Способ снижения токсического действия энрофлоксацина на клеточный иммунитет с применением гомеопатических препаратов in vitro

Изобретение относится к ветеринарии и может быть использовано для снижения токсического эффекта энрофлоксацина на опсонофагоцитарную активность нейтрофилов с применением гомеопатических препаратов in vitro. Для этого к лейкоцитарной взвеси в объеме 0,5 мл добавляют 0,15 мл антибактериального препарата энрофлоксацин 5%. Затем полученный раствор помещают в термостат на 3 часа при Т=37±0,5°C, после инкубации вносят по 0,5 мл гомеопатического препарата, разведенного в физиологическом растворе в выбранном разведении С6, С12, С30, С200. После этого пробирки вновь помещают в термостат на 4 часа при Т=37±0,5°C и затем вносят взвесь микроорганизмов референтного штамма Staphylococcus albus №182 по 0,5 мл, содержащего 109 КОЕ в 1 мл физиологического раствора. Далее помещают в термостат на 30 минут при Т=37±0,5°C, после инкубации мазки крови фиксируют в спирт-формалине 1:9, 40% раствор формалина и 96° спирта, в течение 10 минут и окрашивают по Романовскому - Гимзе в течение 30 минут. Использование данного способа позволяет in vitro оценить влияние гомеопатических препаратов на снижение токсического эффекта энрофлоксацина на опсонофагоцитарную активность нейтрофилов. 4 табл.


Изобретение относится к ветеринарии и может быть использовано в лабораторной работе по изучению способа снижения токсического действия энрофлоксацина на клеточный иммунитет с применением гомеопатических препаратов in vitro.

Известно, что антибактериальный препарат энрофлоксацин снижает уровень IgG, тем самым оказывает угнетающее действие на иммунную систему (S. Tokarzewski Influence of enrofloxacin and chloramphenicol on the level of IgG in serum and egg yolk after immunostimulation of hens with salmonella enteritidis antigens/ Pol. J. Vet. Sci. 2002. -V. 5(3). - P. 151-158).

Известен «Модулятор клеточного иммунитета» (патент РФ №2146528, кл. А61К 35/78 от 20.03.2000), включающий приготовление растительного экстракта из свежих листьев Geranium robertanium, сухих листьев Plantago lanceolata и сухих листьев Calendula officinales. Листья настаивают в течение 8 дней при комнатной температуре, при одно- или многократных ежедневных помешиваниях.

Недостатком известного способа является длительность срока приготовления препарата (до 15 дней), необходимость наличия лабораторных животных и ограниченный срок хранения препарата, а также отсутствие данных по влиянию на различные показатели фагоцитарной активности нейтрофилов.

Ближайшим техническим решением к данному изобретению является способ оценки клеточного иммунитета в опсонофагоцитарной реакции (ОФР) нейтрофилов крупного рогатого скота, которую проводили по методике (Оценка естественной резистентности сельскохозяйственных животных: Метод. Рекомендации / Россельхозакадемия, Сиб. Отделение, ГНУ ИЭВС и ДВ, ГНУ ВИЕВ, ФГОУ НРИПК АПК МСХ РФ, НГАУ. - Новосибирск, 2003. - 32 с.). Оценку снижения иммуносупрессивного влияние препарата глюкортин клеточного иммунитета учитывали по изменению фагоцитарной активности (ФА) нейтрофилов, фагоцитарного числа (ФЧ) нейтрофилов, фагоцитарного индекса (ФИ) нейтрофилов, фагоцитарной емкости (ФЕ) нейтрофилов и переваривающей способности крови (ПСК).

Задача изобретения - расширение арсенала способов снижения токсического действия энрофлоксацина на клеточный иммунитет с использованием гомеопатических препаратов in vitro.

Указанная задача достигается тем, что в способе снижения токсического действия энрофлоксацина на опсонофагоцитарную активность нейтрофилов с применением гомеопатических препаратов in vitro, включающем использование лейкоцитарной взвеси, антибактериального и гомеопатического препаратов разведенных в физиологическом растворе в выбранном разведении, согласно изобретению к лейкоцитарной взвеси в объеме 0,5 мл добавляют 0,15 мл антибактериального препарата энрофлоксацин 5,0%, затем полученный раствор помещают в термостат на 3 часа при Т=37±0,5°C, после инкубации вносят по 0,5 мл гомеопатического препарата, разведенного в физиологическом растворе в выбранном разведении С6, С12, С30, С200, и вновь помещают в термостат на 4 часа при Т=37±0,5°C, затем вносят взвесь микроорганизмов референтного штамма Staphylococcus albus №182 по 0,5 мл, содержащую 109 КОЕ в 1 мл физиологического раствора, далее помещают в термостат на 30 минут при Т=37±0,5°C, после инкубации мазки крови фиксируют в спирт-формалине 1:9, 40% раствор формалина и 96° спирта, в течение 10 минут и окрашивают по Романовскому - Гимзе в течение 30 минут.

Для определения достоверности полученные результаты сопоставляли с результатами исследований в контрольных группах. В контрольной группе использовали энрофлоксацин 5,0% и 0,85% водный раствор NaCl. Оценку роста показателя активности клеточного иммунитета проводили по отношению к показателям контрольной группы.

Пример 1.

Снижение токсического действия энрофлоксацина на фагоцитарную активность нейтрофилов при применении гомеопатических лекарственных средств выявило наличие роста показателя ФА нейтрофилов при изучении всех исследуемых препаратов относительно показателей контрольной группы, где наблюдали снижение опсонофагоцитарной активности вследствие токсичных явлений, обусловленных энрофлоксацином (табл. 1).

Наиболее выраженную активацию клеточного иммунитета наблюдали при воздействия на нейтрофилы монопрепаратами растительного происхождения в разведениях Нукс Вомика С6, С30, С200, сопровождающийся максимальным ростом показателя ФА от 276,9 до 300,0%, ФЁот 257,1 до 278,6%, ФЧ от 306,6 до 350,0%, ПСК от 253,3 до 280,0% (табл. 2).

При использовании препаратов в различных разведениях отмечали рост показателей ФА нейтрофилов после контакта с препаратами, он составил от 223,0 до 300,0%.

Выраженный рост ФИ, ФЧ после контакта с монопрепаратами был отмечен у Ипекакуана С30 (287,1 и 330,3%), Ипекакуана С200 (300,0 и 343,3%), Нукс Вомика С6 (264,5 и 306,6%), Нукс Вомика С30 (267,7 и 343,3%), Нукс Вомика С200 (274,2 и 350,0%) соответственно.

Снижение токсического действия энрофлоксацина на клеточный иммунитет с применением гомеопатических препаратов растительного происхождения выявило наличие роста показателя ПСК у 100% исследуемых препаратов, представленных в трех и более разведениях, при этом тенденция к росту находится в прямой зависимости от степени их разведения. Так, рост показателя ПСК наблюдали при контакте с Ипекакуаной С30 (413,3%), Аконитом С200 (431,3%), Ипекакуаной С200 (445,5%), относительно контрольных групп.

Снижение токсического действия энрофлоксацина на клеточный иммунитет с применением гомеопатических лекарственных препаратов животного происхождения выявило наличие роста всех исследуемых показателей фагоцитарной активности нейтрофилов. Так, рост показателя ПСК наблюдали при контакте с Лахезис С6 на 438,1%, Лахезис С30 на 523,5%, Лахезис С200 на 554,1%, Апис С6 на 374,1%, Апис С30 на 387,7%, Апис С200 на 404,7% (табл. 3).

Снижение токсического действия энрофлоксацина на клеточный иммунитет с применением гомеопатических лекарственных средств минерального происхождения, выявило рост показателя ПСК при использований 27 (100%), а ФЧ при культивировании с 14 (51,8%) испытуемый препаратами, при этом тенденция к росту сохраняется в зависимости от степени разведения (табл. 4).

Снижение токсического действия энрофлоксацина на клеточный иммунитет с применением гомеопатических препаратов минерального происхождения выявило наибольший эффект при одновременном использовании 2-3 разведений. Так, рост показателей опсонофагоцитарной реакции нейтрофилов при использовании Кали бихромикум составил ФЁ - 342,8%, ФА - 369,4%, ФЧ - 583,3%, ФИ - 629,0%, ПСК - 837,4%.

Промышленная применимость иллюстрируется следующим примером. Группе телят возрастом от 1 до 3 мес. при бронхопневмонии назначали лечение энрофлоксацином 5,0% внутримышечно, 1 мл / 10 кг живой массы, 1 раз в день в течение 5-7 дней. После окончания курса лечения брали кровь с цитратом натрия и выделяли нейтрофилы.

К образцам проб телят опытной группы добавляли водный раствор гомеопатических препаратов, к пробам контрольной группы добавляли 0,85% раствор хлорида натрия по вышеописанной методике. Результаты исследования показали, что водный раствор гомеопатических лекарственных средств вызывал увеличение показателей опсонофагоцитарной активности относительно контрольной группы ФА на 45-86%, ФЁ на 54-112%, ФИ на 65-90%, ФЧ на 40-122%, ПСК на 76 - 115%.

Способ снижения токсического действия энрофлоксацина на опсонофагоцитарную активность нейтрофилов с применением гомеопатических препаратов in vitro, отличается тем, что включает использование лейкоцитарной взвеси, антибактериального и гомеопатического препаратов, разведенных в физиологическом растворе в выбранном разведении, согласно изобретению к лейкоцитарной взвеси в объеме 0,5 мл добавляют 0,15 мл антибактериального препарата энрофлоксацин 5%, затем полученный раствор помещают в термостат на 3 часа при Т=37±0,5°C, после инкубации вносят по 0,5 мл гомеопатического препарата, разведенного в физиологическом растворе в выбранном разведении С6, С12, С30, С200, после этого пробирки вновь помещают в термостат на 4 часа при Т=37±0,5°C, затем вносят взвесь микроорганизмов референтного штамма Staphylococcus albus №182 по 0,5 мл, содержащего 109 КОЕ в 1 мл физиологического раствора, далее помещают в термостат на 30 минут при Т=37±0,5°C, после инкубации мазки крови фиксируют в спирт-формалине 1:9, 40% раствор формалина и 96° спирта, в течение 10 минут и окрашивают по Романовскому - Гимзе в течение 30 минут.


Похожие патенты:

Группа изобретений относится к области экспериментальной биологии и медицины для приготовления тотальных препаратов биологических тканей для оптической проекционной томографии, конфокальной, мультифотонной и светоплоскостной микроскопии и может быть использована для предклинических испытаний фармакологических препаратов и оценки физиологических воздействий на организм, а также для работы с материалом биопсий в диагностических и исследовательских целях.

Изобретение относится к области медицины и касается способов прогнозирования достижения ПМР у больных ТНР молочной железы. Проводят иммунногистохимическое исследование ткани опухоли.

Изобретение относится к медицине, биологии, фармации и пищевой технологии применительно к исследованию гомолитических свойств липидов и их участия в свободнорадикальных реакциях окисления, а также - к осуществлению подбора антиоксидантов.

Изобретение относится к области медицины, а именно к акушерству и гинекологии, и может быть использовано для прогнозирования ранней гипогалактии - перед родами у беременных женщин при анализе анамнеза, течения настоящей беременности выявляют факторы риска гипогалактии.
Изобретение относится к медицине, а именно к способу прогнозирования синдрома задержки внутриутробного развития плода в третьем триместре гестации при реактивации хронической цитомегаловирусной инфекции (ЦМВ) у женщин с угрозой невынашивания во втором триместре беременности.

Изобретение относится к медицине, а именно к психиатрии, и может быть использовано при ранней диагностике шизофрении. Способ включает генетический анализ Vall58Met полиморфизма гена катехол-О-метил-трансферазы, при этом у носителей гаплотипа Met/Met проводят избирательную оценку предстимульного торможения и базового латентного периода акустической стартл-реакции.

Изобретение относится к области судебно-медицинской экспертизы, а именно к тестовым наборам, и позволяет произвести тестирование спермы в пятнах на исследуемом образце.

Изобретение относится к медицине и может быть использовано для диагностики опухолей головного мозга (ОГМ). Для этого путем электронной феноменологической спектроскопии измеряют оптическую плотность плазмы крови человека в видимой и ультрафиолетовой области спектра.
Изобретение относится к медицине, а именно к способу прогнозирования рецептивности эндометрия в циклах экстракорпорального оплодотворения (ЭКО). Сущность способа состоит в том, что определяют оптическую плотность экспрессии лейкемия ингибирующего фактора (LIF) в поверхностном и железистом эпителии эндометрия в период окна имплантации в цикле, предшествующем проведению экстракорпорального оплодотворения, и дополнительно определяют содержание сосудистого эндотелиального фактора роста (VEGF) в цервикальной слизи в день трансвагинальной пункции фолликулов, систолодиастолическое отношение (S/D) и индекс резистентности (IR) спиральных артерий в день введения триггера овуляции, а затем рассчитывают значение регрессионной функции (Z) по формуле.
Изобретение относится к медицине, а именно к микологии и дерматовенерологии, и может быть использовано для диагностики микроспории. Способ включает выделение тотальной нативной ДНК из кожи и волос, специфическую амплификацию фрагмента гена 5.8S рРНК Trichophyton verrucosum с использованием праймеров следующей структуры: 5′ CCACGATAGGGATCAGCGTT 3′, 5′ GAAAGTTTTAACTGATTTTGCTTG 3′.

Изобретение относится к области медицины, а именно к педиатрии, и описывает способ диагностики муковисцидоза. Способ характеризуется тем, что определяют концентрации Na, В и Pb в пробоподготовленных волосах детей раннего возраста методами атомной эмиссионной спектрометрии с индукционно связанной аргоновой плазмой и/или масс-спектрометрии с индуктивно связанной аргоновой плазмой, при этом у больных муковисцидозом относительно контрольной группы увеличивается содержание Na и В соответственно в 8,5; 3,3 раза и уменьшается содержание Pb в 1,3 раза. Предложенный способ является простым в исполнении, достоверным. Изобретение может использоваться при диагностике муковисцидоза у детей с первых дней жизни. 1 табл.

Изобретение относится к медицине, а именно к офтальмологии, и может быть использовано для ранней диагностики первичной открытоугольной глаукомы. Для этого проводят измерение и оценку внутриглазного давления, исследование полей зрения и слезной жидкости с последующим определением уровня провоспалительных и противоспалительных цитокинов с дополнительным определением их уровня в сыворотке крови. При повышении соотношения в сыворотке крови ИФ-γ/ИЛ-4, ИЛ-1β/ИЛ-10, ФНО-α/ИЛ-10 у пациентов с подозрением на глаукому уровня коэффициентов цитокинов, равных значению 3,66±1,77, 1,9±0,47, 1,20±0,32 соответственно, у пациентов с начальной стадией первичной открытоугольной глаукомы соотношения ИФ-γ/ИЛ-4, ИФ-γ/ИЛ-10, ИЛ-1β/ИЛ-10, ФНО-α/ИЛ-10 уровня коэффициентов цитокинов, равных значению 1,85±0,44, 1,48±0,34, 2,85±0,74, 2,42±0,71 соответственно, а также при повышении соотношения в слезной жидкости ИФ-γ/ИЛ-4, ИФ-γ/ИЛ-10, ИЛ-1β/ИЛ-10, ФНО-α/ИЛ-10 у пациентов с подозрением на глаукому уровня коэффициентов цитокинов, равных значению 1,11±0,19, 1,06±0,09, 3,81±0,63, 4,04±0,36 соответственно, а у пациентов с начальной стадией первичной открытоугольной глаукомы повышением соотношения ИФ-γ/ИЛ-4, ИФ-γ/ИЛ-10, ИЛ-1β/ИЛ-10 уровня коэффициентов цитокинов, равных значению 1,26±0,22, 0,84±0,08, 3,98±0,61 соответственно, диагностируют первичную открытоугольную глаукому. Способ позволяет упростить раннюю диагностику заболевания при его высокой точности и информативности. 4 ил.
Изобретение относится к медицине, а именно к способу определения адаптационной способности пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Для этого методом иммуноферментного анализа определяют количественный уровень биомаркеров в ротовой жидкости пациента до или не ранее чем через 30 мин после приема пищи. В качестве биомаркера выбирают матриксную металлопротеиназу 2 (ММП 2) или матриксную металлопротеиназу 8 (ММП 8). Для группы клинического сравнения ММП 2 принимают уровень 1,89-2,69 нг/мл; при уровне 4,2-6,6 нг/мл диагностируют низкую адаптационную способность, а при 2,9-3,8 нг/мл - полную функциональную адаптацию пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Для группы клинического сравнения ММП 8 принимают уровень 21,65-41,85 нг/мл; при уровне 433,0-1011,6 нг/мл диагностируют низкую адаптационную способность, а при 52,8-186,3 нг/мл - полную функциональную адаптацию пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Изобретение позволяет повысить точность экспресс-диагностики адаптационной способности к съемным пластиночным конструкциям ортопедических протезов пациента с новообразованиями челюстно-лицевой области в день обращения пациента. 2 з.п. ф-лы, 6 пр.
Изобретение относится к медицине, а именно к оториноларингологии, и может быть использовано для лечения больных риносинуситом с болевым симптомом. Для этого в сыворотке крови больного до начала лечения определяют уровень субстанции Р. При значении уровня субстанции Р 2000 пг/мл и более в схему общепринятой терапии с первого дня лечения в течение 5 дней включают препараты Преднизолон и Мильгамму. Преднизолон в дозе 30 мг 1 раз в день вводят перорально. Мильгамму вводят внутримышечно в дозе 2 мл 1 раз в день. Способ позволяет повысить эффективность лечения больных риносинуситом за счет расширения функциональных возможностей общепринятой стандартной терапии при сокращении сроков купирования болевого симптома. 2 пр.

Группа изобретений относится к медицине, онкологии и касается формирования плана индивидуальной терапии пациента. Способ включает формирование исходного плана терапии с помощью вероятностной модели осложнения здоровой ткани (NTCP) и вероятностной модели подавления опухоли (TCP) целевой области. Модели NTCP и TCP адаптируют на основании начальных количественных значений набора биомаркеров пациента. После применения исходной терапии формируют исправленный план терапии с помощью моделей NTCP и TCP, адаптированных на основании обновленных после применения терапии количественных значений набора биомаркеров. Начальные и обновленные модели NTCP выражены в виде функции эквивалентной однородной дозы (EUD), модифицированной с использованием скалярной величины. Значения наборов биомаркеров представляют собой определяемые путем исследования значения параметров из группы: уровни Hb, CRP, PSA, TNF-α, ферритина, трансферрина, LDH, IL-6, гепсидина, креатинина, глюкозы, HbA1c, комплексов, связывающихся с концевыми участками ДНК (DNA-EBC), HIF-lα, галектина-1, САР43 и/или NDRG1; длина теломера; тип опухоли; степень опухоли; стадия опухоли; расположение первичной опухоли; степень злокачественности по шкале Глисона; данные анализа уровня коллагена; предшествующее лечение в виде абдоминальной хирургии, гормональной лекарственной терапии, антикоагуляционной лекарственной терапии; наличие диабета; возраст пациента. Используют машиночитаемый носитель информации, содержащий программу, которая управляет процессором для выполнения данного способа, и процессор, сконфигурированный для выполнения стадий способа. Изобретения обеспечивают индивидуальное адаптивное планирование терапии онкологического пациента с оптимизацией вероятности повреждения здоровых тканей и обезвреживания опухоли в соответствии с индивидуальными маркерами для каждого пациента. 3 н. и 5 з.п. ф-лы, 6 ил.
Изобретение относится к медицине, а именно к способу определения адаптационной способности пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Для этого методом иммуноферментного анализа определяют количественный уровень биомаркеров в ротовой жидкости пациента до или не ранее чем через 30 мин после приема пищи. В качестве биомаркера выбирают матриксную металлопротеиназу 8 (ММП 8) или матриксную металлопротеиназу 9 (ММП 9). Для группы клинического сравнения ММП 8 принимают уровень 21,65-41,85 нг/мл; при уровне 171,25-524,7 нг/мл диагностируют низкую адаптационную способность, а при 58,7-162,7 нг/мл - полную функциональную адаптацию пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Для группы клинического сравнения ММП 9 принимают уровень 134,9-207,7 нг/мл; при уровне 526,5-919,1 нг/мл диагностируют низкую адаптационную способность, а при 236,8-492,3 нг/мл - полную функциональную адаптацию пациента с новообразованиями челюстно-лицевой области к съемным пластиночным конструкциям ортопедических протезов. Изобретение позволяет повысить точность экспресс-диагностики адаптационной способности к съемным пластиночным конструкциям ортопедических протезов пациента с новообразованиями челюстно-лицевой области в день обращения пациента. 1 н. и 2 з.п. ф-лы, 6 пр.
Изобретение относится к области ветеринарии и предназначено для оценки повышенной чувствительности крупного рогатого скота к лейкозной инфекции. Способ включает выделение нейтрофильных гранулоцитов из венозной крови крупного рогатого скота путем центрифугирования в градиенте плотности фиколл-урографина (плотностью 1,077 г/см3), внесение по 100 мкл клеточной взвеси в две параллельные лунки 96 луночного плоскодонного планшета для иммуноферментного анализа. В одну лунку планшета добавляют 50 мкл забуференного физиологического раствора или физиологического раствора (спонтанный НСТ-тест), а в другую - 50 мкл стимулятора (БЦЖ) в оптимальном разведении в забуференном физиологическом растворе или физиологическом растворе (индуцированный НСТ-тест), затем в обе лунки планшета добавляют по 50 мкл 0,15% раствора нитросинего тетразолия, перемешивают, инкубируют 20 минут при температуре 37°С, центрифугируют при 500 g 10 минут. Затем отделяют надосадок, добавляют 200 мкл абсолютного этилового спирта. Раствор центрифугируют 5 минут при 500 g, отделяют надосадочную жидкость. В клеточный осадок добавляют 200 мкл физиологического раствора. Центрифугируют 5 минут при 500 g. Добавляют в каждую лунку 130 мкл димексида и инкубируют при 60°С 20 минут, добавляют по 70 мкл 2 М раствора КОН, тщательно перемешивают. Результаты реакции фиксируют с помощью иммунохимического анализатора и выражают в условных единицах оптической плотности. После учета реакции определяют коэффициент стимуляции, при этом при определении уровня индуцированной активности в лунку дополнительно вносят 50 мкл левамизола в конечной концентрации 0,5 мкг/мл. Результаты реакции определяют по разнице экстинкций при длине волны 630 и 490 нм. Коэффициент стимуляции (КС) определяется отношением индуцированного уровня клеточной активности к спонтанному уровню. При КС ≤0,95 животное считают с повышенной чувствительностью к лейкозной инфекции крупного рогатого скота. Заявленный способ позволяет быстро и достоверно проводить оценку чувствительности к инфекции ВЛКРС и дает возможность диагностировать развитие инфекционно-воспалительных процессов у больных лейкозом животных. 4 табл., 3 пр.

Изобретение относится к медицине и биологии и может быть использовано для изготовления гистологических образцов биологических тканей с элементами имплантированных металлических и/или полимерных конструкций для изучения с помощью световой микроскопии. Способ заключается в том, что биологический образец последовательно обрабатывают раствором фиксаторов, отмывают, обезвоживают, пропитывают раствором прозрачной смолы для холодной заливки в течение 6-24 часов, погружают в чистую смолу на 12-24 часа и окрашивают красителями на глубину 1-2 мкм. При этом микроскопию последующих слоев выполняют после шлифовки, полировки и повторного окрашивания поверхности образца. Изобретение позволяет проводить послойное исследование образцов без повреждения клеточных компонентов и изменения архитектуры ткани в зоне контакта с инородным телом. 1 ил., 1 пр.

Изобретение относится к медицине и описывает способы для определения концентрации аналита в пробе, приборы и системы, используемые в связи с ними. В одном из вариантов осуществления изобретения способ включает обнаружение содержащей аналит пробы, введенной в электрохимический сенсор, содержащий два электрода в разнесенной конфигурации; реагирование аналита с вызыванием физического превращения аналита между двумя электродами; измерение выходов тока на дискретных интервалах для выведения времени заполнения сенсора пробой и емкости сенсора с пробой; определение первого значения концентрации аналита по выходам тока; расчет второго значения концентрации аналита по выходам тока и первому значению концентрации аналита; корректировку второго значения концентрации аналита на влияния температуры для обеспечения третьего значения концентрации аналита; корректировку третьего значения концентрации аналита как функции времени заполнения сенсора для обеспечения четвертого значения концентрации аналита; и корректировку четвертого значения концентрации аналита как функции емкости для обеспечения конечного значения концентрации аналита. Изобретение обеспечивает более точное определение концентрации аналита в пробе. 7 н. и 66 з.п. ф-лы, 21 ил., 6 пр., 4 табл.

Изобретение относится к области медицины, а именно к способу диагностики функциональной задержки полового развития у мальчиков-подростков. Сущность способа состоит в том, что предварительно у ребенка определяют росто-весовой индекс (РВИ), если его значение менее 340 отн.ед., дополнительно атомно-абсорбционным методом определяют в суточной моче концентрации цинка, селена, свинца и вычисляют соотношения концентраций пар свинец/цинк, свинец/селен. Если индекс соотношения превышает не менее чем в 2 раза установленные нормативы, то диагностируют у данного мальчика-подростка задержку полового развития полимикроэлементозного генеза. У мальчиков с росто-весовым индексом более 400 отн.ед. определяют концентрацию хрома в моче и если его уровень не менее чем в 2 раза ниже установленного норматива, диагностируют задержку полового развития мономикроэлементозной этиологии. Использование заявленного способа позволяет повысить точность и достоверность диагностики функциональной задержки полового развития у мальчиков-подростков с ранним его выявлением. 2 табл., 2 пр.

Изобретение относится к ветеринарии и может быть использовано для снижения токсического эффекта энрофлоксацина на опсонофагоцитарную активность нейтрофилов с применением гомеопатических препаратов in vitro. Для этого к лейкоцитарной взвеси в объеме 0,5 мл добавляют 0,15 мл антибактериального препарата энрофлоксацин 5. Затем полученный раствор помещают в термостат на 3 часа при Т37±0,5°C, после инкубации вносят по 0,5 мл гомеопатического препарата, разведенного в физиологическом растворе в выбранном разведении С6, С12, С30, С200. После этого пробирки вновь помещают в термостат на 4 часа при Т37±0,5°C и затем вносят взвесь микроорганизмов референтного штамма Staphylococcus albus №182 по 0,5 мл, содержащего 109 КОЕ в 1 мл физиологического раствора. Далее помещают в термостат на 30 минут при Т37±0,5°C, после инкубации мазки крови фиксируют в спирт-формалине 1:9, 40 раствор формалина и 96° спирта, в течение 10 минут и окрашивают по Романовскому - Гимзе в течение 30 минут. Использование данного способа позволяет in vitro оценить влияние гомеопатических препаратов на снижение токсического эффекта энрофлоксацина на опсонофагоцитарную активность нейтрофилов. 4 табл.
