Способ диагностики растительного материала на трансгенность



Способ диагностики растительного материала на трансгенность
Способ диагностики растительного материала на трансгенность

 

C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2607372:

федеральное государственное бюджетное образовательное учреждение высшего образования "Санкт-Петербургский государственный университет" (СПбГУ) (RU)

Изобретение относится к области биохимии, в частности к способу диагностики растительного материала на трансгенность. Способ включает выделение из биоматериала ДНК и проведение полимеразной цепной реакции в режиме реального времени с зондами, меченными флуоресцентными красителями и гасителями флуоресценции. При этом составляют реакционную смесь, содержащую праймеры aacacatgagcgaaacccta, caagctcgagtttctccata, ccggtcttgcgatgattat, tatattttgttttctatcgcgtatt, tatattttgttttctatcgcgtatt, agatggattgcacgcaggttc, gcatcagagcagccgattgt и зонды FAM-cccttatctgggaactactcacacatta-BHQ1, FAM-tgcgggactctaatcataaaaacccatct-BHQ1, FAM-ccagtcatagccgaatagcctctccacc-BHQ1. Полимеразную цепную реакцию проводят в режиме реального времени, при этом осуществляют непрерывный контроль флуоресценции и по экспоненциальному ее нарастанию диагностируют трансгенность растений. Изобретение позволяет эффективно диагностировать растительный материал на трансгенность. 2 ил., 1 табл.

 

Изобретение относится к биотехнологии сельскохозяйственных растений и может найти применение для нужд сельского хозяйства и растениеводства при диагностике трангенного растительного материала. Изобретение может быть использовано в пищевой промышленности при выявлении генноинженерно модифицированных организмов (ГМО).

Известен способ определения трансгенных растений [1, 2], сущность которого состоит в анализе нуклеотидных последовательностей методом полимеразной цепной реакции (ПЦР) с последующей гибридизацией ее продуктов на микрочипах. Основным недостатком этого способа является необходимость переноса амплификата после проведения ПЦР в ячейки биочипов, что создает предпосылку для загрязнения реактивов и лабораторного оборудования продуктами ПЦР и может привести к получению ложных результатов анализа.

Известен способ определения трансгенных растений [3], основанный на амплификации методом ПЦР в реальном времени последовательностей некоторых разновидностей промотора 35S и терминатора nos. Однако этот способ не позволяет выявить значительное количество трансгенных линий, содержащих отличающиеся последовательности данных маркеров.

ПЦР в режиме реального времени позволяет контролировать увеличение количества синтезируемого продукта в ходе реакции и не требует проведения электрофореза на последующих стадиях. Это стало возможным благодаря добавлению в реакционную среду красителей, обеспечивающих флуоресценцию, прямо пропорциональную количеству синтезированного ПЦР-продукта, - репортерную флуоресценцию.

ПЦР в режиме реального времени существует в двух основных модификациях, различающихся по способам генерации репортерной флуоресценции. Первая из них связана с применением интеркалирующих флуоресцентных агентов, свечение которых значительно возрастает при связывании с двуцепочечной ДНК, вторая связана с использованием меченных флуоресцентными агентами олигонуклеотидных проб, комплементарных участку ПЦР-продукта. Вторая модификация ПЦР является более предпочтительной для диагностических целей, поскольку дает дополнительную возможность контроля специфичности реакции.

Использование ПЦР в реальном времени позволяет свести к минимуму проблему контаминации продуктом реакции, ускорить процедуру анализа за счет отсутствия необходимости проведения электрофореза, позволяет получать количественные характеристики присутствия интересующей ДНК в пробе.

На настоящий момент на основе ПЦР технологии разработано огромное количество диагностических систем различного назначения, в том числе для нужд сельского хозяйства и растениеводства.

Известны аналогичные изобретения «Патент РФ 2386698, Кузнецов В.В., Абрамов Д.Д., Митрохин И.А., Цыдендамбаев В.Д. Способ идентификации трансгенных последовательностей днк в растительном материале и продуктах на его основе» [3].

Однако аналогичные наборы не позволяют выявить все разнообразие коммерческих трансгенных линий растений. Это связано с тем, что в генно-инженерных конструкциях использовано несколько разновидностей последовательностей терминатора nos и большое разнообразие последовательностей промоторов 35S.

По данным базы NCBI (ncbi.nlm.nih.gov) последовательности 35S варьируют по длине от 47 до 485 нуклеотидов, а также по нуклеотидному составу. Данные о последовательностях 35S приведены в приложениях 1 и 2.

Сущность изобретения поясняется фиг. 1 и 2.

Фиг. 1 иллюстрирует нецелесообразность применения праймеров к промотору 35S для диагностики трансгенности в виду большой молекулярной дивергенции ДНК мишеней.

Древо, отражающее сходство последовательностей, построенное в программе Vector NTI, представлено на фиг. 1.

Как видно из фиг. 1, последовательности 35S существенно отличаются друг от друга и формируют не менее 6 групп сходства. При этом варьирование в пределах каждой группы может быть существенным. Эти обстоятельства делают невозможным применение данной последовательности в качестве универсальной мишени для подбора праймеров, детектирующих ГМО. Анализ последовательностей терминатора nos, напротив, показал, что существует 2 его основные вариации.

То есть данная мишень является пригодной для разработки тест-системы, но необходимо учитывать две разновидности последовательности терминатора nos. Анализ распространения селективного маркера nptII (таблица 1) показал, что он присутствует в более сотни линий ГМО и может быть использован как вспомогательный [4].

Заявителю известно, что работа над созданием праймеров, которые используются в подобных наборах, строится обычно следующим образом.

1) С помощью открытых и коммерческих баз данных нуклеотидных последовательностей генно-инженерных конструкций выбирается их консервативный участок, специфичный для как можно большего количества генно-инженерно модифицированных организмов.

2) На основании выбранного участка генома с помощью специального программного обеспечения подбирается последовательность олигонуклеотидов, используемых для проведения ПЦР-реакции (часто 2 праймера и зонд). На данном этапе работа заключается в создании выравнивания многих нуклеотидных последовательностей и выборе участка последовательности рекомбинантной ДНК с наименьшим полиморфизмом.

3) Изготовление праймеров.

4) С помощью практических экспериментов доказывается пригодность подобранных последовательностей для конкретных целей (например, для определения наличия/отсутствия генно-инженерно модифицированных растений в биоматериале).

Наиболее близким способом по достигаемому техническому результату является способ Диагностики ГМО [3], принятый в качестве прототипа. Сущность его состоит в проведении ПЦР с использованием специфических праймеров и флуоресцентномеченых зондов, комплиментарных трансгенным последовательностям ДНК (таблица 1), с последующей детекцией продуктов амплификации в закрытых амплификационных пробирках с помощью флуоресцентного ПЦР-детектора. Ключевым элементом заявляемого способа является использование флуоресцентномеченых зондов, представляющих собой олигонуклеотиды, меченные молекулами флуорофора и гасителя флуоресценции. Зонды добавляют в реакционную смесь наряду с праймерами и другими компонентами реакции. В ходе ПЦР флуоресцентномеченый зонд гибридизуется на специфических ампликонах и разрушается Taq-полимеразой, в результате чего флуорофор оказывается свободным от гасителя. Таким образом, уровень флуоресценции в амплификационных пробирках возрастает пропорционально количеству образовавшихся специфических продуктов ПЦР.

Недостатком известного способа, принятого в качестве прототипа, является невозможность выявить некоторые трансгенные линии с его помощью. Например, некоторые линии сои, устойчивой к раундапу (см. последовательности NCBI ##AJ783418.1, АВ209952.1, AF465641.1), кукурузы с геном Bt (см. последовательности NCBI ##EU363768.1 EU363766.1). Изобретение свободно от этих недостатков.

Технический результат изобретения состоит в расширении диапазона генотипов диагностируемых ГМО.

Указанный технический результат достигается тем, что в способе диагностики биоматериалов на наличие в них трансгенных растений, заключающемся в выделении из биоматериала ДНК и проведении на ней полимеразной цепной реакции в режиме реального времени зондами, меченными флуоресцентными красителями и гасителями флуоресценции, в соответствии с изобретением после выделения из образцов ДНК в концентрации 0,1-100 нг/мкл на ее основе составляют реакционную смесь, содержащую праймеры , , , , , , и зонды , , . Полимеразную цепную реакцию проводят в режиме реального времени с температурой отжига праймеров 60°C при 40 циклах, при этом осуществляют непрерывный контроль флуоресценции и по экспоненциальному ее нарастанию диагностируют трансгенность растений. Кроме этого, указанный технический результат достигается тем, что в качестве термостабильной полимеразы с активностью 0,1-0,3 ед. на 1 мкл смеси берут Taq. Вместе с тем указанный технический результат достигается тем, что в качестве термостабильной полимеразы с активностью 0,1-0,3 ед. на 1 мкл смеси берут Tth.

Сущность изобретения состоит в том, что для диагностики наличия в образце трансгенных растений или продуктов их переработки проводят ПЦР в реальном времени с праймерами и зондами к регуляторным последовательностям ДНК (терминатор nos) нескольких разновидностей и селективному маркеру nptII, используемым в большинстве линий трансгенных растений. Например, при сравнении уровня техники:

По патенту РФ 2386698 (RU):

Способ идентификации трансгенных последовательностей ДНК в растительном материале и продуктах на его основе (RU).

При схожей технологии детекции в известном патенте описывается детекция более узкого набора линий, содержащих трансгены.

Существенными признаками изобретения являются:

из анализируемого образца выделяют ДНК чистоты, достаточной для проведения ферментативных реакций, после этого составляют реакционную смесь, содержащую, по меньшей мере: праймеры , , , , , , и зонды , , , зонд может содержать и другие флуоресцентные красители или гасители флуоресценции;

Полимеразную цепную реакцию проводят в амплификаторе (термоциклире) при температуре отжига праймеров 60°C при 40 циклах, при этом осуществляют непрерывный контроль флуоресценции и по экспоненциальному ее нарастанию диагностируют трансгенность растений. Реакцию можно проводить в амплификаторе, обладающем возможностью детектировать изменение флуоресценции в режиме реального времени или в обычном амплификаторе без детектора (в этом случае о прохождении реакции судят по изменению уровня флуоресценции, измеренной перед началом реакции и после ее прохождения).

В случае, если прохождение реакции в виде увеличения уровня флуоресценции образца будет детектировано, делается вывод о наличии трансгенных растений в анализируемом образце.

Реализация заявленного способа.

Для обнаружения заявленным способом трансгенных растений или продуктов их переработки в образце требуется:

1. Выделить ДНК из образца СТАБ-методом. Для этого нужно гомогенезировать образец в СТАВ-буфере (NaCl 1,4М, Трис HCl (pH 8) 0,1М, ЭДТА (pH 8) 20 мМ, СТАВ 2% m/v), инкубировать полученную смесь 1 ч при 56°C, 40-60 мин экстрагировать хлороформом, разделить фракции центрифугированием, верхнюю (водную), содержащую ДНК фракцию переосадить этанолом, ДНК растворить в воде.

2. Приготовить реакционную смесь для ПЦР, которая должна содержать 1х буфер для полимеразы, катионы Mg 2+ в концентрации 0,1-0,3 мM, нуклеотиды в концентрации 2-10 мкМ, Taq полимеразу (или другую термостабильную полимеразу, обладающую 5' экзонуклеазной активностью), 0,1-0,3 ед. активности на 1 мкл смеси, ДНК матрицу исследуемого образца 0,1-100 нг/мкл, праймеры, следующего состава: , , , , , , и зонды , , , зонд может содержать и другие флуоресцентные красители или гасители флуоресценции.

3. Провести полимеразную цепную реакцию в режиме реального времени с температурой отжига праймеров 60°C при 40 циклах. Пример программы: 95°C - 5 мин, 40 циклов (95°C - 18 с, 60°C - 30 с, 72°C - 30 с). Прохождение реакции контролируют посредством прибора для измерения уровня флуоресценции в ходе реакции, при прохождении реакции хотя бы в одной из реакционных смесей, наблюдается повышение уровня флуоресценции, делается вывод о наличии трансгенных растений в исследуемом образце.

Заявленный способ апробирован в реальном времени на лабораторной базе Санкт-Петербургского государственного университета и поясняется конкретными примерами.

Пример конкретной реализации.

Для обнаружения описываемым методом трансгенных растений и продуктов их переработки в образце требуется:

1. Выделить ДНК из образца СТАБ-методом (подготовительный этап).

2. Провести ПЦР в реальном времени (собственно анализ).

Выделение ДНК из образцов трансгенных корней каланхоэ (трансформированных штаммом А4 Agrobacterium rhizogenes), клубней картофеля семян сои и мясного фарша с добавлением сои.

Гомогенезировать образец в СТАВ-буфере (NaCl 1,4М, Трис HCl (pH 8) 0,1М, ЭДТА (pH 8) 20 мМ, СТАВ 2% m/v), инкубировать полученную смесь 1 ч при 56°C, 40-60 мин экстрагировать хлороформом, разделить фракции центрифугированием, верхнюю (водную), содержащую ДНК фракцию переосадить этанолом, ДНК растворить в воде.

ПОСТАНОВКА ПЦР

В ходе апробации заявленного способа были приготовлены 2 реакционные смеси для ПЦР. Первая смесь содержала 1х буфер для полимеразы, катионы Mg 2+ в концентрации 0,2 мМ, нуклеотиды в концентрации 2 мкМ, Taq полимеразу, 0,2 ед. активности на 1 мкл смеси, ДНК матрицу исследуемого образца 10-100 нг/мкл, праймеры, следующего состава: , , , , , , в концентрации 2 mM и зонды , ,

Полимеразную цепную реакцию в режиме реального времени проводили по программе:

95°C - 5 мин, 40 циклов (95°C - 18 с, 60°C - 30 с, 72°C - 30 с).

Прохождение реакции контролировали посредством прибора для измерения уровня флуоресценции в ходе реакции, например амплификатор АНК32 (испытания проводились на лабораторной базе Института Аналитического приборостроения РАН), или CFX96 (Biorad, США). Результаты реакции представлены в качестве примера на фиг. 2.

Фиг. 2 иллюстрирует прохождение реакции с разработанными авторами праймерами на трансгенном и контрольном растительном материале. ПЦР с разработанными авторами праймерами и зондами для детекции ГМО (графики 1-8) и праймерами к гену лектина сои (графики 9-11) на контрольных ДНК плазмиды pART27 (график 1), штаммов агробактерии Т37, С58 (графики 2-3), опытных ДНК трансгенной сои (графики 4, 9), трансгенного картофеля (графики 5-7), трансгенного каланхоэ (график 8), нетрансгенной сои (график 10), мясного фарша (график 11).

Как видно из фиг. 2, амплификация фрагмента гена лектина проходит только на ДНК сои, амплификация терминатора nos - только на трансгенных растениях. Значения пороговых циклов для лектина и nos отличаются на 1 у трансгенной сои, что может быть объяснено большей дозой генов с терминатором nos по сравнению с референсом. Аналогичные результаты получены на трансгенных линиях картофеля с референсным геном соланина и терминатором nos.

Таким образом, наблюдается прохождение реакции, свидетельствующей о работе апробированной диагностической системы. Можно сделать вывод об успешной работе диагностической системы при использовании ДНК заявленных концентраций.

Технико-экономическая эффективность изобретения состоит в том, что предлагаемый новый способ диагностики растительного материала на предмет трансгенности направлен на решение проблемы быстрой диагностики биологического материала растительного происхождения (растения и продукты их переработки), т.е. на эффективное и оперативное выявление наличия в исследуемых биоматериалах трансгенных растений. Заявленный способ по достигаемому техническому результату отличается от известных в данной области аналогов: позволяет расширить список детектируемых трансгенных линий растений.

Источники информации

1. Патент РФ №2453605, Грановский И.Э., Белецкий И.П., Шляпникова Е.А., Шляпников Ю.М., Гаврюшкин А.В., Бирюков С.В. Дифференцирующий и специфический олигонуклеотиды для идентификации последовательностей днк трансгенных растений в пищевых продуктах, способ идентификации трансгенных продуктов, биочип, комбинация олигонуклеотидов (варианты) и набор для осуществления этого способа.

2. Патент РФ 2270254, Мирзабеков А.Д., Грядунов Д.А., Михайлович В.М., Заседателев А.С., Романов Г.А., Кузнецов В.В., Цыденедамбаев В.Д., Митрохин И.А., Крылова Е.М. Способ идентификации трансгенных последовательностей днк в растительном материале и продуктах на его основе, набор олигонуклеотидов и биочип для осуществления этого способа.

3. Патент РФ 2386698, Кузнецов В.В., Абрамов Д.Д., Митрохин И.А., Цыдендамбаев В.Д. Способ идентификации трансгенных последовательностей ДНК в растительном материале и продуктах на его основе (RU 2386698) – прототип.

4. Navarro M.J., Natividad-Tome K.G. Gimutao K.A / From Monologue to Stakeholder Engagement: The Evolution of Biotech Communication ISAAA Briefs N48, 2012, 137. P.

Способ диагностики растительного материала на трансгенность, заключающийся в выделении из биоматериала ДНК и проведении на ней полимеразной цепной реакции в режиме реального времени с зондами, меченными флуоресцентными красителями и гасителями флуоресценции, отличающийся тем, что после выделения из образцов ДНК в концентрации 0,1-100 нг/мкл на основе ее составляют реакционную смесь, которая содержит праймеры aacacatgagcgaaacccta, caagctcgagtttctccata, ccggtcttgcgatgattat, tatattttgttttctatcgcgtatt, tatattttgttttctatcgcgtatt, agatggattgcacgcaggttc, gcatcagagcagccgattgt и зонды FAM-cccttatctgggaactactcacacatta-BHQ1, FAM-tgcgggactctaatcataaaaacccatct-BHQ1, FAM-ccagtcatagccgaatagcctctccacc-BHQ1, праймеры в составе реакционных смесей имеют концентрацию 0,2-2 мM, а зонды 0,1-1 мM, реакционные смеси содержат буфер для полимеразы, катионы Mg 2+ в концентрации 0,1-0,3 мM, нуклеотиды в концентрации 2-10 мкМ, Taq полимеразу 0,1-0,3 ед. активности на 1 мкл смеси, полимеразную цепную реакцию проводят в режиме реального времени с температурой отжига праймеров 60°С при 40 циклах, при этом осуществляют непрерывный контроль флуоресценции и по экспоненциальному ее нарастанию диагностируют трансгенность растений.



 

Похожие патенты:

Изобретение относится к области биохимии, клинико-лабораторной диагностики, в частности к определению степени обсемененности пародонта патогенными бактериями с помощью ПЦР в реальном времени.

Изобретение относится к области медицины, стоматологии, молекулярной биологии и клинико-лабораторной диагностики. Описан способ определения выраженности нагноения (гноетечения) тканей пародонта.

Изобретение относится к области биохимии и медицины, в частности к способу выявления кандидатных генов для проведения популяционных исследований генетического полиморфизма у детей, проживающих в условиях стронциевой геохимической провинции.

Изобретения относятся к ветеринарной вирусологии и биотехнологии, а именно к генетической инженерии. Предложены синтетические олигонуклеотидные праймеры для выявления РНК атипичного пестивируса крупного рогатого скота и способ их применения.

Настоящее изобретение относится к области генетики. Предложен способ оценки риска возникновения у индивида тромбоэмболического эпизода или диагностики возникновения или наличия такой болезни или эпизода на основании присутствия серпина А10 (ингибитор протеина Z) Arg67Stop (rs2232698), серпина С1 (антитромбин) Ala384Ser (Cambridge II), фактора XII С46Т (rs1801020), фактора XIII Val34Leu (rs5985), фактора II (протромбин) G20210A (rs1799963), фактора V Leiden Arg506Gln (rs6025), фактора V Cambridge Arg306Thr, фактора V Hong Kong Arg306Gly, группы крови ABO rs8176719, группы крови ABO rs7853989, rs8176743 и rs8176750.

Изобретение относится к области биотехнологии, а именно к синтетическим олигонуклеотидным зондам и праймерам для выявления ДНК вируса африканской чумы свиней. Предложенные синтетические олигонуклеотидные праймеры и флуоресцентно меченый зонд с внутренним гасителем комплементарны консервативной области гена Р30 (CP204L) вируса африканской чумы свиней и имеют следующий нуклеотидный состав: F1 р30 5'-GTTACGACCGCTATAAAAACA-3' R1 р30 5'-TTCCATTCTTCTTGAGACCTG-3' Z1 (int) p30 5'-(FAM)TACTGTT(RTQ1)AAGTATGATATTGTGA(BHQ1)-3' Предложенное изобретение может быть использовано в генодиагностике инфекционных болезней свиней и ветеринарной вирусологии.

Группа изобретений относится к области биотехнологии и представлена набором олигонуклеотидных зондов для профилирования микробиоты желудочно-кишечного тракта (ЖКТ), где указанный набор включает в частности (a) олигонуклеотид, состоящий из (ai) нуклеотидной последовательности, выбранной из ACGCTTGCACCCT (SEQ ID NO: 1) необязательно с не более тремя замещенными основаниями или AGGGTGCAAGCGT (SEQ ID NO: 27) необязательно с не более тремя замещенными основаниями, и (aii) 0-5 нуклеотидов в дополнение к (ai), где олигонуклеотид согласно (а) способен гибридизоваться с SEQ ID NO: 27 или SEQ ID NO: 1, соответственно, в строгих условиях гибридизации.

Изобретение относится к области медицины, в частности к онкологии, и молекулярной биологии. Предложен способ диагностики папиллярной почечноклеточной карциномы (ППК), включающий стадии получения исходной пары образцов ткани от пациента, выделение и очистку препаратов РНК, синтез кДНК на матрице РНК с использованием олигонуклеотидных праймеров, проведение количественной реакции амплификации фрагмента гена CALL и сравнение количества амплифицированного фрагмента CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани.
Изобретение относится к области медицины и предназначено для оценки риска прогрессирования хронической болезни почек (ХБП) у детей. У ребенка с подозрением на ХБП забирают кровь из периферической вены и с помощью метода аллель-специфичной полимеразной цепной реакции проводят идентификацию однонуклеотидных полиморфизмов генов ангиотензин-превращающего фермента (АСЕ) Alu Ins/Del I>D, ангиотензина (AGT) Thr174Met и Met235Thr, рецепторов 1 типа ангиотензина 2 (R1AGT) С1166С и эндотелина-1 (ЕТ-1) Lys198Asn.

Группа изобретений относится к области биотехнологии. Способы определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки в нуклеиновой кислоте включают: выделение нуклеиновой кислоты из одного образца или порций; приведение нуклеиновой кислоты в контакт с прямым праймером, способным связываться с нуклеиновой кислотой выше сайта вставки; первым обратным праймером, специфичным для вставленной нуклеотидной последовательности, и вторым обратным праймером, способным связываться с нуклеиновой кислотой ниже сайта вставки.

Изобретение относится к биотехнологии и представляет собой способ получения полипептидного мультимера, который включает первый полипептид, обладающий антигенсвязывающей активностью, и второй полипептид, обладающий антигенсвязывающей активностью, или помимо первого и второго полипептидов мультимер включает один или два третьих полипептида, обладающих антигенсвязывающей активностью, или помимо первого, второго и третьего полипептидов мультимер включает четвертый полипептид, обладающий антигенсвязывающей активностью, и способ включает стадии: (a) экспрессии ДНК, которая кодирует первый полипептид, обладающий антигенсвязывающей активностью, и ДНК, которая кодирует второй полипептид, обладающий антигенсвязывающей активностью, или экспрессии ДНК, которая кодирует первый, второй и третий полипептиды, обладающие антигенсвязывающей активностью, или экспрессии ДНК, которая кодирует первый, второй, третий и четвертый полипептиды, обладающие антигенсвязывающей активностью; и (b) сбора продукта экспрессии стадии (а) с использованием аффинной хроматографии с белком А.

Изобретение относится к области биохимии. Предложен антисмысловой олигонуклеотид, содержащий по меньшей мере одну модифицированную межнуклеотидную связь, который гибридизуется с природным антисмысловым полинуклеотидом аполипопротеина A1 (ApoA1) и повышает экспрессию молекул ApoA1 по сравнению с нормальным контролем.

Настоящее изобретение относится к биохимии, в частности к иммуногенным композициям против ВИЧ-1, содержащим фармацевтически приемлемый носитель и антигенный пептид, выбранный из группы, состоящей из PWNASASNKSLDDIW, PWNASWANKSLDDIW, PWNASWSAKSLDDIW и PWNASWSNKALDDIW.
Изобретение относится к области биохимии, в частности к способу борьбы с нежелательной растительностью на поле, содержащем сельскохозяйственную культуру устойчивых к арилоксиалканоат ауксиновому гербициду растений хлопчатника, включающему применение к месту, где желательно уничтожение нежелательной растительности, эффективного количества 2,4-ДБ.

Изобретение относится к области биохимии, в частности к трансгенному растению осины, которое демонстрирует пониженную скорость разложения древесины по сравнению с нетрансформированным растением, содержащему XegA трансген, который кодирует фермент ксилоглюканазу гриба Penicillium canescens с сигнальным пептидом целлюлазы тополя белого.

Настоящее изобретение относится к области иммунологии. Предложен выделенный пептид, обладающий способностью индуцировать цитотоксические Т-лимфоциты (CTL) против белка NEIL3 в присутствии антигенпредставляющей клетки (АРС), несущей HLA-A*0201 и/или HLA-A*0206.

Данное изобретение относится к области биотехнологии и медицины. Предложено применение гантелеподобной линейной, ковалентно замкнутой экспрессионной конструкции ДНК с двухцепочечной основой и одноцепочечными петлями, расположенными на обоих концах основы, где основа комплементарных дезоксирибонуклеиновых кислот кольцевой цепочки ДНК включает промоторную последовательность, кодирующую последовательность и сигнал терминации, где конструкция ДНК кодирует TNF-α, для лечения меланомы, причем указанная конструкция ДНК вводится путем безыгольной инъекции и указанная конструкция вводится одновременно или последовательно с виндесином.

Настоящее изобретение относится к биотехнологии. Предложены соединение, способное ингибировать экспрессию рецептора глюкагона (GCGR), состоящее из 12-30 соединенных нуклеозидов, композиция, снижающая экспрессию GCGR, способы лечения метаболического заболевания, снижения или задержки начала повышения уровней глюкозы в крови, профилактики заболевания, ассоциированного с GCGR, применение предложенного соединения для приготовления лекарственного средства.

Изобретение относится к области биотехнологии, конкретно к способу повышения экспрессии полинуклеотида альфа-L-идуронидазы (IDUA), и может быть использовано в медицине.

Изобретение относится к генной инженерии. Описан способ доставки нуклеиновой кислоты в митохондрию и генетической модификации клетки, включающий воздействие на клетку композицией, содержащей по меньшей мере одну нуклеиновую кислоту и по меньшей мере один органоидно-направленный наноноситель, где наноноситель доставляет по меньшей мере одну нуклеиновую кислоту сквозь клеточную мембрану в митохондрию.

Изобретение относится к биохимии. Описаны способы повышения экспрессии полинуклеотида NANOG с помощью олигонуклеотидов длиной от 19 до 30 нуклеотидов. Описаны соответствующие олигонуклеотиды и композиция, содержащая их. Также описан способ предотвращения или лечения заболевания, ассоциированного с по меньшей мере одним полинуклеотидом NANOG и/или по меньшей мере одним продуктом, кодируемым указанным полинуклеотидом, включающий: введение пациенту терапевтически эффективной дозы по меньшей мере одного описанного олигонуклеотида. 9 н. и 26 з.п. ф-лы, 1 ил., 1 табл., 2 пр.
Наверх