Способ получения иммуногенной композиции на основе гибридного белка cfp10-dbd и декстрана, рекомбинантная плазмида pcfp10-dbd, штамм escherichia coli [prep4, pcfp10-dbd], химерный белок cfp10-dbd и их применение



Способ получения иммуногенной композиции на основе гибридного белка cfp10-dbd и декстрана, рекомбинантная плазмида pcfp10-dbd, штамм escherichia coli [prep4, pcfp10-dbd], химерный белок cfp10-dbd и их применение
Способ получения иммуногенной композиции на основе гибридного белка cfp10-dbd и декстрана, рекомбинантная плазмида pcfp10-dbd, штамм escherichia coli [prep4, pcfp10-dbd], химерный белок cfp10-dbd и их применение
Способ получения иммуногенной композиции на основе гибридного белка cfp10-dbd и декстрана, рекомбинантная плазмида pcfp10-dbd, штамм escherichia coli [prep4, pcfp10-dbd], химерный белок cfp10-dbd и их применение
Способ получения иммуногенной композиции на основе гибридного белка cfp10-dbd и декстрана, рекомбинантная плазмида pcfp10-dbd, штамм escherichia coli [prep4, pcfp10-dbd], химерный белок cfp10-dbd и их применение
Способ получения иммуногенной композиции на основе гибридного белка cfp10-dbd и декстрана, рекомбинантная плазмида pcfp10-dbd, штамм escherichia coli [prep4, pcfp10-dbd], химерный белок cfp10-dbd и их применение
Способ получения иммуногенной композиции на основе гибридного белка cfp10-dbd и декстрана, рекомбинантная плазмида pcfp10-dbd, штамм escherichia coli [prep4, pcfp10-dbd], химерный белок cfp10-dbd и их применение
Способ получения иммуногенной композиции на основе гибридного белка cfp10-dbd и декстрана, рекомбинантная плазмида pcfp10-dbd, штамм escherichia coli [prep4, pcfp10-dbd], химерный белок cfp10-dbd и их применение
Способ получения иммуногенной композиции на основе гибридного белка cfp10-dbd и декстрана, рекомбинантная плазмида pcfp10-dbd, штамм escherichia coli [prep4, pcfp10-dbd], химерный белок cfp10-dbd и их применение

 

C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2546875:

Федеральное государственное бюджетное учреждение "Центральный научно-исследовательский институт туберкулеза" Российской академии медицинских наук (RU)
Федеральное государственное бюджетное учреждение "Научно-исследовательский институт эпидемиологии и микробиологии имени почётного академика Н.Ф. Гамалеи" Министерства здравоохранения Российской Федерации (RU)

Группа изобретений относится к генной инженерии, биохимии, биотехнологии и иммунологии. Представлена рекомбинантная плазмида pCFP10-DBD, состоящая из искусственного бактериального оперона химерного белка, включающего промоторную область раннего промотора бактериофага Т5, ген химерного белка, состоящий из последовательности белкового антигена CFP10 из Mycobacterium tuberculosis, слитой с последовательностью декстрансвязывающего домена (DBD) декстрансукразы Leuconostoc citreum KM20, и терминатор транскрипции, бактериального оперона бета-лактамазы и бактериального участка инициации репликации типа ColE1. Также представлен штамм Escherichia coli - продуцента химерного белка CFP10-DBD. Описан способ иммобилизации, концентрирования и очистки полученного белка на целлюлозе. Описана иммуногенная композиция, содержащая рекомбинантный белок CFP10-DBD, направленная на индукцию иммунитета против туберкулезной инфекции. Изобретение расширяет арсенал средств, используемых для лечения туберкулеза. 4 н.п. ф-лы, 6 ил., 1 табл., 4 пр.

 

Заявляемая группа изобретений относится к генной инженерии, биохимии, биотехнологии и иммунологии и может быть использовано для получения рекомбинантного (химерного) белка CFP10-DBD и содержащей его иммуногенной композиции, направленной на индукцию иммунитета против туберкулезной инфекции. Изобретение позволяет получать штамм-продуцент, обеспечивающий высокий уровень продукции устойчивых иммуногенных белков, которые могут быть получены, иммобилизованы и очищены в одну стадию, а также получать эффективные иммуногенные композиции против туберкулеза.

Известна вакцина против туберкулеза БЦЖ (BCG, Bacillus Calmette-Guerin, 1921 г.), которая представляет собой живой аттенуированный штамм Mycobacterium bovis. Она безопасна, недорога и достаточно эффективно защищает детей как от заражения туберкулезом, так и от милиарного туберкулеза и туберкулезного менингита. Однако BCG не защищает взрослых от легочного туберкулеза, а именно эта форма болезни приводит к распространению инфекции и тяжелой эпидемической ситуации. Отсюда следует высокая актуальность разработки новых вакцин против туберкулеза.

Существует несколько направлений разработки новых противотуберкулезных вакцин, альтернативных БЦЖ: субъединичные вакцины, ДНК-вакцины и живые вакцины с улучшенными свойствами. Наиболее полно в экспериментальных моделях на животных охарактеризованы субъединичные вакцины, в том числе препараты, состоящие из нескольких секретируемых белков/пептидов Mycobacterium tuberculosis (Doherty T.M., Olsen A.W., Weischenfeldt I J. et al. Comparative Analysis of Different Vaccine Constructs Expressing Defined Antigens from Mycobacterium tuberculosis. The Journal of Infectious Diseases, 2004, Vol.190, pp.2146-2153). Идентифицировано много антигенов М. tuberculosis, потенциально важных в качестве компонентов новых вакцин. К ним относятся, в частности, иммунодоминантные секретируемые антигены, присутствующие в культуральном фильтрате М. tuberculosis. Среди секретируемых антигенов М tuberculosis лучше всего изучены антигены ESAT-6 (Early Secret Antigen Target-6), CFP-10 (culture-filtrate protein-10) и белки комплекса 85 (Ag85A, В, С).

Белки ESAT-6 и CFP-10 транслируются в составе одной рамки считывания, RD1, присутствующей в разных штаммах вирулентных микобактерий, но утраченной вакцинным штаммом BCG. Как нативные, так и рекомбинантные белки ESAT-6 и CFP-10 индуцируют синтез интерферона-гамма (ИФН-гамма, ИФН-γ) Т-лимфоцитами периферической крови инфицированных М tuberculosis лиц (Johnson P.O., Stuart R.L, Grayson M.L. et al. Tuberculin-purified protein derivative-, MPT-64, and ESAT-6-stimulated gamma interferon responses in medical students before and after Mycobacterium bovis BCG vaccination and in patients with tuberculosis. Clin. Diagn. Lab. Immunol, 1999, Vol.6, №6, pp.934-937; Berthet F.X., Rasmussen P.B., Rosenkrands I. et al. Mycobacterium tuberculosis operon encoding ESAT-6 and a novel low-molecular-mass culture filtrate protein (CFP-10). Microbiology, 1998, Vol.144, №11, pp.3195-3203), поэтому оба белка используются для разработки различных тестов серологической диагностики туберкулеза (Arena S.M., Andersen P., van Meijgaarden K.E. et al. Detection of active tuberculosis infection by Т cell responses to early-secreted antigenic target 6-kDa protein and culture filtrate protein 10. J. Infect. Dis., 2000, Vol.181, № 5, pp.1850-1854; van Pinxteren L.A., Ravn P., Agger E.M. et al. Diagnosis of tuberculosis based on the two specific antigens ESAT-6 and CFP10. Clin. Diagn. Lab. Immunol., 2000, Vol.7, №2, pp.155-160).

Известен способ [RU 2381274 C2, C12N 15/31, 10.02.2010], который касается получения микробиологическим синтезом нового гибридного полипептида GST-CFP10 со свойствами видоспецифичного белка-антигена CFP10 Mycobacterium tuberculosis, который может быть использован для ранней видоспецифичной диагностики туберкулезной инфекции. Использование изобретения обеспечивает возможность получать целевой высокоочищенный гибридный полипептид GST-CFP10 в препаративных количествах при сохранении иммуногенных свойств последнего.

Недостатком этого технического решения является относительно узкая область применения, поскольку полученный рекомбинантный белок не может быть использован эффективно в качестве иммуногенной композиции, т.к. иммуногенность рекомбинантного белка в условиях in vivo без применения адъювантов остается низкой.

Известны также технические решения, в которых описывается использование декстрансвязывающего домена из микроорганизма Leuconostoc mesenteroides в качестве домена, взаимодействующего с декстраном. Так, например, в [RU 2428477 C2, C12N 9/38, 10.09.2011] приводится описание химерной белковой конструкции ДСД-сп-β-ГАЛ, содержащей декстрансвязывающий домен из микроорганизма Leuconostoc mesenteroides, который генно-инженерным путем объединен через глицин-сериновый спейсер с термостабильной бета-галактозидазой из термофильного микроорганизма Thermoanaerobacter ethanolicus.

Однако отсутствие в изобретении разработанного способа очистки рекомбинантного белка с использованием декстрана в качестве сорбента (поскольку приводимый в известном техническом решении пример по определению декстрансвязывающих свойств у химерного белка можно использовать только для очистки термостабильных рекомбинантных белков) существенно снижает область его применения, т.к. использовать это техническое решение для получения иммуногенных компонентов медицинских иммунобиологических препаратов не эффективно по причине термолабильности антигенов.

Наиболее близким к предложенному является техническое решение [RU 2422525 C1, C12N 15/00, 27.06.2011], в котором предложена рекомбинантная плазмида pESAT6-CBD, представленная нуклеотидной последовательностью №1, обеспечивающая экспрессию рекомбинантного белка ESAT6-CBD, состоящего из полноразмерного белка ESAT6 M. tuberculosis, Gly-Ser спейсера, целлюлозосвязывающего домена гена эндоглюканазы CelD из A. thermophilum, размером 4282 п.н., состоящая из следующих структурных элементов:

- искусственный бактериальный оперон рекомбинантного белка ESAT6-CBD, включающий: промоторную область раннего промотора бактериофага Т5 (7-87 п.н.), ген рекомбинантного белка ESAT6-CBD (117-1007 п.н.), нетранслируемую область терминации транскрипции (1047-1141 п.н.);

- бактериальный оперон бета-лактамазы, обеспечивающий устойчивость к ампициллину (3217-4067 п.н.);

- бактериальный участок инициации репликации типа ColE1 (2474-2485 п.н.), обеспечивающий репликацию плазмиды в штаммах E.coli.

Кроме того, в наиболее близком техническом решении предложен рекомбинантный штамм E.coli M15 [pREP4, pESAT6-CBD], полученный трансформацией штамма E.coli M15 [pREP4] полученной плазмидой, продуцент белка ESAT6-CBD.

Предложен также способ получения, иммобилизации, концентрирования и очистки рекомбинантного белка ESAT6-CBD на целлюлозе, включающий:

- выращивание клеток штамма E.coli M15 [pREP4, pESAT6-CBD];

- иммобилизацию белка ESAT6-CBD в составе клеточных экстрактов штамма E.coli M15[pREP4, pESAT6-CBD] на целлюлозном сорбенте за счет аффинного взаимодействия при процедуре инкубации с последующей отмывкой от несвязавшихся бактериальных белков, при этом происходит концентрирование целевого продукта и его очистка; выделение целевого продукта.

Кроме того, предложен рекомбинантный белок ESAT6-CBD с молекулярной массой 32,0 кДа (р1 5,05), включающий полноразмерный белок ESAT6 с последовательностью №2, Gly-Ser спейсер с последовательностью №3, целлюлозосвязывающий домен гена эндоглюканазы CelD из A. thermophilum с последовательностью №4, а также иммуногенная композиция, содержащая белок по п.4 ESAT6-CBD, иммобилизованный на целлюлозе, в эффективном количестве, специфически активирующая Т-лимфоциты, синтезирующие ИФН-гамма при стимуляции антигенами микобактерий, и способ проверки протективных свойств иммуногенной композиции по п.5 в отношении туберкулезной инфекции в модели туберкулеза у мышей, включающий:

а) вакцинацию мышей инбредной линии C57BL/6 дважды, подкожно, с интервалом 2 недели препаратами: иммуногенная композиция по п.5 из расчета 10 мкг на мышь по содержанию действующего вещества; CBD-целлюлоза из расчета 10 мкг на мышь по содержанию CBD - отрицательный контроль 1; физиологическим раствором - отрицательный контроль 2;

в) заражение через 5 нед. после второй вакцинации мышей внутривенно в дозе 5·106 КОЕ вирулентным штаммом M.tuberculosis H37Rv;

с) умерщвление через 4 нед. после заражения из каждой группы по 4 мыши и проведение оценки размножения микобактерий в легких и селезенке методом посева гомогенатов органов на агар Дюбо с последующим подсчетом колоний;

d) построение кривых выживания при проведении наблюдений за оставшимися мышами (8 в каждой группе), при этом о протективных свойствах иммуногенной композиции по п.5 судят по результатам стадий с) и d).

Изобретение позволяет получать штамм-продуцент, обеспечивающий высокий уровень продукции устойчивых иммуногенных белков, которые могут быть получены, иммобилизованы и очищены в одну стадию, а также получать эффективные иммуногенные композиции против туберкулеза.

Недостатком данного изобретения является относительно низкая эффективность применения иммуногенной композиции «рекомбинантный белок CFP10-CBD - целлюлоза» в фармацевтической практике, что обусловлено низкой биодеградируемостью целлюлозы.

Задачей, на решение которой направлено изобретение, является разработка вакцинного препарата на основе отдельных белковых компонентов с высоким уровнем экспрессии и стабильности этих белков в бактериальной системе и получение на этой основе штамма-продуцента, обеспечивающего высокий уровень продукции устойчивых иммуногенных белков, которые могут быть получены, иммобилизованы и очищены в одну стадию, а также получение эффективных иммуногенных композиций против туберкулеза с возможностью обеспечения простоты тестирования иммуногенности.

Требуемый технический результат заключается в расширении области применения и повышение эффективности использования в фармацевтической практике.

Поставленная задача решается, а требуемый технический результат достигается тем, что согласно изобретению предложены:

1. Рекомбинантная плазмида pCFPlO-DBD с последовательностью №1, обеспечивающая экспрессию рекомбинантного белка CFPlO-sp-DBD, состоящего из фрагмента белка CFP10 из М. tuberculosis, Gly-Ser спейсера, декстрансвязывающего домена DBD из Leuconostoc citreum, размером 3771 п.н., состоящая из следующих структурных элементов:

- искусственный бактериальный оперон рекомбинантного белка CFP10-sp-DBD, включающий: промоторную область раннего промотора бактериофага Т5 (7-87 п.н.), ген рекомбинантного белка CFP10-sp-DBD (117-869 п.н), нетранслируемую область терминации транскрипции (909-1596 п.н.);

- бактериальный оперон бета-лактамазы, обеспечивающий устойчивость к ампицилину (2786-3646 п.н.);

- бактериальный участок инициации репликации типа ColE1 (2028-2038 п.н.), обеспечивающий репликацию плазмиды в штаммах Е. coli.

2. Рекомбинантный штамм E.coli M15 [pREP4, pCFP10-DBD], полученный трансформацией штамма E.coli M15 [pREP4] плазмидой по п.1, продуцент белка CFP10-DBD.

3. Способ получения иммобилизованного очищенного рекомбинантного белка CFP10-DBD на декстране, включающий выращивание клеток штамма E.coli M15 [pREP4, pCFP10-DBD] по п.2, для концентрирования целевого продукта и его очистки путем иммобилизации белка CFP10-DBD в составе клеточных экстрактов штамма E.coli M15 [pREP4, pCFP10-DBD] на декстрановом сорбенте за счет аффинного взаимодействия при процедуре инкубации с последующей отмывкой от несвязавшихся бактериальных белков и выделение целевого продукта.

4. Рекомбинантный белок CFP10-DBD с молекулярной массой 27,3 кДа, включающий полноразмерный белок CFP10 с последовательностью №2, Gly-Ser спейсер с последовательностью №3, декстрансвязывающий домен декстрансукразы Leuconostoc citreum KM20 с последовательностью №4.

5. Иммуногенная композиция, содержащая рекомбинантный белок по п.4 CFP10-DBD, иммобилизованный на декстране в эффективном количестве, специфически активирующая Т-лимфоциты, синтезирующие ИФН-гамма при стимуляции антигенами микобактерий.

Группа изобретений характеризуется чертежами:

на фиг.1 - схема плазмиды pCFP10-DBD;

на фиг.2 - последовательность №1 (последовательность нуклеотидов рекомбинантной плазмидной ДНК pCFP10-DBD);

на фиг.3 - последовательность №2 (последовательность аминокислот белка CFP10-sp-DBD;

на фиг.4 - последовательность №3 (нуклеотидная последовательность и соответствующая аминокислотная последовательность Gly-Ser спейсера);

на фиг.5 - последовательность №4 (нуклеотидная последовательность гена, кодирующего домен декстрансукразы Leuconostoc citreum KM20 и соответствующая аминокислотная последовательность белка);

на фиг.6 - электрофоретический анализ стабильности рекомбинантных белков CFP10-DBD L. citreum и CFP10-DBD L. mesenteroides в 12% ПААГ в течение 6 и 12 месяцев с момента лиофилизации препаратов, где обозначены: 1 - рекомбинантный белок CFP10-DBD L. citreum после 6 месяцев хранения, 2 - рекомбинантный белок CFP10-DBD L. citreum после 12 месяцев хранения, 3 - маркер молекулярных масс, 4 - рекомбинантный белок CFP10-DBD L. mesenteroides после 6 месяцев хранения, 5 - рекомбинантный белок CFP10-DBD L. mesenteroides после 12 месяцев хранения, стрелкой отмечена деградация рекомбинантного белка.

Для решения поставленной задачи и достижения требуемого технического результата используется конструирование химерного белка за счет соединения в одной рамке трансляции двух генов - гена вакцинирующего белка и гена белка-носителя, что приводит к синтезу в бактериальной системе химерного белка. Был создан рекомбинантный белок, состоящий из двух компонентов: антигена М. tuberculosis и декстрансвязывающего домена декстрансукразы Leuconostoc citreum KM20 (DBD). Рекомбинантный белок, имеющий в своем составе DBD, можно в одну стадию иммобилизовать на декстрановом носителе. В результате происходит одновременная очистка, концентрирование и стабилизация, а также обеспечивается защита от протеаз бактерий-продуцентов. При этом исходные антигенные свойства функционально активного белкового домена не нарушаются. Использование декстрансвязывающего домена декстрансукразы Leuconostoc citreum определяется тем, что он обеспечивает большую стабильность рекомбинантных белков, чем описанный в литературе последовательности из микроорганизмов Leuconostoc mesenteroides и Streptococcus sobrinus (S. Suwannarangsee, С.Moulis, G. Potocki-Veronese, P. Monsan, M. Remaud- Simeon, and W. Chulalaksananukul, "Search for a dextransucrase minimal motif involved in dextran binding.," FEBS letters, vol.581, №24, pp.4675-80, Oct. 2007).

При использовании этого подхода был получен двухкомпонентный рекомбинантный белок. Последовательность гена M. tuberculosis CFP10 кодирует полноразмерный белок, который формирует первый белковый домен, определяющий функциональные иммунологические свойства комплексной молекулы. Далее следует соединяющая (спейсерная) аминокислотная последовательность из нескольких чередующихся остатков глицина и серина (Gly-Ser). Второй белковый домен кодируется последовательностью гена декстрансукразы Leuconostoc citreum KM20; он определяет способность продукта взаимодействовать с декстрановым сорбентом. Белковый продукт нарабатывается в непатогенных лабораторных штаммах Escherichia coli. Иммобилизированный на декстране антиген представляет собой суспензию сорбента с адсорбированными на нем белками. Декстрановый носитель выступает в роли адъюванта при иммунизации, обеспечивающего укрупнение, полимеризацию антигена, без которого развивается более слабый иммунный ответ на белковые моноантигены. Антиген в свободном состоянии представляет собой раствор с определенной ионной силой, свободный от примесей липополисахаридов и ДНК штамма-продуцента.

Очистка конечного продукта от высокотоксичных для организма липополисахаридов, балластных белков, ДНК и РНК штаммов-продуцентов является важной проблемой.

Таким образом, заявляемая группа изобретений позволяет: создавать штамм E.coli, обеспечивающий высокий уровень продукции рекомбинантного белка, содержащего белок М. tuberculosis CFP10; получить простую и эффективную схему очистки рекомбинантного белка, специфически и эффективно индуцирующего иммунный ответ на антиген микобактерий, в том числе синтез ИФН-гамма, необходимый для противотуберкулезной защиты; создавать иммуногенную композицию на основе рекомбинантного белка на декстрановом носителе (адъювант).

Указанный результат достигается за счет синтеза рекомбинатного белка CFP10-DBD в клетках рекомбинантного штамма E.coli M15 [pREP4, pCFP10-DBD], несущего рекомбинантную плазмиду pCFPlO-DBD. Также за счет создания комплексного препарата CFPlO-DBD-декстран, в котором рекомбинантный белок CFP10-DBD (3,5 мг/мл) иммобилизован на декстране (50 мг/мл) и ресуспендирован в 1×PBS буфере рН 7,2-7,4.

Предложенная группа изобретений реализуется следующим образом.

Создана рекомбинантная плазмида pCFP10-DBD (3771 п.н., последовательность №1), кодирующая бифункциональный рекомбинантный белок CFP10-DBD (последовательность №2), обладающий способностью самопроизвольно связываться с декстрансодержащим сорбентом. Плазмида pCFP10-DBD содержит следующие существенные для ее функционирования структурные элементы:

- искусственный бактериальный оперон рекомбинантного белка CFP10-sp-DBD, включающий: промоторную область раннего промотора бактериофага Т5 (7-87 п.н.), ген рекомбинантного белка CFP10-sp-DBD (117-869 п.н), нетранслируемую область терминации транскрипции (909-1596 п.н.);

- бактериальный оперон бета-лактамазы, обеспечивающий устойчивость к ампицилину (2786-3646 п.н.);

- бактериальный участок инициации репликации типа ColE1 (2028-2038 п.н.), обеспечивающий репликацию плазмиды в штаммах Е. coli.

Штамм-продуцент рекомбинантного белка CFP10-DBD получают трансформацией клеток E.coli штамма M15[pREP4] плазмидой pCFP10-DBD. Штамм обеспечивает продукцию рекомбинантного белка CFP10-DBD после проведения процедуры индукции (изопропил-β-D-тио-галактопиранозидом) (ИПТГ) до 12-15% от тотального белка клетки.

Штамм E.coli M15[pREP4], несущий плазмиду pCFPlO-DBD, - продуцент бифункционального рекомбинантного белка CFP10-DBD - характеризуется следующими признаками.

Культурально-морфологические признаки.

Клетки прямые, палочковидные, неподвижные, грамотрицательные. При рассеве на чашке с 2,0% агаризованной средой LB рост в виде отдельных колоний, иногда в R-форме с неровными краями. Хорошо растет на плотных и жидких питательных средах (LB-бульон, LB-агар, МПА, МПБ).

Физиолого-биохимические признаки.

Клетки растут при температуре от +4°С до +42°С при оптимуме рН 6,8-7,5. Штамм разлагает глюкозу, маннит с образованием кислоты, не разлагают сахарозу, арабинозу, галактозу, сбраживают мальтозу, ксилозу, сорбит, рамнозу. Существенным при использовании данного штамма является его чувствительность к налидиксовой кислоте (25 мг/мл), стрептомицину (20 мг/мл) и рифампицину (25 мг/мл). Проявляет устойчивость к ампициллину (до 300 мкг/мл), обусловленную наличием плазмиды pCFP10-DBD, и к канамицину (до 50 мкг/мл), обусловленную наличием плазмиды pREP4.

По созданию комплексного препарата рекомбинантного белка и декстрана технический результат достигается за счет создания двухкомпонентного рекомбинатного белка, состоящего из белка CFP10 М. tuberculosis и гена декстрансукразы Leuconostoc citreum KM20. А также за счет получения комплексного препарата (иммунологического композиции), в которой рекомбинатный белок (CFP10-DBD) иммобилизован на декстране (CFP 10-DBD-декстран).

Рекомбинантный белок CFP10-DBD имеет в своем составе домен, определяющий способность связываться с декстраном, что позволяет проводить в одну стадию концентрирование, очистку и иммобилизацию белкового продукта на декстране. Иммобилизация на декстране обеспечивается за счет присутствия в рекомбинантном белке декстрансвязывающего домена декстрансукразы Leuconostoc citreum KM201. Поскольку в Е. coli отсутствуют белки, связывающиеся с декстраном, то синтезируемый в клетках E.coli, трансформированных плазмидой pCFP10-DBD, рекомбинантный белок CFP10-DBD является единственным белком штамма-продуцента, прочно связывающимся с декстраном. Это обеспечивает возможность одностадийного получения высокоочищенного препарата белка, иммобилизованного на сорбенте. На чертеже приведена схема плазмиды pCFP10-DBD.

Сравнение стабильности рекомбинантных микобактериальных белков, слитых с декстрансвязывающими доменами из L. mesenteroides и L. citreum выявили, что белки, слитые с декстрансвязывающим доменом из L. mesenteroides являются нестабильными и склонны к деградации при хранении свыше полугода, что не позволяет использовать вышеупомянутый домен для очистки этих рекомбинантных белков. Использование DBD L. citreum в качестве субъединицы, которая связывается с декстраном, позволяет получать более стабильные иммуногенные композиции.

Была исследована иммуногенность комплексного препарата CFP10-DBD-декстран на мышах. Мышей иммунизировали под кожу спины 2-кратно с 2-недельным интервалом иммуногенным и контрольным препаратом. Через 5 недель был исследован пролиферативный ответ Т-клеток и количество Т-клеток, продуцирующих ИФН-гамма. Был выявлен прирост ИФН-гамма-положительных Т-клеток и усиление пролиферации в присутствии антигена в культуре клеток по сравнению с контрольными животными.

Изобретение проиллюстрировано следующими примерами.

Генно-инженерные и микробиологические манипуляции, амплификацию и секвенирование ДНК проводили по стандартным методикам (T.Parish, N.G. Stoker. Mycobacterium tuberculosis protocols., Humana Press Inc., 2001, Methods in molecular Medicine, 54; Маниатис Т., Фрич Э., Сэмбрук Дж. Молекулярное клонирование, М.: Мир, 1984; Клонирование ДНК. Методы. Под ред. Д.Гловера, Пер. с англ., М.: Мир, 1988; Saiki R.K., Gelfand D.H., Stoffel S. et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 1988, Vol.239, №4839, pp.487-491; Sanger F., Nicklen S., Coulson A.R. DNAsequencing with chain-terminating inhibitors (DNA polymerase/nucleotide sequences/bacteriophage 4Х174). Proc. Nat. Acad. Sci. USA, 1977, Vol.74, № 12, pp.5463-5467).

Пример 1. Получение экспрессионной генетической конструкции. а) Получение фрагмента гена белка sp-DBD с последующим его клонированием в вектор pQE6.

Фрагмент гена белка sp-DBD, содержащий Gly-Ser спейсер (последовательность №3) и последовательность декстрансвязывающего домена DBD из L. citreum KM20 (последовательность №4), получали синтетическим путем в фирме Евроген. Нуклеотидная последовательность, кодирующая белок sp-DBD, была спланирована с использованием оптимальных кодонов для экспрессии в Е. coli с учетом отсутствия выраженной вторичной структуры мРНК.

Для клонирования гена белка sp-DBD плазмидный вектор pQE6 и синтезированную в фирме Евроген плазмиду pAT-sp-DBD гидролизовали эндонуклеазами рестрикции NcoI и Kpn2I при 37°С в буфере, содержащем 33 мМ Трис-ацетата (рН 7,9 при 37°С), 10 мМ ацетата магния, 66 мМ ацетата калия и 0,1 мг/мл BSA в течение 1 ч. В 1,2% агарозном геле проводили разделение продуктов рестрикции. Выделенный из агарозного геля фрагмент вектора pQE6 (размером 3016 п.н.) объединяли с фрагментом плазмиды pAT-sp-DBD (464 п.н.). Далее фрагменты лигировали при 25°С в буфере, содержащем 40 мМ Трис-HCl, 10 мМ MgCl2, 10 мМ DTT, 0,5 мМ АТФ (рН 7,8 при 37°С) с помощью ДНК-лигазы бактериофага Т4 в течение 1 ч. Продукты реакции переосаждали при -20°С 96%-ным этиловым спиртом с добавлением ацетата аммония в течение 1,5 ч. После переосаждения смесь растворяли в деионизированной воде. Методом электропорации полученной лигазной смесью трансформировали компетентные клетки Е. coli штамма M15 [pREP4] (NalS, StrS, rifS, lac-, ara-, gal-, mtl-, F-, recA+, uvr+). После трансформации клоны отбирали на агаризованной среде LB, содержащей антибиотики ампициллин (50 мг/мл) и канамицин (25 мг/мл). Плазмидную ДНК из колоний выделяли методом щелочного лизиса; анализировали методом рестрикционного картирования эндонуклеазами рестрикции BglI, BglII, BspMII и NcoI. Отбирали клоны плазмидной ДНК psp-DBD (3480 п.н.), содержащие в своем составе последовательность гена белка sp-DBD. Первичную структуру полученных конструкций подтверждали секвенированием.

б) Получение фрагмента гена белка CFP10 с последующим его клонированием в плазмиду psp-DBD.

Фрагмент гена белка CFP10 из М. tuberculosis получали синтетическим путем в фирме Евроген. Нуклеотидная последовательность, кодирующая белок CFP10, была спланирована с использованием оптимальных кодонов для экспрессии в Е. coli с учетом отсутствия выраженной вторичной структуры мРНК.

Для клонирования гена белка CFP10-sp-DBD2 плазмиду psp-DBD2 и синтезированную в фирме Евроген плазмиду рАТ- CFP10 гидролизовали эндонуклеазами рестрикции NcoI-BamHI и NcoI-BglII соответственно при 37°С в буфере, содержащем 33 мМ Трис-ацетата (рН 7,9 при 37°С), 10 мМ ацетата магния, 66 мМ ацетата калия и 0,1 мг/мл BSA в течение 1 ч. В 1,2% агарозном геле проводили разделение продуктов рестрикции. Выделенный из агарозного геля фрагмент вектора psp-DBD2 (размером 3469 п.н.) объединяли с фрагментом плазмиды pAT-CFPIO (302 п.н.). Далее фрагменты лигировали при 25°С в буфере, содержащем 40 мМ Трис-HCl, 10 мМ MgCl2, 10 мМ DTT, 0,5 мМ АТФ (рН 7,8 при 37°С) с помощью ДНК лигазы бактериофага Т4 в течение 1 ч. Продукты реакции переосаждали при -20°С 96% C2H5OH с добавлением ацетата аммония в течение 1,5 ч. После переосаждения смесь растворяли в деионизированной воде (mQ Н2О). Методом электропорации полученной лигазной смесью трансформировали компетентные клетки Е. coli штамма M15 [pREP4] (NalS, StrS, rifS, lac-, ara-, gal-, mtl-, F-, recA+, uvr+). После трансформации клоны отбирали на агаризованной среде LB, содержащей антибиотики ампициллин (50 мг/мл) и канамицин (25 мг/мл). Плазмидную ДНК из колоний выделяли методом щелочного лизиса; анализировали методом рестрикционного картирования эндонуклеазами рестрикции BglI, BglII, BspMII, NcoI. Отбирали клоны плазмидной ДНК pCFP10-sp-DBD2 (3771 п.н.), содержащие в своем составе последовательность гена белка CFP10-sp-DBD2. Первичную структуру полученных конструкций подтверждали секвенированием.

Пример 2. Конструирование штамма Е. coli - продуцента антигена M.tuberculosis, соединенного с декстрансвязывающим доменом.

Для получения штамма E.coli - продуцента рекомбинантного белка CFP10-DBD - клетки штамма Е. coli M15 [pREP4] трансформировали плазмидой pCFP10-DBD. Трансформированные клетки выращивали в 3,5 мл среды LB с ампициллином и канамицином при 37°С до оптической плотности, соответствующей 1 ед. поглощения при длине волны 550 нм (около 2,5 ч). В культуру добавляли 3 мкл 0,1 М раствора изопропил-бета-D-тиогалактопиранозида (ИПТГ, IPTG) и выращивали в течение 3 ч. Для контроля продукции рекомбинантного белка в штамме E.coli M15[pREP4, pCFP10-DBD] применяли метод электрофореза по Лэммли в присутствии додецилсульфага натрия (ДСН). Разделение белков проводили в 12% полиакриламидном геле (ПААГ) в стандартной системе буферов (электродный буфер: 25 мМ Tris-HCl, 192 мМ глицин, 0,1% додецилсульфаг натрия, рН 8,3; буфер для геля: 375 мМ Трис-HCl, рН 8,8). По окончании электрофореза гели окрашивали 0,15%-ным раствором Кумасси G250 в 25%-ном изопропаноле и 10%-ной уксусной кислоте и отмывали в 10%-ной уксусной кислоте. При сравнении спектра белков в штаммах E.coli M15 [pREP4], E.coli M15 [pREP4, pCFP10-DBD] обнаруживали появление дополнительной белковой полосы. Молекулярная масса дополнительной полосы 27,3 кДа соответствовала расчетной для белка CFP10-DBD. Уровень синтеза белка в E.coli определяли, сравнивая интенсивность окрашивания полосы рекомбинантного белка с полосой соответствующего белка-стандарта Unstained Protein Molecular Weight Marker («Fermentas», Литва).

Для проверки растворимости синтезируемого белка биомассу выращенного штамма (Е. coli M15 [pREP4, pCFP10-DBD) подвергали разрушению в 1% TES буфере (25 мМ Трис-HCl, 5 мМ ЭДТА, 50 мМ NaCl, 1% Тритон Х-100, 5 мг/мл лизоцим) в соотношение биомасса-буфер 1:2 и гомогенизировали до однородной массы. После центрифугирования пробы разделяли на 2 фракции: растворимых клеточных белков (надосадочная жидкость) и нерастворимых (осадок). Обе фракции подвергали разрушению в лизирующем буфере (0,05 М Трис-HCl, рН 6.8, 0,5% Triton X-100, 0,5 М NaCl, 0,25 М MgCl2, 5 мг/мл лизоцим, 10 мг/мл PMSF, 20 мг/мл ДНКаза) в соотношении 1:1; гомогенизировали до однородной массы; прогревали при +95°С 15 мин. Результаты контролировали с помощью электрофореза по Лэммли. Было показано, что рекомбинантный белок CFP10-DBD синтезируется в клетках Е. coli как в растворимой фракции, так и виде телец-включений.

Пример 3. Получение рекомбинантного белка CFP10-DBD в свободном состоянии и иммобилизованном на декстране.

Для получения рекомбинантного белка культуру штамма Е. coli M15[pREP4, pCFP10-DBD] выращивали в 1000 мл среды LB с ампициллином и канамицином при 37°С до оптической плотности, соответствующей 1 ед. поглощения при длине волны 550 нм. В среду добавляли 100 мкл 0,1 М раствора ИПТГ и выращивали в течение 3 ч. Клетки осаждали центрифугированием при 5500 об/мин в течение 15 мин.

Осадок ресуспендировали в лизирующем буфере, содержащем 50 мМ Трис-HCl (рН 8,0), 0,25 мМ NaCl, 5 мМ MgCl2, 0,15 мМ PMSF, 0,1% Тритон-X100, 0,5 мг/ мл лизоцима, 20 мг/ мл ДНКазы; из расчета 1 г биомассы на 4 мл буфера. Дополнительно суспензию обрабатывали ультразвуком 3 раза по 20 сек. После центрифугирования при 16000 об/мин в течение 30 мин фракция нерастворимых клеточных белков оставалась в осадке, растворимых - в надосадочной жидкости.

Осадок (нерастворимая фракция) суспендировали в лизирующем буфере (50 мМ Трис-HCl (рН 8,0), 10 мМ ЭДТА, 0,002 объема β-меркаптанола) и добавляли равный (по массе) объем мочевины. После перемешивания выдерживали на водяной бане при +37°С до полного растворения мочевины. Центрифугировали при 12000 об/мин 30 мин и отбирали надосадочную жидкость. Для очистки рекомбинантного белка надосадочную жидкость переносили на колонку с Sephadex G200 (декстран со сшивками). Элюцию белков с декстрана проводили градиентным раствором (8-2 М) мочевины и 50 мМ Трис-HCl (рН 8,0). Для удаления мочевины образцы диализовали против PBS буфера при 25°С в течение ночи.

Растворимую фракцию белков использовали для иммобилизации на декстране. К надосадочной жидкости добавляли раствор декстрана с концентрацией 50 мг/мл в физиологическом растворе; инкубировали при 25°С 1 ч. В иммобилизованном на сорбенте состоянии белки представляют собой суспензию.

Концентрацию белков в свободной и иммобилизованной форме определяли по Бредфорду при длине волны 595 нм. Образцы подвергали лиофилизации. Таким образом, были получены следующие комплексные препараты (иммуногенные композиции) CFP10-DBD и CFP10-DBD-декстран.

Пример 4. Оценка стабильности очищенного рекомбинантного белка.

Оценка стабильности рекомбинантных белков, полученных путем слияния последовательности микобактериального белка CFP10 и DBD Leuconostoc citreum или DBD Leuconostoc mesenteroides, проводилась с помощью электрофореза в 12% ПААГ. Препараты химерных белков CFP10-DBD Leuconostoc citreum и CFP10-DBD Leuconostoc mesenteroides хранились при температуре 0-4°С в течение 6 и 12 месяцев с даты лиофилизации. Исследования выявили, что белок CFP10-DBD Leuconostoc mesenteroides менее стабилен, чем CFP10-DBD Leuconostoc citreum и после 6 месяцев хранения начинается его денатурация (см. фиг.1).

Пример 5. Способ проверки иммуногенности комплексных препаратов Ag-DBD-декстран на мышах.

Продукция Т-клетками ИФН-γ в ответ на стимуляцию секретируемыми антигенами микобактерий считается самым важным элементом адаптивного защитного иммунного ответа при туберкулезной инфекции, поэтому вакцинация прежде всего должна стимулировать именно эту функцию.

Иммуногенные свойства иммуносорбента, содержащего рекомбинантный антиген М. tuberculosis - CFP10-DBD, проверяли на мышах инбредной линии C57BI/6. Положительным контролем была группа мышей, вакцинированная BCG. Количество Т-лимфоцитов, продуцирующих ИФН-γ, определяли в лимфатических узлах и селезенке методом ELISPOT.

У иммунизированных мышей исследовали селезенку и паховые лимфоузлы; готовили суспензию клеток. В работе использовали связывающие моноклональные антитела к ИФН-γ мыши клон R4-6A2, биотинилированные антитела к ИФН-γ мыши клон XMG1.2. Связывающие моноклональные антитела разводили в буфере PBS (рабочая концентрация 4 мкг/мл), вносили в лунки планшета и инкубировали 18 ч при 4°С. После этого содержимое лунок удаляли, вносили суспензию клеток (2,5-3,0×105 клеток/лунка) в культуральной среде и инкубировали 2-4 ч при 37°С. На этом этапе и далее перед внесением каждого следующего компонента планшет отмывали PBS. Содержимое лунок удаляли, в часть из них вносили образец рекомбинантного белка, разведенный в PBS (10 мкг/мл), в отрицательный контроль - PBS, инкубировали 48 ч при 37°С в 5% CO2. В лунки вносили биотинилированные проявляющие антитела в концентрации 1 мкг/мл, инкубировали 2-4 ч при 25°С. Добавляли конъюгат щелочной фосфатазы со стрептавидином, разведенный в PBS до концентрации 1:1000 (100 мкл/лунка), инкубировали 1-2 ч при 25°С. Добавляли субстрат щелочной фосфатазы, разведенный в PBS. Через 5-60 мин реакцию останавливали дистиллированной водой, планшет высушивали, оценивали количество пятен в лунках. Для выявления достоверности различий использовали t-критерий Стьюдента (Р<0,01). Результаты представлены в таблице.

Количество Т-клеток (×10*6), продуцирующих ИФН-γ in vitro в ответ на антиген CFP10 после двукратной подкожной иммунизации препаратом CFP10-DBD-декстран.

Вакцинация Количество продуцентов ИФН-гамма на 1 млн клеток лимфатических узлов Количество продуцентов ИФН-гамма на 1 млн клеток селезенки
Без антигена в культуре 6±0,5 8±1,0
CFP10-DBD-декстран 10,5±1,2 34,8±2,1
BCG 31±1,4 132±3,5
DBD-декстран 7±0,3 6±0,8

Результаты показывают, что вакцинация моноантигенами, связанными с декстраном через DBD-домен, приводит к специфической активации продуцентов ИФН-гамма. Вакцинация теми же антигенами, в тех же количествах, но без адсорбции на декстране не вызывает иммунного ответа.

Таким образом, в предложенном изобретении достигается требуемый технический результат, поскольку получен штамм-продуцент, обеспечивающий высокий уровень продукции устойчивого иммуногенного белка, который может быть получен, иммобилизован и очищен в одну стадию, а также получена эффективная иммуногенная композиция против туберкулеза.

1. Рекомбинантная плазмида pCFP10-DBD с последовательностью №1, обеспечивающая экспрессию рекомбинантного белка CFP10-sp-DBD, состоящего из фрагмента белка CFP10 из М. tuberculosis, Gly-Ser спейсера, декстрансвязывающего домена DBD из Leuconostoc citreum, размером 3771 п.н., состоящая из следующих структурных элементов:
- искусственный бактериальный оперон рекомбинантного белка CFP10-sp-DBD, включающий: промоторную область раннего промотора бактериофага Т5 (7-87 п.н.), ген рекомбинантного белка CFP10-sp-DBD (117-869 п.н), нетранслируемую область терминации транскрипции (9091596 п.н.);
- бактериальный оперон бета-лактамазы, обеспечивающий устойчивость к ампицилину (2786-3646 п.н.);
- бактериальный участок инициации репликации типа ColEl (20282038 п.н.), обеспечивающий репликацию плазмиды в штаммах Е.coli.

2. Рекомбинантный штамм E.coli M15 [pREP4, pCFP10-DBD], полученный трансформацией штамма E.coli M15 [pREP4] плазмидой по п. 1, продуцент белка CFP10-DBD.

3. Способ получения иммобилизованного очищенного рекомбинантного белка CFP10-DBD на декстране, включающий выращивание клеток штамма E.coli M15 [pREP4, pCFP10-DBD] по п. 2, для концентрирования целевого продукта и его очистки путем иммобилизации белка CFP10-DBD в составе клеточных экстрактов штамма E.coli M15 [pREP4, pCFP10-DBD] на декстрановом сорбенте за счет аффинного взаимодействия при процедуре инкубации с последующей отмывкой от несвязавшихся бактериальных белков, и выделение целевого продукта.

4. Иммуногенная композиция, специфически активирующая Т-лимфоциты, синтезирующие ИФН-гамма при стимуляции антигенами микобактерий, содержащая рекомбинантный белок CFP10-DBD с молекулярной массой 27,3 кДа, включающий полноразмерный белок CFP10 с последовательностью №2, Gly-Ser спейсер с последовательностью №3 и декстрансвязывающий домен декстрансукразы Leuconostoc citreum КМ20 с последовательностью №4.



 

Похожие патенты:

Заявленная группа изобретений относится к области биологии, в частности к оборудованию для автоматической очистки биологических образцов при выделении целевых веществ из множества биологических образцов, для автоматической очистки биологического образца, оснащенное элементом для приложения магнитного поля, в котором элемент для приложения магнитного поля для очистки биологических образцов и нагревательный элемент сформированы в виде единого компонента друг с другом так, чтобы быть подвижными вверх и вниз.

Изобретение относится к области биотехнологии, конкретно к созданию конъюгатов магнитная частица - нуклеиновая кислота, и может быть использовано для молекулярно-генетической диагностики.

Изобретение относится к области биотехнологии, в частности к способам получения ферментных препаратов. Изобретение касается термостабильной двухдоменной лакказы бактерии Streptomyces griseoflavus Ac-993 со щелочным оптимумом активности, последовательности ДНК, кодирующей данный фермент, и способа получения фермента, включающий клонирование в клетках бактерии Escherichia coli гена фермента, продукцию фермента в клетках Escherichia coli, внесение ионов меди в среду для культивирования рекомбинантного штамма для образования активного фермента, получение ферментного препарата методами металлхелатной хроматографии и гельфильтрации.

Группа изобретений относится к генной инженерии, биохимии, биотехнологии и иммунологии и представляет собой рекомбинантную плазмиду pESAT6-CFP10-DBD, рекомбинантный штамм Escherichia coli M15 [pREP4, pESAT6-CFP10-DBD], способ получения, иммобилизации, концентрирования и очистки рекомбинантного белка ESAT6-CFP10-DBD на декстране, рекомбинантный белок ESAT6-CFP10-DBD с молекулярной массой 26,4 кДа, иммуногенную композицию, содержащую белок ESAT6-CFP10-DBD, иммобилизованный на декстране, специфически активирующую Т-лимфоциты, синтезирующие ИФН-гамма при стимуляции антигенами микобактерий.

Изобретение относится к биохимии, в частности к молекулярной биологии, биотехнологии, генной инженерии. Изобретение представляет собой оптимизированные последовательности ДНК, кодирующие легкую и тяжелую цепь моноклонального антитела, предназначенные для синтеза антитела в рекомбинантных CHO-S клетках, и способ получения данного антитела в указанных клетках.

Настоящее изобретение относится к биотехнологии и представляет собой молекулярные конъюгаты, способные связываться с нуклеиновыми кислотами (ДНК или РНК) для доставки их в клетки млекопитающего, экспрессирующие рецепторы трансферрина.

Изобретение относится к области молекулярной биологии и генной инженерии. Предложена молекула RNAi для супрессии экспрессии тимидилатсинтазы за счет действия RNAi, содержащая домен двухцепочечной РНК, состоящий из смысловой цепи, состоящей из нуклеотидной последовательности, представленной SEQ ID NO: 1, гибридизованной с антисмысловой цепью, гибридизующейся в жестких условиях со смысловой цепью.

Изобретение относится к биотехнологии и генной инженерии и представляет собой рекомбинантный слитый белок формулы S-L-R, в том числе SR10, SR13, SR15, SdR10, SdR13 или SdR15, специфически узнающий меланомные клетки, в котором S - мономер стрептавидина, L - линкер, имеющий аминокислотную последовательность Ser-Arg-Asp-Asp-Asp-Asp-Lys, содержащую сайт расщепления энтеропептидазой и обозначаемую как «d», или аминокислотную последовательность Ser-Arg-Ala-Gly-Ala,R - меланома-адресующий олигопептид, представляющий собой R10, имеющий аминокислотную последовательность Asp-Gly-Ala-Arg-Tyr-Cys-Arg-Gly-Asp-Cys-Phe-Asp-Gly, или R13, имеющий аминокислотную последовательность Leu-Ser-Gly-Cys-Arg-Gly-Asp-Cys-Phe-Glu-Glu, или R15, имеющий аминокислотную последовательность Asp-Gly-Phe-Pro-Gly-Cys-Arg-Gly-Asp-Cys-Ser-Gln-Glu.

Группа изобретений относится к области биотехнологии и направлена на молекулы нуклеиновых кислот, которые кодируют белок, проявляющий свойства биосенсора для детекции пероксида водорода в живых клетках, обладающий флуоресценцией в красной области спектра.

Изобретение относится к молекулярной биологии, в частности к коротким интерферирующим РНК (siRNA), и может быть использовано в противоопухолевой терапии. На основе геномного анализа сконструированы последовательности siRNA против гена HIF1A человека с SEQ ID NO:1-2, siRNA против гена HSP8A человека с SEQ ID NO:3-4, siRNA против гена APEX1 человека с SEQ ID NO:5-6 и siRNA против гена CCND3 человека с SEQ ID NO:7-8, ассоциированных с пролиферацией клеток аденокарциномы поджелудочной железы человека.

Изобретение относится к биохимии. Изобретение обеспечивает способ одновременной (мультиплексной) амплификации и флуоресцентного маркирования ДНК нескольких сегментов генома микобактерий туберкулезного комплекса (Mycobacterium tuberculosis, M. bovis, M. bovis BCG, M. africanum и M. microti). Далее проводится гибридизационный или электрофоретический анализ последовательностей данных сегментов. Мультиплексная ПЦР осуществляется в едином реакционном объеме с использованием специфичных и адаптерных праймеров, флуоресцентного субстрата, встраиваемого в растущую цепь ДНК в ходе ПЦР и геномной ДНК в качестве матрицы. Мультиплексная ПЦР включает два последовательных профиля амплификации, различающихся температурами отжига специфичных и адаптерных праймеров не менее чем на 10°С. Изобретение позволяет проводить анализ последовательностей данных генов на выявления мутаций, ассоциированных с устойчивостью к противотуберкулезным препаратам. Способ по изобретению сокращает число стадий амплификаций для получения одноцепочечных флуресцентно-меченных ПЦР-продуктов, исключает перенос ДНК-матрицы из одного реакционного объема в другой, что повышает устойчивость процедуры к контаминации ПЦР-продуктами и существенно снижает время и трудоемкость анализа. 4 ил., 1 табл., 1 пр.

Изобретение относится к области биотехнологии и может быть использовано для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы ММР9-1562 C>Т (rs3918242). Способ основан на снятии кривых плавления с флуоресцентно-мечеными аллель-специфичными олигонуклеотидными пробами. В способе используют общую для всех аллелей пару праймеров, отличающиеся для каждого аллеля флуоресцентно-меченые аллель-специфичные олигонуклеотидные пробы и универсальный олигонуклеотид, меченый гасителем флуоресценции следующего нуклеотидного состава: MMP9-1562s CGAAACCAGCCTGGTCAACG; ММР9-1562а TCTGCCTCCCGGGTTCAAGC; ММР9-1562р1 GGCGCACGCCTATAA-FAM; ММР9-1562р2 GGCGCATGCCTATAA-HEX; ММР9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), где FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный краситель HEX, BHQ1 - означает присоединенный к 5'-концевому нуклеотиду темновой гаситель флуоресценции. Отнесение образца к гомозиготе или гетерозиготе по данному аллелю оценивается по форме кривых плавления ДНК - по максимуму первой производной графиков флуоресценции. Изобретение позволяет повысить надежность и доступность генотипирования. 1 ил.

Изобретение относится к области биотехнологии и медицины и касается РНК-аптамера. Предложенный РНК-аптамер представляет собой 57-звенный олигонуклеотид смешанного типа, имеющий нуклеотидную последовательность GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, где A,G - рибонуклеотиды, U, С - 2'-дезокси-2'-фторрибонуклеотиды, обладает способностью узнавать характерные для рассеянного склероза аутоантитела. Охарактеризованное изобретение специфично и высокоафинно связывается с аутоантителами, характерными для рассеянного склероза и может быть использовано для диагностики рассеянного склероза. 3 ил., 2 пр.

Изобретение относится к биотехнологии и предоставляет собой способ получения полезных метаболитов с использованием бактерии семейства Enterobacteriaceae, в частности бактерии, принадлежащей к роду Escherichia, которая модифицирована таким образом, что она содержит генетическую экспрессионную систему, включающую транскрипционный аппарат, регулируемый белком типа LysR, и модифицированную таким образом, что самоиндуцируемая положительная регуляция по типу обратной связи указанной системы опосредована коиндуктором. Данный способ пригоден для продукции L-аминокислот с разветвленной цепью, в частности L-валина, L-изолейцина и L-лейцина, высших спиртов и D-пантотеновой кислоты. Изобретение позволяет получать L-аминокислоты с высокой степенью эффективности. 3 н. и 20 з.п. ф-лы, 2 ил., 5 табл., 6 пр.

Изобретение относится к олигопептидам, содержащим последовательность NLSSAEVVV (SEQ ID NO:6), в которой одна или две аминокислоты могут быть замещены, имеющим индуцибельность цитотоксических Т-клеток, их фармацевтическим композициям и применению для изготовления противораковых вакцин. 10 н. и 10 з.п. ф-лы, 6 ил., 1 табл., 1 пр.

Изобретение относится к области биохимии, в частности к способу выявления устойчивых к пиразииамиду изолятов Mycobacterium tuberculosis, путем определения наличия мутаций в гене pncA, ассоциированных с формированием устойчивости к пиразинамиду, посредством проведения ПЦР в режиме «реального времени» с использованием HRM-анализа. При этом проводят амплификацию на смеси равного количества тестируемой ДНК и ДНК дикого типа с использованием праймеров: Pnc18U: 5'-TACGCTCCGGTGTAGGCAC-3' и Pnc15R: 5'-GAAGCGGCGGACTACCATC-3', формируют гетеродуплексы за счет одновременной коамплификации ДНК дикого типа и тестируемой ДНК, при этом на первом этапе ПЦР проводят уравнивание концентрации с помощью количественной ПЦР с использованием той же пары праймеров (Pnc18U/Pnc15R) с построением калибровочной кривой и использованием регрессионного уравнения. Изобретение благодаря высокой специфичности и чувствительности позволяет надежно и быстро определить тип мутаций в гене pncA, ассоциированных с возникновением устойчивости к пиразинамиду.1 ил.

Изобретение относится к области биохимии. Предложена конкатемерная молекула некодирующей нуклеиновой кислоты, содержащая по меньшей мере четыре одноцепочечных участка с неметилированными CG-мотивами, для модуляции активности иммунной системы человека и животного. Рассмотрены содержащие конкатемерную молекулу фармацевтические композиции и набор, а также применение для изготовления средства для модуляции иммунной системы или для модуляции активности иммунной системы человека или животного молекулы и композиции по изобретению. Данное изобретение может найти дальнейшее применение в качестве иммуномодулятора в терапии различных заболеваний. 5 н. и 15 з.п. ф-лы, 4 ил.

Изобретение относится к области молекулярной биологии и может быть использовано в диагностике кардиомиопатий различной природы. Предложен набор синтетических олигонуклеотидов для выявления мутаций кодирующей части гена десмина (DES), ассоциированных с кардиомиопатиями. Мутации выявляют путем определения полной нуклеотидной последовательности кодирующей части гена DES. Осуществляют амплификацию кодирующей части гена DES с помощью 7 пар синтетических олигонуклеотидов при одной температуре и времени отжига, с последующим секвенированием полученных продуктов амплификации с помощью одной пары универсальных праймеров. Предложенное изобретение позволяет чувствительно и специфично определять мутации гена DES, при этом сокращаются время реакции амплификации, количество манипуляций, время внесения реактивов для реакции секвенирования и снижается вероятность ошибки при постановке реакции. 2 з.п. ф-лы, 1 ил.

Изобретение относится к области биохимии, в частности к кодон-оптимизированным последовательностям ДНК. Заявлены кодон-оптимизированные кДНК, кодирующие фактор стромальных клеток 1 альфа и сосудистый эндотелиальный фактор роста изоформы 165, а также содержащая их рекомбинантная плазмида. Рекомбинантную плазмиду можно использовать в составе фармацевтической композиции для восстановления кровеносных сосудов и улучшения кровоснабжения в поврежденных тканях или органах. Изобретение позволяет повысить эффективность использования генных препаратов. 4 н.п. ф-лы, 5 ил.

Изобретение относится к области биохимии, в частности к способам получения растения с повышенной устойчивостью к засухе и действию солей по сравнению с диким видом растения путем снижения экспрессии/функции белка-фактора транскрипции у растения. Также изобретение относится к растению с повышенной устойчивостью к засухе и действию солей, полученное вышеуказанным способом. Изобретение позволяет эффективно получать растения с повышенной устойчивостью к засухе и действию солей по сравнению с диким видом растения. 4 н. и 2 з.п. ф-лы, 6 ил., 1 табл., 6 пр.
Наверх