0158] ER-897992 (12,2 мг, 0,032 ммоль, выход 31,1%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 1-(трет-бутоксикарбонил)пиперидин-4-карбоновой кислоты (34,8 мг, 0,152 ммоль).

[0159] ER-897993 (9,7 мг, 0,026 ммоль, выход 25,2%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 1-(трет-бутоксикарбонил)пиперидин-3-карбоновой кислоты (34,4 мг, 0,150 ммоль).

[0160] ER-897994 (9,8 мг, 0,026 ммоль, выход 25,2%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 2-(1-(трет-бутоксикарбонил)пирролидин-3-ил)уксусной кислоты (34,4 мг, 0,150 ммоль).

[0161] ER-897995 (10,8 мг, 0,030 ммоль, выход 27,2%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 4-(трет-бутоксикарбонил)пиперазин-2-карбоновой кислоты (34,5 мг, 0,150 ммоль).

[0162] ER-897996 (11,2 мг, 0,028 ммоль, выход 29,1%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (2S,4R)-1-(трет-бутоксикарбонил)-4-гидроксипирролидин-2-карбоновой кислоты (35,0 мг, 0,151 ммоль).

[0163] ER-897997 (4,9 мг, 0,013 ммоль, выход 12,6%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (2S,3S)-2-((трет-бутоксикарбонил)амино)-3-метилпентановой кислоты (35,6 мг, 0,154 ммоль).

[0164] ER-897998 (9,3 мг, 0,025 ммоль, выход 24,3%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (R)-2-((трет-бутоксикарбонил)амино)-4-метилпентановой кислоты (35,7 мг, 0,154 ммоль).

[0165] ER-897999 (7,7 мг, 0,020 ммоль, выход 29,5%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-4-метилпентановой кислоты (34,8 мг, 0,150 ммоль).

[0166] ER-898000 (9,5 мг, 0,025 ммоль, выход 24,3%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-3,3-диметилбутановой кислоты (34,9 мг, 0,151 ммоль).

[0167] ER-898001 (3,3 мг, 0,009 ммоль, выход 8,7%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (R)-2-((трет-бутоксикарбонил)амино)-3,3-диметилбутановой кислоты (34,9 мг, 0,151 ммоль).

[0168] ER-898334 (4,5 мг, 0,012 ммоль, выход 11,7%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 2-((трет-бутоксикарбонил)(метил)амино)-3-метилбутановой кислоты (35,0 мг, 0,151 ммоль).

[0169] ER-898335 (5,1 мг, 0,013 ммоль, выход 12,6%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-4-амино-3-((трет-бутоксикарбонил)амино)-4-оксобутановой кислоты (35,3 мг, 0,152 ммоль).

[0170] ER-898336 (2,6 мг, 0,007 ммоль, выход 6,6%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-4-амино-2-((трет-бутоксикарбонил)амино)-4-оксобутановой кислоты (35,3 мг, 0,152 ммоль).

[0171] ER-898337 (2,8 мг, 0,007 ммоль, выход 7,1%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (R)-4-амино-2-((трет-бутоксикарбонил)амино)-4-оксобутановой кислоты (35,4 мг, 0,152 ммоль).

[0172] ER-898338 (4,5 мг, 0,012 ммоль, выход 11,7%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-3-(трет-бутоксикарбонил)тиазолидин-4-карбоновой кислоты (35,8 мг, 0,153 ммоль).

[0173] ER-898339 (2,7 мг, 0,007 ммоль, выход 6,8%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 4-((трет-бутоксикарбонил)амино)бензойной кислоты (36,1 мг, 0,152 ммоль).

[0174] ER-898341 (7,5 мг, 0,019 ммоль, выход 18,4%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 2-(1-(трет-бутоксикарбонил)пиперидин-4-ил)уксусной кислоты (36,0 мг, 0,148 ммоль).

[0175] ER-898342 (8,8 мг, 0,022 ммоль, выход 21,3%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 1-(трет-бутоксикарбонил)-4-метилпиперидин-4-карбоновой кислоты (36,0 мг, 0,148 ммоль).

[0176] ER-898343 (2,2 мг, 0,006 ммоль, выход 5,4%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 1-((трет-бутоксикарбонил)амино)-3-гидроксициклопентанкарбоновой кислоты (37,0 мг, 0,151 ммоль).

[0177] ER-898344 (9,4 мг, 0,024 ммоль, выход 23,3%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)(метил)амино)-4-метилпентановой кислоты (37,0 мг, 0,151 ммоль).

[0178] ER-898345 (8,0 мг, 0,020 ммоль, выход 19,4%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-4,4-диметилпентановой кислоты (37,0 мг, 0,151 ммоль).

[0179] ER-898346 (6,5 мг, 0,017 ммоль, выход 16,5%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)-(метил)амино)гексановой кислоты (37,0 мг, 0,151 ммоль).

[0180] ER-898347 (0,9 мг, 0,002 ммоль, выход 2,2%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-5-амино-2-((трет-бутоксикарбонил)амино)-5-оксопентановой кислоты (37,0 мг, 0,150 ммоль).

[0181] ER-898348 (6,3 мг, 0,016 ммоль, выход 15,5%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (R)-2-((трет-бутоксикарбонил)амино)-3-(этилтио)пропановой кислоты (37,0 мг, 0,148 ммоль).

[0182] ER-898349 (6,0 мг, 0,015 ммоль, выход 14,6%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 2-((трет-бутоксикарбонил)амино)-4-(метилтио)бутановой кислоты (37,0 мг, 0,148 ммоль).

[0183] ER-898350 (5,6 мг, 0,014 ммоль, выход 13,6%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (R)-2-((трет-бутоксикарбонил)амино)-2-фенилуксусной кислоты (38,0 мг, 0,151 ммоль).

[0184] ER-898351 (8,6 мг, 0,022 ммоль, выход 21,3%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-2-фенилуксусной кислоты (38,0 мг, 0,151 ммоль).

[0185] ER-898352 (5,1 мг, 0,013 ммоль, выход 12,6%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-3-(1H-имидазол-4-ил)пропановой кислоты (38,0 мг, 0,149 ммоль).

[0186] ER-898353 (6,8 мг, 0,017 ммоль, выход 16,5%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 3-(1-(трет-бутоксикарбонил)пиперидин-2-ил)пропановой кислоты (39,0 мг, 0,152 ммоль).

[0187] ER-898354 (4,9 мг, 0,012 ммоль, выход 11,7%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 3-(1-(трет-бутоксикарбонил)пиперидин-3-ил)пропановой кислоты (39,0 мг, 0,152 ммоль).

[0188] ER-898355 (3,2 мг, 0,008 ммоль, выход 7,7%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 1-((трет-бутоксикарбонил)амино)-4-гидроксициклогексанкарбоновой кислоты (39,0 мг, 0,150 ммоль).

[0189] ER-898356 (3,3 мг, 0,008 ммоль, выход 7,8%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (R)-2-((трет-бутоксикарбонил)амино)-3-фенилпропановой кислота (40,0 мг, 0,151 ммоль).

[0190] ER-898357 (9,1 мг, 0,022 ммоль, выход 21,3%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (2S)-2-((трет-бутоксикарбонил)амино)-4-(метилсульфинил)бутановой кислоты (40,1 мг, 0,151 ммоль).

[0191] ER-898358 (12,6 мг, 0,030 ммоль, выход 29,1%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-3-(пиридин-2-ил)пропановой кислоты (40,0 мг, 0,150 ммоль).

[0192] ER-898359 (16,3 мг, 0,039 ммоль, выход 37,9%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-3-(пиридин-4-ил)пропановой кислоты (40,0 мг, 0,150 ммоль).

[0193] ER-898360 (17,1 мг, 0,041 ммоль, выход 39,8%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-3-(пиридин-3-ил)пропановой кислоты (40,0 мг, 0,150 ммоль).

[0194] ER-898361 (19,6 мг, 0,047 ммоль, выход 45,6%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (R)-2-((трет-бутоксикарбонил)амино)-3-(пиридин-3-ил)пропановой кислоты (40,0 мг, 0,150 ммоль).

[0195] ER-898362 (9,1 мг, 0,022 ммоль, выход 21,4%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 5-(трет-бутоксикарбонил)-4,5,6,7-тетрагидро-1H-пиразоло[4,3-с]пиридин-3-карбоновой кислоты (40,0 мг, 0,150 ммоль).

[0196] ER-898364 (9,1 мг, 0,022 ммоль, выход 21,4%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и 2-(1-(((трет-бутоксикарбонил)амино)метил)-циклогексил)уксусной кислоты (41,7 мг, 0,154 ммоль).

[0197] ER-898365 (11,7 мг, 0,028 ммоль, выход 27,2%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-3-(тиазол-4-ил)пропановой кислоты (41,0 мг, 0,151 ммоль).

[0198] ER-898366 (13,7 мг, 0,032 ммоль, выход 31,1%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)(метил)амино)-3-фенилпропановой кислоты (42,0 мг, 0,150 ммоль).

[0199] ER-898367 (14,5 мг, 0,034 ммоль, выход 33,0%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (R)-2-((трет-бутоксикарбонил)(метил)амино)-3-фенилпропановой кислоты (43,0 мг, 0,154 ммоль).

[0200] ER-898368 (6,8 мг, 0,016 ммоль, выход 15,5%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-3-(4-гидроксифенил)пропановой кислоты (42,2 мг, 0,150 ммоль).

[0201] ER-898369 (9,5 мг, 0,022 ммоль, выход 21,4%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-4-(метилсульфонил)бутановой кислоты (43,0 мг, 0,153 ммоль).

[0202] ER-898758 (9,5 мг, 0,022 ммоль, выход 21,4%) получали аналогичным способом, что и ER-897979, исходя из ER-888840 (35,0 мг, 0,103 ммоль) и (S)-2-((трет-бутоксикарбонил)амино)-4-(метилсульфонил)бутановой кислоты (43,0 мг, 0,153 ммоль).

[0203] ER-898761:

[0204] К перемешиваемому раствору ER-888840-2HCl (50 мг, 0,147 ммоль) в ДХМ (1,0 мл, 15,542 ммоль) и ТЭА (0,041 мл, 0,295 ммоль) добавляли 3,3,3-трифторпропановую кислоту (56,6 мг, 0,442 ммоль) и HOBT (29,9 мг, 0,221 ммоль) с последующим охлаждением до 0°C. Добавляли EDC (85 мг, 0,442 ммоль) и полученную в результате реакционную смесь перемешивали при 40°С в течение 3 ч. Полученную после завершения реакции реакционную смесь разбавляли с помощью ДХМ (2 мл) и промывали насыщенным водным раствором NH4Cl (1 мл), насыщенным водным раствором NaHCO3 (1 мл) и насыщенным солевым раствором (1 мл). Органический слой сушили над безводным Na2SO4, фильтровали и концентрировали с последующей очисткой на силикагеле (Колонка Biotage SP4. Interchim 25 г) с получением ER-898761 (36 мг, 0,096 ммоль, выход 64,9%) в виде белого твердого вещества после концентрирования и сушки в вакууме целевых фракций.

[0205] ER-898991 (3,6 мг, 0,009 ммоль, выход 5,1%) и ER-898992 (1,6 мг, 0,004 ммоль, выход 2,3%) разделяли с использованием аналогичного способа получения, что и для ER-898761, исходя из ER-888840-2HCl (60 мг, 0,177 ммоль) и 2-амино-3,3,3-трифторопропановой кислоты (25,3 мг, 0,177 ммоль). Стереохимия обоих диастереомеров произвольно задана и не подтверждена.

[0206] ER-899072 (51,4 мг, 0,137 ммоль, выход 89%) получали аналогичным образом, что и ER-898761, исходя из ER-888840-2HCl (52,3 мг, 0,154 ммоль) и 3-метилоксетан-3-карбоновой кислоты (50,2 мг, 0,432 ммоль).

[0207] ER-898763 (19 мг, 0,050 ммоль, выход 34,0%) получали аналогичным способом, что и ER-898761, исходя из ER-888840-2HCl (50 мг, 0,147 ммоль) и (S)-3-((трет-бутоксикарбонил)амино)-4-метилпентановой кислоты (102 мг, 0,442 ммоль) с последующим удалением защитной Вос-группы с использованием ТФУК и методов нейтрализации, описанных в предыдущих примерах.

[0208] ER-898765 (19 мг, 0,054 ммоль, выход 36,7%) получали аналогичным способом, что и ER-898763, исходя из ER-888840-2HCl (50 мг, 0,147 ммоль) и (S)-3-((трет-бутоксикарбонил)амино)бутановой кислоты (90 мг, 0,442 ммоль).

[0209] ER-898901 (42 мг, 0,120 ммоль, выход 81,6%) получали аналогичным способом, что и ER-898763, исходя из ER-888840-2HCl (50 мг, 0,147 ммоль) и (S)-2-((трет-бутоксикарбонил)(метил)амино)пропановой кислоты (90 мг, 0,442 ммоль).

[0210] ER-898902 (13 мг, 0,034 ммоль, выход 23,1%) получали аналогичным способом, что и ER-898763, исходя из ER-888840-2HCl (50 мг, 0,147 ммоль) и (R)-3-((трет-бутоксикарбонил)амино)-4-метилпентановой кислоты (102 мг, 0,442 ммоль).

[0211] ER-898976 (19 мг, 0,054 ммоль, выход 36,7%) получали аналогичным способом, что и ER-898763, исходя из ER-888840-2HCl (50 мг, 0,147 ммоль) и (R)-3-((трет-бутоксикарбонил)амино)бутановой кислоты (90 мг, 0,442 ммоль).

[0212] ER-898977 (50 мг, 0,132 ммоль, выход 89,8%) получали аналогичным способом, что и ER-898763, исходя из ER-888840-2HCl (50 мг, 0,147 ммоль) и (S)-2-((трет-бутоксикарбонил)(метил)амино)-3-метилбутановой кислоты (102 мг, 0,442 ммоль).

[0213] ER-899127: К перемешиваемому раствору (R)-4-(трет-бутоксикарбонил)морфолин-3-карбоновой кислоты (87 мг, 0,375 ммоль) в ТГФ (2,0 мл) при комнатной температуре добавляли 4-метилморфолин (0,041 мл, 0,375 ммоль) с последующим добавлением изобутилхлорформиата (0,049 мл, 0,375 ммоль) по каплям. Отдельно раствор ER-888840-2HCl (51,2 мг, 0,150 ммоль) и ДИПЭА (0,052 мл, 0,30 ммоль) перемешивали при комнатной температуре, через 15 мин этот раствор добавляли к ранее полученному смешанному ангидриду. Итоговую реакционную смесь перемешивали еще в течение 3 ч, после чего полученную после завершения реакции реакционную смесь концентрировали, и остаток растворяли в ДХМ (5 мл). Раствор очищали пропусканием через силикагель (12 г, элюирование с помощью 0-75% EtOAc в гептане) с получением Boc-защищенного промежуточного соединения в виде желтого твердого вещества.

[0214] Промежуточное соединение растворяли в ДХМ (1,0 мл), и ТФУК (1,00 мл, 12,98 ммоль) добавляли в виде одной порции. Полученную смесь перемешивали при комнатной температуре в течение 1 ч, после чего полученную после завершения реакции реакционную смесь концентрировали досуха. Остаток растворяли в МеОН (10 мл) и добавляли МР-карбонатную основную смолу (~ 250 мг). Полученную смесь перемешивали при комнатной температуре в течение 30 мин, после чего оранжевый цвет сменился на бледно-желтый. Суспензию фильтровали, фильтрат концентрировали и сушили в вакууме с получением ER-899127 (21,7 мг, 0,057 ммоль, выход 37,9%).

[0215] ER-899128 (29,9 мг, 0,078 ммоль, выход 52,2%) получали аналогичным способом, что и ER-899127, исходя из ER-888840-2HCl (51,2 мг, 0,150 ммоль) и (S)-4-(трет-бутоксикарбонил)морфолин-3-карбоновой кислоты (87 мг, 0,375 ммоль).

[0216] ER-898881 (101 мг, 0,266 ммоль, выход 31,6%) получали аналогичным способом, что и ER-899127, исходя из ER-888840-2HCl (250 мг, 0,841 ммоль) и (S)-трет-бутил 2-(аминометил)морфолин-4-карбоксилата (364 мг, 1,682 ммоль).

[0217] ER-898979: К перемешиваемому раствору гидрохлорида 2-(1Н-имидазол-4-ил)уксусной кислоты (33 мг, 0,200 ммоль) в ДМФ (0,5 мл) добавляли HATU (76 мг, 0,200 ммоль). Смесь перемешивали 30 минут при комнатной температуре, после чего добавляли ER-888840-2HCl (68 мг, 0,200 ммоль) в ДМФ (0,5 мл) с последующим добавлением ДИПЭА (0,14 мл, 0,80 ммоль). Полученную смесь перемешивали 24 ч при комнатной температуре, после чего ее гасили водным раствором NaHCO3 (2 мл) и водой (10 мл). Твердое вещество собирали фильтрацией, промывали водой, сушили в вакууме и очищали на силикагеле (10 г, 0-10% МеОН в ДХМ) с получением ER-898979 (23 мг, 0,061 ммоль, выход 30,7%) после сбора целевых фракций, концентрирования и сушки в вакууме.

[0218] ER-898980 (30 мг, 0,078 ммоль, выход 36,7%) получали аналогичным способом, что и ER-898979, исходя из ER-888840-2HCl (68 мг, 0,200 ммоль) и гидрохлорида 2-(пиридин-2-ил)уксусной кислоты (34,7 мг, 0,200 ммоль).

[0219] ER-898981 (25 мг, 0,067 ммоль, выход 33,4%) получали аналогичным способом, что и ER-898979, исходя из ER-888840-2HCl (68 мг, 0,200 ммоль) и 2-(1H-пиразол-1-ил)уксусной кислоты (25,2 мг, 0,200 ммоль).

[0220] ER-898982 (10 мг, 0,028 ммоль, выход 13,9%) получали аналогичным способом, что и ER-898979, исходя из ER-888840-2HCl (68 мг, 0,200 ммоль) и 1Н-пиразол-4-карбоновой кислоты (22,4 мг, 0,200 ммоль).

[0221] ER-898984 (18 мг, 0,048 ммоль, выход 24,4%) получали аналогичным способом, что и ER-898979, исходя из ER-888840-2HCl (68 мг, 0,200 ммоль) и никотиновой кислоты (25 мг, .200 ммоль).

[0222] ER-898985 (27 мг, 0,072 ммоль, выход 36,1%) получали аналогичным способом, что и ER-898979, исходя из ER-888840-2HCl (68 мг, 0,200 ммоль) и 1-метил-1H-имидазол-5-карбоновой кислоты (25,2 мг, 0,200 ммоль).

[0223] ER-898986 (45 мг, 0,120 ммоль, выход 60,1%) получали аналогичным способом, что и ER-898979, исходя из ER-888840-2HCl (68 мг, 0,200 ммоль) и 1-метил-1Н-пиразол-5-карбоновой кислоты (25,2 мг, 0,200 ммоль).

[0224] ER-899350⋅HCl (36 мг, 0,090 ммоль, выход 30,5%) получали аналогичным способом, что и ER-898979, исходя из ER-888840-2HCl (100 мг, 0,295 ммоль) и 3-((трет-бутоксикарбонил)амино)оксетан-3-карбоновой кислоты (70,4 мг, 0,324 ммоль) с использованием ТФУК для удаления защитной ВОС-группы и образования соли HCl, как описано в предыдущих примерах.

[0225] ER-896760: К перемешиваемому раствору ER-888840-2HCl (100 мг, 0,295 ммоль) в ДХМ (1,0 мл) добавляли TEA (0,205 мл, 1,474 ммоль) с последующим добавлением изпропилсульфонилхлорида (0,050 мл, 0,442 ммоль). Реакционную смесь перемешивали в течение 2 ч при комнатной температуре, после чего полученную после завершения реакции реакционную смесь разбавляли с помощью ДХМ (10 мл) с последующим промыванием нас. NaHCO3 (5 мл) и насыщенным солевым раствором (5 мл). Органический слой сушили над Na2SO4, фильтровали и концентрировали с последующей очисткой на силикагеле (Колонка Biotage SP4. Interchim 25 г, 30 мкМ. 6-50% EtOAc в гептане) с получением ER-898760 (3,7 мг, 9,93 мкмоль, выход 3,37%) в виде белого твердого вещества после концентрирования целевых фракций продукта, концентрирования и сушки в вакууме.

[0226] ER-899672⋅HCL (25 мг, 0,055 ммоль, выход 37,6%) получали аналогичным способом, что и ER-898760, исходя из ER-888840-2HCl (50 мг, 0,147 ммоль) и гидрохлорида 3-(диметиламино)пропан-1-сульфонилхлорида (65,5 мг, 0,295 ммоль). Гидрохлорид получали аналогичным образом, описанным в других примерах.

[0227] ER-899669-HCl: К перемешиваемому раствору ER-888840-2HCl (200 мг, 0,59 ммоль) в ДХМ (2,0 мл, 31.083 ммоль) добавляли ТЭА (0,411 мл, 2,948 ммоль) с последующим добавлением 2-(1,3-диоксоизоиндолин-2-ил)этансульфонилхлорида (323 мг, 1,179 ммоль). Реакционную смесь перемешивали в течение 2 ч при комнатной температуре, после чего полученную после завершения реакции реакционную смесь разбавляли с помощью ДХМ (5 мл), промывали насыщенным раствором NaHCO3 (2 мл) и насыщенным солевым раствором (2 мл). Органический слой сушили над Na2SO4, фильтровали и концентрировали с последующей очисткой на силикагеле (Колонка Biotage SP4. Biotage SNAP Ultra 50 г, 30 мкМ. 12-100% EtOAc/гептан). Целевые фракции концентрировали и сушили в вакууме с получением N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(1,3-диоксоизоиндолин-2-ил)этансульфонамида (266 мг, 0,528 ммоль, выход 90%).

[0228] N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(1,3-диоксоизоиндолин-2-ил)этансульфонамид (100 мг, 0,199 ммоль) добавляли к гидразину моногидрату (0,096 мл, 1,986 ммоль) в ТГФ (2,00 мл). Реакционную смесь перемешивали при комнатной температуре в течение ночи, после чего полученную после завершения реакции реакционную смесь фильтровали через слой целита 545 и промывали с помощью ТГФ (5 мл). Сырой продукт очищали на силикагеле (Колонка Biotage SP4. Biotage SNAP Ultra 25 г, 30 мкМ. 1-40% МеОН/ДХМ), и целевые фракции объединяли, концентрировали и сушили в вакууме с получением ER-899669 (52 мг, 0,139 ммоль, выход 70,1%) в виде желтого твердого вещества.

[0229] ER-899669 (52 мг, 0,139 ммоль) растворяли в 1,4-диоксане (2,0 мл) и обрабатывали 4,00М HCl в диоксане (0,037 мл) при комнатной температуре в течение 30 мин. Смесь разбавляли толуолом (2 мл) и концентрировали. Продукт подвергали азеотропной перегонке с толуолом (2 мл). Продукт сушили на вакуумном насосе с получением ER-899669-HCl (57 мг, 0,139 ммоль, выход 100,0%) в виде оранжевого твердого вещества.

[0230] ER-899671-HCl: Раствор ER-899669 (50 мг, 0,134 ммоль) и 37%-го формальдегида в воде (109 мг, 1,339 ммоль) в муравьиной кислоте (0,1 мл, 2.607 ммоль) перемешивали при 80°C в течение 8 ч. Полученную после завершения реакции реакционную смесь два раза подвергали азеотропоной перегонке с толуолом (2 мл каждый раз). Остаток растворяли в МеОН (5 мл) с последующим добавлением Amberlite IRA400 в форме гидроксида при перемешивании в течение 10-минутного периода, пока не получили нейтральный рН. Amberlite отфильтровывали, промывали MeOH и фильтрат концентрировали с последующей азеотропной перегонкой досуха с толуолом (2 мл) два раза. Остаток очищали на силикагеле (Колонка Biotage SP4. Biotage SNAP Ultra 25 г, 30 мкМ. 1-40% МеОН/ДХМ), и целевые фракции объединяли, концентрировали и сушили в вакууме с получением ER-899671 (28 мг, 0,070 ммоль, выход 52,1%).

[0231] ER-899671 (28 мг, 0,070 ммоль) растворяли в 1,4-диоксане (2,0 мл) и обрабатывали 4,0М HCl в диоксане (0,017 мл, 0,066 ммоль) при комнатной температуре в течение 30 мин. Смесь трижды подвергали азеотропной перегонке с толуолом (2 мл каждый раз). Продукт сушили в вакууме с получением ER-899671-HCl (30 мг, 0,068 ммоль, выход 100%) в виде оранжевого твердого вещества.

[0232] Другие примеры:

[0233] ER-889591: ER-888840 (15 мг, 0,056 ммоль), муравьиную кислоту (0.0.64 мл, ммоль) и 37% водный формальдегид (0,042 мл, ммоль) объединяли и подвергали микроволновому облучению при 80°С в течение 8 ч, после чего охлажденную реакционную смесь концентрировали. Сырой продукт разбавляли в МеОН (2 мл) и очищали на колонке С-18 ВЭЖХ с обращенной фазой, элюируя с помощью 10-100% ацетонитрила в воде, содержащей 0,1% ТФУК. Целевые фракции концентрировали, растворяли в МеОН (1 мл) и пропускали через основную колонку с силикагелем (Biotage Isolute SPE, 1 г SiCO3, элюируя с помощью MeOH) с последующим концентрированием и сушкой в вакууме с получением ER-889591 (2,1 мг, 0.007 ммоль, выход 12,7%).

[0234] ER-895386: К раствору (R)-трет-бутил (1,5-дигидрокси-4,4-диметилпентан-2-ил)карбамата (636 мг, 2,571 ммоль) и ТЭА (1,434 мл, 10,286 ммоль) в EtOAc (10 мл) при 0°С добавляли по каплям метансульфонилхлорид (0,421 мл, 5,40 ммоль), после чего полученную смесь перемешивали 2 часа при 0°С. Реакционную смесь гасили водным раствором NaHCO3 (5 мл), слои разделяли и водный слой экстрагировали три раза с помощью EtOAc (5 мл каждый раз). Объединенные слои EtOAc промывали водой (5 мл), сушили над MgSO4, фильтровали и концентрировали досуха. Продукт, (R)-4-((трет-бутоксикарбонил)амино)-2,2-диметилпентан-1,5-диил диметансульфонат (1,01 г, 2,503 ммоль, выход 97%), использовали без очистки.

[0235] Бензиламин (0,819 мл, 7,50 ммоль) нагревали до 50°С с последующим добавлением по каплям раствора (R)-4-((трет-бутоксикарбонил)амино)-2,2-диметилпентан-1,5-диил диметансульфоната (1,009 г, 2,50 ммоль) в ДМЭ (1,50 мл, 14,431 ммоль) в течение 15-минутного периода. После того, как добавление было закончено, смесь перемешивали при 50°С в течение 20 ч. Полученную после завершения реакции реакционную смесь охлаждали до комнатной температуры и разбавляли насыщенным раствором NaHCO3 (10 мл) и EtOAc (10 мл) с последующим энергичным перемешиванием в течение 10 мин. Органическую фракцию из полученной смеси промывали насыщенным солевым раствором (5 мл), сушили над MgSO4, фильтровали и концентрировали. Остаток очищали на силикагеле (Biotage, элюируя с помощью от 0 до 10% EtOAc в гептане) с получением (R)-трет-бутил (1-бензил-5,5-диметилпиперидин-3-ил)карбамата (500 мг, 1,570 ммоль, выход 62,8%) после объединения целевых фракций, концентрирования и сушки в вакууме.

[0236] Трет-бутил ((3R,5S)-1-бензил-5-метилпиперидин-3-ил) карбамат (500 мг, 1,642 ммоль) растворяли в этаноле (50 мл, 856.335 ммоль) и гидрировали в реакторе H-Cube с использованием картриджа catcart с 5%-ным Pd/C при 45°С и 50 бар с помощью газообразного Н2, и скоростью потока раствора 1 мл/мин в течение 7 ч. Раствор концентрировали, чтобы получить трет-бутил ((3R, 5S)-5-метилпиперидин-3-ил)карбамат (350 мг, 1,633 ммоль выход, 99,5%) в виде белого порошка и использовали без дополнительной очистки.

[0237] К раствору трет-бутил ((3R,5S)-5-метилпиперидин-3-ил)карбамата (890 мг, 4,153 ммоль) и 5-бромхинолин-8-карбонитрила (1 452 мг, 6,229 ммоль) в DMAC (14 мл) добавляли ДИПЭА (2,176 мл, 12,459 ммоль) с последующей герметизацией и нагреванием до 110°С, и перемешивании в течение 48 ч. Полученную после завершения реакции реакционную смесь охлаждали до комнатной температуры, разбавляли водой (20 мл) с последующей экстракцией три раза с помощью EtOAc (10 мл каждый раз). Объединенные органические слои промывали водой (10 мл) и насыщенным солевым раствором (10 мл), сушили над MgSO4, фильтровали и концентрировали досуха. Сырой продукт очищали на силикагеле (Biotage, SP4, элюируя смесью от 0 до 100% EtOAc в гептане) с получением трет-бутил ((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)карбамата (817 мг, 2,229 ммоль, выход 53,7%) после объединения целевых фракций, концентрирования и сушки в вакууме.

[0238] (R)-трет-бутил (1-(8-цианохинолин-5-ил)-5,5-диметилпиперидин-3-ил)карбамат (70 мг, 0,184 ммоль) обрабатывали 4М HCl в диоксане (2 мл, 8,00 ммоль) и перемешивали 1 ч при комнатной температуре. Полученную после завершения реакции реакционную смесь концентрировали и сушили в вакууме без дополнительной очистки с получением ER-895386 (51,6 мг, 0,184 ммоль, выход 100%) в виде соли дигидрохлорида.

[0239] ER-897810: К перемешиваемому раствору трет-бутил ((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)карбамата, 54 (75 мг, 0,205 ммоль) в этаноле (4,5 мл) добавляли 0,5М раствор гидроксида натрия (4.503 мл, 2,251 ммоль) с последующим 60%-ной перекиси водорода в воде (0,233 мл, 2,281 ммоль). Реакционную смесь нагревали до 50°С и затем перемешивали в течение 4 ч. Полученную после завершения реакции реакционную смесь охлаждали до комнатной температуры с последующим добавлением 5%-ного водного раствора тиосульфата натрия (1 мл), перемешиванием в течение 5 мин, и добавлением 1н HCl до рН 7-8. Смесь концентрировали до объема 50% с последующей экстракцией три раза с помощью ДХМ (5 мл каждый раз). Объединенные органические слои промывали водой (5 мл), сушили над MgSO4, фильтровали и концентрировали досуха. Сырой продукт очищали на силикагеле (10 г, элюирование с помощью 0-60% EtOAc в гептане) с получением трет-бутил ((3R,5S)-1-(8-карбамоилхинолин-5-ил)-5-метилпиперидин-3-ил)карбамата (57 мг, 0,148 ммоль, выход 72,4%) после сбора целевых фракций, концентрирования и сушки в вакууме.

[0240] К раствору трет-бутил ((3R,5S)-1-(8-карбамоилхинолин-5-ил)-5-метилпиперидин-3-ил)карбамата (57 мг, 0,148 ммоль) в ДХМ (5 мл) добавляли ТФУК (0,5 мл, 6,49 ммоль), после чего полученную смесь перемешивали при комнатной температуре в течение 1 часа. Полученную после завершения реакции реакционную смесь концентрировали и затем растворяли в МеОН (2 мл) и обрабатывали 0,5 г бикарбонатной смолы. После перемешивания в течение 30 мин при комнатной температуре суспензию фильтровали, промывали два раза с помощью МеОН (1 мл), и объединенные фильтраты концентрировали до светло-желтого твердого вещества. Твердое вещество растворяли в EtOAc (1 мл), обрабатывали 4М HCl в диоксане (0,029 мл, 0,115 ммоль), перемешивали в течение 15 мин. Полученное твердое вещество собирали фильтрованием и сушили в вакууме с получением ER-897810-HCl (37 мг, 0,115 ммоль, выход 78%).

[0241] Общее скрининговое исследование и фармакологическая стратегия.

[0242] Чтобы определить активные и селективные к TLR7/8 соединения, аналоги на начальной стадии подвергали скринингу на всех панелях на основе клеток репортерных линий человека TLR4, TLR7 и TLR9 (см. Материалы и способы для получения более подробной информации). По меньшей мере, одно соединение, которое было активным и селективным для TLR7, также испытывали на активность в отношении TLR8 (смотри нижеприведенную таблицу 2) и на эффективность в отношении TLR7/8 в первичном анализе человеческих РВМС (см. Материалы и способы для получения более подробной информации). Некоторые соединения были перспективными в коротком анализе in-vivo (STIV) по определению дозозависимой активности и продолжительности действия против мышиных TLR7 (см. Материалы и методы для получения более подробной информации). Выбранные соединения затем оценивали по воздействию на одну или несколько из следующих мышиных моделей болезни волчанки: BXSB-Yaa, NZBxNZW и Пристановая: DBA/1.

[0243] Многие соединения, охарактеризованные в данном раскрытии в качестве вариантов осуществления, демонстрируют наномолярную активность против мышиных TLR7 и человеческих TLR8, когда эти рецепторы, экспрессируемые либо на клеточных линиях, либо на первичных клетках, стимулируются синтетическими лигандами, низкомолекулярными лигандами (CL097, R848) или лигандами нуклеиновых кислот (РНК). И наоборот, большинство соединений, охарактеризованные в данном раскрытии в качестве вариантов осуществления, являются неактивными в отношении пути TLR9.

[0244] Современные препараты SOC волчанки включают противомалярийные препараты, такие как хлорохин и гидроксихлорохин (HCQ), которые ингибируют активацию TLR7/9 in vitro. Это может, по крайней мере, частично объяснить их эффективность в контролировании вспышки волчанки. Варианты осуществления раскрытия, однако, как было показано, предлагают значительно более сильное ингибирование. Это продемонстрировано результатами, показанными в нижеприведенной таблице 1.

[0245]

Таблица 1
Активность и селективность соединения ER-888840 по сравнению с гидроксихлорохином (Plaquenil).
Формат клеток: Лиганд: Рецептор(ы): Аналит: ER-888840 IC50 (мкM) HCQ2
IC50 (мкM)
HEK-293 LPS TLR4 человека NFkB-люцифераза >10 Н.О.
HEK-293 CL097 TLR7 человека NFkB-люцифераза 0,0002 Н.О.
HEK-293 CL097 TLR7 мыши NFkB-люцифераза Н.О.
HEK-293 CL097 TLR8 человека NFkB-люцифераза Н.О.
HEK-293 CpG-ODN TLR9 человека NFkB-люцифераза 8,77 Н.О.
PBMC человека 1РНК-Ig TLR7/8 человека ИЛ-6 0,0014 1-2
PBMC человека 1РНК-Ig TLR7/8 человека ФНОα Н.О.
PBMC человека 1РНК-Ig TLR7/8 человека ИБ-10 Н.О.
PBMC человека R848 TLR7/8 человека ИЛ-6 Н.О.
селезенки мыши R848 TLR7 мыши ИЛ-6 Н.О.
PBMC человека Pam3CSK4 TLR1/2 человека ИЛ-6 Н.О.
PBMC человека LPS TLR4 человека ИЛ-6 >10
PBMC человека CpG-ODN TLR9 человека ИЛ-6 0,15-0,30
ПОЯСНЕНИЕ К ТАБЛИЦЕ:
1РНК-Ig = оцРНК получена из последовательности «петли-на-стебле» IV U1 няРНК в комплексе с антителом (см. Материалы и методы для получения более подробной информации)
2HCQ = Гидроксихлорохин

[0246]

Таблица 2.
Активность выбранного соединения против человеческого TLR8 в формате анализа НЕК-293 (см. Материалы и методы для получения более подробной информации).
Номер соединения HEK/hTLR8 IC50 (мкM)
ER-878921 0,0740

[0247] Короткий анализ in-vivo (STIV): Чтобы оценить активность соединения in-vivo против мышиных TLR7 использовали короткий анализ in-vivo (STIV). Вкратце, мышам перорально давали дозу соединений и в различные моменты времени, после чего подкожно вводили агонист R848, чтобы стимулировать TLR7. Уровень ИЛ-6 плазмы после стимуляции R848 затем измеряли методом ИФА для оценки активности соединения и продолжительности действия. Важно отметить, что последующее продуцирование цитокинов in vitro или in vivo стимуляция с помощью R848, как было показано, является полностью TLR7-зависимой при использовании TLR7-дефицитных мышей. Таким образом, активность соединений в анализе STIV можно уверенно отнести к их модуляции пути TLR7. Краткие результаты об активностях, полученные из анализа STIV, для панели соединений представлены в нижеприведенной таблице 3.

[0248]

Таблица 3.
Краткий обзор данных короткого анализа in-vivo (STIV) для отдельных соединений.
% подавления в сравнении с плацебо
ER-888840 ER-897608 ER-899016 ER-899072 ER-899541 ER-899544 ER-899547 ER-899548 ER-899672
Время Доза (мг/кг)
6 ч 11
33 100 98
100 100 94 97 97 94 84 89
300
12 ч 200
400
600
13 ч 11 53
33 95 56 34
100 100 84 100 72 92 94 87 95 83
300 98 100
24 ч 11 24
33 0 35
100 98 22 0
300 100 95 78

[0249] Мышиные модели заболевания волчанки. Две различные модели заболевания волчанки (NZB/W и Пристановая) были выбраны для оценки POC соединений потому что (1) штамм NZB/W развивает спонтанное заболевание с полигенной этиологией, демонстрируя множество признаков человеческой волчанки, такие как ДНК-ассоциированная аутореактивность, протеинурия, и опосредованный иммунным комплексом нефрит, и (2) положительные результаты ратификации цели TLR7 и/или TLR9 были опубликованы для обеих моделей заболеваний.

[0250] Основные выводы для ER-888840 в модели заболевания СКВ следующие (см. фигуры 6 и 7):

1) ER-888840 подавляло множественные аутоантительные специфичности в Пристановой модели. ER-888840 также дозозависимо значительно снижал экспрессию интерферон-регулируемого гена у Пристан-индуцированных больных животных, как это отражено в показателе интерферона.

[0251] Краткое описание результатов: Эти данные показывают сдерживающее действие описанных соединений на процессы, связанные с важными аспектами человеческой волчанки. Иммунные комплексы, содержащие нуклеиновые кислоты могут управлять продуцированием интерферона типа 1 посредством дендритных клеток, и «профиль интерферона», который отражает наличие интерферона и последующую экспрессию интерферон-регулируемых генов, связан с тяжестью заболевания. ER-888840 подавил повышенную экспрессию интерферон-управляемых генов в пристановой модели. ER-888840 ограничил продуцирование некоторых аутоантительных специфичностей. Полученные результаты свидетельствуют о том, что эти соединения имеют потенциал контролировать симптомы волчанки и прогрессирование у больных людей.

[0252] ФАРМАКОЛОГИЧЕСКИЕ МАТЕРИАЛЫ и МЕТОДЫ:

[0253] Фармакология in vitro:

[0254] Клетки НЕК-293 (ATCC) разрабатывали для стабильной экспрессии фактора транскрипции NF-каппаB, индуцируемого репортер люциферазы E-селектина (ELAM-1), полученный из плазмиды pGL3 (Promega), содержащей пары оснований -2241bp по -254bp из промотора человеческого гена E-селектина (учетный № NM_000450). Эти клетки затем впоследствии разрабатывали для стабильной и индивидуальной экспрессии непроцессированной ОРС кДНК человеческих TLR4, TLR7 или TLR9. кДНК TLR4 человека (учетный № NM_138554) клонировали в экспрессионный вектор пкДНК 3.0 (Invitrogen). Трансфицированные клетки TLR4 также разрабатывали для экспрессии человеческого корецептора MD-2 [кДНК MD-2 (учетный № NM_015364) клонировали в вектор pEF-BOS] и дополняли 10 нМ растворимого CD14 (R&D Systems) в среде для оптимизации отвечаемости LPS. кДНК TLR9 человека (учетный № NM_017442) клонировали в вектор pBluescript II KS (Agilent). кДНК TLR7 человека (учетный № NM_016562) получали из OriGene. Клетки НЕК-293, стабильно экспрессирующие человеческие TLR8 (учетный № NM_138636) или мышиные TLR7 (учетный № NM_133211) приобретали у InvivoGen и затем стабильно трансфицировали с использованием плазмиды репортера pNiFty2(NF-каппаB)-люциферазы (InvivoGen). Каждый тип клеток высевали в модифицированной по способу Дульбекко среде Игла (DMEM), содержащей 10% фетальной бычьей сыворотки (FBS) при плотности 2,22×105 клеток/мл в 384-луночном планшете и инкубировали в течение 2 дней при 37°С, 5% CO2. Затем добавляли различные концентрации соединений антагонистов. Затем клетки инкубировали в течение еще 30 минут перед тем, как добавить соответствующий агонист TLR следующим образом (указаны конечные концентрации): липополисахарид (LPS; Sigma) в концентрации 10 нг/мл для TLR4, CL097 (InvivoGen) в концентрации 3 мкг/мл для человеческих TLR7 и TLR8 и мышиных TLR7, и CpG-2006-2A [последовательность: TCGTCGTTAAGTCGTTAAGTCGTT (SEQ ID NO: 1) с фосфотиоатным остовом, синтезированный Sigma-Aldrich] в концентрации 0,6 мкM для TLR9. Затем клетки инкубировали в течение ночи, и активацию репортера NF-каппаB-зависимой люциферазы определяли количественно путем измерения люминесценции с реагентом SteadyGlo® (Promega) или Steadylite ™ (Perkin Elmer) в соответствии протоколом, предложенным производителем.

[0255] Анализ на основе клеток РВМС человека. Человеческие мононуклеарные клетки периферической крови (РВМС) были выделены из свежевзятой гепаринизированной (10 USP единиц/мл, Hospira, Lakeforest, штат Иллинойс) цельной крови здорового донора посредством градиента плотности (Histopaque® 1077, Sigma, Inc., Сент-Луис, штат Миссури). Вкратце, 25 мл крови разбавляли с помощью 15 мл ФСБ (без Ca2+, Mg2+) в 50 мл конической пробирке, и наслаивали на 12 мл Histopaque с использованием спинальной иглы. Пробирки центрифугировали в течение 45 минут при 1200 оборотах в минуту (350×g), и РВМС собирали из лейкоцитарной пленки. Затем клетки дважды промывали в ФСБ, и красные кровяные тельца лизировали посредством суспендирования в 5 мл раствора хлорида аммония (буфер для лизиса красных кровяных телец 1X, eBioscience) в течение 5 минут при комнатной температуре. После последней промывки в ФСБ, РВМС ресуспендировали при конечной концентрации 2×106/мл в среде RPMI-1640 с L-глутамином (Invitrogen) и дополненной 25 мМ HEPES (Mediatech, Inc, Манассас, штат Вирджиния), 10% фетальной телячьей сывороткой (HyClone, Logan, штат Юта), и пенициллин-стрептомицин-глютамином (Mediatech) и высевали при 100 мкл/лунка (2×105 клеток/лунка) в 96-луночных планшетах, обработанных тканевой культурой (Falcon).

[0256] Соединения антагонисты, солюбилизированные и серийно разведенные в 100% ДМСО, добавляли в трех повторениях к клеткам с получением конечной концентрации 0,1% ДМСО (об./об.). Гидроксихлорохин (Acros Organics), солюбилизированный и серийно разведенный в ФСБ, добавляли в трех повторениях к клеткам. РВМС инкубировали с соединениями антагонистами или HCQ в течение 30 минут при 37°С, 5% СО2 перед добавлением различных реагентов агонистов TLR в 100 мкл полной среды на лунку следующим образом (указаны конечные концентрации): R848 (Resiquimod; GLSynthesis, Вустер, штат Массачусетс) в концентрации 1мкМ для TLR7 и TLR8, Pam3CSK4 (InvivoGen) в концентрации 50 нг/мл для TLR1/2, LPS (Sigma) в концентрации 10 нг/мл для TLR4 и CpG-2216 (InvivoGen) в концентрации 5 мкг/мл для TLR9. Чтобы получить агонист TLR7/8, который имитирует РНК-содержащие аутоантительные иммунные комплексы у пациентов с волчанкой, синтезировали 26-мернную РНК с последовательностью, полученной из «петли-на-стебле» IV человеческой U1 няРНК [(Последовательность: GGGGGACUGCGU-UCGCGCUUUCCC (SEQ ID NO: 2) с фосфотиоатным остовом] (Dharmacon, Inc., округ Лафейетт), которая, как было показано ранее, является сильным агонистом TLR7 и TLR8. Эту молекулу РНК разводили до 2,5 мкМ в бессывороточной среде RPMI и мышиное моноклональное антитело против человеческой одноцепочечной ДНК (MAB3034, Millipore, Inc., Биллерика, штат Массачусетс), которое также перекрестно реагирует с РНК, добавляли в разбавлении 1:25 или в концентрации 1 мкг/мл. Полученный в результате стимул «РНК-Ig» инкубировали при комнатной температуре в течение 15-30 минут перед добавлением к клеткам. РВМС инкубировали с различными агонистами TLR в течение 20 часов при 37°С, 5% СО2. Супернатанты клеточной культуры собирали, и оценивали уровни различных цитокинов человека, как указано стандартной методикой ИФА в соответствии с протоколом, рекомендованным производителем (BD Biosciences, Inc., Сан-Диего, штат Калифорния). Результаты показаны в таблице 4.

Таблица 4
Сводные данные анализа РВМС для выбранных соединений
Номер соединения Человеческие PBMC IC50 (мкM) Номер соединения Человеческие PBMC IC50 (мкM)
ER-878921 0,090 ER-888840 0,001
ER-895386 0,017 ER-889591 0,042
ER-897998 0,002 ER-896310 0,063
ER-897999 0,002 ER-896464 0,006
ER-898334 0,008 ER-897184 0,004
ER-898344 0,022 ER-897272 0,006
ER-898345 0,017 ER-897273 0,107
ER-898350 0,020 ER-897274 0,007
ER-898360 0,011 ER-897275 0,006
ER-898364 0,000 ER-897275 0,006
ER-898365 0,016 ER-897607 0,004
ER-899016 0,006 ER-897608 0,005
ER-899072 0,008 ER-897971 0,005
ER-899669 0,009 ER-897972 0,017
ER-897973 0,011 ER-899505 0,127
ER-897978 0,014 ER-899506 0,009
ER-897979 0,001 ER-899508 0,071
ER-897980 0,027 ER-899541 0,015
ER-897987 0,012 ER-899543 0,012
ER-897989 0,002 ER-899544 0,005
ER-897990 0,003 ER-899547 0,023
ER-897997 0,001 ER-899548 0,030
ER-899350 0,067 ER-899549 0,037
ER-899369 0,013 ER-899550 0,031
ER-899504 0,081 ER-899551 0,024
ER-899577 0,065 ER-899552 0,104
ER-899672 0,003

[0257] Анализ на основе клеток селезенки мыши. Селезенки брали у самок мышей линии BALB/C (Jackson Labs, Бар Харбор, штат Мэн), подвергнутых эвтаназии с помощью СО2. Одноклеточную суспензию получают, пропуская селезенки через нейлоновый клеточный фильтр 40 мкм. Клетки дважды промывали с помощью 50 мл ФСБ (Mediatech, Inc., Манассас, штат Вирджиния) и красные кровяные тельца лизируют в 5 мл буфера для лизиса эритроцитов (eBioscience, Inc., Сан-Диего, штат Калифорния) в течение 5 минут при комнатной температуре. Клетки промывают еще два раза в ФСБ и, наконец, ресуспендируют в дополненной RPMI-1640 при 2,5×106 клеток/мл. Клетки высевают в количестве 100 мкл/лунку (2,5×105 клеток/лунку) в 96-луночных планшетах, обработанных тканевой культурой (Falcon). Серийные разведения соединений, солюбилизированных в 100% ДМСО, добавляют в трех повторениях к клеткам с получением конечной концентрации 0,1% ДМСО. Клетки инкубируют с соединением в течение 30 минут при 37°С, 5% CO2 перед добавлением 100 мкл/лунку R848 в концентрации 740 нМ (Resiquimod; GLSynthesis, Вустер, штат Массачусетс) в полной среде для получения конечной концентрации R848 370 нМ. Клетки инкубируют в течение 20 часов при 37°С, 5% СО2. Супернатанты культуры собирают, и оценивают уровни ИЛ-6 стандартной процедурой ИФА в соответствии с протоколом, рекомендованным производителем (BD Biosciences, Inc., Сан-Диего, штат Калифорния).

[0258] Фармакология in vivo:

[0259] Короткий анализ in vivo (STIV). Шести-восьми недельным самкам мышей линии BALB/C (Jackson Labs, Бар Харбор, штат Мэн) вводили перорально через зонд дозу в объеме 200 мкл с соединениями антагонистами, объединенными с 0,5%-ном водным раствором метилцеллюлозы (Sigma, Сент-Луис, штат Миссури). В различные временные точки после этого мышам вводили подкожно в объеме 100 мкл 15 мкг R848 (Resiquimod; GLSynthesis, Вустер, штат Массачусетс), чтобы стимулировать TLR7. Плазму крови собирали пункцией сердца, и затем оценивали уровни ИЛ-6 через 1,5 часа после стимуляции TLR7 с помощью стандартной процедуры ИФА в соответствии с протоколом, рекомендованным производителем (R&D Systems).

[0260] Штаммы мышиной модели болезни волчанки. Самцы мышей BXSB-Yaa и самки мышей NZBWF1/J приобретали у Jackson Labs (Бар Харбор, штат Мэн), оба из которых проявляют спонтанное заболевание волчанкой. Самки мышей DBA/1 приобретали у Harlan Laboratories (Индианаполис, штат Индиана) и в указанных возрастах внутрибрюшинно вводили 0,5 мл пристана (2,6,10,14-тетраметилпентадекан; Sigma, Сент-Луис, штат Миссури), чтобы химически вызвать болезнь волчанку или 0,5 мл ФСБ, чтобы получить контрольных не заболевших мышей в соответствующей возрастной группе.

[0261] Оценка титров аутоантител методом ИФА. Титры анти-дцДНК, -sm/яРНП, -RiboP и -Гистонов оценивали с помощью стандартного подхода ИФА. Вкратце, 96-луночные планшеты ИФА EIA/RIA (Corning) покрывали 100 мкл разбавленного антигена в ФСБ в течение 90 минут при комнатной температуре следующим образом (указаны конечные концентрации): 10 Ед/мл комплекса Sm/яРНП (Immunovision), 10 мкг/мл дцДНК тимуса теленка (Sigma), 5 Ед/мл RiboP (Immunovision), и 5 мкг/мл гистона (Immunovision). Планшеты промывали ФСБ/0,05% Твин-20 (промывочный буфер) и блокировали в течение ночи с помощью ФСБ/1% BSA (блокирующий буфер) при 4°С. Планшеты промывали, образцы плазмы мышей, разведенные в блокирующем буфере (в диапазоне от 1:25-1:10000 в зависимости от модели и антигена), добавляли в лунки в объеме 100 мкл на лунку, и планшеты инкубировали в течение 90 минут при комнатной температуре. Планшеты затем промывали, 100 мкл анти-мышиного-IgG-HRPO (Southern Biotech), разведенного 1:50000 в ФСБ/1% BSA/0,05% Tween добавляли в каждую лунку, и планшеты инкубировали в течение 90 минут при комнатной температуре. Планшеты промывали, и 100 мкл смеси 1:1 компонентов субстрата из набора субстратов OptEIA ТМВ (BD Biosciences) добавляли в лунки. Планшеты инкубировали при комнатной температуре, и после достаточного развития окраски реакцию останавливали добавлением 100 мкл 0,18M раствора серной кислоты. Планшеты считывали с помощью спектрофотометрии при 450 нм.

[0262] Оценка протеинурии. Мочу собирали вручную от отдельных мышей или путем помещения 1-2 мышей в метаболическую клетку в течение 18 часов, и отношение альбумина/креатинина в моче (UACR) определяли для каждого животного в качестве косвенного показателя функции почек (UACR рассчитывается как отношение мг альбумина/г креатинина на дл мочи). Уровни альбумина в образцах мочи определяли, используя специфический сэндвич протокол ИФА с использованием набора антител против мышиного альбумина (Bethyl Labs), который включал покрывающее антитело и вторичное антитело с меткой конъюгата HRP для обнаружения. Уровни креатинина определяли с использованием коммерческого набора анализа креатинина (Cayman).

[0263] Гистологическая оценка нефрита. Почки брали у отдельных мышей, фиксировали в 10% формалине в течение 24 часов, заливали в парафин и окрашенные H&E срезы получали для гистологической оценки слепым методом. Признаки для оценки заболевания нефрита следующие: Степень 0 - нормальные пределы; Степень 1 - лентовидные утолщения капиллярных стенок; Степень 2 - повышенное содержание паренхиматозных клеток, сегментация, образование полулуния; Степень 3 - см. Оценку 2, повышенная тяжесть и степень (% пораженных гломерул) гломерулярных поражений; Степень 4 - склероз; тяжелое гломерулярное заболевание (нефункциональный орган).

[0264] Оценка экспрессии генов интерферона в цельной крови. Экспрессия ИФН-регулируемых генов в цельной крови измеряли кПЦР. Вкратце, мышей умерщвляли, собирали кровь через полую вену, и 100 мкл консервировали в пробирках, содержащих раствор для стабилизации РНК RNAlater (Амбион, Остин, штат Техас). Общую РНК выделяли с использованием набора RiboPure (Ambion) для выделения РНК из крови мышей. Концентрации РНК определяли с помощью спектрофотометра NanoDrop ND-1000 (Thermo Scientific, Уолтем, штат Массачусетс). Первую цепь кДНК синтезировали из 100 нг тотальной РНК с использованием SuperScript® VILO ™ Master Mix (Life Technologies, Гранд Айленд, Нью-Йорк). После обратной транскрипции, кДНК разводили водой без нуклеаз и смешивали с помощью TaqMan® Fast Advanced Master Mix (Applied Biosystems). Затем смесь наносили на специализированный картридж низкой плотности TaqMan® (TLDA) производства Applied Biosystems, и проводили кПЦР на быстрой системе ПЦР в реальном времени ABI 7900HT (Applied Biosystems). Исходные данные собирали с помощью RQ Manager 1.2.1 (Applied Biosystems) и анализировали с помощью программного обеспечения GeneData Analyst 2.2 (Genedata).

[0265] Панель TLDA содержит до 45 генов-мишеней, выбранных из нижеприведенной таблицы 5 и 3 конститутивных гена для нормализации. Конститутивный ген Hprt1 выбрали для нормализации на основании коэффициента вариации. Относительные величины были определены для генов-мишеней и использованы для расчета кратности изменения для каждой больной мыши относительно небольной контрольной группы, получавшей внутрибрюшинно только инъекции ФСБ. Стандартный t-тест Стьюдента проводили для определения тех целевых генов, количество которых было значительно увеличено между не заболевшей группой (обработанной с помощью ФСБ) и заболевшей группой, обработанной плацебо (обработанной пристаном), тем самым представляя набор генов, регулируемых заболеванием. «Показатель ИФН» впоследствии рассчитывали для каждой мыши в качестве средней кратности изменения всех регулируемых заболеванием генов, идентифицированных в t-тесте.

Таблица 5
Символ гена Taqman ID Название гена
18S Hs99999901_s1 эукариотическая 18S рРНК
Bst2 Mm01609165_g1 антиген 2 стромальных клеток костного мозга
C1qa Mm00432142_m1 компонент комплемента 1, субкомпонент q, полипептид альфа
C3 Mm00437858_m1 компонент комплемента 3
C3ar1 Mm02620006_s1 рецептор 1 компонента комплемента 3a
Ccl2 Mm00441243_g1 хемокиновый (C-C мотив) лиганд 2
Ccl5 Mm01302427_m1 хемокиновый (C-C мотив) лиганд 5
Ccr2 Mm00438270_m1 хемокиновый (C-C мотив) рецептор 2
Cd274 Mm00452054_m1 антиген CD274
Cd300e Mm00468131_m1 антиген CD300e
Cd38 Mm01220906_m1 антиген CD38
Cd40 Mm00441891_m1 антиген CD40
Cdkn2c Mm00483243_m1 Ингибитор 2C циклин-зависимой киназы (p18, ингибирует CDK4)
Cmpk2 Mm00469582_m1 цитидин монофосфат (UMP-CMP) киназа 2
Cxcl10 Mm00445235_m1 хемокиновый (C-X-C мотив) лиганд 10
Cxcl11 Mm00444662_m1 хемокиновый (C-X-C мотив) лиганд 11
Ddx60 Mm00460708_m1 DEAD (Asp-Glu-Ala-Asp) бокс полипептид 60
Elane Mm00469310_m1 эластаза, нейтрофил-экспрессия
Epsti1 Mm00712734_m1 эпителиальное стромальное взаимодействие 1 (грудь)
Fcgr1 Mm00438874_m1 рецептор Fc, IgG, высокая афинность I
Fpr1 Mm00442803_s1 формил-пептидный рецептор 1
Gapdh Mm99999915_g1 глицеральдегид-3-фосфат дегидрогеназа
Herc6 Mm01341950_m1 домен hect и RLD 6
Hprt Mm00446968_m1 гипоксантин-гуанин фосфорибозилтрансфераза
Ifi202b Mm00839397_m1 интерферон-активируемый ген 202B
Ifi204 Mm00492602_m1 интерферон-активируемый ген 204
Ifi27l2a Mm01329883_gH интерферон, альфа-индуцируемый белок 27, подобный 2A
Ifi35 Mm00510329_m1 интерферон-индуцированный белок 35
Ifi44 Mm00505670_m1 интерферон-индуцированный белок 44
Ifih1 Mm00459183_m1 индуцируемый интерфероном с доменом 1 хеликазы C
Ifit1 Mm00515153_m1 интерферон-индуцированный белок с тетратрикопептидными повторами 1
Ifit2 Mm00492606_m1 интерферон-индуцированный белок с тетратрикопептидными повторами 2
Ifit3 Mm01704846_s1 интерферон-индуцированный белок с тетратрикопептидными повторами 3
Il3ra Mm00434273_m1 рецептор интерлейкин 3, альфа-цепь
Il6 Mm00446190_m1 интерлейкин 6
Il6ra Mm00439653_m1 рецептор интерлейкин 6, альфа
Irf5 Mm00496477_m1 регуляторный фактор интерферона 5
Irf7 Mm00516788_m1 регуляторный фактор интерферона 7
Isg15 Mm01705338_s1 убиквитин-подобный модификатор ISG15
Isg20 Mm00469585_m1 интерферон-стимулированный белок
Lta Mm00440228_gH лимфотоксин A
Ly6e Mm01200460_g1 комплекс лимфоцитарного антигена 6, локус E
Mmp8 Mm00439509_m1 матрица металлопептидазы 8
Mmp9 Mm00442991_m1 матрица металлопептидазы 9
Mpo Mm00447886_m1 миелопероксидаза
Ms4a6c Mm00459296_m1 трансмембранные 4-домены, подсемейство А, член 6C
Mx1 Mm00487796_m1 белок устойчивости к миксовирусу (вирус гриппа) 1
Oas3 Mm00460944_m1 2-5 олигоаденилат синтетаза 3
Oasl2 Mm00496187_m1 2-5 олигоаденилат синтетаза-подобный 2
Ppia Mm02342430_g1 пептидилпролил изомераза A (циклоспорин A)
Prf1 Mm00812512_m1 перфорин 1 (белок, образующий поры)
Rsad2 Mm00491265_m1 радикальный S-аденозил-метиониновый домен, содержащий 2
Siglec1 Mm00488332_m1 сиаловая кислота, связывающая Ig-подобный лектин 1, сиалоадгезин
Stat1 Mm00439531_m1 преобразователь сигнала и активатор транскрипции 1
Tlr7 Mm00446590_m1 Толл-подобный рецептор 7
Tlr9 Mm00446193_m1 Толл-подобный рецептор 9
Tnf Mm00443258_m1 фактор некроза опухоли
Tnfsf10 Mm01283606_m1 фактор некроза опухоли (лиганд) надсемейство, член 10
Tnfsf13b Mm00446347_m1 фактор некроза опухоли (лиганд) надсемейство, член 13b
Treml4 Mm00553947_m1 Запускающий рецептор, экспрессируемый на миелоидных клетках-подобных 4
Trex1 Mm00810120_s1 3'-репарационная экзонуклеаза 1
Usp18 Mm00449455_m1 убиквитин-специфичная пептидаза 18
Xaf1 Mm01248390_m1 XIAP-ассоциированный фактор 1

СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ

<110> ЭЙСАЙ Ар ЭНД Ди МЕНЕДЖМЕНТ КО., ЛТД.

Хоукинс, Линн

<120> СЕЛЕКТИВНО ЗАМЕЩЕННЫЕ СОЕДИНЕНИЯ ХИНОЛИНА

<130> 0080171-000082

<160> 2

<170> Версия Патента 3.5

<210> 1

<211> 24

<212> ДНК

<213> Искусственная последовательность

<220>

<223> синтетическая конструкция

<400> 1

tcgtcgttaa gtcgttaagt cgtt 24

<210> 2

<211> 24

<212> РНК

<213> Искусственная последовательность

<220>

<223> синтетическая конструкция

<400> 2

gggggacugc guucgcgcuu uccc 24

1. Соединение формулы (I):

в которой

R8 представляет собой -Н или метил;

R9 представляет собой -Н, метил или гидроксил;

R10 представляет собой метил, гидроксил или NR11R12; и

где R11 и R12 независимо выбирают, и где

R11 представляет собой -H, метил или -СН2-С(O)CH2CH3; и

R12 представляет собой -H, оксопирролидинил, диоксидотиопиранил, изопропилсульфонил, тетрагидропиранил, оксетанил, тетрагидрофуранил, диметиламинэтансульфонил, аминоэтансульфонил, диметиламинопропансульфонил,

С16-алкил, который является линейным, разветвленным или циклическим, необязательно замещен метокси, -F, ≡N, метил оксетанилом, оксо-, метил имидазолилом,

оксазолилом, необязательно замещенным метилом,

пиразолилом, необязательно замещенным метилом или цианo,

C(O)R13, где

R13 представляет собой

C1-C7-алкил, который является циклическим, разветвленным или линейным, необязательно замещен

NR13R14, где R13 и R14 независимо выбирают из метила и -Н;

метокси, гидроксилом, метилтио, этилтио, метилсульфонилом, оксо-, тиазолидинилом, пиридинилом, пиразолопиридинилом, метил амино, тиазолилом, -F, морфолинилом, метилизоксазолилом, метил оксетанилом, аминооксетанилом,

фенилом, необязательно замещенным гидроксилом, -C(O)NH2;

пятичленным циклоалкилом, насыщенным или ненасыщенным, в котором 1 или 2 атома углерода заменены атомами азота, где циклоамин или циклодиамин необязательно замещен гидроксилом или метилом;

или его фармацевтичеки приемлемая соль.

2. Соединение, выбранное из группы, состоящей из:

(R)-5-(3-аминопиперидин-1-ил)хинолин-8-карбонитрила;

5-((3R,5S)-3-амино-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

5-((3R,5S)-3-(диметиламино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

(R)-5-(5-амино-3,3-диметилпиперидин-1-ил)хинолин-8-карбонитрила;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)ацетамида;

5-((3R,5S)-3-гидрокси-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

5-((3S,5R)-3-метил-5-(метиламино)пиперидин-1-ил)хинолин-8-карбонитрила;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(диметиламино)ацетамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-метоксиацетамида;

2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)ацетамида;

5-((3R,5S)-3-((2-метоксиэтил)амино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

5-((3R,5S)-3-((2-метоксиэтил)амино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила 2-гидроксипропан-1,2,3-трикарбоксилата;

2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-метилпропанамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(метиламино)ацетамида;

5-((3R,5S)-3-амино-5-метилпиперидин-1-ил)хинолин-8-карбоксамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-гидроксиацетамида;

(S)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-гидрокси-3-метилбутанамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-гидроксибензамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-4-гидроксибензамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(метилтио)ацетамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(этилтио)ацетамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(метилсульфонил)ацетамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)пропанамида;

(R)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)пропанамида;

1-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)циклопропанкарбоксамида;

(R)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-гидроксипропанамида;

(R)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)пирролидин-2-карбоксамида;

2-(азетидин-3-ил)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)ацетамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)пирролидин-3-карбоксамида;

2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-метилбутанамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-метилбутанамида;

5-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)пентанамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)пентанамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-метоксипропанамида;

(2R,3S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-гидроксибутанамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)пиперидин-4-карбоксамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)пиперидин-3-карбоксамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(пирролидин-3-ил)ацетамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)пиперазин-2-карбоксамида;

(2S,4R)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-4-гидроксипирролидин-2-карбоксамида;

(2S,3S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-метилпентанамида;

(R)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-4-метилпентанамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-4-метилпентанамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3,3-диметилбутанамида;

2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3,3-диметилбутанамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-метил-2-(метиламино)бутанамида;

(S)-3-амино-N1-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)сукцинамида;

(S)-2-амино-N1-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)сукцинамида;

(R)-2-амино-N1-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)сукцинамида;

(S)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)тиазолидин-4-карбоксамида;

4-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)бензамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(пиперидин-4-ил)ацетамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-4-метилпиперидин-4-карбоксамида;

1-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-гидроксициклопентанкарбоксамида;

(S)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-метил-2-(метиламино)бутанамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-4,4-диметилпентанамида;

(S)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(метиламино)гексанамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)пентандиамида;

(R)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-(этилтио)пропанамида;

2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-4-(метилтио)бутанамида;

(R)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-фенилацетамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-фенилацетамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-(1H-имидазол-5-ил)пропанамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-(пиперидин-2-ил)пропанамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-(пиперидин-3-ил)пропанамида;

1-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-4-гидроксициклогексанкарбоксамида;

(R)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-фенилпропанамида;

(2S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-4-(метилсульфинил)бутанамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-(пиридин-2-ил)пропанамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-(пиридин-4-ил)пропанамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-(пиридин-3-ил)пропанамида;

(R)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-(пиридин-4-ил)пропанамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-4,5,6,7-тетрагидро-1H-пиразоло[4,3-c]пиридин-3-карбоксамида;

2-(1-(аминометил)циклогексил)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)ацетамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-(тиазол-4-ил)пропанамида;

(S)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(метиламино)-3-фенилпропанамида;

(R)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(метиламино)-3-фенилпропанамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-(4-гидроксифенил)пропанамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-4-(метилсульфонил)бутанамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2,2,2-трифторацетамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)пропан-2-сульфонамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3,3,3-трифторпропанамида;

(S)-3-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-4-метилпентанамида;

(S)-3-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)бутанамида;

5-((3S,5R)-3-метил-5-((2,2,2-трифторэтил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

5-((3R,5S)-3-((2,2-дифторэтил)амино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)морфолин-2-карбоксамида;

(S)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(метиламино)пропанамида;

(R)-3-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-4-метилпентанамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-5-метилизоксазол-3-карбоксамида;

(R)-3-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)бутанамида;

(S)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-метил-2-(метиламино)бутанамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(1H-имидазол-5-ил)ацетамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(пиридин-2-ил)ацетамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(1H-пиразол-1-ил)ацетамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-1H-пиразол-4-карбоксамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)никотинамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-1-метил-1H-имидазол-5-карбоксамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-1-метил-1H-пиразол-5-карбоксамида;

(S)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3,3,3-трифторпропанамида;

(R)-2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3,3,3-трифторпропанамида;

5-((3S,5R)-3-метил-5-((3,3,3-трифторпропил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

5-((3R,5S)-3-((цианометил)амино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-метилоксетан-3-карбоксамида;

5-((3S,5R)-3-метил-5-(((3-метилоксетан-3-ил)метил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

(R)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)морфолин-3-карбоксамида;

(S)-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)морфолин-3-карбоксамида;

3-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)оксетан-3-карбоксамида;

5-((3R,5S)-3-(((3-аминооксетан-3-ил)метил)амино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

этил 2-(((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)амино)ацетата;

диэтил 2,2'-(((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)азанедиил)диацетата;

5-((3S,5R)-3-метил-5-((тетрагидро-2Н-пиран-4-ил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

5-((3R,5S)-3-(этиламино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

5-((3S,5R)-3-метил-5-(оксетан-3-иламино)пиперидин-1-ил)хинолин-8-карбонитрила;

5-((3S,5R)-3-метил-5-(((5-(трифторметил)пиридин-2-ил)метил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

5-((3S,5R)-3-метил-5-((тетрагидрофуран-3-ил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

2-(((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)амино)ацетамида;

2-(((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)амино)-N-метилацетамида;

2-(((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)амино)-N-этилацетамида;

2-(((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)амино)-N,N-диметилацетамида;

5-((3S,5R)-3-метил-5-((оксазол-2-илметил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

5-((3S,5R)-3-метил-5-(((1-метил-1H-имидазол-4-ил)метил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

5-((3S,5R)-3-метил-5-(((6-(трифторметил)пиридин-3-ил)метил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

5-((3R,5S)-3-(((-пиразол-5-ил)метил)амино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

5-((3R,5S)-3-(((1,4-диметил-1H-пиразол-3-ил)метил)амино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

5-((3R,5S)-3-(((3,5-диметилизоксазол-4-ил)метил)амино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

5-((3S,5R)-3-метил-5-((2-оксопирролидин-3-ил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

5-((3S,5R)-3-метил-5-((3-(метилсульфонил)пропил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

5-((3R,5S)-3-((2-цианоциклопентил)амино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

5-((3S,5R)-3-метил-5-((1-(пиридин-2-ил)этил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

5-((3S,5R)-3-метил-5-((тетрагидро--пиран-3-ил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

5-((3R,5S)-3-(((1S,4S)-4-гидроксициклогексил)амино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

5-((3R,5S)-3-(((1R,4R)-4-гидроксициклогексил)амино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

5-((3S,5R)-3-метил-5-((4-оксоциклогексил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

5-((3R,5S)-3-((1,1-диоксидотетрагидро-2Н-тиопиран-4-ил)амино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

5-((3S,5R)-3-метил-5-((1-(6-метилпиридин-2-ил)этил)амино)пиперидин-1-ил)хинолин-8-карбонитрила;

2-амино-N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)этансульфонамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-2-(диметиламино)этансульфонамида;

N-((3R,5S)-1-(8-цианохинолин-5-ил)-5-метилпиперидин-3-ил)-3-(диметиламино)пропан-1-сульфонамида;

5-((3S,5R)-3-метил-5-(метил(оксетан-3-ил)амино)пиперидин-1-ил)хинолин-8-карбонитрила ацетата; и

5-((5S)-3-((1-гидроксипропан-2-ил)амино)-5-метилпиперидин-1-ил)хинолин-8-карбонитрила;

или его фармацевтичеки приемлемая соль.

3. Соединение по п.1, где указанное соединение представляет собой 5-((3R,5S)-3-амино-5-метилпиперидин-1-ил)хинолин-8-карбонитрил.

4. Способ лечения системной красной волчанки или волчанки, включающий введение фармацевтически эффективного количества соединения или фармацевтически приемлемой соли по любому из пп.1-3.

5. Способ по п.4, отличающийся тем, что указанное соединение вводят в форме фармацевтически приемлемой соли.

6. Способ антагонизации TLR7, включающий введение фармацевтически эффективного количества соединения или фармацевтически приемлемой соли по любому из пп.1-3.

7. Способ антагонизации TLR8, включающий введение фармацевтически эффективного количества соединения или фармацевтически приемлемой соли по любому из пп.1-3.

8. Фармацевтическая композиция, действующая в качестве антагониста или ингибитора для Толл-подобных рецепторов (TLR) 7 и/или 8, содержащая фармацевтически эффективное количество соединения или его фармацевтически приемлемой соли по любому из пп.1-3 и по меньшей мере один фармацевтически приемлемый носитель.

9. Способ лечения системной красной волчанки, кожной волчанки, психоневрологической волчанки или волчанки, включающий введение фармацевтически эффективного количества соединения или фармацевтически приемлемой соли по любому из пп.1-3.

10. Способ по п.9, отличающийся тем, что указанное соединение вводят в форме фармацевтически приемлемой соли.

11. Фармацевтически приемлемая соль соединения по любому из пп.1-3.



 

Похожие патенты:

Изобретение относится к способу получения Празиквантела. Способ включает следующие стадии: 1) β-фенэтиламин и хлорацетилхлорид подвергают реакции конденсации в присутствии щелочного вещества с получением соединения формулы II; 2) соединение формулы II и этаноламин подвергают реакции замещения с получением соединения формулы III; 3) соединение формулы III и циклогексанкарбонилхлорид подвергают реакции ацилирования в присутствии щелочного вещества с получением соединения формулы IV; 4) соединение формулы IV подвергают реакции окисления в присутствии окислителя с получением соединения формулы V; и 5) соединение формулы V подвергают реакции циклизации в присутствии циклизующего агента с получением Празиквантела в качестве соединения формулы I.

Изобретение относится к соединению, представленному общей формулой (I), или его фармацевтически приемлемой соли, где A1 представляет собой группу, выбранную из группы, включающей следующие пункты a) - c), где a) C6 арил, где кольцо является незамещенным или замещенным 1 или 2 заместителями, независимо выбранными из группы, включающей атом галогена, гидрокси, C1-6 алкил, C1-6 алкокси, галоген-C1-6 алкил, C1-6 алкоксикарбонил, циано, гидрокси-C1-6 алкил, карбамоил, нитро, амино, C1-6 алкоксикарбониламино-C1-6 алкил, моно(ди)C1-6 алкиламино, (C1-6 алкил)карбониламино, C1-6 алкилсульфониламино и C1-6 алкилсульфонил; b) тиазолил, и c) группа, выбранная из группы, состоящей из пиридила, пиримидинила, пиразинила и пиридазинила, где кольцо является незамещенным или замещенным 1 или 2 заместителями, независимо выбранными из группы, включающей атом галогена, гидрокси, C1-6 алкил, C1-6 алкокси, галоген-C1-6 алкил, циано и галоген-C1-6 алкокси; A2 представляет собой группу, выбранную из группы, включающей следующие пункты d) - f), где d) C6-10 арил, в котором кольцо является незамещенным или замещенным 1 или 2 заместителями, независимо выбранными из группы, включающей: атом галогена, гидрокси, C1-6 алкил, C1-6 алкокси, гидрокси-C1-6 алкокси, галоген-C1-6 алкил, галоген-C1-6 алкокси, циано, амино, нитро, карбокси, (C1-6 алкил)карбониламино, (C1-6 алкил)карбонилокси, (C1-6 алкил)карбонил и (C7-10 аралкилокси)карбонил; e) группа, состоящая из тиенила, пирролила, пиразолила, имидазолила, оксазолила, изоксазолила, тиазолила, изотиазолила, пиранила, пиридила, 1-оксидопиридила, пиридазинила, пиримидинила, пиразинила, фуразанила, морфонила, бензотиазолила, изохинолила, хинолила, 2,3-дигидробензофуранила, имидазо[1,2-a]пиридила, имидазо[1,2-a]пиразинила, бензо[1,3]диоксолила, бензотиенила, 5,6,7,8-тетрагидроимидазо[1,2-a]пиразинила, где кольцо является незамещенным или замещенным 1 или 2 заместителями, независимо выбранными из группы, включающей атом галогена, гидрокси, C1-6 алкил, C1-6 алкокси, галоген-C1-6 алкил, галоген-C1-6 алкокси, циано, моно(ди)C1-6 алкиламино, C1-6 алкилсульфанил, амино, (C7-10 аралкилокси)карбонил, гидрокси-C1-6 алкил, гидрокси-C1-6 алкокси, C2-6 алкенил, морфолино и (C1-6 алкил)карбонил, и f) C3-6 циклоалкил; X представляет собой CH или N; Y представляет собой -CR1R2- или атом кислорода; R1 и R2, независимо, представляют собой атом водорода, атом галогена или C1-6 алкил; R3 и R4, независимо, представляют собой атом водорода, атом галогена, C1-6 алкил, C1-6 алкокси, галоген-C1-6 алкил, галоген-C1-6 алкокси, гидрокси-C1-6 алкокси, C3-6 циклоалкил, C2-6 алкенил или циано при условии, что, когда Х представляет собой СН и R1 и R2 представляют собой атомы водорода, R3 и R4 при этом не представляют собой атомы водорода; и n равно 1 или 2.
Изобретение относится к полиморфной форме I 2-амино-N-[2-(3a-(R)-бензил-2-метил-3-оксо-2,3,3a,4,6,7-гексагидро-пиразоло[4,3-c]пиридин-5-ил)-1-(R)-бензилоксиметил-2-оксо-этил]изобутирамида L-тартрата.

Изобретение относится к производному пиразолилпиразола формулы (I), где R1 представляет собой атом галогена, R2 представляет собой цианогруппу, нитрогруппу или атом галогена, R3 представляет собой атом водорода, трифторацетильную группу или пентафторпропионильную группу, R4-R9 могут быть одинаковыми или различными и представляют собой атомы водорода, атомы галогена, C1-C6алкильные группы, которые могут быть замещены одним или несколькими атомами галогена в зависимости от случая, C3-C6циклоалкильные группы, которые могут быть замещены одним или несколькими атомами галогена в зависимости от случая, или C2-C6алкенильные группы, которые могут быть замещены одним или несколькими атомами галогена в зависимости от случая, a равен 3-5, и b равен 0-2.

Изобретение относится к новым цианированным нафталинбензимидазольным соединениям формулы I или их смесям, где R1, R2, R3, R4, R5, R6, R7, R8, R9 и R10 - водород, циано или фенил, который является незамещенным или замещенным RAr, где RAr выбран из циано, галогена, C1-С30-алкила, С2-С30-алкенила, С2-С30-алкинила, С3-С8-циклоалкила, фенила, при условии что соединения формулы I содержат по меньшей мере одну циано группу.

Изобретение относится к области органической химии, а именно к гетероциклическому соединению формулы I или к его фармацевтически приемлемой соли присоединения кислоты, где R1 представляет собой фенил, замещенный одним, двумя или тремя заместителями, выбранными из галогена, низшего алкила, замещенного галогеном, низшего алкокси, низшего алкокси, замещенного галогеном, циано или S(O)2-низшего алкила, или представляет собой морфолинил, дигидропиранил, пиридинил или пиперидинил, где пиридинил и пиперидинил замещены галогеном, или представляет собой С(O)O-низший алкил, R2 представляет собой водород; R3 представляет собой водород, низший алкил, замещенный галогеном, -(СН2)n-S(O)2-низший алкил, -(СН2)n-циклоалкил, -(СН2)n-низший алкокси или -бензил-S(O)2-низший алкил; R4 представляет собой водород или низший алкил, n равно 1 или 2.

Изобретение относится к соединению формулы I или его фармацевтически приемлемой соли, или стереоизомеру, которые обладают ингибирующей способностью в отношении Янус-киназ (JAK).

Изобретение относится к области органической химии, а именно к гетероциклическому соединению формулы (I) или к его фармацевтически приемлемой соли, где каждый R1 и R1a независимо выбран из группы, состоящей из Н, метила, CONHC(СН3)3, ОН, CO2H, CO2CH3, CO2CH2CH3, CH2OH, CN, ОСН3 и фенила; или R1 представляет собой CH2CO2H; или любые два R1 у одного атома углерода, взятые вместе, могут образовывать группу формулы =O; Ar представляет собой гетероарильную группу, выбранную из группы, состоящей из: , где каждый R7 независимо выбран из группы, состоящей из галогена, ОН, CN, C1-C3 алкила, C1-C3 алкилокси, С3циклоалкила, гетероциклоалкила, выбранного из пиперидина, который может быть замещен одной карбоксильной группой; С6арила, который может быть замещен одним атомом галогена; гетероарила, выбранного из группы, состоящей из тиофена, фурана, который может быть замещен C1-C3 алкилом, и пиридина; где R8 выбран из группы, состоящей из Н, С1-С2алкила, С1алкокси, С3циклоалкила и SO2R9; где R9 представляет собой C6-арил; е представляет собой целое число, выбранное из группы, состоящей из 0, 1 и 2; f представляет собой целое число, выбранное из группы, состоящей из 0 и 1; А представляет собой -CRaRb-; В представляет собой СН2; где каждый Ra и Rb независимо выбран из группы, состоящей из Н, ОН, CN, CF3, C1-C3алкила, С6арила, гетероарила, выбранного из тиофена; и где Ra и Rb являются различными; W1 и W2 выбраны так, что один представляет собой N, а другой представляет собой (CR12); связь от карбонильного углерода соединена с W1 или W2, представляющим собой N; D представляет собой О или (CR12); а представляет собой целое число, выбранное из группы, состоящей из 0, 1 и 2; b представляет собой целое число, выбранное из группы, состоящей из 0 и 1; с равен 1.

Изобретение относится к производному пиразолилпиразола формулы (I), где R1 представляет собой атом галогена, R2 представляет собой цианогруппу или нитрогруппу, R3 представляет собой атом водорода, трифторацетильную группу, пентафторпропионильную группу, R4-R6 могут быть одинаковыми или различными и представляют собой атомы водорода, атомы галогена, C1-C6алкильные группы, a равен 3-4 и b равен 0-2, исключая соединения, в которых R1 представляет собой атом хлора, R2 представляет собой цианогруппу, R3-R6 представляют собой атомы водорода и b равен 1.

Изобретение относится к области органической химии, а именно к гетероциклическому соединению формулы (X) и к его фармацевтически приемлемой соли, где X, Y и Z, каждый в отдельности, представляют собой N или С и по крайней мере два из них - X, Y или Z - представляют собой N, и когда X представляет собой N, Z представляет собой N; представляет простую или двойную связь; W и V выбраны из Н или незамещенного С1-С4 алкила; R1 представляет собой замещенный 1-2 заместителями или незамещенный моно- или бициклический С6-С10 арил; замещенный 1 или 2 заместителями или незамещенный моно- или бициклический 5-9-членный гетероарил, содержащий 2-3 гетероатома, выбранных из N, О и S; при этом заместитель представляет собой галоген, нитро, циано, гидроксил; незамещенный или тригалогензамещенный C1-С6 алкил, C1-С6 алкокси, С1-С6 алкилкарбонил, -NRaRb, -OC(O)-Rf, незамещенный фенил или фенил, замещенный 1-3 R3, или незамещенный моноциклический 5-6-членный гетероарил, содержащий 1-2 гетероатома, выбранных из N и S, или 5-6-членный гетероарил, содержащий 1-2 гетероатома, выбранных из N, замещенный 1 R4; R2 представляет собой С1-С4 алкоксикарбонил; -NRcRd; замещенный 1-3 заместителями или незамещенный моно- или бициклический С6-С10 арил; замещенный 1 заместителем или незамещенный моно- или бициклический 5-10-членный гетероарил, содержащий 1-2 гетероатома, выбранных из N, О и S; или замещенный 1 заместителем или незамещенный моноциклический частично ненасыщенный 6-членный гетероциклил, содержащий 1 гетероатом, выбранный из N; при этом заместитель представляет собой галоген, С2 алкилендиокси, незамещенный или тригалоген- или NRcRd-замещенный C1-C6 алкил либо С3-С6 циклоалкил, С1-С6 алкокси, C1-С6 сульфамид, -NRaRb, -C(O)R', морфолинил или незамещенный или замещенный R" пиперидинил; при этом R3 представляет собой галоген, циано, С1-С2 алкилендиокси, незамещенный или тригалоген- или морфолинилзамещенный C1-С6 алкил, C1-С6 алкокси, -NRaRb, -C(О)R' или морфолинил; R4 представляет собой галоген, незамещенный C1-С6 алкил либо незамещенный или C1-C6 алкоксикарбонилзамещенный пиперидинил; R' представляет собой C1-С6 алкил, C1-С6 алкокси, -NRaRb, C1-С6 алкилзамещенный 6-членный гетероциклил, содержащий 2 атома азота; R" представляет собой С1-С6 алкил, С3-С6 циклоалкил, C1-С6 алкилкарбонил, C1-С6 алкоксикарбонил, С3-С6 циклоалкилкарбонил либо замещенный бензоил, где заместитель выбран из тригалогензамещенного C1 алкила; Ra и Rb представляют собой Н, С1-С6 алкил или C1-С6 алкилкарбонил; Rc и Rd представляют собой Н или С1-С6 алкил или Rc и Rd, вместе с атомом N, к которому они прикреплены, образуют 6-членный гетероциклил, содержащий один атом кислорода; Rf представляет собой С1-С6 алкил либо незамещенный 5-членный гетероарил, содержащий один атом кислорода.

Изобретение относится к соединению формулы I, в которой W представляет собой -СН2СН2-; X представляет собой N или CR6; R1 выбран из 5-6-членного гетероарила, незамещенного или замещенного от 1 до 3 заместителями, где указанный гетероарил содержит от 1 до 2 гетероатомов, выбранных из атома серы или азота, и каждый из указанных заместителей независимо выбран из атома галогена, прямого или разветвленного С1-С4 алкила, прямого или разветвленного С1-С4 алкокси, -NR10R11, -C(=O)R12, прямого или разветвленного С1-С4 алканоилокси, циано, нитро, или два соседних заместителя вместе с присоединенным атомом углерода образуют 6-членное ароматическое кольцо, 5-членное насыщенное кольцо или 5-членное гетероциклическое кольцо, содержащее 2 гетероатома, выбранных из атома кислорода; R2 выбран из следующих групп, незамещенных или замещенных от 1 до 3 заместителями: прямого или разветвленного С1-С6 алкила, С3-С7 циклоалкила, 6-членной гетероциклической группы, содержащей 1 гетероатом, выбранный из атома азота, С6-арила; где указанный заместитель выбран из группы, состоящей из атома галогена, прямого или разветвленного С1-С4 алкила, прямой или разветвленной С1-С4 алкилсульфонильной группы, тетразолила, циано; каждый из R3, R4 и R5 независимо выбран из группы, состоящей из Н, прямого или разветвленного С1-С6 алкила; значения остальных радикалов указаны в формуле изобретения.

Изобретение относится к новому соединению формулы 1 или его фармацевтически приемлемой соли где А представляет собой оксадиазол, дигидрооксазол, тиазол или тиадиазол, возможно замещенный одним или более чем одним заместителем, выбранным из группы, состоящей из водорода, галогена, прямоцепочечного или разветвленного С1-С6 алкила и С1-С6 спирта, где прямоцепочечная или разветвленная С1-С6 алкильная или С1-С6 спиртовая группа возможно замещена водородом, галогеном или С1-С6 алкоксигруппой; В представляет собой пиридин, пиримидин, пиразин или оксадиазол, возможно замещенный одним или более чем одним заместителем, выбранным из группы, состоящей из водорода, галогена, прямоцепочечной или разветвленной С1-С6 алкильной, С1-С6 спиртовой, С1-С6 алкокси и оксадиазольной групп, где прямоцепочечная или разветвленная С1-С6 алкильная, С1-С6 спиртовая, С1-С6 алкокси или оксадиазольная группа возможно замещена водородом, галогеном, С1-С6 алкильной группой или С1-С6 алкоксигруппой; и X независимо представляет собой F, Cl, Br или I, обладающему агонистической активностью в отношении GPR119.

Изобретение относится к пирролидиновому производному формулы [1], где цикл А представляет собой необязательно замещенную арильную группу и т.п.; R1 представляет собой необязательно замещенную алкильную группу и т.п.; R2 представляет собой атом галогена и т.п.; R3 представляет собой алкильную группу, замещенную необязательно замещенной арильной группой, и т.п., и R4 представляет собой атом водорода и т.п.

Изобретение относится к новому соединению формулы I и его фармацевтически приемлемой соли. Соединения обладают свойствами ингибитора танкираз (TANK) и/или поли(ADP-рибоза)полимеразы (PARP) и могут найти применение для лечения таких заболеваний, как злокачественное новообразование, рассеянный склероз, сердечно-сосудистые заболевания.

Изобретение относится к соединению, выбранному из формулы 1, и его соли, где A представляет собой радикал, выбранный из группы, состоящей из А-1, А-2, А-3, А-4, А-6, А-7 и А-8; R1 представляет собой H или циклопропил; Z представляет собой O или S; L представляет собой -C(R12a)R12b-C(R13a)R13b-, где атом углерода, связанный с R12a и R12b, также связан с атомом азота карбоксамида в формуле 1; или 1,2-фенилен, необязательно имеющий до 4 заместителей, независимо выбранных из галогена и C1-C2алкила; G представляет собой N или C-R2a; каждый R2 независимо представляет собой галоген, нитро, циано, C1-C2алкил или C1-C2галогеналкил; n равняется 0, 1, 2 или 3; R2a представляет собой H, галоген, C1-C2алкил, C1-C2галогеналкил или C1-C2алкокси; B1 представляет собой CH или N; B2 представляет собой CH или N; R3 представляет собой галоген, C1-C3алкил или C1-C3галогеналкил; R4 представляет собой C1-C3галогеналкил; R5 представляет собой H; R6 представляет собой C1-C2алкил; R7 представляет собой C1-C3алкил или C1-C3галогеналкил; R8 представляет собой H или C1-C2алкил; R9 представляет собой галоген, C1-C3алкил или C1-C3галогеналкил; R11 представляет собой C1-C3алкил; m равняется 0, 1 или 2; каждый из R12a и R12b независимо представляет собой H, C1-C2алкил; R12a и R12b, взятые вместе, представляют собой C2-C4алкандиил; R13a представляет собой H, галоген, C1-C2алкил, C1-C2алкокси или C1-C2алкоксиамино; R13b представляет собой H, галоген; или R13a и R13b, взятые вместе, представляют собой C2-C4алкандиил; Q представляет собой 5-членное ненасыщенное гетероциклическое кольцо, содержащее члены кольца, выбранные из атомов углерода и до 3 гетероатомов, независимо выбранных из до 1 атома O, до 3 атомов N, где до 1 члена кольца, представляющего собой атом углерода, независимо выбран из C(=O), причем кольцо необязательно замещено одним заместителем R14c, R14n R15c или и R15n; R20 представляет собой C1-C3алкил; R21 представляет собой C1-C3алкил или C1-C3галогеналкил; и R22 представляет собой H.

Изобретение относится к соединениям, характеризующимся структурной формулой (Ib) или формулой (Id): (Ib), а также к композициям, содержащим соединения по настоящему изобретению, и способам модуляции сладкого вкуса и аромата.

Изобретение относится к бифункциональным соединениям, которые могут найти применение в качестве модуляторов мишеневого убиквитинирования, особенно ингибиторов различных полипептидов и других белков, которые деградируются и/или иным образом ингибируются бифункциональными соединениями в соответствии с настоящим изобретением.

Изобретение относится к соединению формулы I в любой из его стереоизомерных форм или смеси стереоизомерных форм в любом соотношении, или его фармацевтически приемлемым солям, которые обладают свойством ингибирования натрий-кальциевого обмена (NCX).

Изобретение относится к новому способу получения соединения формулы (I). Технический результат: разработан новый способ получения соединения формулы (I), которое полезно для профилактики и лечения инфекции, вызванной респираторно-синцитиальным вирусом (RSV) у млекопитающего или человека.

Изобретение относится к соединению формулы (I), в которой V выбран из C и N так, что ароматическое кольцо, содержащее V, представляет собой фенил или пиридин; R2 отсутствует, когда V представляет собой N; или, когда присутствует, R2 выбран из H, алкила, алкокси и галогена; R1 и R3 независимо выбраны из H, алкила, алкокси, галогена и CF3; W, X, Y и Z независимо выбраны из C и N, так, что кольцо, содержащее W, X, Y и Z, представляет собой пятичленный ароматический гетероцикл; где R5, R6 и R7 независимо отсутствуют или независимо выбраны из H, алкила, арила и CF3; P представляет собой -C(R10)(R11)NH2; A выбран из арила и гетероарила; алкил представляет собой линейный насыщенный углеводород, содержащий до 6 атомов углерода (C1-C6), или разветвленный насыщенный углеводород, содержащий от 3 до 6 атомов углерода (C3-C6); алкил, необязательно, может быть замещен -NR12R13; циклоалкил представляет собой моноциклический насыщенный углеводород, содержащий от 3 до 7 атомов углерода; алкокси представляет собой линейный O-связанный углеводород, содержащий от 1 до 6 атомов углерода (C1-C6), или разветвленный O-связанный углеводород, содержащий от 3 до 6 атомов углерода (C3-C6); алкокси, необязательно, может быть замещен арилом; арил представляет собой фенил; арил, необязательно, может быть замещен заместителем, выбранным из алкила, алкокси, галогена, CN, -морфолинила, -пиперидинила, гетероарила, арилаb, -O-арилаb, -CH2-арилаb, -(CH2)1-3-гетероарила, -CONR12R13, -(CH2)1-3-NR14R15 и NR12R13; гетероарил представляет собой 5, 6, 9 или 10-членное моно- или бициклическое ароматическое кольцо, содержащее, где это возможно, 1 или 2 кольцевых члена, независимо выбранных из N, S и O; гетероарил, необязательно, может быть замещен 1 или 2 заместителями, независимо выбранными из алкила, алкокси, морфолинила, арила, -(CH2)1-3-арила, гетероарилаb и NR12R13; значения остальных радикалов указаны в формуле изобретения.

Изобретение относится к соединениям, ингибирующим HCV, их стереоизомерам, таутомерам и фармацевтически приемлемым солям, их фармацевтическим композициям и применению смеси одной или нескольких из этих композиций для получения ингибирующих HCV лекарственных средств.

Изобретение относится к области органической химии, а именно к селективно замещенным соединениям хинолина формулы, в которой R8 представляет собой -Н или метил; R9 представляет собой -Н, метил или гидроксил; R10 представляет собой метил, гидроксил или NR11R12; и где R11 и R12 независимо выбирают, и где R11 представляет собой -H, метил или -СН2-СCH2CH3; и R12 представляет собой -H, оксопирролидинил, диоксидотиопиранил, изопропилсульфонил, тетрагидропиранил, оксетанил, тетрагидрофуранил, диметиламинэтансульфонил, аминоэтансульфонил, диметиламинопропансульфонил, С1-С6-алкил, который является линейным, разветвленным или циклическим, необязательно замещен метокси, -F, ≡N, метил оксетанилом, оксо-, метил имидазолилом, оксазолилом, необязательно замещенным метилом, пиразолилом, необязательно замещенным метилом или циано, CR13, где R13 представляет собой C1-C7-алкил, который является циклическим, разветвленным или линейным, необязательно замещен NR13R14, где R13 и R14 независимо выбирают из метила и -Н; метокси, гидроксилом, метилтио, этилтио, метилсульфонилом, оксо-, тиазолидинилом, пиридинилом, пиразолопиридинилом, метил амино, тиазолилом, -F, морфолинилом, метилизоксазолилом, метил оксетанилом, аминооксетанилом, фенилом, необязательно замещенным гидроксилом, -CNH2; пятичленным циклоалкилом, насыщенным или ненасыщенным, в котором 1 или 2 атома углерода заменены атомами азота, где циклоамин или циклодиамин необязательно замещен гидроксилом или метилом; или его фармацевтичеки приемлемой соли. Также изобретение относится к конкретным соединениям, способу лечения указанных заболеваний, способам антагонизации TLR7 и TLR8, фармацевтической композиции и фармацевтически приемлимым солям на основе соединения формулы. Технический результат: получены соединения, которые действуют в качестве антагониста или ингибитора для Толл-подобных рецепторов 7 и 8 и эффективны для лечения системной красной, психоневрологической и кожной волчанки. 8 н. и 3 з.п. ф-лы, 37 ил., 5 табл.

Наверх