Производные пиразолиндиона как ингибиторы надфн-оксидазы



Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы
Производные пиразолиндиона как ингибиторы надфн-оксидазы

 


Владельцы патента RU 2569855:

ЖЕНКИОТЕКС СА (CH)

Изобретение относится к пиразолиндионовому производному формулы (I), а также к его фармацевтически приемлемой соли, где R1 выбран из водорода; возможно замещенного C1-C6алкила; возможно замещенного фенила; возможно замещенного C1-C6алкилфенила; возможно замещенного фенилC1-C6алкила; возможно замещенного пиридила; возможно замещенного C1-C6алкилпиридила; и возможно замещенного пиридилC1-C6алкила; R2 является водородом; R3 является водородом; R4, R5, R6 и R7 являются водородом; R8, R9, R10 и R11 независимо выбраны из атомов водорода и C16алкилов; R12 выбран из водорода; -CHR17R18; возможно замещенного C1-C6алкокси-карбонила, возможно замещенного -C(O)-фенила; возможно замещенного C1-C6алкилфенила; возможно замещенного фенилC1-C6алкила, возможно замещенного C1-C6алкилгетероарила или возможно замещенного гетероарилC1-C6алкила, где гетероарил выбран из пиридила, пирролила, пиримидинила, фурила, имидазолила, оксазолила, изоксазолила, пиразолила, 1,2,3-триазолила, 1,2,4-триазолила, 1,2,3-оксадиазолила, 1,2,4-оксадиазолила, 1,2,5-оксадиазолила, 1,3,4-оксадиазолила, 1,3,4-триазинила и 1,2,3-триазинила; R17 и R18 независимо выбраны из водорода; возможно замещенного фенила; возможно замещенного гетероарила, где гетероарил выбран из пиридила, пирролила, пиримидинила, фурила, имидазолила, оксазолила, изоксазолила, пиразолила, 1,2,3-триазолила, 1,2,4-триазолила, 1,2,3-оксадиазолила, 1,2,4-оксадиазолила, 1,2,5-оксадиазолила, 1,3,4-оксадиазолила, 1,3,4-триазинила и 1,2,3-триазинила; X выбран из О, NR12, S и S(O)2; n является целым числом, выбранным из 0 и 1; причем термин «замещенный» означает, что данная группа замещена 1-5 заместителями, выбранными из «C1-C6алкила», «C1-C6алкокси» и «галогенов». Также изобретение относится к фармацевтической композиции на основе соединения формулы (I), промежуточному соединению формулы (II), способу получения соединений формул (I) и (II). Технический результат: получены новые производные пиразолиндиона, полезные для ингибирования активности или функции никотинамидадениндинуклеотидфосфатоксидазы (НАДФН-оксидазы). 5 н. и 12 з.п. ф-лы, 2 табл., 23 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к пиразолиндионовым производным формулы (1), их фармацевтическим композициям и их использованию для получения лекарственных средств для лечения и/или профилактики сердечно-сосудистых заболеваний, респираторных расстройств, нарушений метаболизма, заболеваний кожи и/или костей, нейродистрофических заболеваний, заболеваний почек, заболеваний репродуктивной системы, воспалительных и раковых заболеваний. В частности, настоящее изобретение относится к пиразолиндионовым производным, из которых можно получить композиции для модуляции, а именно ингибирования, активности или функции никотинамидадениндинуклеотидфосфатоксидазы (НАДФН-оксидазы).

Уровень техники

НАДФН-оксидазы (NOX) - это белки, которые переносят электроны через биологические мембраны. Вообще, акцептором электронов является кислород, а продуктом реакции переноса электронов является супероксид. Таким образом, биологическая функция NOX-ферментов состоит в генерировании активных форм кислорода (АФК) из молекулярного кислорода. Активные формы кислорода (АФК) представляют собой небольшие молекулы-производные кислорода, включающие в себя кислородные радикалы (супероксидный анион [О2-], гидроксил [НО], пероксил [ROO], алкоксил [RO] и гидропероксил [HOO]) и некоторые нерадикальные частицы, которые являются окисляющими агентами и/или агентами, легко превращающимися в радикалы. Азотсодержащие окисляющие агенты, такие, как оксид азота (II), называются также реактивными формами азота (РФА). Обычно АФК образуются в ходе каскада реакций, которые начинаются с образования супероксида. Супероксид быстро дисмутирует (спонтанно, особенно при низком рН, или под действием фермента супероксиддисмутазы) в перекись водорода. Другие этапы каскадного образования АФК включают реакцию супероксида с оксидом азота (II) с образованием пероксинитрита, катализируемое пероксидазой образование гипохлорной кислоты из перекиси водорода, и катализируемую железом реакцию Фентона, в результате которой образуется гидроксильный радикал.

АФК легко взаимодействуют с большим количеством молекул, включающих другие небольшие неорганические молекулы, а также ДНК, белки, липиды, углеводы и нуклеиновые кислоты. В такой начальной реакции может образовываться второй радикал, увеличивая таким образом возможное повреждение. АФК вовлечены не только в процесс разрушения клетки и уничтожения патогенов, но и в значительное количество обратимых регуляторных процессов в, по существу, всех клетках и тканях. Однако несмотря на важную роль, которую АФК играют в регуляции фундаментальных физиологических процессов, их образование может вызвать необратимое нарушение или изменение функции молекул-мишеней. Следовательно, АФК все чаще идентифицируются как факторы, играющие значительную роль в повреждении биологических организмов, то есть в так называемом «окислительном стрессе».

В процессе воспаления НАДФН-оксидаза является одним из важных источников образования АФК в клетках сосудистой стенки, вовлеченной в воспалительный процесс (Thabut et al., 2002, J. Biol. Chem., 277: 22814-22821).

Легочная ткань постоянно подвергается действию окислителей, которые образуются либо эндогенно в метаболических реакциях (например, при митохондриальном дыхании или активации рекрутированных воспалительных клеток) либо экзогенно в воздухе (например, в табачном дыму или в веществах, загрязняющих воздух). Кроме того, легкие, постоянно подвергаются воздействию больших количеств кислорода, по сравнению с другими тканями, имеют большую площадь поверхности и богатое кровоснабжение и потому особенно подвержены повреждающему действию АФК (Brigham, 1986, Chest, 89(6): 859-863). НАДФН-оксидазозависимое образование АФК описано для легочных эндотелиальных клеток и гладкомышечных клеток. Полагают, что активация НАДФН-оксидазы в ответ на стимулы играет роль в развитии дыхательных расстройств, например легочной гипертензии, и усиливает легочную вазоконстрикцию (Djodjevic et al., 2005, Arterioscler. Thromb. Vasc. Biol., 25, 519-525; Liua et al., 2004, Am. J. Physiol. Lung, Cell. Mol. Physiol., 287: L111-118). Кроме того, было найдено, что воспаление и повышенное образование АФК характерно и для легочного фиброза.

Остеокласты, которые являются макрофагоподобными клетками и играют важную роль в обороте костной ткани (например, в резорбции кости), генерируют АФК с помощью механизмов, опосредуемых НАДФН-оксидазой (Yang et al., 2002, J. Cell. Chem. 84, 645-654).

Известно, что при сахарном диабете как у человека, так и у животных усиливается окислительный стресс (например, происходит повышенное образование АФК за счет аутоокисления глюкозы), а усиление окислительного стресса, как полагают, играет важную роль в развитии осложнений сахарного диабета. Было показано, что зоны повышенного содержания пероксидазы и дисфункции эндотелиальных клеток в области центрального пятна сетчатки крыс, пораженных сахарным диабетом, совпадает с участками НАДФН-оксидазной активности эндотелиальных клеток сетчатки (Ellis et al., 2000, FreeRad. Biol. Med., 28: 91-101). Было высказано предположение, что подавление окислительного стресса (АФК) в митохондриях и/или воспалительного процесса, возможно, является рациональным подходом в лечении сахарного диабета (Pillarisetti et al., 2004, ExpertOpin. Ther. targets, 8(5): 401-408).

АФК играют существенную роль также в патогенезе атеросклероза, пролиферации клеток, и в целом сердечно-сосудистых заболеваний, связанных с повреждающим действием гипертензии и реперфузии (Cai et al., 2003, TrendsPharmacol. Sci., 24: 471-478). Под действием факторов риска атеросклероза не только усиливается образование супероксида, например, в артериальной стенке, но, помимо этого, сами АФК индуцируют также многие проатерогенные клеточные ответы invitro. Важным последствием образования АФК в клетках сосудистой стенки является потребление оксида азота (II) (NO). NO препятствует развитию сосудистых заболеваний и недостаток NO играет важную роль в патогенезе сосудистой патологии. Имеются сообщения о повышении НАДФН-оксидазной активности в сосудистой стенке после ее повреждения баллоном катетера (Shi et al., 2001, Throw. Vasc. Biol., 2001, 21, 739-745).

Считают, что окислительный стресс или повреждение свободными радикалами является также существенной причиной развития нейродегенеративных заболеваний. Подобные повреждения могут включать в себя повреждение митохондрий, демиелинизация нейронов, апоптоз, гибель нейронов и снижение когнитивной функции, что может привести в итоге к прогрессирующим нейродегенеративным заболеваниям (Nunomura et al., 2001, J. Neuropathol. Exp. Neurol., 60: 759-767; Girouard, 2006, J. Appl. Physiol. 100: 328-335).

Кроме того, в сперме многих видов животных было выявлено образование АФК, что было предложено отнести к активности НАДФН-оксидазы сперматозоидов (Vernet et al., Blol. Reprod., 2001, 65: 1102-1113). Полагают, что чрезмерное образование АФК играет роль в патологии сперматозоидов, лежащей в основе мужского бесплодия, а также в патологиях полового члена и в развитии рака предстательной железы.

НАДФН-оксидаза является ферментом, состоящим из многих субъединиц, и образована из домена мембранно-связанного цитохрома b558, и трех цитозольных белковых субъединиц p47phox, p67phox, и малой ГТФазы семейства Rac. Идентифицировано семь изоформ ферментов NOX: NOX1, NOX2, NOX3, NOX4, NOX5, DUOX1 и DUOX2 (Leto et al., 2006, AntioxidRedoxSignal, 8(9-10): 1549-61; Cheng et al., 2001, Gene, 16: 269 (1-2): 131-40).

Таким образом, АФК, образующиеся посредством НАДФН, участвуют в патогенезе многих заболеваний, особенно сердечно-сосудистых расстройств и заболеваний, респираторных расстройств или заболеваний, метаболических расстройств и заболеваний, заболеваний костей, нейродегенеративных расстройств и заболеваний, воспалительных заболеваний, заболеваний репродуктивной системы, боли, раковых заболеваний, заболеваний и расстройств желудочно-кишечного тракта. Поэтому весьма желательно создание новых активных агентов, действие которых было бы сфокусировано на каскаде сигнальной системы АФК, в частности НАДФН-оксидазе (NOX).

Раскрытие изобретения

Настоящее изобретение направлено на новые молекулы, которые можно применять в лечении и/или профилактике патологии, связанной с никотинамидадениндинуклеотидфосфатоксидазой (НАДФН-оксидазой), в частности сердечно-сосудистых заболеваний, респираторных расстройств, метаболических расстройств, заболеваний кожи и/или костей, нейродегенеративных заболеваний, заболеваний почек, заболеваний репродуктивной системы, заболеваний воспалительной природы, раковых заболеваний, аллергических заболеваний, травматизма, септического, геморрагического и анафилактического шока, заболеваний желудочно-кишечного тракта и желудочно-кишечных расстройств, ангиогенеза и ангиогенез-зависимых состояний. В частности, изобретение относится к новым молекулам, применяемым для подавления или уменьшения образования АФК в клетках.

Первый аспект изобретения касается пиразолиндионовых производных формулы (I) (где R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, Х и n определены ниже), а также их фармацевтически приемлемых солей и их фармацевтически активных производных.

Второй аспект изобретения касается применения пиразолиндионовых производных формулы (I) (где R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, Х и n определены ниже), а также их фармацевтически приемлемых солей и их фармацевтически активных производных в качестве лекарственных средств.

Третий аспект изобретения касается фармацевтической композиции, содержащей по меньшей мере одно пиразолиндионовое производное по изобретению, а также их фармацевтически приемлемые соли, их фармацевтически активное производное и фармацевтически приемлемый носитель, растворитель или наполнитель.

Четвертый аспект изобретения касается применения пиразолиндионовых производных по изобретению, а также их фармацевтически приемлемых солей, их фармацевтически активных производных для приготовления фармацевтической композиции для лечения или профилактики заболевания или расстройства из числа из сердечно-сосудистых заболеваний, респираторных расстройств, метаболических расстройств, заболеваний кожи, заболеваний костей, нейродегенеративных и/или нейровоспалительных расстройств, заболеваний почек, заболеваний репродуктивной системы, заболеваний глаза и/или хрусталика и/или поражений внутреннего уха, заболеваний воспалительной природы, заболеваний печени, боли, раковых заболеваний, аллергических заболеваний, травматизма, септического, геморрагического и анафилактического шока, заболеваний и расстройств желудочно-кишечного тракта, ангиогенеза и ангиогенез-зависимых состояний и/или других заболеваний и расстройств, связанных с активностью никотинамидадениндинуклеотидфосфатоксидазы (НАДФН-оксидазы).

Пятый аспект изобретения касается способа лечения больных, страдающих каким-либо заболеванием или поражением из числа сердечно-сосудистых заболеваний, респираторных расстройств, метаболических расстройств, заболеваний кожи, заболеваний костей, нейродегенеративных и/или нейровоспалительных расстройств, заболеваний почек, заболеваний репродуктивной системы, заболеваний глаза и/или хрусталика и/или поражений внутреннего уха, заболеваний воспалительной природы, заболеваний печени, боли, раковых заболеваний, аллергических заболеваний, травматизма, септического, геморрагического и анафилактического шока, заболеваний и расстройств желудочно-кишечного тракта, ангиогенеза и ангиогенез-зависимых состояний и других заболеваний и/или расстройств, связанных с активностью никотинамидадениндинуклеотидфосфатоксидазы (НАДФН-оксидазы). Способ заключается во введении пиразолиндионовых производных формулы (I) (где R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, X и n определены ниже), а также их фармацевтически приемлемых солей и их фармацевтически активных производных больным, которые нуждаются в таком лечении.

Шестой аспект настоящего изобретения касается пиразолиндионовых производных формулы (I) (где R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, Х и n определены ниже), а также их фармацевтически приемлемых солей и их фармацевтически активных производных для лечения больных, страдающих заболеванием или расстройством из числа сердечно-сосудистых заболеваний, респираторных расстройств, метаболических расстройств, заболеваний кожи, заболеваний костей, нейродегенеративных и/или нейровоспалительных расстройств, заболеваний почек, заболеваний репродуктивной системы, заболеваний глаза и/или хрусталика и/или поражений внутреннего уха, заболеваний воспалительной природы, заболеваний печени, боли, раковых заболеваний, аллергических заболеваний, травматизма, септического, геморрагического и анафилактического шока, заболеваний и расстройств желудочно-кишечного тракта, ангиогенеза и ангиогенез-зависимых состояний и других заболеваний и/или расстройств, связанных с активностью никотинамидадениндинуклеотидфосфатоксидазы (НАДФН-оксидазы).

Седьмой аспект настоящего изобретения касается интермедиата формулы (II) пиразолиндионовых производных по изобретению.

Восьмой аспект настоящего изобретения касается способа получения интермедиата формулы (II) по изобретению.

Девятый аспект настоящего изобретения касается способа получения пиразолиндионовых производных формулы (I), где R1, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, Х и n определены ниже, и R2 является водородом.

Десятый аспект настоящего изобретения касается способа получения пиразолиндионовых производных формулы (I), где R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, Х и n определены ниже.

Другие особенности и преимущества настоящего изобретения будут ясны из дальнейшего подробного описания.

Осуществление изобретения

В следующих абзацах даны определения химических групп, из которых состоят соединения по изобретению и которые будут приводиться в описании и формуле изобретения, если не будет в явном виде использована другая, более широкая, формулировка.

Термин «алкил», используемый отдельно или в сочетании с другими терминами, включает прямые и разветвленные С120алкильные группы, и означает моновалентные алкильные группы, имеющие от 1 до 20 атомов углерода. Примерами алкильных групп являются метил, этил, n-пропил, i-пропил, n-бутил, s-бутил, i-бутил, t-бутил, n-пентил, 1-этилпропил, 2-метилбутил, 3-метилбутил, 2,2-диметилпропил, n-гексил, 2-метилпентил, 3-метилпентил, 4-метилпентил, n-гептил, 2-метилгексил, 3-метилгексил, 4-метилгексил, 5-метилгексил, n-гептил, n-октил, n-нонил, n-децил, тетрагидрогеранил, n-додецил, n-тридецил, n-тетрадецил, n-пентадецил, n-гексадецил, n-октадецил, n-нонадецил, n-эйкозанил и подобные им группы. Они предпочтительно включают в себя алкильные группы C1-C9, более предпочтительно C16алкильные и особенно предпочтительно C14алкильные группы, которые, по аналогии, означают, соответственно, моновалентные алкильные группы, содержащие от 1 до 9 атомов углерода, моновалентные алкильные группы, содержащие от 1 до 6 атомов углерода, и моновалентные алкильные группы, содержащие от 1 до 4 атомов углерода. Особенно предпочтительно они включают C16алкильные группы.

Термин «алкенил», используемый отдельно или в сочетании с другими терминами, включает прямой или разветвленный С220алкенил. Он может содержать любое возможное число двойных связей в любых возможных положениях, причем двойная связь может иметь конфигурацию (Е) или (Z). К примерам алкенилов относятся винил, аллил, изопропенил, 1-пропенил, 2-метил-1-пропенил, 1-бутенил, 2-бутенил, 3-бутенил, 2-этил-1-бутенил, 3-метил-2-бутенил, 1-пентенил, 2-пентенил, 3-пентенил, 4-пентенил, 4-метил-3-пентенил, 1-гексенил, 2-гексенил, 2-гексенил, 3-гексенил, 4-гексенил, 5-гексенил, 1-гептенил, 1-октенил, геранил, 1-деценил, 1-тетрадеценил, 1-октадеценил, 9-октадеценил, 1-эйкозенил, и 3,7,11,15-тетраметил-1-гексадеценил и подобные им группы. Предпочтительно эти группы включают С28алкенил, более предпочтительно С26алкенил. Из других алкенилов особенно предпочтительными являются винил или этенил (-СН=СН2), n-2-пропенил (аллил, -СН2СН=СН2), изопропенил, 1-пропенил, 2-метил-1-пропенил, 1-бутенил, 2-бутенил, и 3-метил-2-бутенил и им подобные группы.

Термин «алкинил», используемый отдельно или в сочетании с другими терминами, включает прямой или разветвленный С220алкинил. Он может содержать любое возможное число тройных связей в любых возможных положениях. К примерам алкинилов относятся такие группы, как алкинильные группы из 2-20 атомов углерода, которые могут опционально содержать двойную связь, например этинил (-С≡СН), 1-пропинил, 2-пропинил (пропаргил:-СН2С≡СН), 2-бутинил, 2-пентен-4-инил и подобные им группы. В частности алкинилы включают в себя С28алкинилы, более предпочтительно С26алкинилы и подобные им группы. Предпочтительными являются С26алкинильные группы, то есть группы, содержащие от 2 до 6 атомов углерода и имеющие по меньшей мере 1 или 2 алкинильные ненасыщенности.

«Гетероалкил» означает С112алкил, предпочтительно C16алкил, в котором по меньшей мере один атом углерода заменен гетероатомом - кислородом, азотом или серой, и включает 2-метоксиэтил и подобные им группы.

«Арил» означает ненасыщенную ароматическую карбоциклическую группу, имеющую от 6 до 14 атомов углерода и содержащую одно кольцо (например, фенил) или множественные конденсированные кольца (например, инденил, нафтил). Арил включает в себя фенил, нафтил, антрил, фенантренил и подобные группы.

«C16алкиларил» означает арильную группу, которая имеет C16алкильный заместитель, включая метилфенил, этилфенил и подобные группы.

«АрилС16алкил» означает C16алкильные группы, в которые входит один арильный заместитель, включая 3-фенилпропанил, бензил и подобные группы.

«Гетероарил» означает моноциклические гетероароматические, бициклические или трициклические гетероароматические группы с конденсированными кольцами. Конкретные примеры гетероароматических групп включают возможно замещенные пиридил, пирролил, пиримидинил, фурил, тиенил, имидазолил, оксазолил, изоксазолил, тиазолил, изотиазолил, пиразолил, 1,2,3-триазолил, 1,2,4-триазолил, 1,2,3-оксадиазолил, 1,2,4-оксадиазолил, 1,2,5-оксадиазолил, 1,3,4-оксадиазолилом, 1,3,4-триазинил, 1,2,3-триазинил, бензофурил, [2,3-дигидро]бензофурил, изобензофурил, бензотиенил, бензотриазолил, изобензотиенил, индолил, изоиндолил, 3Н-индолил, бензимидазолил, имидазо[1,2-а]пиридил, бензотиазолил, бензоксазолил, хинолизинил, хиназолинил, фталазинил, хиноксалинил, циннолинил, нафтиридинил, пиридо[3,4-b]пиридил, пиридо[3,2-b]пиридил, пиридо[4,3-b]пиридил, хинолил, изохинолил, тетразолил, 5,6,7,8-тетрагидрохинолил, 5,6,7,8-тетрагидроизохинолил, пуринил, птеридинил, карбазолил, ксантенил или бензохинолил.

«C16алкилгетероарил» означает гетероарильные группы, содержащие C16алкильный заместитель, включая метилфурил и подобные им группы.

«ГетероарилС16алкил» означает C16алкильные группы, содержащие гетероарильный заместитель, включая фурилметил и подобные группы.

«С26алкениларил» означает арильные группы, содержащие С26алкенильный заместитель, включая винилфенил и подобные группы.

«Арил С26алкенил» означает С26алкенильные группы, содержащие арильный заместитель, включая фенилвинильную и подобные группы.

«С26алкенилгетероарил» означает гетероарильные группы, содержащие С26алкенильный заместитель, включая винилпиридинил и подобные группы.

«Гетероарил С26алкенил» означает С16алкенильные группы, содержащие гетероарильный заместитель, включая пиридинилвинил и подобные группы.

«С38циклоалкил» означает насыщенную карбоциклическую группу, содержащую от 3 до 8 атомов углерода и имеющую одно кольцо (например, циклогексил) или множество конденсированных колец (например, норборнил). С38циклоалкилы включают в себя циклопентил, циклогексил, норборнил и подобные группы.

«Гетероциклоалкил» означает С38циклоалкильную группу, соответствующую приведенному выше определению, в которой до трех атомов углерода заменены гетероатомами, выбранными из О, S, NR, где R является водородом или метилом. Гетероциклоалкил включает в себя пирролидинил, пиперидинил, пиперазинил, морфолинил, тетрагидрофуранил и подобные группы.

«С16алкилС38циклоалкил» означает С38циклоалкильные группы, содержащие C16алкильный заместитель, включая метилциклопентил и подобные группы.

«С38циклоалкилС16алкил» означает C16алкильные группы, содержащие С38циклоалкильный заместитель, включая 3-циклопентилпропил и подобные группы.

«C16алкилгетероциклоалкил» означает гетероциклоалкильные группы, содержащие C16алькильный заместитель, включая 4-метилпиперидинил и подобные группы.

«Гетероциклоалкил C16алкил» означает C16алкильные группы, содержащие гетероциклоалкильный заместитель, включая (1-метилпиперидин-4-ил)метил и подобные группы.

«Карбокси» означает группу -С(O)ОН.

«КарбоксиС16алкил» означает C16алкильные группы, содержащие карбоксильный заместитель, включая 2-карбоксиэтил и подобные группы.

«Ацил» означает группу -C(O)R, где R включает водород, «алкил», предпочтительно «C16алкил», «арил», «гетероарил», «С38циклоалкил», «гетероциклоалкил», «арилС16алкил», «гетероарилС16алкил», «С38циклоалкилС16алкил» или «гетероциклоалкилС16алкил», включая ацетил и подобные группы.

«АцилС16алкил» означает C16алкильные группы, содержащие ацильный заместитель, включая 2-ацетилэтил и подобные группы.

«Ациларил» означает арильные группы, содержащие ацильный заместитель, включая ацетилфенил и подобные группы.

«Ацилокси» означает группу -OC(O)R, где R включает водород, «C16алкил», «С26алкенил», «С26алкинил», «С38циклоалкил», «гетероциклоалкил», «арил», «гетероарил», «арилС16алкил», «гетероарилС16алкил», «арилС26алкенил», «гетероарилС26алкенил», «арилС26алкинил», «гетероарилС26алкинил», «арилС26алкинил», «гетероарилС26алкинил», «С38циклоалкилС16алкил» или «гетероциклоалкилС16алкил», включая ацетокси и подобные группы.

«АцилоксиС16алкил» означает C16алкильные группы, содержащие ацилокси заместитель, включая 2-(этилкарбонилокси)этил и подобные группы.

«Алкокси» означает группу -O-R, где R включает «C16алкил», «арил», «гетероарил», «арил-С16алкил» или «гетероарилС16алкил». Предпочтительные алкокси-группы включают, к примеру, метокси, этокси, фенокси и другие подобные группы.

«АлкоксиС16алкил» означает C16алкильные группы, содержащие алкоксильный заместитель, включая метоксиэтил и подобные группы.

«Алкоксикарбонил» означает группу -C(O)OR, где R означает «C16алкил», «арил», «гетероарил», «арилС16алкил», «гетероарилС16алкил» или «гетероалкил».

«АлкоксикарбонилС16алкил» означает C16алкильные группы, содержащие алкоксикарбонильный заместитель, включая 2-(бензилоксикарбонил)этил и подобные группы.

«Аминокарбонил» означает группу -C(O)NRR', где R и R' независимо являются водородом, C16алкилом, арилом, гетероарилом, «арилС16алкилом» или «гетероарилС16алкилом», включая N-фенилкарбонил и подобные группы.

«АминокарбонилС16алкил» означает алкильные группы, содержащие аминокарбонильный заместитель включая 2-(диметиламинокарбонил)этил, N-этилацетамидил, N,N-диэтилацетамидил и подобные группы.

«Ациламино» означает группу -NRC(O)R', где R и R' независимо являются водородом, «C16алкилом», «С26алкенилом», «С26алкинилом», «С38циклоалкилом», «гетероциклоалкилом», «арилом», «гетероарилом», «арилС16алкилом», «гетероарилС16-алкилом», «арилС26алкенилом», «гетероарилС26алкенилом», «арилС26алкинилом», «гетероарилС26алкинилом», «циклоалкилС16алкилом» или «гетероциклоалкилС16алкилом», включая ацетамино- и подобные группы.

«АциламиноС16алкил» означает C16алкильные группы, содержащие ациламино заместитель, включая 2-(пропиониламино)этил и подобные группы.

«Уреидо» означает группу -NRC(O)NR'R'', где R, R' и R'' независимо являются водородом, «C16алкилом», «алкенилом», «алкинилом», «С38циклоалкилом», «гетероциклоалкилом», «C16арилом», «гетероарилом», «арилС16алкилом», «гетероарилС16алкилом», «арилС26алкенилом», «гетероарилС26алкенилом», «арилС26алкинилом», «гетероарилС26алкинилом», «циклоалкилС16алкилом» или «гетероциклоалкилС16алкилом», и где R' и R'' вместе с атомом азота, с которым они связаны, опционально могут образовывать 3-8-членное гетероциклическое кольцо.

«УреидоС16алкил» означает C16алкильные группы, содержащие уреидо заместитель, включая 2-(N'-метилуреидо)этил и подобные группы.

«Карбамат» означает группу -NRC(O)OR', где R и R' независимо являются «С16алкилом», «С26алкенилом», «С26алкинилом», «С38циклоалкилом», «гетероциклоалкилом», «арилом», «гетероарилом», «C16алкиларилом», «гетероарилС16алкилом», «арилС26алкенилом», «гетероарилС26алкенилом», «арилС26алкинилом», «гетероарилС26алкинилом», «циклоалкилС16алкилом» или «гетероциклоалкилС16алкилом», и R опционально может быть водородом.

«Амино» означает группу -NRR', где R и R' независимо являются водородом, «C16алкилом», «арилом», «гетероарилом», «C16алкиларилом», «C16алкилгетероарилом», «циклоалкилом» или «гетероциклоалкилом», и где R и R' вместе с атомом азота, с которым они связаны, опционально могут образовывать 3-8-членное гетероциклическое кольцо.

«Аминоалкил» означает алкильные группы, содержащие амино заместитель, включая 2-(1-пирролидинил)этил и подобные группы.

«Аммоний» означает положительно заряженную группу -N+RR'R'', где R, R' и R'' независимо являются «C16алкилом», «C16алкиларилом», «C16алкилгетероарилом», «циклоалкилом» или «гетероциклоалкилом», и где R и R' вместе с атомом азота, с которым они связаны, опционально могут образовывать 3-8-членное гетероциклическое кольцо.

«Алкил аммония» означает алкильные группы, содержащие аммонийный заместитель, включая 1-этилпирролидиний и т.п.

«Галоген» означает атом фтора, хлора, брома или йода.

«Сульфонилокси» означает группу -OSO2-R, где R выбран из «C16алкила», «C16алкила», замещенного галогенами (например, группу -OSO2-CF3), «С26алкенила», «алкинила», «С38-циклоалкила», «гетероциклоалкила», «арила», «гетероарила», «арилС16алкила», «гетероарилС16алкила», «арилС26алкенила», «гетероарилС26алкенила», «арилС26алкинила», «гетероарилС26алкинила», «циклоалкилС16алкила» или «гетероциклоалкилалкила».

«СульфонилоксиС16алкил» означает алкильные группы, содержащие замещающую сульфонилоксигруппу включая 2-(метилсульфонилокси)этил и подобные группы.

«Сульфонил» означает группу «-SO2-R», где R выбран из «арила», «гетероарила», «C16алкила», «C16алкила», замещенного галогенами (например, -SO2-CF3 группа), «С26алкенила», «С26алкинила», «С38циклоалкила», «гетероциклоалкила», «арила», «гетероарила», «арилС16алкила», «гетероарилС16алкила», «арилС26алкенила», «гетероарилС26алкенила», «арилС26алкинила», «гетероарилС26алкинила», «циклоалкилС16алкила» или «гетероциклоалкилС16алкила».

«СульфонилС16алкил» означает алкильные группы, содержащие сульфонильный заместитель, включая 2-(метилсульфонил)этил и подобные группы.

«Сульфинил» означает группу «-S(O)-R», где R выбран из «алкила», «алкила», замещенного галогенами (например, -SO-CF3 группа), «С26алкенила», «С26алкинила», «С38циклоалкила», «гетероциклоалкила», «арила», «гетероарила», «арилС16алкила», «гетероарилС16алкила», «арилС26алкенила», «гетероарилС26алкенила», «арилС26алкинила», «С38циклоалкилС16алкила», «гетероциклоалкилС16алкила».

«Сульфинилалкил» означает алкильные группы, содержащие сульфинильный заместитель, включая 2-(метилсульфинил)этил и подобные группы.

«Сульфанил» означает группы -S-R, где R выбран из водорода, «C16алкила», «C16алкила», замещенного галогенами (например, -S-CF3 группа), «С26алкинила», «С38циклоалкила», «гетероциклоалкила», «арила», «гетероарила», «арилС16алкила», «гетероарилС16алкила», «арилС26алкенила», «гетероарилС26алкенила», «арилС26алкинила», «алкинилгетероарила», «циклоалкилС16алкила» или «гетероциклоалкилС16алкила».

Предпочтительными сульфанильными группами являются метилсульфанил, этилсульфанил и подобные группы.

«СульфанилС16алкил» означает С15алкильные группы, содержащие сульфанильный заместитель, включая 2-(этилсульфанил)этил и подобные группы.

«Сульфониламино» означает группу -NRSO2-R', где R и R' независимо являются «C16алкилом», «С26алкенилом», «С26алкинилом», «С38циклоалкилом», «гетероциклоалкилом», «арилом», «гетероарилом», «арилС16алкилом», «гетероарилС16алкилом», «арилС26алкенилом», «гетероарилС26алкенилом», «арилС26алкинилом», «гетероарилС26алкинилом», «С38циклоалкилС16алкилом» или «гетероциклоалкилС16алкилом».

«СульфониламиноС16алкил» означает алкильные группы, замещенные сульфониламиногруппой, включая 2-(этилсульфониламино)этил и подобные группы.

«Аминосульфонил» означает группу -SO2-NRR', где R и R' независимо являются водородом, «С16алкилом», «С26алкенилом», «C16алкинилом», «С38циклоалкилом», «гетероциклоалкилом», «арилом», «гетероарилом», «арилС16алкилом», «гетероарилС16алкилом», «арилалкенилом», «гетероарилС26алкенилом», «арилС26алкинилом», «гетероарилС26алкинилом», «С38циклоалкилС16алкилом» или «гетероциклоалкилС16алкилом» и где R и R' вместе с атомом азота, с которым они связаны, опционально образуют 3-8-членное гетероциклическое кольцо. Аминосульфонильные группы включают в себя циклогексиламиносульфонил, пиперидинилсульфонил и подобные группы.

«АминосульфонилС16алкил» означает C16алкильные группы, замещенные аминосульфонильной группой, включая 2-(циклогексиламиносульфонил)этил и подобные группы.

Если в определении не налагаются никаких условия на заместители, любая из перечисленных выше замещающих групп может быть также опционально замещена.

Если в определении не налагаются никакие условия на замещающие группы, термин «замещенный» означает, что группа замещена 1-5 заместителями, выбранными из «C16алкила», «С26алкенила», «С26алкинила», «С38циклоалкила», «гетероциклоалкила», «C16-алкиларила», «C16-алкилгетероарила», «C16алкилциклоалкила», «C16алкилгетероциклоалкила», «амино», «аминосульфонила», «аммония», «ациламино», «аминокарбонила», «арила», «гетероарила», «сульфинила», «сульфонила», «алкокси», «алкоксикарбонила», «карбамата», «сульфанила», «галогенов», «тригалометила», «цианогруппы», «гидрокси», «меркапто», «нитро» и подобных групп.

Под термином «фармацевтически приемлемые соли или комплексы» понимают соли или комплексы указанных ниже соединений формулы (I). Примеры таких солей включают (но ими перечень не ограничиваются) соли присоединения оснований, образуемые в реакции между соединениями формулы (I) и органическими или неорганическими основаниями, такими как гидроксиды, карбонаты или бикарбонаты катионов металлов, например выбранных из группы, состоящей из щелочных металлов (натрия, калия или лития), щелочноземельных металлов (например, кальция или магния), или органических первичных, вторичных или третичных алкиламинов. В рамках настоящего изобретения описываются также соли аминов, образованные метиламином, диметиламином, триметиламином, этиламином, диэтиламином, триэтиламином, морфолином, N-Me-D-глюкамином, N,N'-бис(фенилметил)-1,2-этандиамином, трометамином, этаноламином, диэтаноламином, этилендиамином, N-метилморфолином, прокаином, пиперидином, пиперазином и подобными аминами.

К фармацевтически приемлемым солям относятся также соли присоединения кислоты, образованные с неорганическими кислотами (например, хлористоводородной, бромистоводородной, серной, фосфорной, азотной и подобными кислотами), а также соли, образованные с органическими кислотами, например уксусной, щавелевой, винной, янтарной, яблочной, фумаровой, малеиновой, аскорбиновой, бензойной, дубильной, пальмоевой, альгиновой, полиглутаминовой, нафталинсульфоновой, нафталиндисульфоновой и полигалактуроновой.

«Фармацевтически активными производными» называются любые соединения, которые при введении реципиенту прямо или опосредованно проявляют активность, описанную в настоящем изобретении. При «опосредованном» проявлении активности речь идет о пролекарствах, которые могут перейти в активную форму лекарства путем эндогенных ферментативных или метаболических превращений. Пролекарство является производным соединения по изобретению, обладает свойством ингибировать активность НАДФН-оксидазу и имеет химически или метаболически разлагаемую группу, и соединением, которое может превратиться в фармацевтически активные соединения in vivo при сольволизе в физиологических условиях. Изобретение охватывает также таутомеры соединений по изобретению.

Термин «сердечно-сосудистые расстройства или заболевания» охватывает атеросклероз, особенно заболевания или расстройства, связанные с дисфункцией эндотелия и включающие (но не ограниченные только ими) артериальную гипертензию, сердечно-сосудистые осложнения сахарного диабета I и II типа, гиперплазию интимы, коронарную болезнь, церебральный, коронарный или артериальный вазоспазм, дисфункцию эндотелия, сердечную недостаточность, включая застойную сердечную недостаточность, заболевания периферических артерий, рестеноз, травму стентом, инсульт, ишемические атаки, сосудистые осложнения, в частности осложнения после трансплантации органов, инфаркт миокарда, артериальную гипертензию, образование атеросклеротических бляшек, агрегацию тромбоцитов, стенокардию, аневризмы, расслоение аорты, ишемическую болезнь сердца, гипертрофию миокарда, эмболию легочной артерии, тромбоз, включая тромбоз глубоких вен, повреждение ткани после восстановления кровотока или доставки кислорода, наблюдающееся, например, при трансплантации органов, операциях на открытом сердце, ангиопластике, геморрагическом шоке, ангиопластике ишемизированного органа, включая сердце, головной мозг, печень, почку, сетчатку и кишечник.

«Респираторные расстройства или заболевания» охватывают бронхиальную астму, бронхит, аллергический ринит, респираторный дистресс-синдром взрослых, муковисцидоз, вирусную инфекцию легких (грипп), легочную гипертензию, идиопатический легочный фиброз и хронические обструктивные заболевания легких (ХОЗЛ).

«Аллергические заболевания» включают сенную лихорадку и бронхиальную астму.

Под «травматизмом» понимается политравматизм.

«Метаболические расстройства или болезни» включают ожирение, метаболический синдром и сахарный диабет II типа.

«Заболевания или поражения кожи» включают в себя псориаз, экзему, дерматит, заживающие раны и образование рубцов.

«Заболевания костей» включают в себя остеопороз, остеосклероз, периодонтит и гиперпаратироз.

«Нейродегенеративные расстройства или заболевания» включают в себя заболевания или патологические состояния, характеризующиеся дистрофическими изменениями или альтерацией, особенно на уровне нейронов центральной нервной системы (ЦНС), например, при болезни Альцгеймера, болезни Паркинсона, болезни Гентингтона, боковом амиотрофическом склерозе, эпилепсии и мышечной дистрофии. В эту группу заболеваний включены также воспалительные и демиелинизирующие поражения и болезни, такие, как лейкоэнцефалопатия и лейкодистрофии.

Под термином «демиелинизирующий» понимают расстройства и заболевания нервной системы, характеризующиеся деградацией миелина, окружающего аксоны. В контексте настоящего изобретения термин «демиелинизирующие заболевания» охватывает состояния, в основе которых лежит процесс демиелинизации клеток, в частности рассеянный склероз, прогрессирующая мультифокальная лейкоэнцефалопатия (ПМЛ), миелопатии, любой воспалительный процесс в нервной системе, включая появление в ЦНС аутореактивных лейкоцитов, врожденные метаболические нарушения, невропатию с нарушением миелинизации, лекарственную демиелинизацию, лучевую демиелинизацию, наследственные демиелинизирующие состояния, демиелинизирующий процесс, вызванный прионной инфекцией, демиелинизацию при энцефалите или повреждении спинного мозга. Предпочтительно под таким заболеванием понимается рассеянный склероз.

«Заболевания или поражения почек» включают диабетическую невропатию, почечную недостаточность, гломерулонефрит, нефротоксичность аминогликозидов и соединений платины и гиперактивность мочевого пузыря. В конкретном варианте осуществления изобретения «заболевания и поражения почек» включают в себя хронические поражения и заболевания почек.

«Расстройства или заболевания репродуктивной системы» включают эректильную дисфункцию, бесплодие, гипертрофию и доброкачественную гиперплазию предстательной железы.

«Заболевания или поражения глаз и/или хрусталика» включают катаракту, в том числе диабетическую, рецидив помутнения после хирургического вмешательства по поводу катаракты, диабетическую и другую формы ретинопатии.

«Поражения внутреннего уха» включают пресбиакузис, шум в ушах, болезнь Меньера и другие поражения органа равновесия, утрикулолитиаз, вестибулярную мигрень и тугоухость, связанную с действием шума, а также лекарств.

«Воспалительные поражения или заболевания» означают воспалительные заболевания кишечника, сепсис, септический шок, респираторный дистресс-синдром взрослых, панкреатит, травматический шок, бронхиальную астму, аллергический ринит, ревматоидный артрит, хронический ревматоидный артрит, артериосклероз, кровоизлияния в мозг, инфаркт мозга, сердечную недостаточность, инфаркт миокарда, псориаз, муковисцидоз, инсульт, острый бронхит, хронический бронхит, острый бронхиолит, хронический бронхиолит, остеоартрит, подагру, миелит, анкилозирующий спондилит, синдром Рейтера, псориатический артрит, спондилоартрит, ювенильный артрит или ювенильный анкилозирующий спондилит, реактивный артрит, инфекционный и постинфекционный артрит, гонококковый артрит, сифилитический артрит, болезнь Лайма, артрит, индуцированный «ангиитическим синдромом», узелковый периартериит, анафилактический ангиит, гранулематоз Легенека, ревматоидную полимиалгию, суставной ревматизм, кальциевый микрокристаллический артрит, псевдоподагру, несуставную форму ревматизма, бурсит, тендовагинит, эпикондилит («локоть теннисиста»), синдром запястного канала, заболевания, связанные с однообразной деятельностью (печатание на пишущей машинке), артрозоартрит, невропатическую артропатию, геморрагический артрит, пелиоз, гипертрофическую остеоартропатию, мультицентрический ретикулогистиоцитоз, артрит при специфических заболеваниях, окрашивание тканей пигментами крови, серповидно-клеточную анемию, гемоглобинопатии, гиперлипопротеинемию, дисгаммаглобулинемию, гиперпаратироз, акромегалию, периодическую болезнь, болезнь Бехчета, системную красную волчанку, рассеянный склероз, болезнь Крона и заболевания, подобные рецидивирующему полихондриту, хронические воспалительные заболевания кишечника или родственные заболевания у млекопитающих, которые необходимо лечить соединениями формулы (I), вводя их в дозе, достаточной для ингибирования активности НАДФН-оксидазы.

«Поражения или заболевания печени» включают фиброз печени, алкогольный фиброз, стеатоз и неалкогольный стеатогепатит.

«Артрит» включает в себя острый ревматоидный артрит, хронический ревматоидный артрит, хламидийный артрит, хронический абсорбтивный артрит, хилезный артрит, артрит при заболеваниях кишечника, филяриатозный артрит, гонорейный артрит, подагрический артрит, гемофилический артрит, гипертрофический артрит, ювенильный хронический артрит, артрит при болезни лайма, артрит новорожденных жеребят, нодулярный артрит, охронотический артрит, псориатический артрит, гнойный артрит или родственные заболевания у млекопитающих, которые необходимо лечить соединениями, описываемыми формулой (I), вводя их в дозе, достаточной для ингибирования активности НАДФН-оксидазы.

Термин «боль» включает гиперальгезию, связанную с воспалительным процессом

«Раковые заболевания» включают в себя раковые опухоли (такие как фибросаркома, миксосаркома, липосаркома, хондросаркома, остеогенная саркома, хордома, ангиосаркома, эндотелиосаркома, лимфаигиосаркома, лимфангиоэндотелиома, периостеома, мезотелиома, саркома Юинга, лейомиосаркома, рабдомиосаркома, рак толстой кишки, рак поджелудочной железы, рак молочной железы, рак яичника, рак почки, рак предстательной железы, плоскоклеточный рак, базально-клеточный рак, аденокарцинома, рак потовой железы, рак сальной железы, папиллярный рак, папиллярная аденокарцинома, цистаденокарцинома, медуллярный рак, бронхогенный рак, рак почек, гепатоцеллюлярная карцинома, холангиокарцинома, хориокарцинома, семинома, эмбриональный рак, опухоль Вилмса, рак шейки матки, опухоль яичка, рак легкого, мелкоклеточный рак легкого, аденокарцинома легкого, рак мочевого пузыря, или рак кожи), а также родственные заболевания у млекопитающих, которые нуждаются к лечении соединениями, описываемыми формулой (I), посредством введения их в дозе, достаточной для ингибирования активности НАДФН-оксидазы.

«Заболевания или расстройства желудочно-кишечного тракта» включают в себя поражение слизистой оболочки желудка, ишемическое поражение кишечника, энтерит/колит, изменения, вызываемые противоопухолевой химиотерапией, или нейтропению.

Термин «ангиогенез» включает прорастающий и ветвящийся ангиогенез, васкулогенез, артериогенез и лимфангиогенез. Ангиогенез представляет собой образование новых кровеносных сосудов из предсуществующих капилляров или поскапиллярных венул и наблюдается при патологии, например раке, артрите и воспалительном процессе. Многие ткани и органы, состоящие из организованных тканей, могут поддерживать ангиогенез в условиях патологии, например при болезнях кожи, мышц, кишечника, соединительной ткани, суставов, костей и подобных им тканей, в которые могут прорастать кровеносные сосуды под влиянием факторов ангиогенеза. В рамках настоящего изобретения под «ангиогенез-зависимым состоянием» понимается состояние, при котором ангиогенез или васкулогенез поддерживает или усиливает патологический процесс. В основе васкулогенеза лежит образование новых кровеносных сосудов, исходящих из ангиобластов, которые являются предшественниками эндотелиальных клеток. Оба процесса (как разрастание предсуществующих сосудов, так и образование сосудов de novo) приводят к образованию новых кровеносных сосудов и входят в понятие «ангиогенез-зависимые состояния». Аналогично, термин «ангиогенез» при использовании здесь включает образование новых сосудов, в частности в результате васкулогенеза, а также в результате ветвления и прорастания имеющихся капилляров, венул и других сосудов.

«Подавляющий ангиогенез» означает эффективный в уменьшении степени выраженности ангиогенеза, количества новообразующихся сосудов и темпов образования новых сосудов. Эффективное уменьшение количества, темпов и протяженности пролиферации эндотелиальных клеток и их миграции в ткани является частным примером подавления ангиогенеза. Подавление ангиогенеза целесообразно, в частности, при лечении любого ракового заболевания, так как направлено на подавление опухолевого процесса; в отсутствие неоваскуляризации опухолевая ткань не получает необходимых нутриентов, ее рост замедляется, она перестает увеличиваться, регрессирует и в конечном итоге подвергается некрозу и погибает. Кроме того, подавление ангиогенеза особенно действенно при лечении злокачественной опухоли, так как оно эффективно против метастазов, для образования которых необходима васкуляризация первичной опухоли, позволяющая опухолевым клеткам покинуть первичную опухоль и «обосноваться» вдали от нее; для роста метастазировавших клеток также необходима неоваскуляризация.

Термины «лечить» и «лечение», используемые в настоящем изобретении, означают действия, направленные на получение желаемого фармакологического и физиологического эффекта. Этот эффект может быть профилактическим, когда он направлен на хотя бы частичное предупреждение заболевания, симптома, или патологического состояния, характерного для заболевания, и/или лечебным, когда позволяет вылечить, хотя бы частично, болезнь, патологическое состояние, симптом или побочный эффект, обусловленный заболеванием. Термин «лечение», используемый в описании изобретения, охватывает любое лечение у млекопитающих, и особенно у человека, которое состоит в: (а) предотвращении развития заболевания у субъекта, возможно предрасположенного к нему, но у которого заболевание еще не диагностировано; (б) подавлении заболевания, т.е. прекращении его развития, или облегчении клинических проявлений заболевания, т.е. обеспечении регрессии заболевания или обратного развития его симптомов и патологических состояний.

Термин «субъект» при использовании в настоящей заявке означает млекопитающее. Например, настоящее изобретение распространяется на таких млекопитающих, как человек, приматы, домашние животные, такие как крупный рогатый скот, овцы, свиньи, лошади и подобные животные.

Термин «ингибитор», используемый в контексте настоящего изобретения, означает молекулу вещества, которая частично или полностью ингибирует активность НАДФНоксидазы и/или подавляет или уменьшает образование активных форм кислорода (АФК).

Соединения по изобретению

В одном варианте осуществления изобретения предлагается пиразолиндионовое производное формулы (I):

,

где R1 выбран из водорода; возможно замещенного алкоксикарбонила; возможно замещенного C16алкила; возможно замещенного С26алкенила; возможно замещенного С26алкинила; возможно замещенной алкоксигруппы; возможно замещенного алкоксиС16алкила; возможно замещенного аминоалкила; возможно замещенного ацила; возможно замещенного арила, например, фенила (в частности, 2-хлорфенила, 2-метоксифенила); возможно замещенного C16алкиларила; возможно замещенного арилС16алкила; возможно замещенного гетероарила; возможно замещенного C16алкилгетероарила; возможно замещенного гетероарилС16алкила; возможно замещенного С26алкениларила; возможно замещенного C26алкенила; возможно замещенного С26алкенилгетероарила; возможно замещенного гетероарилС26алкенила; возможно замещенного С38циклоалкила; возможно замещенного гетероциклоалкила; возможно замещенного С16алкилС38циклоалкила; возможно замещенного С38циклоалкилС16алкила; возможно замещенного C16алкилгетероциклоалкила и возможно замещенного гетероциклоалкилС16алкила; R2 выбран из водорода; возможно замещенного алкоксикарбонила; возможно замещенного ацила; возможно замещенного ацилС16алкила; возможно замещенного C16алкила; возможно замещенного С26алкенила; возможно замещенного С26алкинила; возможно замещенного арила; возможно замещенного гетероарила; возможно замещенного С38циклоалкила; возможно замещенного гетероциклоалкила; возможно замещенного С38циклоалкилС16алкила; возможно замещенного гетероциклоалкилС16алкила; возможно замещенного арилС16алкила и возможно замещенного гетероарилС16алкила; R3 выбран из водорода; возможно замещенного алкоксикарбонила; возможно замещенного ацила; возможно замещенного C16алкила; возможно замещенного С26алкенила; возможно замещенного С26алкинила; возможно замещенного арила; возможно замещенного C16алкиларила; возможно замещенного арилС16алкила; возможно замещенного гетероарила; возможно замещенного C16алкилгетероарила; возможно замещенного гетероарилС16алкила; возможно замещенного С26алкениларила; возможно замещенного арилС16алкенила; возможно замещенного С26алкенилгетероарила; возможно замещенного гетероарилС16алкенила; возможно замещенного С38циклоалкила; возможно замещенного гетероциклоалкила; возможно замещенного С16алкилС38циклоалкила; возможно замещенного С38циклоалкилС16алкила; возможно замещенного C16алкилгетероциклоалкила и возможно замещенного гетероциклоалкилС16алкила; R4, R5, R6, R7, R8 и R9 независимо выбраны из водорода; галогенов; нитрогруппы, а также из возможно замещенного C16алкила; возможно замещенного С26алкенила; возможно замещенного С26алкинила; возможно замещенной аминогруппы; возможно замещенного аминоалкила; возможно замещенной алкоксигруппы; возможно замещенного алкоксиС16алкила; R10 выбран из водорода и возможно замещенного C16алкила; R11 выбран из водорода; возможно замещенного алкоксикарбонила; возможно замещенного ацила; возможно замещенного C16алкила; возможно замещенного С26алкенила; возможно замещенного С26алкинила; возможно замещенной алкоксигруппы; возможно замещенного алкоксиС16алкила, возможно замещенного аминоалкила, возможно замещенного ацила; возможно замещенного арила; возможно замещенного C16алкиларила; возможно замещенного арилС16алкила; возможно замещенного гетероарила; возможно замещенного C16алкилгетероарила; возможно замещенного гетероарилС16алкила; возможно замещенного С26алкениларила; возможно замещенного арилС26алкенила; возможно замещенного С26алкенилгетероарила; возможно замещенного гетероарилС26алкенила; возможно замещенного С38циклоалкила; возможно замещенного гетероциклоалкила; возможно замещенного С16алкилС38циклоалкила; возможно замещенного С38циклоалкилС16алкила; возможно замещенного C16алкилгетероциклоалкила и возможно замещенного гетероциклоалкилС16алкила; R12 выбран из водорода; -Z-NR13R14; -CHR17R18; возможно замещенного алкоксикарбонила, например карбоксилата (например, третичного бутилкарбоксилата); возможно замещенного ацила; возможно замещенного C16алкила; возможно замещенного С26алкенила; возможно замещенного С26алкинила; возможно замещенной алкоксигруппы; возможно замещенного алкоксиС16алкила; возможно замещенного аминоалкила; возможно замещенного ацила; возможно замещенного арила, возможно замещенного C16алкиларила, возможно замещенного арилС16алкила, например, возможно замещенного фенилС16алкила, такого как фенилметил (например, бензил, 2-хлорбензил, 3-метоксибензил, 3-хлоробензил, 4-хлоробензил, 2-метоксибензил); возможно замещенного гетероарила; возможно замещенного C16алкилгетероарила; возможно замещенного гетероарилС16алкила, такого как возможно замещенный пиридинС16алкил (например, пиридинметил, такой как пиридин-2-илметил, пиридин-3-илметил) или возможно замещенного фуранилС16алкила (например, возможно замещенного фуранметила, такого как фуран-3-метил) или возможно замещенного пиразолилС16алкила (например, возможно замещенного пиразолилметила, такого как 1-метил-1Н-пиразол-3-ил); возможно замещенного С26алкениларила; возможно замещенного арилС26алкенила; возможно замещенного С26алкенилгетероарила; возможно замещенного гетероарилС26алкенила; возможно замещенного С38циклоалкила; возможно замещенного гетероциклоалкила; возможно замещенного C16алкилС38циклоалкила; возможно замещенного С38циклоалкилС16алкила; возможно замещенного C16алкилгетероциклоалкила и возможно замещенного гетероциклоалкилС16алкила; R13, R14, R17 и R18 независимо выбраны из водорода; возможно замещенногоС16алкила; возможно замещенного С26алкенила; возможно замещенного С26алкинила; возможно замещенного арила; возможно замещенного C16алкиларила; возможно замещенного арилС16алкила; возможно замещенного гетероарила; возможно замещенного C16алкилгетероарила; возможно замещенного гетероарил-С16алкила; возможно замещенного С26алкениларила; возможно замещенного арилС26алкенила; возможно замещенного С26алкенилгетероарила; возможно замещенного гетероарилС26алкенила; возможно замещенного С38циклоалкила; возможно замещенного гетероциклоалкила; возможно замещенного C16алкилС38циклоалкила; возможно замещенного С38циклоалкилС16алкила; возможно замещенного C16алкилгетероциклоалкила и возможно замещенного гетероциклоалкилС16-алкила; Х выбран из О, NR12, S, S=O и S(O)2; Z выбран из С(O); C(S) и SO2. n является целым числом, выбранным из 0 и 1; а также его фармацевтически приемлемые соли и его фармацевтически активные производные.

Композиции

В настоящем изобретении предлагаются фармацевтические или терапевтические агенты в виде композиций и способы лечения больных, предпочтительно млекопитающих и особенно предпочтительно больных людей, которые страдают от заболеваний и, в частности, от заболеваний, связанных с активностью НАДФН-оксидазы, из числа сердечно-сосудистых расстройств или заболеваний, респираторных расстройств или заболеваний, метаболических расстройств или болезней, поражений кожи, поражений костей, нейровоспалительных и нейродегенеративных расстройств, заболеваний почек, расстройств репродуктивной системы, заболеваний или расстройств глаз и/или хрусталика, поражений внутреннего уха, воспалительных заболеваний и расстройств, болезней печени, боли, раковых заболеваний, ангиогенеза и ангиогенез-зависимых состояний и/или заболеваний или расстройств желудочно-кишечного тракта.

Фармацевтические композиции по изобретению могут содержать одно или более пиразолиндионовое производное в любой описанной в изобретении форме. Композиции по изобретению могут дополнительно содержать также один или более фармацевтически приемлемых ингредиентов, например алюмокалиевые квасцы, стабилизаторы, противомикробные вещества, буферы, красители, вкусовые добавки, адъюванты и т.п.

Соединения по изобретению вместе с традиционно применяемым адъювантом, носителем, растворителем или наполнителем может быть переведено в форму фармацевтической композиции и стандартную дозировку такой композиции и в такой форме может применяться в твердом виде (например, в таблетках или капсулах) или жидком виде (например, в растворах, суспензиях, эмульсиях, эликсирах или наполненных ими капсулах - все для перорального введения), или в инъекциях в виде стерильного раствора, то есть для парентерального введения (включая подкожное введение). Такие фармацевтические композиции и их стандартные дозировки могут содержать ингредиенты в традиционных пропорциях с дополнительными активными соединениями или компонентами или без них, и такие стандартные дозировки могут содержать любое эффективное количество активного ингредиента, соответствующее диапазону планируемой суточной дозы, которую следует ввести. Композиции по изобретению предпочтительно являются инъекционными.

Композиции по изобретению могут быть также жидкими формами, включая водные или масляные взвеси, растворы, эмульсии, сиропы и эликсиры, но не ограничиваясь только ими. Жидкие формы, пригодные для введения внутрь, могут включать в себя водный или неводный растворитель с буферами, суспендирующими, диспергирующими, красящими веществами, вкусовыми добавками и тому подобными веществами. Композиции могут быть также в виде сухого продукта, которые перед применением доводятся до подходящей формы путем добавления воды или другого подходящего растворителя. Такие жидкие препараты могут содержать добавки, включая суспендирующие и эмульгирующие вещества, а также неводные растворители и консерванты, но не ограничиваясь только ими. Суспендирующие вещества включают сироп сорбитола, метилцеллюлозу, глюкозный/сахарный сироп, желатин, гидроксиэтилцеллюлозу, карбоксиметилцеллюлозу, гель стеарата алюминия, гидрогенизированные пищевые жиры, но не ограничиваются только ими. Эмульгирующие вещества (эмульгаторы) включают лецитин, сорбитана моноолеат и аравийскую камедь, но ограничиваются только ими. Неводные растворители включают пищевые масла, миндальное масло, фракционированное кокосовое масло, жирные эфиры, пропиленгликоль, этиловый спирт, и не только. Консерванты включают метил- или пропил-р-гидроксибензойную кислоту и сорбиновую кислоту, и не только. О других веществах и способах обработки и т.п. можно узнать из части 5 Remington's PharmaceuticalSciences, 21st Edition, 2005, University of the Sciences in Philadelphia, Lippincott Williams & Wilkins, включенной в настоящее описание посредством ссылки.

Твердые композиции по настоящему изобретению могут быть в форме таблеток и леденцов, изготовленных обычным способом. Например, таблетки и капсулы для перорального введения могут содержать традиционные наполнители, включая связующие вещества, наполнители, лубриканты, разрыхлители и увлажняющие вещества, но ограничиваясь только ими. Связующие вещества включают сироп, аравийскую камедь, желатин, сорбитол, трагакант, крахмальный клейстрер и поливинилпирролидон, но не ограничиваются только ими. Наполнители включают лактозу, сахар, микрокристаллическую целлюлозу, зерновой крахмал, кальция фосфат, сорбитол, но не ограничиваются только ими. Лубриканты включают в себя магния стеарат, стеариновую кислоту, тальк, полиэтиленгликоль, и диоксид кремния, но не ограничиваются только ими. Разрыхлители включают в себя картофельный крахмал и натрия крахмал гликолят, но не ограничиваются только ими. Увлажняющие вещества включают в себя натрия лаурилсульфат, и не только. На таблетки может быть нанесено покрытие тем или иным способом, хорошо известным в этой области техники.

Инъекционные композиции обычно готовят на основе обычного физиологического раствора, физиологического раствора с фосфатным буфером или другого инъекционного носителя, известного в данной области техники.

Композиции по изобретению могут быть в форме суппозиториев, которые содержат основу, включая масло какао или триглицериды, но не ограничиваясь только ими. Композиции по изобретению могут быть в виде ингаляционных препаратов, например (но не только), в форме раствора, суспензии или эмульсии, которые можно назначать в виде сухого порошка или аэрозоля, используя в последнем случае дихлордифлуорометан или трихлорфлуорометан в качестве пропеллента. Композиции по изобретению могут быть также в виде препаратов для трансдермального применения, содержащих водные или неводные растворители, включая крема, мази, лосьоны, пасты, лечебные пластыри, пластины или пленки, но не ограничиваясь только ими.

Композиции по изобретению могут быть в виде лекарств для парентерального введения, например в инъекциях или непрерывных инфузиях, но не только. Инъекционные препараты можно приготовить в форме суспензий, растворов или эмульсий в масляном или водном растворителе; эти препараты могут содержать вспомогательные вещества, включая суспендирующие, стабилизирующие и диспергирующие добавки, но не ограничиваясь только ими. Композицию можно выполнить также в форме порошка, прилагая к нему подходящий растворитель включая стерильную апирогенную воду, но не ограничиваясь только ею.

Композиции по изобретению могут быть лекарствами медленного всасывания (депо), которые вводят в виде внутримышечных инъекций или имплантируют. Композиции могут быть в виде препаратов с подходящими полимерами или гидрофобными веществами (например, в виде эмульсии в приемлемом масле), ионообменными смолами или труднорастворимых производных (например, труднорастворимой соли).

Композиции по изобретению могут быть и в виде липосомных препаратов. Липосомный препарат может содержать липосомы, которые проникают в клетки-мишени или через роговой слой кожи и сливаются с клеточной мембраной, доставляя содержимое липосомы в клетку. Другим препаратом композиций по изобретению являются ниосомы. Ниосомы - это липидные везикулы, напоминающие липосомы, мембрана которых состоит в основном из неионных липидов, некоторые формы которых эффективны для транспорта соединений через роговой слой кожи. Соединения по изобретению можно вводить также в виде препаратов с замедленным высвобождением или систем с замедленным высвобождением лекарства. Описание веществ, которые используют для замедленного высвобождения, также можно найти в Remington's Pharmaceutical Sciences.

Способ введения

Композиции по изобретению можно вводить любым путем, в том числе (но не ограничиваясь только этим) перорально, парентерально, сублингвально, трансдермально, ректально, трансмукозально, местно, ингаляционно, буккально или интраназально либо комбинируя эти способы введения. При парентеральном пути введения препарат вводят внутривенно, внутриартериально, внутрибрюшинно, подкожно, внутримышечно, интратекально и интраартикулярно. Композиции по изобретению можно применять и в виде имплантатов, которые позволяют добиться длительного замедленного высвобождения композиции, а также в виде медленной контролируемой внутривенной инфузии. В предпочтительном варианте осуществления изобретения пиразолиндионовые производные согласно изобретению вводят внутривенно или подкожно.

Настоящее изобретение проиллюстрировано следующими примерами, которыми, однако, объем настоящего изобретения ни в коем случае не ограничивается.

Назначаемая доза (однократная или многократная) колеблется в зависимости от ряда факторов, в том числе фармакокинетических особенностей композиции, состояния больного, таких его особенностей, как пол, возраст, масса тела, общее состояние, рост, а также степени выраженности симптомов, одновременно проводимого другого лечения, частоты введения и желаемого эффекта.

Комбинация

Согласно одному варианту осуществления изобретения, соединения по изобретению и фармацевтические препараты из них можно назначать отдельно или в комбинации с ковеществом, которое эффективно при лечении раковых заболеваний, например препаратами, применяемыми в традиционной химиотерапии солидных опухолей и для профилактики и лечения метастазов, или в гормональной терапии, или в комбинации с любой другой молекулой, которая индуцирует программируемую смерть клеток, например ковеществом, выбранным из лекарств, которые блокируют синтез ДНК, таких, как метотрексат (Абитрексат®), фторурацил (Абруцил®), гидроксимочевина (Гидреа®) и меркаптопурин (Пуринетол®), ковеществом, выбранным из лекарств, которые непосредственно разрушают ДНК в ядре клетки, например цисплатин (Платинол®), и антибиотиком - даунорубицином (Церубидин®), доксорубицином (Адриамицин®) и этопозидом (Вепезид®), ковеществом, выбранным из лекарств, которые нарушают синтез или распад митотических веретен, таких, например, как винбластин (Велбан®), винкристин (Онковин®) и пацитаксел (Таксол®).

Согласно другому варианту осуществления изобретения, соединения по изобретению и фармацевтические препараты из них можно вводить в комбинации с веществами, мишенями которых являются белки клеточной поверхности, например путем переноса гена, кодирующего цепочку рецептора цитокина, или введения цитотоксина, нацеленного на рецептор.

Согласно другому варианту осуществления изобретения соединения по изобретению и фармацевтические препараты из них можно вводить, комбинируя введение с лучевой терапией.

Изобретение охватывает введение соединений по изобретению или фармацевтических препаратов из них, причем соединение по изобретению и фармацевтический препарат из него вводят больному до назначения другого лечения, одновременно с назначением такого лечения или после его назначения или в сочетании с ковеществом, эффективным при лечении злокачественной опухоли (например, полимедикаментозное лечение) и подбираемым в терапевтически эффективной дозе. Соединения по изобретению или фармацевтические препараты из них, вводимые одновременно с упомянутыми ковеществами, можно вводить в той же или другой композиции (или тех же или других композициях) тем же или иным путем.

В другом варианте осуществления изобретения рассмотрены соединения и способы по изобретению для использования при лечении раковых заболеваний, причем в типичном случае соединение по изобретению вводят во время или после химио-, гормональной или лучевой терапии.

В другом частном варианте осуществления изобретения соединения и способы по изобретению рассмотрены для лечения раковых заболеваний, причем соединение по изобретению в типичных случаях вводят после химио-, гормональной или лучевой терапии в тот период, когда опухолевая ткань может ответить на токсическое воздействие индукцией ангиогенеза, который обеспечивает опухолевую ткань кровью и нутриентами.

В другом варианте осуществления изобретения соединение по изобретению вводят после хирургического удаления солидных опухолей, чтобы предупредить развитие метастазов.

Пациенты

В настоящем изобретении пациентами по изобретению являются больные сердечно-сосудистыми расстройствами или заболеваниями.

В другом варианте осуществления изобретения пациентами по изобретению являются больные респираторными расстройствами и заболеваниями.

В другом варианте осуществления изобретения пациентами по изобретению являются больные метаболическими расстройствами и болезнями.

В другом варианте осуществления изобретения пациентами по изобретению являются больные поражениями кожи.

В другом варианте осуществления изобретения пациентами по изобретению являются больные поражениями костей.

В другом варианте осуществления изобретения пациентами по изобретению являются больные нейровоспалительными и/или нейродегенеративными расстройствами.

В другом варианте осуществления изобретения пациентами по изобретению являются больные заболеваниями почек.

В другом варианте осуществления изобретения пациентами по изобретению являются больные расстройствами репродуктивной системы.

В другом варианте осуществления изобретения пациентами по изобретению являются больные заболеваниями или расстройствами глаз и/или хрусталика и/или поражениями внутреннего уха.

В другом варианте осуществления изобретения пациентами по изобретению являются больные заболеваниями или расстройствами воспалительной природы.

В другом варианте осуществления изобретения пациентами по изобретению являются больные заболеваниями печени.

В другом варианте осуществления изобретения пациентами по изобретению страдают от боли, например обусловленной воспалительным процессом.

В другом варианте осуществления изобретения пациентами по изобретению являются больные раковыми заболеваниями.

В другом варианте осуществления изобретения нарушение здоровья пациентов по изобретению связано с ангиогенезом или ангиогенез-зависимым состоянием.

В другом варианте осуществления изобретения пациентами по изобретению являются больные аллергическими заболеваниями.

В другом варианте осуществления изобретения нарушение здоровья пациентов по изобретению связано с травматизмом.

В другом варианте осуществления изобретения пациентами по изобретению являются лица в состоянии септического, геморрагического и анафилактического шока.

В другом варианте осуществления изобретения пациентами по изобретению являются больные заболеваниями или расстройствами желудочно-кишечного тракта.

Применение по изобретению

В другом варианте осуществления изобретения предлагаются пиразолиндионовые производные формулы (I); а также фармацевтически приемлемые соли и фармацевтически активные их производные для применения в качестве лекарства.

В дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых R1 выбран из возможно замещенного арила и возможно замещенного гетероарила; R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых R2 является водородом; R1, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых R3 является водородом; R1, R2, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых R4 является водородом; R1, R2, R3, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых R4 и R5 являются водородом; R1, R2, R3, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, X и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых R4, R5, R6, R7, R8 и R9 являются водородом; R1, R2, R3, R10, R11, R12, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых R10 является водородом; R1, R2, R3, R4, R5, R6, R7, R8, R9, R11, R12, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых R11 является водородом; R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R12, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых R12 является водородом; R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых R12 выбран из возможно замещенного арилС16алкила и возможно замещенного гетероарилС16алкила; R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых R12 является возможно замещенным алкоксикарбонилом; R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых Х является кислородом; R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11 и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых Х является NR12; R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18 и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых n означает 0; R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18 и Х определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых n является 1; R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18 и Х определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых R2, R3, R4, R5, R6, R7, R8, R9, R10 и R11 являются водородом; R1, R12, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения».

В другом дополнительном варианте осуществления изобретения предлагаются пиразолиндионовые производные, в которых R2, R3, R4, R5, R6, R7, R8, R9, R10, R11 и R17 являются водородом, R12 является -CHR17R18, Х является NR12, R1, R18 и n определены как в разделе «Осуществление изобретения».

В другом варианте осуществления изобретения предлагаются пиразолиндионовое производное формулы (I), где R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения», а также их фармацевтически приемлемые соли и их фармацевтически активные производные для получения фармацевтической композиции для лечения и профилактики заболеваний или патологических состояний из числа сердечно-сосудистых расстройств или заболеваний, респираторных расстройств, метаболических расстройств, поражений кожи, заболеваний костей, нейровоспалительных и нейродегенеративных заболеваний, заболеваний почек, заболеваний репродуктивной системы, заболеваний глаз и/или хрусталика и/или поражений внутреннего уха, заболеваний воспалительной природы, заболеваний печени, боли, раковых заболеваний, аллергических заболеваний, травматизма, септического, геморрагического и анафилактического шока, заболеваний и расстройств желудочно-кишечного тракта, ангиогенеза и ангиогенез-зависимых состояний и других заболеваний и расстройств, связанных с активностью никотинамидадениндинуклеотидфосфатоксидазы (НАДФН-оксидазы).

В другом варианте осуществления изобретения предлагаются пиразолиндионовое производное формулы (I), в котором R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения», а также их фармацевтически приемлемые соли и из фармацевтически активные производные для лечения или профилактики заболеваний и патологических состояний из числа сердечно-сосудистых расстройств, респираторных расстройств, метаболических расстройств, поражений кожи, заболеваний костей, нейровоспалительных и/или нейродегенеративных заболеваний, заболеваний почек, заболеваний репродуктивной системы, заболеваний глаз и/или хрусталика и/или поражений внутреннего уха, воспалительных заболеваний, заболеваний печени, боли, раковых заболеваний, аллергических заболеваний, травматизма, септического, геморрагического и анафилактического шока, заболеваний и расстройств желудочно-кишечного тракта, ангиогенеза и ангиогенез-зависимых состояний и других заболеваний и расстройств, связанных с активностью никотинамидадениндинуклеотидфосфатоксидазы (НАДФН-оксидазы).

Соединения по настоящему изобретению включают в себя, в частности, соединения из следующих групп:

2-(2-хлорфенил)-10-(пиридин-2-илметил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;

10-бензил-2-(2-метоксифенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;

10-бензил-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;

10-(2-хлорбензил)-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;

2-(2-хлорфенил)-10-(3-метоксибензил)-2,3,8,9,10,11 -гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;

10-(3-хлорбензил)-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;

2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;

трет-бутил-2-(2-хлорфенил)-1,5-диоксо-2,3,5,8,9,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-10(7Н)-карбоксилат;

10-(4-хлорбензил)-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;

2-(2-хлорфенил)-10-(метоксибензил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;

2-(2-хлорфенил)-10-(4-метоксибензил)-2,3,8,9,10,11 -гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;

2-(2-хлорфенил)-10-(фуран-3-илметил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;

9-бензил-2-(2-хлорфенил)-2,3,7,8,9,10-гексагидропиразоло[4',3':3,4]пиридо[1,2-а]пиразин-1,5-дион;

2-(2-хлорфенил)-2,3,7,8-тетрагидро-1Н-пиразоло[4',3':3,4]пиридо[2,1-с][1,4]оксазин-1,5(10Н)-дион;

2-(2-метоксифенил)-10-(пиридин-2-илметил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;

10-(3-метоксибензил)-2-(2-метоксифенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;

2-(2-хлорфенил)-10-[(1-метил-1Н-пиразол-3-ил)метил]-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион; и

2-(2-хлорфенил)-10-(пиридин-3-илметил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион.

В другом варианте осуществления изобретения предлагается инетермедиат формулы (II):

в котором R1, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R17, R18, Х и n определены как в разделе «Осуществление изобретения», R15 является замещенным C16-алкилом, таким, как метил, этил, пропил, изопропил или бутил.

В дополнительном варианте осуществления изобретения предлагается интермедиат формулы (II), который выбран из группы: метил[(4Z)-4-(4-бензил-1,4-диазепан-2-илиден)-1-(2-хлорфенил)-5-оксо-4,5-дигидро-1Н-пиразол-3-ил]ацетат и метил[(4Z)-4-(4-бензил-1,4-диазепан-2-иллиден)-1-(2-метоксифенил)-5-оксо-4,5-дигидро-1Н-пиразол-3-ил]ацетат.

В другом варианте осуществления изобретения предлагается способ получения интермедиата формулы (II), содержащий этап взаимодействия соединения формулы (V) с амином формулы (IV):

где R1, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R17, R18, X и n определены как в разделе «Осуществление изобретения».

В другом варианте осуществления изобретения предлагается способ получения соединения формулы (I), содержащий этап циклизации соединения формулы (II) в присутствие основания:

где R1, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R17, R18, Х и n определены как в разделе «Осуществление изобретения», а R2 является водородом.

В другом варианте осуществления изобретения предлагается способ получения соединения формулы (I), включающий в себя взаимодействие соединения формулы (Ia) с алкилирующим или связующим веществом в присутствие основания:

где R1, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, Х и n определены как в разделе «Осуществление изобретения», R2 является таким, как указано в описании изобретения, но отлично от водорода.

В другом варианте осуществления изобретения предлагается способ лечения больного, страдающего заболеванием или патологическим состоянием из числа сердечно-сосудистых расстройств, респираторных расстройств, метаболических расстройств, поражений кожи, заболеваний костей, нейровоспалительных и/или нейродегенеративных заболеваний, заболеваний почек, заболеваний репродуктивной системы, заболеваний глаз и/или хрусталика и/или поражений внутреннего уха, заболеваний воспалительной природы, болезней печени, боли, раковых заболеваний, аллергических заболеваний, травматизма, септического, геморрагического и анафилактического шока, желудочно-кишечных расстройств, ангиогенеза и ангиогенез-зависимых состояний и других болезней, связанных с активностью никотинамидадениндинуклеотидфосфатоксидазы (НАДФН-оксидазы). Способ состоит в назначении больному соединения формулы (I).

В другом варианте осуществления изобретения предлагается способ подавления ангиогенеза у больного, который в этом нуждается, состоящий во введении соединения формулы (I) в дозе, подавляющей ангиогенез, больному, который нуждается в таком подавлении.

В другом варианте осуществления изобретения предлагается способ подавления неоваскуляризации опухоли путем подавления ангиогенеза в соответствии с настоящими способами. Аналогично, в изобретении предлагается способ подавления роста опухоли применением способов подавления ангиогенеза.

В частном варианте осуществления изобретения рассматривается возможность воздействия соединениями и способами по изобретению на опухолевую ткань у больного с опухолью, с солидной опухолью, метастазами, раком, меланомой, раком кожи, раком молочной железы, гемангиомой или ангиофибромой и другими подобными опухолями; а ангиогенез, который следует подавлять является ангиогенезом в опухолевой ткани, т.е. процессом ее неоваскуляризации. Ткань типичной солидной опухоли, поддающаяся воздействию соединениями и способами по изобретению, - это ткань рака кожи, меланомы, рака легкого, рака поджелудочной железы, рака молочной железы, рака толстой кишки, рака гортани, рака яичника, рака предстательной железы, рака прямой кишки, опухолей головы, рака шеи, рака яичка, рака лимфоидной ткани, опухолей костного мозга, саркомы, рака почки, рака потовой железы и других подобных опухолей. Примерами раковых опухолей, подходящих для такого лечения, являются также глиобластомы.

В другом частном варианте осуществления изобретения рассматривается возможность подавления соединениями и способами по изобретению воспалительного процесса и ангиогенеза, когда происходит неоваскуляризация воспаленной ткани. В этом случае рассматривается возможность подавления с помощью соединений и способов по изобретению ангиогенеза в воспаленной ткани при артрите, например у больного с хроническим артритом ревматической природы, в ткани, пораженной воспалительным и аутоиммунным процессом, ткани псориатической и других тканях, пораженных воспалительным процессом.

В вариантах осуществления изобретения рассматривается подавление ангиогенеза в ткани. Интенсивность ангиогенеза в ткани и, следовательно, степень подавления его способами по изобретению можно оценить с помощью различных способов, описанных в изобретении.

В другом варианте осуществления изобретения предлагаются фармацевтические композиции, содержащие по меньшей мере одно пиразолиндионовое производное формулы (I), и фармацевтически приемлемый носитель, растворитель или наполнитель.

Соединения по изобретению названы в соответствии со стандартами Международного союза по теоретической (чистой) и прикладной химии (IUPAC), использованными в программе ACD/Name (версия 10.01).

Соединения по изобретению включают соединения формулы (I), их таутомеры, геометрические изомеры, оптически активные формы, такие, как энантиомеры, диастереомеры и рацемические формы, а также их фармацевтически приемлемые соли. Производные, приведенные в качестве примеров в настоящем изобретении, можно получить из легко доступных исходных реагентов с помощью известных способов и методик. Следует принять во внимание, что там, где указаны типичные или предпочтительные условия эксперимента (например, температура реакции, время, количество молей реагентов, растворители), можно подобрать и другие условия, если обратное особо не оговаривается. Оптимальные условия реакции варьируются в зависимости от конкретных реагентов или растворителей, но эти условия подбирает специалист в данной области, используя рутинные способы оптимизации.

Литературные источники, цитируемые здесь, включены в изобретение полностью посредством ссылки. Настоящее изобретение не ограничивается обзором конкретных вариантов осуществления, описанных здесь в качестве иллюстрации отдельных аспектов изобретения, в изобретении охватываются также эквивалентные в функциональном отношении способы и компоненты. По существу из предшествующего изложения и прилагаемых чертежей специалисту в данной области становятся очевидными различные модификации изобретения наряду с продемонстрированными или описанными здесь. Такие модификации также включены в объем приложенной формулы изобретения.

Описанное изобретение проиллюстрировано примерами, которыми, однако, оно не ограничивается.

Синтез соединений по изобретению

Новые производные формулы (I) можно легко получить из доступных исходных реагентов, используя следующие общие способы. Следует иметь в виду, что там, где приводятся типичные или предпочтительные экспериментальные условия (например, температура реакции, время, количество молей реагентов, растворители и т.др.), можно подобрать и другие условия, если обратное особо не оговаривается. Оптимальные условия реакции варьируются в зависимости от конкретных реагентов или растворителей, эти условия может определять специалист в данной области, используя рутинные способы оптимизации.

Общий синтетический подход к получению соединений формулы (I) приводится ниже на схеме 1. Пиразолопиридиновые производные формулы (I), в которой заместители R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R17, R18, X и n определены выше, можно получить в четыре или пять этапов из коммерческих или синтезируемых на заказ замещенных производных гидразина формулы (VIII), производных ацетондикарбоновой кислоты формулы (IX), производных первичных аминов формулы (IV), и триалкилортоэфиров формулы (VI); синтез показан ниже на схеме 1. При более специфическом способе производное гидразина формулы (VIII), где R1 определен выше, вступает в реакцию с производным ацетондикарбоновой кислоты формулы (IX), в которой R3 и R15 определены выше. В результате реакции, которая протекает в нейтральных условиях при кипячении с обратным холодильником в подходящем растворителе, таком как бензол, толуол и другие нереакционноспособные растворители, из соединений формулы (VIII) через промежуток времени, зависящий от химической активности соединений формулы (VIII), образуются 2-гидроксилпиразоловые производные формулы (VII), замещенные в 4-м положении.

Схема 1

Интермедиаты формулы (VII) далее взаимодействовали с триалкилортоэфиром формулы (VI), в которой R4, R5 и R16 определены выше. Реакция протекает в присутствие уксусной кислоты при кипячении с обратным холодильником и приводит к образованию промежуточного продукта формулы (V). Промежуточные продукты формулы (V) затем обрабатывали производными первичных аминов формулы (IV), в которой R6, R7, R8, R9, R10, R11, Х и n определены выше, в растворителе, таком как ацетонитрил, при температуре от ниже 0°С до комнатной и получали промежуточные соединения формулы (III). Промежуточные соединения формулы (III) обычно не выделяют, и они при тех же условиях реакции или иногда при нагревании спонтанно образуют in situ промежуточный продукт формулы (II), в которой R1, R3, R4, R5, R6, R7, R8, R9, R10, R11, R15, X и n определены выше.

Пиразолопроизводные формулы (Ia), то есть формулы (I), в которой R2 является водородом, после циклизации промежуточных соединений формулы (II) выделяли предпочтительно в кислотном растворителе в присутствие основания, такого как метанолат натрия, изопропанолат натрия или другие подобные вещества, при обычном кипячении с обратным холодильником, хорошо знакомом специалистам в данной области техники (см. схему 1). Эта реакция может происходить в метаноле, этаноле, изопропаноле или других нереакционноспособных растворителях при комнатной температуре в течение промежутка времени, зависящего от химической активности соединений формулы (II), но обычно реакция требует нагрева традиционным способом или с помощью микроволновой технологии, при стандартных условиях, хорошо известных специалистам в данной области (см. выше схему 1).

На следующем этапе пиразолопиридиновые производные формулы (Ia) обрабатывали алкилирующим веществом, имеющим формулу R2W, таким как алкилхлориды, бромиды, йодиды или мезилаты; в этой формуле R2 и W определены так же, как ранее. Обработку осуществляли в присутствие подходящего основания, например триэтиламина, гидрида натрия или карбоната калия в подходящем растворителе, например N,N-диметилформамиде или тетрагидрофуране, при нагревании традиционным способом или с помощью микроволновой технологии. В альтернативном варианте пиразолопиридиновые производные формулы (Ia) (R2 определен, как ранее) обрабатывали ангидридами, ацилхлоридами или карбоновыми кислотами в присутствие связующего вещества, например N,N-дициклогексилкарбодиимида, в присутствие подходящего основания (например, триэтиламина) в подходящем растворителе (например, N,N-диметилформамиде или тетрагидрофуране, дихлорметане) при нагревании традиционным способом или с помощью микроволновой технологии. По этой методике пиразолопиридиновые производные формулы (Ib) получают и выделяют в стандартных условиях, хорошо знакомых специалистам в данной области техники (см. схему 2).

Схема 2

На следующем этапе пиразолопиридиновые производные формулы (Ia) или (Ib) обрабатывали окислителем, таким как m-хлорпербензойная кислота или кислород, в присутствие мезо-тетрафенилпорфина при нагревании традиционным или фотохимическим способом. Эта реакция может протекать в растворителях, таких как тетрагидрофуран или дихлорметан или другие нереакционноспособные растворители, при комнатной температуре и длиться в зависимости от химической активности соединений формулы (Ia) или (Ib). После такой обработки пиразолопиридиновые производные формулы (Ic) или (Id) выделяли в стандартных условиях, которые хорошо знакомы специалистам в данной области техники (см. схему 2).

Производные первичных аминов формулы (IV'), в которой Х является NCHR17R18, а заместители R6, R7, R8, R9, R10, R11, R17, R18 и n определены выше, можно получить из промежуточных продуктов формулы (XI) или (X) в один или два этапа из коммерческих или синтезируемых на заказ производных замещенных аминов формулы (X) и из производных альдегида или кетона формулы (XII) в реакции синтеза, показанной ниже на схеме 3.

Схема 3

В более конкретном способе производное замещенного амина формулы (X), в которой R6, R7, R8, R9, R10, R11 и n определены выше, вступало в реакцию в присутствие восстанавливающего вещества, такого как орогидрат натрия, с производным альдегида или кетона формулы (XII), в которой R17, R18 определены выше, в подходящем растворителе, таком как дихлорэтан, дихлорметан и метанол или другой нереакционноспособный растворитель (длительность реакции зависела от химической активности соединений формулы (XII)), образуя производные аминов формулы (XI) или (IV), то есть формулы (IV), в которой Х является NCHR17R18. Промежуточные продукты формулы (XI) подвергали дальнейшей обработке хлористоводородной кислотой в подходящем растворителе, таком как диоксан, и получали производные первичного амина формулы (IV'), в которой R6, R7, R8, R9, R10, R11, R17, R18 и n определены выше, в стандартных условиях, хорошо известных специалистам в данной области техники (см. схему 3).

Расшифровка сокращений, которые использованы в последующем изложении:

Ǻ (ангстрем), Ac2O (уксусный ангидрид), экв. (эквивалент), мин (минута), ч (час), г (грамм), МГц (мегагерц), мл (миллилитр), мм (миллиметр), ммоль (миллимоль), мМ (миллимоль/литр), нг (нанограмм), нм (нанометр), α-SMA (α-актин гладких мышц), BLM (блеомицин), BSA (альбумин бычьей сыворотки), DCE (дихлорэтан), DCF (2,7-дихлордигидрофлуоресцеин), DCM (дихлорметан), DEPC (диэтилпирокарбонат), DIPEA (диизопропилэтиламин), ДМСО (диметилсульфоксид), DMF (N,N-диметилформамид), DAPI (4,6-диамидино-2-фенилиндол), DPI (дифенилйодоний), сНех (циклогексан), ЭДТА (этилендиаминтетраацетат), EGF (эпидермальный фактор роста), EtOAc (этилацетат), ФХ (флэш-хроматография на силикагеле), GAPDH (глицеральдегид-3-фосфатдегидрогеназа), HBSS (буферный солевой раствор Хэнка), ВЭЖХ (высокоэффективная жидкостная хроматография), H2DCF-DA (2',7'-дихлордигидрофлуоресцеина диацетат), MEM (2-метоксиэтоксиметил), MS (масс-спектрометрия), MOPS (3-(N-морфолино)пропансульфоновая кислота), NaBH4 (натрия борогидрид), НАДФН (восстановленная форма никотинамидадениндинуклеотид фосфата), NBT (нитросиний тетразолий), ЯМР (ядерно-магнитный резонанс), PBS (фосфатный буферный раствор), АФК (активные формы кислорода), RIPA (радиоиммунопреципитационный буфер), SDS (натрия додецилсульфат), SOD (супероксиддисмутаза), SPA (сцинтилляционный анализ), tBuOK (калия трет-бутоксид), TEA (триэтиламин), TFA (трифторуксусная кислота), TGF-β (трансформирующий фактор роста β), THF (тетрагидрофуран), ТСХ (тонкослойная хроматография), TRIS (трисгидроксиметиламинометан), УФ (ультрафиолет).

Если описанные выше способы невозможно применить для получения соединений формулы (I) и/или промежуточных продуктов, необходимых для синтеза соединений формулы (I), следует воспользоваться подходящими способами их получения, известными специалистам в данной области техники. В целом, пути синтеза отдельных соединений формулы (I) будут зависеть от конкретных заместителей для каждого соединения и от того, имеются ли необходимые для получения этих соединений промежуточные продукты; и в этом случае оценить и учесть эти факторы должен специалист в данной области техники. Информация о способах защиты и снятия защиты изложена в следующих источниках: Philip J.Kocienski, in "Protecting Groups", Georg Thieme Verlag Stuttgart, 2005 и Theodora W.Greene and Peter G.M.Wuts in "Protective Groups in Organic Synthesis ", Wiley Interscience, 4th Edition 2006.

Соединения по изобретению можно выделить вместе с молекулами растворителя путем кристаллизации при выпаривании соответствующего растворителя. Фармацевтически приемлемые соли присоединения кислот к соединениям формулы (I), содержащим основный центр, можно получить обычными способами. Например, раствор свободного основания можно обработать подходящей кислотой в «чистом» виде или в подходящем растворе, и образующуюся соль можно выделить фильтрацией или выпариванием раствора, в котором произошла реакция, в вакууме. Фармацевтически приемлемые соли присоединения основания можно получить аналогичным способом, обрабатывая раствор соединений формулы (I) подходящим основанием. Оба типа солей можно получить или перевести один тип в другой, используя ионообменные смолы.

Далее настоящее изобретение проиллюстрировано несколькими примерами, которыми, однако, данное изобретение не ограничивается.

ВЭЖХ, ЯМР и MS, результаты которых приводятся в примерах, были выполнены при следующих условиях: ВЭЖХ - колонка С8 Waters Symmetry длиной 50×4,6 мм, MeCN/H2O от 5 до 100% (время анализа 8 мин), максимум поглощения 230-400 нм; MS - масс-спектрометр PE-SCIEX API 150 EX (источники ионизации APCI и ESI); жидкостная хроматография/масс-спектрометрия - масс-детектор Waters ZMD (ES); 1Н-ЯМР - спектрометр Bruker DPX-300 MHz.

Очистку препаративной ВЭЖХ осуществляли с использованием HPLC Waters Prep LC 4000, оборудованной колонками PrepNova-Pak®HR C186 мкм 60 Ǻ, 40×30 мм (до 100 мг) или XTerra®Prep MS С8, 10 мкм 50×300 мм (до 1 г). Все очистки осуществляли с градиентом MeCN/Н2О 0,09% TFA; УФ-детекцию выполняли при длине волны 254 нм и 220 нм; поток 20 мл/мин (до 50 мг). Анализ ТСХ выполняли на планшетах Merck Precoated 60 F254. Очистку флэш-хроматографией выполняли на подложке SiO2, используя в качестве элюентов смеси циклогексан/EtOAc или DCM/MeOH.

Пример 1: Получение 2-(2-хлорфенил)-10-(пиридин-2-илметил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4',3':3,4]пиридо[1,2-a][1,4]диазепин-1,5(7H)-диона (1)

(Соединение 1a на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и пиридин-2-карбальдегида получают указанное в заголовке соединение (1), выделенное виде желтоватого твердого вещества (выход 32%, степень чистоты ВЭЖХ 97%). MS(ESI+): 422.9.

Пример 2: Получение 10-бензил-2-(2-метоксифенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион (2) (Соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием метоксифенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и бензальдегида получают указанное в заголовке соединение (2), выделенное в виде желтоватого твердого вещества (выход 32%, степень чистоты ВЭЖХ 94%). MS(ESI+): 417.7.

Пример 3: Получение 10-бензил-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-диона (3) (соединение Ia на схеме 1)

а) метил[1-(2-хлорфенил)-5-гидрокси-1Н-пиразол-3-ил]ацетат (соединение формулы (VII) на схеме 1)

К суспензии 2-хлорфенилгидразина (1,82 г, 10,16 ммоль, 1 экв.) в безводном толуоле (50 мл) последовательно добавляли диизопропилэтиламин (2,1 мл, 12,19 ммоль, 1,2 экв.) и диметил-3-оксопентандиоат (1,77 г, 10,16 ммоль, 1 экв.). Образовавшуюся смесь нагревали при температуре 130-140°С с помощью аппарата Дина-Старка (некоторое количество влажного толуола при этом отгонялось). Через 2 ч образовывался чистый промежуточный продукт (гидразон). Затем дополнительно добавляли диизопропилэтиламин (2,1 мл, 12,19 ммоль, 1,2 экв.) и образовавшуюся смесь нагревали при температуре 140°С в течение 46 ч с помощью аппарата Дина-Старка. Большую часть остающегося гидразона можно удалить отмыванием сырой смеси с толуолом. Образующееся коричневое масло очищали флэш-хроматографией на силикагеле. Получали 1,65 г чистого метил[1-(2-хлорфенил)-5-гидрокси-1Н-пиразол-3-ил]ацетата в виде твердого желтоватого вещества. Выход реакции равен 61%. MS(ESI+): 267,8; MS(ESI-): 265,6.

b) метил[4-хлорацетил]-1-(2-хлорфеиил)-5-гидрокси-1Н-пиразол-3-ил]ацетат (соединение формулы (V) на схеме 1)

Из полученной ранее смеси метил [1-(-хлорфенил)-5-гидрокси-1Н-пиразол-3-ил]ацетата (соединение формулы (IV), 0,60 г) готовили суспензию в ацетонитриле (5 мл) и ледяной уксусной кислоте (14 мг, 0,1 экв.) и 2-хлор-1,1,1-этоксиэтане (1,5 г) в атмосфере азота и ее нагревали при 70°С в течение 45-60 мин. Образующийся красный раствор концентрировали в вакууме с получением красного сиропа, который отмывали циклогексаном и высушивали в вакууме. Из-за относительной нестабильности метил[4-(хлорацетил)-1-(2-хлорфенил)-5-гидрокси-1Н-пиразол-3-ил]ацетат дальнейшей очистке не подвергали (количественный выход 0,77 г). MS(ESI+): 344,3; MS(ESI-): 342,2.

с) метил[(4Z)-4-(4-бензил-1,4-диазепан-2-илиден)-1-(2-хлорфенил)-5-оксо-4,5-дигидро-1H-пиразол-3-ил]ацетат (соединение формулы (II) на схеме 1)

К раствору полученного ранее метил[4-(хлорацетил)-1-(2-хлорфенил)-5-гидрокси-1H-пиразол-3-ил]ацетата (соединение формулы (V), 1,88 ммоль, 1 экв.), растворенного в 3 мл ацетонитрила, медленно добавляли при 0°С N-бензилпропан-1,3-диамин (0,277 мг, 0,9 экв.). Реакционную смесь перемешивали при 0°С в течение 0,5 ч. Образовавшийся раствор очищали на слое из силикагеля, используя этилацетат/0,1% триэтиламин. Растворитель выпаривали в вакууме, и оставалось красное твердое вещество, представлявшее собой чистый метил[(4Z)-4-(4-бензил-1,4-диазепан-2-илиден)-1-(2-хлорфенил)-5-оксо-4,5-дигидро-1Н-пиразол-3-ил]ацетат (0,530 г). Выход продукта 71%. MS(ESI+): 454,0.

d) 10-бензил-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион (соединение формулы (Ia) на схеме 1)

Изопропаноловый раствор MeONa, полученный путем растворения натрия (0,055 г, 2,4 ммоль, 2 экв.) в МеОН (3 мл) в атмосфере азота, обрабатывали метил [(4Z)-4-(4-бензил-1,4-диазепан-2-илиден)-1-(2-хлорфенил)-5-оксо-4,5-дигидро-1Н-пиразол-3-ил]ацетатом (соединение формулы (II), 530 мг, 1,2 ммоль, 1 экв.). Реакционную смесь перемешивали при комнатной температуре в течение 0,5 ч, затем охлаждали, разбавляли водой (8 мл) и нейтрализовали до рН 6 добавлением 1 М раствора HCl. Осадок отфильтровывали и высушивали в вакууме. В результате очистки неочищенного вещества флэш-хроматографией получали 129 мг чистого продукта 10-бензил-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-диона. Выход продукта составил 26%.

Н-ЯМР (500 МГц, ДМСО-д6): 1,62-1,68 (м, 2Н); 2,83 (т, 2Н, J=7,5 Гц); 3,62-3,66 (м, 2Н); 4,40-4,76 (м, 2Н); 5,73 (с, 1Н); 7,21-7,32 (м, 5Н); 7,44-7,50 (м, 2Н); 7,55-7,60 (м, 1Н); 7,61-7,67 (м, 1Н); 10,75-10,68 (ушир.с, 1Н). MS(ESI+): 421,9.

Пример 4: Образование 10-(2-хлорбензил)-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-диона (4) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и 2-хлорбензальдегида получали указанное в заголовке соединение (4), выделенное в виде желтоватого твердого вещества (выход 28%, степень чистоты ВЭЖХ 98%). MS(ESI+): 456,3.

Пример 5: Получение 2-(2-хлорфенил)-10-(3-метоксибензил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-диона (5) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и 3-метоксибензальдегида получали указанное в заголовке соединение (5), выделенное в виде желтоватого твердого вещества (выход 35%, степень чистоты ВЭЖХ 95%). MS(ESI+): 451,9.

Пример 6: Получение 10-(3-хлорбензил)-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-диона (6) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и 3-хлорбензальдегида получали указанное в заголовке соединение (6), выделенное в виде желтоватого твердого вещества (выход 32%, степень чистоты ВЭЖХ 98%). MS(ESI+): 456,4;

Пример 7: Получение 2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-диона (7) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина получали указанное в заголовке соединение (7), выделенное в виде желтоватого твердого вещества (выход 28%, степень чистоты ВЭЖХ 98%). MS(ESI+): 331,9.

Пример 8: Получение трет-бутил 2-(2-хлорфенил)-1,5-диоксо-2,3,5,8,9,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-10(7Н)-карбоксилата (8) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и ди-трет-бутил-карбоната получали указанное в заголовке соединение (8), выделенное выделяли в виде желтоватого твердого вещества (выход 36%, степень чистоты ВЭЖХ 97%). MS(ESI+): 431,9

Пример 9: Получение 10-(4-хлорбензил)-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-диона (9) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и 4-хлорбензальдегида получали указанное в заголовке соединение (9), выделенное в виде желтоватого твердого вещества (выход 30%, степень чистоты ВЭЖХ 98%). MS(ESI+): 456,4.

Пример 10: Получение 2-(2-хлорфенил)-10-(метоксибензил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-диона (10) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и 2-метоксибензальдегида получали указанное в заголовке соединение (10), выделенное в виде желтоватого твердого вещества (выход 33%, степень чистоты ВЭЖХ 94%). MS(ESI+): 451,9.

Пример 11: Получение 2-(2-хлорфенил)-10-(4-метоксибензил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-диона (11) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и 4-метоксибензальдегида получали указанное в заголовке соединение (11), выделенное в виде желтоватого твердого вещества (выход 32%, степень чистоты ВЭЖХ 96%). MS(ESI+): 451,9.

Пример 12: Получение 2-(2-хлорфенил)-10-(фуран-3-илметил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а]диазепин-1,5(7Н)-диона (12) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и фуран-3-карбальдегида получали указанное в заголовке соединение (12), выделенное в виде желтоватого твердого вещества (выход 32%, степень чистоты ВЭЖХ 95%). MS(ESI+): 411,9.

Пример 13: Получение 9-бензил-2-(2-хлорфенил)-2,3,7,8,9,10-гексагидропиразоло[4',3':3,4]пиридо[1,2-а]пиразин-1,5-диона (13) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, N-бензилэтан-1,2-диамина получали указанное в заголовке соединение (13), выделенное в виде желтоватого твердого вещества (выход 18%, степень чистоты ВЭЖХ 90%). MS(ESI+): 408,0.

Пример 14: Получение 2-(2-хлорфенил)-2,3,7,8-тетрагидро-1Н-пиразоло[4',3':3,4]пиридо[2,1-с][1,4]оксазин-1,5(10Н)-диона (14) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана и 2-аминоэтанола получали указанное в заголовке соединение (14), выделенное в виде желтоватого твердого вещества (выход 35%, степень чистоты ВЭЖХ 91%). MS(ESI): 318,8.

Пример 15: Получение 2-(2-метоксифенил)-10-(пиридин-2-илметил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5-диона (15) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-метоксифенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и пиридин-2-карбальдегида получали указанное в заголовке соединение (15), выделенное в виде желтоватого твердого вещества (выход 30%, степень чистоты ВЭЖХ 94%). MS(ESI): 418,6.

Пример 16: Получение 10-(3-метоксибензил)-2-(2-метоксифенил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-диона (16) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-метоксифенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и 3-метоксибензальдегида получали указанное в заголовке соединение (16), выделенное в виде желтоватого твердого вещества (выход 33%, степень чистоты ВЭЖХ 97%). MS(ESI): 447,6.

Пример 17: Получение 2-(2-хлорфенил)-10-[(1-метил-1Н-пиразол-3-ил)метил]-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-диона (17) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и 1-метил-1H-пиразол-3-карбальдегида получали указанное в заголовке соединение (17), выделенное в виде желтоватого твердого вещества (выход 29%, степень чистоты ВЭЖХ 93%). MS(ESI): 425,9.

Пример 18: Получение 2-(2-хлорфенил)-10-(пиридин-3-илметил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4',3':3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-диона (18) (соединение Ia на схеме 1)

Следуя методике, описанной в примере 3, с использованием 2-хлорфенилгидразина, диметил-3-оксопентандиоата, 2-хлор-1,1,1-триэтоксиэтана, 3-пропан-1,3-диамина и пиридин-3-карбальдегида получали указанное в заголовке соединение (18), выделенное в виде желтоватого твердого вещества (выход 30%, степень чистоты ВЭЖХ 98%). MS(ESI+): 422,9.

Пример 19: Определение содержания активных форм кислорода в различных клеточных культурах

Соединения по изобретению могут быть протестированы на предмет их способности подавлять или уменьшать образование активных форм кислорода (АФК) из кислорода, содержащегося в клетках (активность). Активность соединений была определена на следующих культурах клеток с помощью различных методик, таких как методика с тетразолием нитросиним, красителем AmplexRed, Хемилюминесценция (Люминол) и методика с 2',7'-дихлордигидрофлюоресцеиндиацетат (H2DCF-DA) в соответствии с приведенными ниже протоколами.

Микроглиальная клеточная линия человека

Микроглиальную клеточную линию человека (НМС3, human microglia clone 3, то есть микроглиальный клон 3) (Janabietal., 1995, Neurosci. Lett. 195:105) культивировали на минимальной поддерживающей среде Игла (MEM), содержащей 10% фетальной сыворотки с 50 ЕД/мл натриевой соли пенициллина G, 50 мкг/мл сульфата стрептомицина, и инкубировали при температуре 37°С в течение 24 ч. Перед детекцией О2- в культуральную среду добавляли человеческий интерферон γ (IFNγ человека Roche. 11040596001) в конечной концентрации 10 нг/мл на 24 ч.

Эндотелиальные клетки пуповинной вены человека (HUVEC)

Эндотелиальные клетки пуповинной вены человека культивируют в базальной среде для эндотелиальных клеток, в которую добавляют гидрокортизон (1 мкг/мл, CalbioChem), экстракт бычьего мозга (12 мкг/мл), гентамицин (50 мкг/мл, CalbioChem), амфотерицин В (50 нг/мл, CalbioChem), EGF (10 нг/мл) и 10% фетальную телячью сыворотку до четвертого пассажа. С начала пятого пассажа клетки культивировали в среде с меньшей концентрацией фетальной телячьей сыворотки (2%) без добавления EGF, если обратное не оговорено особо. Все эксперименты проведены на клетках пятого пассажа. Перед тем как исследовать образование O2-, клетки для контроля инкубировали в течение 24 ч с OxLDL (окисленные липопротеины низкой плотности) или их буфером.

Клетки HL-60

Линию HL-60 клеток острого миелоидного лейкоза человека культивировали на среде RPMI 1640 (Invitrogen), в которую добавляли инактивированную нагреванием телячью сыворотку (10%), 2 мМ глутамин, пинициллин (Сигма) 100 ЕД/мл и 100 мкг стрептомицин (Сигма) при 37°С в увлажненной атмосфере 5% CO2. Чтобы вызвать дифференцировку клеток HL-60 и превращение их в клетки с нейтрофильным фенотипом в культуральную среду добавляли Me2SO (конечная концентрация 1,25% об./об. в течение 6 дней).

1. Нитросипий тетразолий (NBT)

Концентрацию внутриклеточного и внеклеточного супероксида измеряли колориметрическим способом путем исследования с нитросиним тетразолием (NBT). Превращение NBT в формазан, нежно-голубой осадок, ингибируемое SOD в присутствие аниона супероксида, определяли с помощью спектрометра FluostarOptima (BMGlabtech). После инкубации с соответствующими стимуляторами клетки обрабатывали трипсином (1×трипсин-ЭДТА), собирали центрифугированием и отмывали PBS от культуральной среды. 5×105 клеток высеивали в 48-луночный планшет и инкубировали в сбалансированном растворе Хэнка, содержащем 0,5 мг/мл NTB с 800 ЕД/мл SOD или без SOD в присутствие или отсутствие соединений по изобретению. В качестве контроля использовали раствор, в который добавляли DPI в конечной концентрации 10 мкмоль. Через 2,5 ч клетки фиксировали и отмывали метанолом для удаления невосстановленного NBT. Восстановленный формазан затем растворяли в 230 мкм 2 М раствора гидроксида калия и 280 мкл диметилсульфоксида. Поглощение исследовали при длине волне 630 нм. Для расчетов поглощение при длине волны 630 нм нормировалось для каждой лунки планшета. Для каждого момента времени среднее значение четырех холостых проб вычитали из каждого откорректированного значения. Активность НАДФН-оксидазы выражали в процентах от ее активности в контрольных клетках. Остаточная активность НАДФН-оксидазы в клетках, обработанных DPI, обычно была меньше 10%.

2. Краситель AmplexRed

Концентрацию внеклеточной перекиси водорода определяли с использованием красителя Amplex UltraRed (Molecular Probes). Клетки обрабатывали трипсином (1×трипсин-ЭДТА), собирали центрифугированием и готовили взвесь в сбалансированном солевом растворе Хэнка, в котором содержался 1% глюкозы. Клетки высеивали в 96-луночный планшет при плотности 50000 клеток на 200 мкл тестирующего буферного раствора (сбалансированный солевой раствор Хэнка, содержащий 1% глюкозы, 0,005 ЕД/мл пероксидазы хрена (Roche) и 50 мкмоль красителя AmplexRed) в присутствие или отсутствие соединений по изобретению. В контрольные взвеси клеток добавляли еще и DPI в конечной концентрации 10 мкмоль. Планшеты помещали в спектрофотометр Optima Fluorescent и выдерживали при температуре 37°С в течение 20 мин. Флюоресценцию измеряли ежечасно по 15 мин при длине волны возбуждения и эмиссии 544 нм и 590 нм соответственно. Активность НАДФН-оксидазы выражали в процентах к активности контрольной взвеси клеток. Остаточная активность клеточной взвеси, обработанной DPI, обычно была менее 10%.

В приведенной ниже таблице 1 показана степень ингибирования активности НАДФН-оксидазы в процентах, определенная на лейкозных клетках линии HL60 с помощью методики с использованием красителя AmplexRed, описанной выше, при стимулировании их дифференцировки ДМСО:

Таблица 1
Соединение № Ингибирование (%)
(1) 86
(2) 81
(5) 80
(7) 86
(8) 85
(12) 77
(13) 81
(14) 83
(15) 87

В таблице 2 приведены значения IC50 (для ингибирования НАДФН-оксидазы), измеренной с помощью методики с использованием красителя AmplexRed на лейкозных клетках линии HL60, стимулированных к дифференцировке с помощью ДМСО.

Таблица 2
Соединение № IC50 (мкмоль)
(1) <5
(2) <5
(5) <5
(7) <5
(8) <5
(12) <5

3. Хемилюминесценция (Люминол)

Активные формы кислорода (АФК) определяли с помощью люминесцентной пробы с люминолом. Клетки культивировали и высеивали на планшет, как при исследовании с использованием красителя AmplexRed, но при этом вместо красителя AmplexRed использовали люминол (Sigma 09235). Эмиссию излучения регистрировали непрерывно при температуре 37°С в течение 60 мин, используя люминесцентную функцию флюоресцентного спектрофотометра для прочтения планшетов FluoStar Optima. Среднее значение четырех холостых проб вычитали из каждого откорректированного значения для каждого момента времени. Активность НАДФН-оксидазы выражали в процентах от ее активности в контрольной взвеси клеток. Остаточная активность НАДФН-оксидазы в клетках, обработанных DPI, обычно была меньше 10%.

4. 2',7'-дихлордигидрофлюоресцеиндиацетат (H2DCF-DA)

HUVEC высевали на покровные стекла и оставляли на ночь в 0,5% альбумине бычьей сыворотки, перед тем как стимулировать их TGF-β. Клетки нагружали в течение 10 мин 5 мкмоль хлорметильного производного CM-H2DCFDA в среде, не содержащей фенолового красного, в темноте и затем обрабатывали TGF-β (R&DSystems) в присутствие или в отсутствие соединений по изобретению. Клетки затем фиксировали и после окраски ядер DAPI исследовали с помощью иммунофлюоресцентной микроскопии или же клетки исследовали живыми с помощью конфокальной микроскопии. DCF-флюоресценцию наблюдали при длине волны возбуждения 488 нм, эмиссии - от 515 до 540 нм. Во избежание фотоокисления индикаторной краски изображения «собирали» однократным быстрым сканированием при одних и тех же параметрах для всех проб. Для расчетов для каждой отдельной лунки поглощение при длине волны 540 нм нормировали на поглощение при 540 нм. Среднее значение для четырех холостых проб вычитали из откорректированного значения для каждого момента времени. Активность НАДФН-оксидазы выражали в процентах то ее активности в клетках контрольных проб. Остаточная активность клеток, обработанных DPI, была менее 10%.

Пример 20; Измерение артериального давления у крыс гипертензивной линии (SHR - спонтанно гипертензивные крысы)

Чтобы проверить, способны ли соединения по изобретению снижать артериальное давление при гипертензии, проведено следующее исследование.

Для исследования брали крыс SHR в возрасте 11 нед с артериальным давлением более 170 мм рт.ст. Соединения по изобретению вводили внутрь в дозе около 3, 10, 30 и 100 мг на кг массы тела, в период суток от 10:00 ч до 12:00 ч. Осуществляли мониторинг среднего, систолического и диастолического давления и частоты сердечных сокращений, измеряя эти параметры через 2, 4, 6, 8 и 24 ч после первого введения соединения по изобретению, чтобы проследить кинетику за сутки. После этого мониторинг артериального давления осуществляли раз в два дня в течение двух недель, утром в то же время, когда вводили соединение, и через время равное периоду полувыведения соединения.

После последнего введения артериальное давление измеряли в течение 24 ч. Животных контролировали еще в течение недели без лечения, чтобы выяснить, как сказывается на животных отмена соединения. Животным вводили соединение раз в сутки в течение двух недель с помощью специальной канюли, рассчитанной на то, чтобы из нее вытекало раствора в количестве 5 мл/кг. Перед тем как использовать животных, выжидали двое суток, чтобы они акклиматизировались, и далее тренировали их еще в течение одной недели. Артериальное давление измеряли на бодрствующих животных с помощью манжетки, накладываемой на хвост (манжетная плетизмография) (Codas 6, Kent). После тренировки в течение нескольких дней животных, если вариабельность систолического давления была ≤40 мм рт.ст., то есть ±20 мм рт.ст., распределяли по нескольким группам. Исходное (базальное) артериальное давление измеряли в течение по меньшей мере двух дней перед началом эксперимента. Животных рандомизировали, чтобы группы были однородными.

Пример 21: Блеомициновое повреждение легких у мышей

Чтобы выяснить, можно ли с помощью соединений по изобретению предупредить или лечить респираторные расстройства или заболевания, проведено следующее исследование.

Поражение легких, сравнимое с респираторными расстройствами или заболеваниями, такими как идиопатический легочный фиброз, вызывали эндотрахеальным введением однократной сублетальной дозы блеомицина (BLM) (0,0125МЕ в 40 мкл 0,9% раствора хлорида натрия на 1 мышь). Протокол исследования животных контрольной группы был таким же, но в трахею им вместо BLM вводили физиологический раствор. Инсталляцию раствора в трахею выполняли под общей анестезией кетамином (80 мг на кг массы тела внутрибрюшинно) и ксилазином (20 мг на кг массы тела внутрибрюшинно). Через 5 дней после эндотрахеального введения BLM или физиологического раствора животных умерщвляли инъекцией летальной дозы пентобарбитала с последующим кровопусканием из брюшной аорты. Легкие взвешивали и обрабатывали отдельно для биохимического (по 10 животных в группе) и гистологического (по 5 животных в группе) исследований, как показано далее. Животных произвольно делили на четыре группы: контрольную группу, получившую физиологический раствор (n=8) и контрольную группу, получившую физиологический раствор с BLM (n=15); опытную группу, получившую BLM и дозу 1 соединения по изобретению (n=15) и опытную группу, получившую BLM и дозу 2 соединения по изобретению (N=15). Лечебный раствор или соединения вводили в течение 5 нед.

Мышей лечили ежедневным введением соединения по изобретению или, если это была контрольная группа, - введением физиологического раствора начиная с 0-го дня в течение 5 нед в профилактической модели и начиная с 10-го дня до 5 недель для лечебной модели. С помощью коммерческого набора Sircol assay определяли содержание в легком кислоторастворимого коллагена.

Профилактическая модель

В целом, придерживались протокола исследований, описанного выше. В 0-й день животным интратрахеально вводили 0,0125 ME BLM (20 мкл), чтобы вызвать поражение легких. Также группе животных в профилактической модели перорально вводили соединение по изобретению 1 раз в день в течение 5 нед, начиная с 0-го дня. Животных произвольно делили на четыре группы: контрольную группу, которой вводили физиологический раствор (n=11), контрольную группу, которой вводили физиологический раствор и BLM (n=12), опытную группу, которой внутрь вводили соединение 3 по изобретению в дозе 40 мг на кг массы тела и BLM (n=12) и группу, которой вводили пирфенидон (AQCHEM, ссылка Р1002) (антифибротический препарат, который известен своей активностью при многих фиброзных заболеваниях, включая фиброзные заболевания легких, почек и печени) в дозе 100 мг на кг массы тела перорально и BLM (n=12). Через 35 дней после эндотрахеального введения BLM или физиологического раствора животных умерщвляли и их легкие исследовали, как описано выше, с помощью набора SIRCOL assay (TebuBio, ref S1000) для количественного определения отложения коллагена в них и оценки воспалительного процесса. Соединение 3 в дозе 40 мг на кг массы тела подавляло отложение коллагена на 46% по сравнению с животными контрольной группы, которым вводили BLM; степень подавления была сравнима с той, которая была достигнута при лечении пирфенидоном в дозе 100 мг на кг массы тела (45%).

Лечебная модель

В целом, придерживались протокола исследований, описанного выше. В 0-й день животным вводили интратрахеально 0,0125 ME BLM (40 мкл), чтобы вызвать поражение легких. Группе животных при исследовании на лечебной модели перорально вводили соединение по изобретению один раз в день в течение 3,5 нед до 35-го дня начиная с 10-го дня. Животных произвольно делили на шесть групп: контрольную группу, которой вводили физиологический раствор (n=8), две контрольные группы, которым вводили физиологический раствор + BLM (n=13), группу, которой вводили перорально соединение 3 по изобретению в дозе 40 мг на кг массы тела + BLM (n=13), группу, которой вводили перорально соединение 3 по изобретению в дозе 10 мг на кг массы тела + BLM (n=13) и группу, которой вводили перорально пирфенидон (AQCHEM, ref P1002) в дозе 100 мг на кг массы тела + BLM (n=13). В одной контрольной группе, которой вводили BLM, животных умерщвляли на 10-й день и определяли содержание коллагена. В других группах через 35 дней после эндотрахеального введения BLM или физиологического раствора животных умерщвляли и их легкие исследовали, как описано выше, для количественного определения отложения коллагена в них и оценки воспалительного процесса, как описано выше. Соединение 3 в дозе 40 мг на кг массы тела и 10 мг на кг массы тела подавляло отложение коллагена, снижало его содержание (52% и 64% соответственно) по сравнению с контрольной группой, которой вводили BLM, что было значительно больше по сравнению с группой, получавшей пирфенидон в дозе 100 мг на кг массы тела (12%).

Таким образом, результаты экспериментов показали, что соединения по изобретению оказывают профилактический и лечебный эффект при респираторных расстройствах и заболеваниях, в частности при фиброзе легких.

Пример 22: Экспериментальные модели рака на животных

Чтобы проверить, можно ли с помощью соединений по изобретению предупредить и лечить рак, в частности уменьшить рост опухоли и/или ангиогенез, проведены следующие исследования.

Исследование ангиогенеза in vivo

Самкам мышей C57BL6/J в возрасте от 7 до 10 нед подкожно вводили 400 мкл фактор роста Matrigel и дополнительно небольшое количество 500 нг/мл ангиогенного фактора (b-FGF или VEGF). Через 1 неделю после трансплантации мышей сканировали с помощью MircroCT (Skyscan). Мышам вводили ретроорбитально радиоактивный индикатор (400 мкл липосом, меченных йодом) для визуальной оценки плотности сосудов. Сканограммы реконструировали с помощью программы Recon и определяли плотность серого в матригелевой бляшке на протяжении всего среза. Соединение по изобретению вводили перорально в подходящих дозах 1 и 2 один раз в день в течение 10 дней. Результаты выражали в плотности серого, которая коррелирует с плотностью сосудов. Матригелевые бляшки замораживают и окрашивают CD31 для визуализации сосудов

Оценка роста опухоли

5×105 клеток раковой опухоли легкого Lewis (LLC1) вводили под кожу спины мышей. Мышей лечили соединением по изобретению, вводя его перорально ежедневно в дозе 40 мг на кг массы тела. Когда контрольная опухоль достигала длины 1 см, животных забивали, опухоль иссекали, взвешивали и замораживали. Для оценки терапевтической эффективности соединения по изобретению мышам вводили клетки LLC1 и, когда опухоль достигала длины 0,5 см, мышам вводили соединение по изобретению и определяли размер опухоли ежедневно. После умерщвления животного опухоль взвешивали, замораживали и готовили из нее срезы, которые окрашивали анти-CD31 антителами и определяли уровень АФК.

Пример 23: Влияние на фибробласты легких (клетки IMR-90)

Чтобы выяснить, можно ли применять соединения по изобретению для профилактики и лечения респираторных расстройств и заболеваний, выполнены следующие исследования.

Экспрессия α-актина гладких мышц (α-SMA)

Активность соединений по изобретению изучена по их влиянию на вызываемую TGF-β дифференцировку фибробластов легких в миофибробласты путем количественной оценки экспрессии α-SMA в клетках IMR-90.

Клетки IMR-90 (АТСС (LGC), ref ATCC-CCL-186) культивировали на минимальной поддерживающей среде Игла (ЕМЕМ), в которую добавлено 10% фетальной телячьей сыворотки, при температуре 37°С в атмосфере, содержащей 5% СО2. При достижении 75-80% конфлюентности клетки пересевали в 6-ячеечные чашки, используя раствор, содержащий трипсин и ЭДТА. Плотность клеток составляла 200000 на 1 ячейку. Клетки культивировали в течение 24 ч на ЕМЕМ, в которую было добавлено 10% фетальной телячьей сыворотки. Затем клетки подвергали голоданию, заменяя среду на ЕМЕМ, не содержащую фетальную телячью сыворотку. Через 24 ч клетки обрабатывали соединением по изобретению (0,1, 1 и 10 мкМ). Через 1 ч клетки экспонировали в течение 48 ч TGF-β (2,5 нг/мл). Маточный раствор соединения по изобретению и TGF-β готовили в ЕМЕМ. Конечная концентрация ДМСО в культуральной среде была 1%. Животным контрольной группы вводили вещество-носитель (ДМСО). В день взятия клеток их промывали ледяным раствором PBS и отделяли с помощью клеточного скребка в 1,1 мл PBS, в который были добавлены ингибиторы протеаз (Complete, Roche). Клетки собирали центрифугированием при 10000×g в течение 10 мин при температуре 4°С. Клеточные комки гомогенизировали в 65 мкл лизирующего RIPA буфера (Sigma) (150 мМ NaCl, 1% IGEPAL® CA-630, 0,5% деоксихолат натрия, 0,1% додецилсульфат натрия, 50 мМ трисбуфер с рН 8,0), в который добавляли ингибиторы протеаз (Complete, Mini Protease Inhibitor Cocktail Tablets, Roche ref 11836153001, список ингибиторов протеаз можно получить от поставщика по заявке) и разрушали непродолжительной обработкой ультразвуком. Лизаты замораживали и хранили при температуре -80°С до момента анализа. Уровень белков определяли с помощью набора Брэдфорда (Sigma, ref B6919), белки растворяли до конечной концентрации 0,25 мкг/мкл в смеси из RIPA буфера и нагрузочного буфера (трис-основание 0,31 М, глицерин 10%, SDS 2%, β-меркаптоэтанол 5%, бромфеноловый синий 0,002%). Пробы нагревали при температуре 95°С в течение 5 мин и белки отделяли с помощью электрофореза на 12% Bis-Tris геле Nu Page в подвижном буфере MOPS (50 мМ MOPS, 50 мМ Трис, 3,5 мМ додецилсульфат натрия, 0,8 мМ ЭДТА) при постоянном напряжении 200 В в течение 60 мин. Белки переносили на 75 мин при постоянном напряжении 35 В на регидрированные нитроцеллюлозные мембраны во влажных условиях, используя гибридизационный буфер (Invitrogen). Мембраны блокировали 5% нежирным сухим молоком в PBS, содержащим 0,05% твин (PBS-Твин). После блокирования мембраны инкубировали в течение ночи с первичными антителами (анти-α-SMA), растворенными в PBS-T и 3% сухом молоке. Раствор анти-α-SMA антител (RnDsystem, MAB1420) готовили в разведении 1:3000. Мембраны ополаскивали в PBS и инкубировали в течение 1 ч с первичными антителами к GAPDH (SantaCruz, sc-47724) в PBS-T и 3% сухом молоке, в разведении 1:3000, чтобы убедиться в выравнивании белковой нагрузки каждой из электрофоретических дорожек. Затем мембраны промывали PBS-T и зондировали козлиными антителами к мышиному IgG, конъюгированными с пероксидазой хрена (1:4000). После третьего промывания мембран приступали к детекции хемилюминесценции блота (ECL; Amersham Biosciences, Buckinghamshire, UK). Авторадиограммы сканировали с помощью анализатора изображений и обрабатывали, используя общедоступную программу ImageJ Национального института здравоохранения (http://rsbweb.nih.gov/ij/; Vittal, 2007, JPET; 321: 35-44). Данные получали с помощью денситометрических устройств и выражены в процентах к денситометрическим уровням, определенным при сканировании контрольных образцов, исследованных визуально на тех же блотах. Интенсивность сигнала от α-SMA сравнивали с интенсивностью сигнала от GAPDH. Данные выражали как среднее ± средняя квадратичная ошибка, сравнительный статистический анализ двух групп выполнен с помощью t-критерия Стьюдента.

Экспрессия белка HSP-47

Активность соединений по изобретению была изучена по их влиянию на индуцируемую TGF-β дифференцировку фибробластов легких человека в миофибробласты на основании количественного анализа экспрессии HSP-47 (белков теплового шока) в клетках IMR-90.

Клетки IMR-90 культивировали, высевали, подвергали голоданию и обрабатывали соединениями по изобретению, как было отмечено выше.

В день забора клетки обрабатывали, как было описано выше. Мембраны после блокирования инкубировали в течение ночи, как было описано выше. Анти-Hsp-47 антитела (Abeam, ab-13510) разводили в соотношении 1:3000. Мембраны затем промывали, как описано выше. Авторадиограммы анализировали, как описано выше. Интенсивность сигнала от Hsp-47 сравнивали с интенсивностью сигнала от GAPDH.

Соединение 3 подавляло биомаркеры дифференцировки в миофибробласты человека (α-SMA) и отложения внеклеточного матрикса (HSP-47) в диапазоне концентрации соответственно 0,1-20 мкМ (от 21 до 51% и от 89 до 77% соответственно). Следовательно, данные результаты убедительно свидетельствуют о влиянии соединения 3 по изобретению на респираторные расстройства или заболевания, в патогенезе которых играет роль фиброз, в частности фиброз легких.

Уровни мРНК Col3a

Активность соединений по изобретению была изучена по их влиянию на индуцируемую TGF-β дифференцировку фибробластов легких человека в миофибробласты на основании количественного анализа уровней мРНК Col3a в клетках IMR-90.

Клетки IMR-90 культивировали, как описано выше. Культуральную среду меняли каждые три дня. При достижении 75-80% конфлюэнтности клетки пассировали с использованием смеси трипсина и ЭДТА. Для предупреждения спонтанной дифференцировки использовали лишь клетки восьмого или более ранних пассажей.

Для выделения РНК клетки IMR-90 пересевали на 6-ячеечные планшеты, плотность клеток была равна 200000 на 1 ячейку. Клетки культивировали в течение 24 ч на обогащенной ЕМЕМ. На следующий день для приостановки роста клеток из среды исключали фетальную телячью сыворотку. К клеткам добавляли соединение по изобретению в конечной концентрации 0,1 и 20 мкМ за 1 ч до добавления в нее TGF-β. Чтобы произошла дифференцировка в миофибробласты клетки IMR-90 инкубировали в течение 24 ч с TGF-β в концентрации 2,5 нг/мл. Маточные растворы соединения по изобретению и TGF-β готовили, как описано выше. Концентрация ДМСО и контрольное исследование были такими же, как описано выше.

Общее количество РНК выделяли с помощью набора Rneasy Mini (Qiagen, ref 74104) в соответствии с инструкциями производителя. Вкратце, этот процесс заключался в том, что лизат клеток гомогенизировали и гомогенат с помощью иглы 20G в присутствие лизирующего буфера RLT из набора Rneasy Mini переносили в колонку дезинтегратора QIA (Qiagen, ref 79654) для завершения гомогенизации. В лизат добавляли этанол, создавая условия, облегчающие избирательное связывание РНК с мембраной RNeasy. Пробу вводили в микроцентрифужную колонку. Вся РНК связывается с мембраной. Остаточную геномную ДНК удаляли путем инкубирования пробы РНК с ДНКазой (Qiagen, ref 79254) в количестве, эквивалентном активности 30 ЕД, в течение 15 мин при комнатной температуре. Контаминанты эффективно удаляли отмыванием в буфере, поставляемом в наборе Rneasy Mini. Образцы РНК добавляли в раствор DEPC в концентрации 100 нг/мкл. Для синтеза кДНК 5000 нг общего количества РНК обрабатывали обратной транскриптазой PrimerScript (Takara, ref DRR027sp) в соответствии с протоколом производителя. Экспрессию COL3a исследовали с помощью количественной ПЦР (ПЦР в реальном времени). Амплификацию проводили в 10 мкл конечной реакционной смеси, содержащей буфер 2Х SYBR Green I Master Mix (Applied Biosystems, ref 4309155), 0,3 мМ каждого конкретного праймера, кДНК матрицу (500 нг общей РНК) и Н2О (стерильная вода, пригодная для ПЦР).

Праймеры, дизайн которых подбирали с помощью компьютерной программы Primer Express® 2.0 (Applied Biosystems), синтезировала компания Invitrogen. Праймеры COL3 человека для ПЦР включали в себя:

- Col3a прямой праймер: 5'TTAAAGGAAAGACACTCCGATCAGAGATGA3'

- Col3a обратный праймер: 5'AATGTTTCCGGAGTAGGGGAGTCTTTTT3'

ПЦР протекала на детекторе ABI prism® 7900 Ht (Applied Biosystems). Программа амплификации включала в себя начальную стадию денатурации при температуре 95° в течение 10 мин и 45 циклов денатурации при температуре 95°С в течение 15 с, отжиг при температуре 60°С в течение 1 мин и достройку праймеров при температуре 72°С в течение 1 мин. Скорость перехода температуры была равна 20°С/с. В конце каждого цикла измеряли флюоресценцию. После амплификации строили кривые плавления для оценки специфичности ПЦР. Анализ образцов РНК при каждом состоянии выполняли трижды.

Уровни транскриптов COL3a нормировали на уровень транскриптов α-субъединицы комплекса фактора элонгации 1 (EEF1A), β-глюкуронидазы (GUSB) и β-микротубулина, используя компьютерную программу geNorm (Yandesompeleetal., 2002, Genome Biol., Jun 18; 3(7)).

Результаты переводили в кратность увеличения уровня транскриптов по сравнению с уровнем их в контрольных образцах и выражали как среднее ± средняя квадратичная ошибка. Статистическое сравнение результатов двух групп осуществляли с помощью t-критерия Стьюдента.

Уровни мРНК PLOD2

Активность соединений по изобретению была изучена по их влиянию на индуцируемую TGF-β дифференцировку фибробластов легких человека в миофибробласты на основании количественного анализа уровней мРНК белка PLOD2 в клетках IMR-90.

Клетки IMR-90 культивировали, как описано выше. Культуральную среду меняли каждые три дня. При достижении 75-80% конфлюэнтности клетки пассировали с использованием смеси трипсина и ЭДТА. Для предупреждения спонтанной дифференцировки использовали лишь клетки восьмого или более ранних пассажей.

Чтобы выделить РНК и синтезировать кДНК путем обратной транскрипции, исследование выполняли по такому же протоколу, как описано выше. Экспрессию PLOD2 анализировали так же, как экспрессию COL3a.

Праймеры PLOD2 человека для ПЦР включали в себя:

- PLOD2 прямой праймер: 5'TGGCTACTTCTCGCTCTGCT33'

- PLOD2 обратный праймер: 5'TTCCTGTTGTGCCAAAATAATAGTG3'

Результаты анализировали так же, как описано выше.

Соединение 3 по изобретению в концентрации 0,1-20 мМ подавляло биомаркеры накопления коллагена (Col3a) и активность фермента, сшивающего коллагеновые волокна (PLOD2) (соответственно от 0% до 57% и от 1% до 36%). Соединение 3 по изобретению подавляло индуцируемое TGF-β увеличение уровня мРНК Col3a и PLOD2 в фибробластах легких (клетки IMR-90). Эти данные говорят о том, что соединение 3 подавляет индуцируемую TGF-β дифференцировку фибробластов в миофибробласты и последующую гиперпродукцию коллагена.

Таким образом, результаты исследований убедительно свидетельствуют о терапевтическом эффекте соединений по изобретению на респираторные расстройства и заболевания, такие, как фиброз легких.

1. Пиразолиндионовое производное формулы (I):

в котором R1 выбран из водорода; возможно замещенного C1-C6алкила; возможно замещенного фенила; возможно замещенного C1-C6алкилфенила; возможно замещенного фенилC1-C6алкила; возможно замещенного пиридила; возможно замещенного C1-C6алкилпиридила; и возможно замещенного пиридилC1-C6алкила; R2 является водородом; R3 является водородом; R4, R5, R6 и R7 являются водородом; R8, R9, R10 и R11 независимо выбраны из атомов водорода и C16алкилов; R12 выбран из водорода; -CHR17R18; возможно замещенного C1-C6алкокси-карбонила, возможно замещенного -C(O)-фенила; возможно замещенного C1-C6алкилфенила; возможно замещенного фенилC1-C6алкила, возможно замещенного C1-C6алкилгетероарила или возможно замещенного гетероарилC1-C6алкила, где гетероарил выбран из пиридила, пирролила, пиримидинила, фурила, имидазолила, оксазолила, изоксазолила, пиразолила, 1,2,3-триазолила, 1,2,4-триазолила, 1,2,3-оксадиазолила, 1,2,4-оксадиазолила, 1,2,5-оксадиазолила, 1,3,4-оксадиазолила, 1,3,4-триазинила и 1,2,3-триазинила; R17 и R18 независимо выбраны из водорода; возможно замещенного фенила; возможно замещенного гетероарила, где гетероарил выбран из пиридила, пирролила, пиримидинила, фурила, имидазолила, оксазолила, изоксазолила, пиразолила, 1,2,3-триазолила, 1,2,4-триазолила, 1,2,3-оксадиазолила, 1,2,4-оксадиазолила, 1,2,5-оксадиазолила, 1,3,4-оксадиазолила, 1,3,4-триазинила и 1,2,3-триазинила; X выбран из О, NR12, S и S(O)2; n является целым числом, выбранным из 0 и 1; а также его фармацевтически приемлемые соли,
причем термин «замещенный» означает, что данная группа замещена 1-5 заместителями, выбранными из «C1-C6алкила», «C1-C6алкокси» и «галогенов».

2. Пиразолиндионовое производное по п.1, в котором R1 выбран из возможно замещенного фенила и возможно замещенного пиридилC1-C6алкила; R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R17, R18, X и n определены, как в предыдущем пункте формулы изобретения.

3. Пиразолиндионовое производное по п.1, в котором X является NR12; R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R17, R18 и n определены, как в любом из предыдущих пунктов формулы изобретения.

4. Пиразолиндионовое производное по п.2, в котором X является S.

5. Пиразолиндионовое производное по любому из пп.1-4, в котором X является NH; R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11 и n определены, как в любом из предыдущих пунктов формулы изобретения.

6. Пиразолиндионовое производное по п.1 или 2, в котором X является кислородом; R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11 и n определены, как в любом из предыдущих пунктов формулы изобретения.

7. Пиразолиндионовое производное по любому из пп.1-4, в котором R12 выбран из возможно замещенного фенилC1-C6-алкила и возможно замещенного гетероарилC1-C6-алкила; R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, X и n определены, как в любом из предыдущих пунктов формулы изобретения.

8. Пиразолиндионовое производное по любому из пп.1-4, в котором R12 является возможно замещенным C1-C6алкокси-карбонилом; R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, X и n определены, как в любом из предыдущих пунктов формулы изобретения.

9. Пиразолиндионовое производное по любому из пп.1-4, в котором R2, R3, R4, R5, R6, R7, R8, R9, R10 и R11 являются водородом; R1, R12, R17, R18, X и n определены, как в любом из предыдущих пунктов формулы изобретения.

10. Пиразолиндионовое производное по любому из пп.1-4, выбранное из следующей группы:
2-(2-хлорфенил)-10-(пиридин-2-илметил)-2,3,8,9,10,11-гексагидро-1Н-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;
10-бензил-2-(2-метоксифенил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо [1,2-а][1,4]диазепин-1,5(7H)-дион;
10-бензил-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7H)-дион;
10-(2-хлорбензил)-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7Н)-дион;
2-(2-хлорфенил)-10-(3-метоксибензил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7H)-дион;
10-(3-хлорбензил)-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7H)-дион;
2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7H)-дион;
трет-бутил-2-(2-хлорфенил)-1,5-диоксо-2,3,5,8,9,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-10(7H)-карбоксилат;
10-(4-хлорбензил)-2-(2-хлорфенил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7H)-дион;
2-(2-хлорфенил)-10-(метоксибензил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7H)-дион;
2-(2-хлорфенил)-10-(4-метоксибензил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7H)-дион;
2-(2-хлорфенил)-10-(фуран-3-илметил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7H)-дион;
9-бензил-2-(2-хлорфенил)-2,3,7,8,9,10-гексагидропиразоло[4′,3′:3,4]пиридо[1,2-а]пиразин-1,5-дион;
2-(2-хлорфенил)-2,3,7,8-тетрагидро-1H-пиразоло[4′,3′:3,4]пиридо[2,1-с][1,4]оксазин-1,5(10H)-дион;
2-(2-метоксифенил)-10-(пиридин-2-илметил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7H)-дион;
10-(3-метоксибензил)-2-(2-метоксифенил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7H)-дион;
2-(2-хлорфенил)-10-[(1-метил-1H-пиразол-3-ил)метил]-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7H)-дион; и
2-(2-хлорфенил)-10-(пиридин-3-илметил)-2,3,8,9,10,11-гексагидро-1H-пиразоло[4′,3′:3,4]пиридо[1,2-а][1,4]диазепин-1,5(7H)-дион.

11. Фармацевтическая композиция для ингибирования активности или функции никотинамидадениндинуклеотидфосфатоксидазы (НАДФН-оксидазы), содержащая по меньшей мере одно пиразолиндионовое производное по любому из пп.1-10 и фармацевтически приемлемый носитель, растворитель или наполнитель для него.

12. Пиразолиндионовое производное по любому из пп.1-4 для использования в качестве лекарственного средства для ингибирования активности или функции никотинамидадениндинуклеотидфосфатоксидазы (НАДФН-оксидазы).

13. Пиразолиндионовое производное по любому из пп.1-4 для лечения заболеваний и состояний из числа сердечно-сосудистых расстройств, респираторных расстройств, метаболических расстройств, поражений кожи, заболеваний костей, нейровоспалительных и/или нейродегенеративных заболеваний, заболеваний почек, заболеваний репродуктивной системы, заболеваний глаз и/или хрусталика и/или поражений внутреннего уха, воспалительных заболеваний, заболеваний печени, боли, раковых заболеваний, аллергических заболеваний, травматизма, септического, геморрагического и анафилактического шока, заболеваний и расстройств желудочно-кишечного тракта, ангиогенеза и ангиогенез-зависимых состояний и других заболеваний и/или расстройств, связанных с активностью никотинамидадениндинуклеотидфосфатоксидазы (НАДФН-оксидаза).

14. Интермедиат формулы (II):

в котором R1, R3, R4, R5, R6, R7, R8, R9, R10, R11, X и n определены, как в любом из предыдущих пунктов формулы изобретения; R15 является возможно замещенным C1-C6алкилом.

15. Интермедиат по п.14, выбранный из группы, состоящей из следующих соединений:
метил [(4Z)-4-(4-бензил-1,4-диазепан-2-илиден)-1-(2-хлорфенил)-5-оксо-4,5-дигидро-1H-пиразол-3-ил]ацетат и метил [(4Z)-4-(4-бензил-1,4-диазепан-2-илиден)-1-(2-метоксифенил)-5-оксо-4,5-дигидро-1H-пиразол-3-ил]ацетат.

16. Способ получения интермедиата формулы (II), включающий этап взаимодействия между соединением формулы (V) и амином формулы (IV):

где R1, R3, R4, R5, R6, R7, R8, R9, R10, R11, R15, X и n определены, как в любом из предыдущих пунктов формулы изобретения.

17. Способ получения соединения формулы (I), включающий этап циклизации соединения формулы (II) в присутствии основания:

где R1, R3, R4, R5, R6, R7, R8, R9, R10, R11, R15, X и n определены, как в любом из предыдущих пунктов формулы изобретения.



 

Похожие патенты:

Изобретение относится к способам получения гетероарильных соединений, представленных структурными формулами (I) или (II): где R1-R4 имеют значения, указанные в пп.1,14 формулы.

Предложены гетеромерные пептиды на основе имидазо[4,5-е]бензо[1,2-с;3,4-с′]дифуроксана, ингибирующие агрегацию тромбоцитов: , где R=Phe-Ile-Ala-Asp-Thr; Arg-Tyr-Gly-Asp-Arg; Lys-Ile-Ala-Asp-Asp; His-Ile-Gly-Asp-Asp.

Изобретение относится к N-карб(аргинил)оксиметилимидазо[4,5-e]бензо[1,2-c;3,4-c′]дифуроксану формулы Технический результат - N-карб(аргинил)оксиметилимидазо[4,5-e]бензо[1,2-c;3,4-c′]дифуроксан, ингибирующий агрегацию тромбоцитов.

Изобретение относится к области органической химии, а именно к гетероциклическому соединению формулы I и к его фармацевтически приемлемым солям, стереоизомерам и изомерам, где Т: N, U: N, X: CR3 и Y: N; или Т: CR6, U: CR4, X: CR3 и Y: N; или Т: CR6, U: N, X: NR3 и Y: C; или Т: O, U: N, X: CR3 и Y: С; или Т: NR6, U: N, X: CR3 и Y: С; и R1, R2 и R5: H, гетероарил, замещенный 1-2 заместителями; или Т: CR6, U: N, X: CR3 и Y: N; или Т: N, U: CR4, X: CR3 и Y: N; и R1 и R2: H, гетероарил, замещенный 1-2 заместителями; R5: гетероарил, замещенный 1-2 заместителями; R3: H, мостиковый (С7-С10)циклоалкил; (С1-C8)алкил, необязательно замещенный 1 заместителем; (С3-С10)циклоалкил, необязательно замещенный 1 заместителем; (С6-С8)циклоалкенил, замещенный двумя (C1-С6)алкилами; (С6)арил, необязательно замещенный 1-2 заместителями; гетероарил, необязательно замещенный (C1-С6)алкилом; гетероциклил, необязательно замещенный (C1-С6)алкилом или гетероарилом; или R3: -A-D-E-G, где: А: связь или (C1-С6)алкилен; D : (C1-C2)алкилен, необязательно замещенный (C1-С6)алкилом, мостиковый (С6-С10)циклоалкилен, необязательно замещенный (C1-С6)алкилом, (С3-С10)циклоалкилен, необязательно замещенный 1-2 заместителями, (С4-С6)циклоалкенилен, необязательно замещенный (C1-С6)алкилом, (С6)арилен, гетероарилен или гетероциклилен, необязательно замещенный одним (C1-С6)алкилом; Е: связь, -Re-, -Re-C(О)-Re-, -Re-C(О)O-Re-, -Re-O-Re-, -Re-S(O)2-Re-, -Re-N(Ra)-Re-, -Re-N(Ra)С(O)-Re-, -Re-C(O)N(Ra)Re-, -Re-N(Ra)C(O)ORe- или -Re-N(Ra)S(О)2-Re-; где во всех случаях E связан или с атомом углерода, или с атомом азота в D; G: Н, -N(Ra)(Rb), галоген, -ORa, S(O)2Ra, -CN, -C(O)N(Ra)(Rb), -N(Ra)С(О)Rb, -C(O)Ra, -CF3, N(Ra)S(O)2Rb, -(C1-C6)алкил, необязательно замещенный 1-3 заместителями; -(С3-С6)циклоалкил, необязательно замещенный CN; -гетероарил, необязательно замещенный 1-2 галогенами, CN, -C(O)NH2 или -CF3; -гетероциклил, необязательно замещенный 1-5 заместителями, -(С6-С10)арил, необязательно замещенный 1-3 заместителями; где во фрагменте, содержащем -N(Ra)(Rb), азот, Ra и Rb могут образовывать кольцо так, что -N(Ra)(Rb) представляет собой необязательно замещенный 1 заместителем (С3-С6)гетероциклил, где указанный (С3-С6)гетероциклил связан через азот; R4 и R6: Н, (C1-С4)алкил, необязательно замещенный -ОН, -СООН; (С3-С8)циклоалкил, фенил, необязательно замещенный -SO2CH3 или -NHSO2CH3, галоген или -J-L-M-Q; где: J: (С2-С6)алкенилен; L: связь; М: связь; Q: -C(O)ORa; Ra и Rb: Н, (С1-С4)алкил, необязательно замещенный циано, -CF3 или циклопропаном; (С6)арил, необязательно замещенный галогеном или -O(С1-С4)алкилом; и Re: связь, (С1-С4)алкилен или (С3)циклоалкилен.

Изобретение относится к способу получения N-карбоксиметилимидазо[4,5-е]бензо[1,2-с;3,4-с′]дифуроксана гидролизом N-карбэтоксиметилимидазо[4,5-е]бензо[1,2-с;3,4-с′]дифуроксана 10%-ным водным раствором соляной кислоты.

Изобретение относится к N-карб(глутаминил)оксиметилимидазо[4,5-е]бензо[1,2-с; 3,4-с']дифуроксану формулы Технический результат: получено новое соединение, которое может найти применение в медицине в качестве лекарственного препарата, ингибирующего агрегацию тромбоцитов.

Изобретение относится к соединению формулы (1) или (1'): где: Z представляет собой реактивный карбоксильный эфир, выбранный из группы, состоящей из N-сукцинимидила, N-сульфосукцинимидила, N-фталимидила, N-сульфофталимидила, 2-нитрофенила, 4-нитрофенила, 2,4-динитрофенила, 3-сульфо-4-нитрофенила, 3-карбокси-4-нитрофенила и сложного эфира трифторфенила, или галоацетамида; D представляет собой майтанзиноид; Х представляет собой алифатическую структурную единицу; Y представляет собой алифатическую структурную единицу, присоединенную к майтанзиноиду через тиоэфирную связь; где указанная алифатическая структурная единица, представленная Х или Y, является простой или разветвленной алкильной группой, имеющей 1-20 атомов углерода в цепи, циклической алкильной группой, имеющей 3-10 атомов углерода, простой или разветвленной алкенильной группой, имеющей 2-15 атомов углерода в цепи, или простой или разветвленной алкинильной группой, имеющей 2-15 атома углерода в цепи; 1 представляет собой 0 или 1; p представляет собой 0 или 1; и n представляет собой целое число от 1 до 2000.

Изобретение относится к соединениям формулы (I) где значения заместителей раскрыты в формуле изобретения. .
Изобретение относится к области органической химии, а именно к новым гетероциклическим соединениям формулы (1) и/или к их фармацевтически приемлемым солям, где А1 представляет СН; А4 и А5 независимо представляют собой СR2 или N; А2 и А3 совместно с кольцом В представляют собой 5-членный гетероарил или гетероцикл, причем указанный 5-членный гетероарил или гетероцикл выбран из где t представляет собой 1 или 2; и R3 независимо выбран из Н, С1-С6 алкила, С6-арила, С3-С6-членного циклоалкила, C(O)NRcRd, -ORb, гетероарила, представляющего собой пиридин, и гетероцикла, представляющего собой пиперидин и тетрагидропиран; и каждый из вышеуказанных алкила, арила, циклоалкила, гетероарила и гетероцикла может быть замещен одной группой, независимо выбранной из С1-С6 алкила, возможно замещенного одним заместителем, выбранным из -CONMe2, С3-членного циклоалкила, -CN, -ОМе, -пиридина, тетрагидропирана, -СО-морфолина, -СО-пирролидина, (3-метил)оксетана; -ОН; -C(O)Ra; -CN; -C(O)NRcRd; -NRcRd; -ORb; -S(O)nRe; галогена; и замещенного одной группой -СОМе гетероцикла, представляющего собой пиперидин; при условии, что когда А4 представляет собой CR2, А2 и А3 совместно с кольцом В выбраны из структуры (3), (5) или (6); представляет собой одинарную связь или двойную связь; R1 представляет собой гетероарил, представляющий собой 6-членное или 9-10-членное ароматическое моно- или бициклическое кольцо, содержащее 1-3 гетероатома, выбранных из азота, кислорода и серы, возможно замещенный одной или двумя группами, независимо выбранными из С1алкила, С2алкинила, -NRcRd, -NRcS(O)nRe, -ORb, галогена, галогеналкила; R2 независимо выбран из Н; каждый Ra, Rb, Rc, Rd, и Re независимо выбран из Н; С1-С4алкила, возможно замещенного одним заместителем, выбранным из -ОН, -ОМе, -CN, -NH2, -NMe2, С3-циклоалкила; С2-С3алкенила; С3алкинила; С6арила, возможно замещенного одним или двумя заместителями, выбранными из фтора или метильной группы; С3-членного циклоалкила, возможно замещенного одним заместителем, выбранным из -ОН и -CN; галогеналкила; гетероарила, представляющего собой пиридин; и замещенного одной метильной группой гетероцикла, представляющего собой пиперидин, или Rc и Rd совместно с атомом (атомами), к которым они присоединены, образуют 5-6-членное гетероциклическое кольцо, представляющее собой пирролидин или морфолин; и в каждом случае n независимо равен 2.

Изобретение относится к соединению формулы (VIII), где А и V независимо представляют собой Η или галоген; Q отсутствует; R4 независимо представляет собой Н, С1-С6 алкил или С3-С6 циклоалкил; R7 представляет собой Н; и R8 представляет собой С1-С10 алкил, замещенный ОН или С1-С6 алкокси; или С1-4 алкил, замещенный 5-6-членным ароматическим гетероциклическим кольцом, содержащим 1-2 гетероатома, выбранные из N и S, где указанное ароматическое гетероциклическое кольцо необязательно замещено С1-С10 алкилом; или в -NR7R8, R7 и R8 вместе с N могут образовывать необязательно замещенное азациклическое кольцо, при необходимости содержащее дополнительный гетероатом, выбранный из Ν, О и S, в качестве члена цикла, необязательно замещенное С1-С10 алкилом, который замещен С1-С6 алкокси; m равно 0; n равно 0.

Изобретение относится к области органической химии, а именно к гетероциклическому соединению формулы I и к его фармацевтически приемлемым солям, стереоизомерам и изомерам, где Т: N, U: N, X: CR3 и Y: N; или Т: CR6, U: CR4, X: CR3 и Y: N; или Т: CR6, U: N, X: NR3 и Y: C; или Т: O, U: N, X: CR3 и Y: С; или Т: NR6, U: N, X: CR3 и Y: С; и R1, R2 и R5: H, гетероарил, замещенный 1-2 заместителями; или Т: CR6, U: N, X: CR3 и Y: N; или Т: N, U: CR4, X: CR3 и Y: N; и R1 и R2: H, гетероарил, замещенный 1-2 заместителями; R5: гетероарил, замещенный 1-2 заместителями; R3: H, мостиковый (С7-С10)циклоалкил; (С1-C8)алкил, необязательно замещенный 1 заместителем; (С3-С10)циклоалкил, необязательно замещенный 1 заместителем; (С6-С8)циклоалкенил, замещенный двумя (C1-С6)алкилами; (С6)арил, необязательно замещенный 1-2 заместителями; гетероарил, необязательно замещенный (C1-С6)алкилом; гетероциклил, необязательно замещенный (C1-С6)алкилом или гетероарилом; или R3: -A-D-E-G, где: А: связь или (C1-С6)алкилен; D : (C1-C2)алкилен, необязательно замещенный (C1-С6)алкилом, мостиковый (С6-С10)циклоалкилен, необязательно замещенный (C1-С6)алкилом, (С3-С10)циклоалкилен, необязательно замещенный 1-2 заместителями, (С4-С6)циклоалкенилен, необязательно замещенный (C1-С6)алкилом, (С6)арилен, гетероарилен или гетероциклилен, необязательно замещенный одним (C1-С6)алкилом; Е: связь, -Re-, -Re-C(О)-Re-, -Re-C(О)O-Re-, -Re-O-Re-, -Re-S(O)2-Re-, -Re-N(Ra)-Re-, -Re-N(Ra)С(O)-Re-, -Re-C(O)N(Ra)Re-, -Re-N(Ra)C(O)ORe- или -Re-N(Ra)S(О)2-Re-; где во всех случаях E связан или с атомом углерода, или с атомом азота в D; G: Н, -N(Ra)(Rb), галоген, -ORa, S(O)2Ra, -CN, -C(O)N(Ra)(Rb), -N(Ra)С(О)Rb, -C(O)Ra, -CF3, N(Ra)S(O)2Rb, -(C1-C6)алкил, необязательно замещенный 1-3 заместителями; -(С3-С6)циклоалкил, необязательно замещенный CN; -гетероарил, необязательно замещенный 1-2 галогенами, CN, -C(O)NH2 или -CF3; -гетероциклил, необязательно замещенный 1-5 заместителями, -(С6-С10)арил, необязательно замещенный 1-3 заместителями; где во фрагменте, содержащем -N(Ra)(Rb), азот, Ra и Rb могут образовывать кольцо так, что -N(Ra)(Rb) представляет собой необязательно замещенный 1 заместителем (С3-С6)гетероциклил, где указанный (С3-С6)гетероциклил связан через азот; R4 и R6: Н, (C1-С4)алкил, необязательно замещенный -ОН, -СООН; (С3-С8)циклоалкил, фенил, необязательно замещенный -SO2CH3 или -NHSO2CH3, галоген или -J-L-M-Q; где: J: (С2-С6)алкенилен; L: связь; М: связь; Q: -C(O)ORa; Ra и Rb: Н, (С1-С4)алкил, необязательно замещенный циано, -CF3 или циклопропаном; (С6)арил, необязательно замещенный галогеном или -O(С1-С4)алкилом; и Re: связь, (С1-С4)алкилен или (С3)циклоалкилен.

Изобретение относится к 1,7-диазакарбазольным соединениям формулы (I) или к его сольватам, гидратам или солям где X, Y, Z, R3, R5 и R6 такие, как указано в п.1 формулы изобретения.

Описываются новые полициклические азотсодержащие гетероароматические соединения - тетрацианозамещенные 1,4,9b-триазафеналены общей формулы 1 где R означает - фенил, замещенный NO2, галогеном, С1-4алкилом или группой -OR1, где R1 - метил, - нафтил или - гетероарил состава C4H3S, и способ их получения исходя из соответствующих R-замещенных 1,1,2,2-тетрацианоциклопропанов при их кипячении в 1,2-дихлорбензоле.

Изобретение относится к замещенным пиперидиновым соединениям хиноксалинового типа формулы (II) или к его фармацевтически приемлемому производному, где Y1 представляет собой О; Q выбирают из конденсированного бензо или пиридино; каждый R2 независимо выбирают из (а) -галогена или -CN; (b) -(C1 -C6)алкила; а является целым числом, выбранным из 0, 1 или 2; пунктирная линия в 6-членном содержащем атом азота кольце, которое является конденсированным с Q группой, обозначает присутствие или отсутствие связи и когда эта пунктирная линия обозначает присутствие связи, тогда R3 и один R 4 отсутствуют; R3 выбирают из (а) -Н; каждый R4 независимо выбирают из (а) -Н; или (b) -галогена или CN; или (с) -X, -(C1-C6)алкила-X, -(5- или 6-членного)гетероцикла-X или -(5- или 6-членного)гетероцикл-(C 1-C6)алкила-X; или (d) -C(=Y)X, -С(=Y)T 3, -C(=Y)YX, -C(=Y)YT3, -C(=Y)N(T1 )(T2), -C(=Y)N(R9)CN, -C(-Y)N(R9 )X, -C(=Y)N(R9)YH, -C(=Y)N(R9)YX, -C(=Y)N(R 9)YCH2X, -C(-Y)N(R9)YCH2 CH2X или -C(=Y)N(R9)S(=O)2T 3; или (e) -N(R9)X, -N(R9)-CH 2X, -N(R9)-CH2CH2X, -N(R 9)CH2N(R9)C(=N(R12))N(R 12)2, -N(R9)-CH2CH 2N(R9)C(=N(R12))N(R12) 2, -N(T1)(T2), -N(T3)С(=Y)T 3, -N(T3)С(=Y)YT3, -N(T3 )C(=Y)N(T1)(T2), -N(T3)S(=O) 2T3 или -N(T3)S(=O)2N(T 1)(T2); X представляет собой (а) -Н, -(C 1-C6)алкил, -(C2-C6)алкенил, -(C1-C6)алкокси, -(C3-C 7)циклоалкил, -(5- или 6-членный)гетероцикл или -(7-10-членный)бициклогетероцикл, каждый из которых является незамещенным или замещенным с помощью 1, 2 или 3 из независимо выбранных R8 групп; или (b) -фенил, -нафталинил, или -(5- или 6-членный)гетероарил, каждый из которых является незамещенным или замещенным с помощью 1 или 2 из независимо выбранных R7 групп; каждый Y независимо выбирают из О; А и В независимо выбирают из (а) -Н; или (с) А-В могут вместе образовывать (C2-C6)мостик, который необязательно содержит -HC=CH- или -О- в (C2 -C6)мостике; где 6-членное содержащее атом азота кольцо является конденсированным с Q группой, может находиться в эндо- или экзоконфигурации по отношению к А-В мостику; или (d) А-В могут вместе образовывать -CH2-N(Ra)-CH 2- мостик, где 6-членное содержащее атом азота кольцо является конденсированным с Q группой, может находиться в эндо- или экзоконфигурации по отношению к А-В мостику; Ra выбирают из -Н или -(C1-C6)алкила; Z представляет собой -[(C 1-C10)алкил, необязательно замещенный R 1]h-, где h равно 0 или 1; каждый R1 независимо выбирают из (b) -(C1-C10)алкила, -(C2-C10)алкенила, -(C2-C 10)алкинила, -(C3-C7)циклоалкокси, -(C6-C14)бициклоалкила, -(C8 -C10)трициклоалкила, -(C5-C10 )циклоалкенила, -(C7-C14)бициклоалкенила, -(3-7-членного)гетероциклила, каждый из которых является незамещенным или замещенным с помощью 1, 2 или 3 из независимо выбранных R 8 групп; или или (d) -фенила, -нафталинила, каждый из которых является незамещенным или замещенным с помощью R 7 группы; каждый R6 независимо выбирают из -Н; каждый R7 независимо выбирают из -(C1-C 4)алкила, -OR9, -С(галогена)3, -СН(галогена) 2, -CH2(галогена), -CN, -галогена, -N(R 9)2, -C(=O)OR9; каждый R8 независимо выбирают из -(C1-C4)алкила, тетразолила, имидазолила, фуранила, -(C1-C6 )алкилаCOOR9.

Изобретение относится к применению 5-алкил-3-(пирид-3-ил)изоксазолов и их 4,5-дигидропроизводных общей формулы , где для 5-алкил-3-(пирид-3-ил)изоксазолов R1 представляет собой CH3, C3H7, C4H9, C7H15, C8H17, а для 4,5-дигидропроизводных R1 представляет собой CH3, C8H17, C16H33, в качестве средств, обладающих антиагрегационной активностью.
Наверх