Способ определения метилирования сайтов pucgpy регуляторных областей генов-онкомаркеров колоректального рака методом glad-пцр-анализа и набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для осуществления указанного способа



Способ определения метилирования сайтов pucgpy регуляторных областей генов-онкомаркеров колоректального рака методом glad-пцр-анализа и набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для осуществления указанного способа
Способ определения метилирования сайтов pucgpy регуляторных областей генов-онкомаркеров колоректального рака методом glad-пцр-анализа и набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для осуществления указанного способа
Способ определения метилирования сайтов pucgpy регуляторных областей генов-онкомаркеров колоректального рака методом glad-пцр-анализа и набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для осуществления указанного способа
Способ определения метилирования сайтов pucgpy регуляторных областей генов-онкомаркеров колоректального рака методом glad-пцр-анализа и набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для осуществления указанного способа
Способ определения метилирования сайтов pucgpy регуляторных областей генов-онкомаркеров колоректального рака методом glad-пцр-анализа и набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для осуществления указанного способа
Способ определения метилирования сайтов pucgpy регуляторных областей генов-онкомаркеров колоректального рака методом glad-пцр-анализа и набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для осуществления указанного способа
Способ определения метилирования сайтов pucgpy регуляторных областей генов-онкомаркеров колоректального рака методом glad-пцр-анализа и набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для осуществления указанного способа
Способ определения метилирования сайтов pucgpy регуляторных областей генов-онкомаркеров колоректального рака методом glad-пцр-анализа и набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для осуществления указанного способа
Способ определения метилирования сайтов pucgpy регуляторных областей генов-онкомаркеров колоректального рака методом glad-пцр-анализа и набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для осуществления указанного способа

 


Владельцы патента RU 2630669:

Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") (RU)

Изобретение относится к области биохимии. Описана группа изобретений, включающая набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации злокачественного поражения толстого кишечника и прямой кишки посредством анализа в образцах ДНК метелирования сайтов RCGY в заданных положениях регуляторных областей генов-онкомаркеров методом GLAD-ПЦР и способ идентификации злокачественного поражения толстого кишечника и прямой кишки посредством анализа в образцах ДНК метилирования сайтов RCGY в заданных положениях регуляторных областей генов-онкомаркеров методом GLAD-ПЦР. Указанный способ включает формирование панели генов-онкомаркеров колоректального рака: ADHFE1, ALX4, CNRIP1, EID3, ELMO1, ESR1, FBN1, HLTF, LAMA1, NEUROG1, NGFR, RARB, RXRG, RYR2, SDC2, SEPT9, SFRP2, SOCS3, SOX17, THBD, TMEFF2, UCHL1 и VIM. Изобретение расширяет арсенал олигонуклеотидных праймеров и флуоресцентно-меченных праймеров. 2 н.п. ф-лы., 3 ил., 4 табл., 3 пр., 1 прил.

 

Изобретение относится к области молекулярной биологии, биотехнологии и медицины, и может быть использовано в молекулярно-генетической диагностике онкологических заболеваний и для оценки эффективности противораковой терапии, а именно для анализа метилирования генов-онкомаркеров колоректального рака в образцах биологического материала.

Перспективным инструментом молекулярно-генетической диагностики и мониторинга онкологических заболеваний является эпигенетическая диагностика, то есть идентификация болезни путем выявления эпигенетических маркеров. Эпигенетические маркеры представляют собой химические группы, которые присоединяются к геномной ДНК человека (метилирование цитозиновых оснований с образованием 5-метилцитозина, 5mC) либо к ассоциированным с ней гистоновым комплексам и оказывают влияние на функциональную активность генов. Наиболее распространенным эпигенетическим нарушением при канцерогенезе является локальное гиперметилирование отдельных участков ДНК, так называемых CpG-островков, в регуляторных областях генов-онкосупрессоров, которые в норме лишены метальных групп. В настоящее время показано, что подобное аберрантное метилирование характерно для начальных стадий большинства ненаследственных (спорадических) форм рака, которые в среднем составляют более 90% всех случаев злокачественных новообразований.

Для осуществления эпигенетической диагностики злокачественных новообразований необходимо решить два ключевых вопроса:

а) какой метод детекции следует использовать для определения статуса метилирования генов;

б) метилирование регуляторных участков каких генов ассоциировано с конкретным онкологическим заболеванием?

Для решения первого вопроса, а именно для анализа статуса метилирования генов, применяется ряд методов, которые можно разделить на четыре группы.

Первая группа методов основана на бисульфитной конверсии ДНК, влекущей изменения ее нуклеотидного состава. В дальнейшем нужный участок конвертированного генома может быть амплифицирован в ПЦР и секвенирован для определения всех метилированных цитозиновых остатков. Если исследователя интересует статус метилирования конкретного CG-динуклеотида, то используются более простые способы анализа. Так, возможно проведение метилчувствительной ПЦР (другой употребляемый термин - «метилспецифическая ПЦР»), в которой проводятся две реакции с использованием праймеров, подобранных для случаев прохождения или непрохождения конверсии в исследуемом динуклеотиде. Другим широко используемым способом определения метилирования является обработка конвертированной ДНК эндонуклеазами рестрикции (метод COBRA, основанный на появлении или исчезновении сайтов узнавания ферментов в измененной ДНК). К недостаткам описанных методов относятся существенная деградация и значительные потери нуклеиновых кислот при проведении бисульфитной конверсии, что делает проблематичным анализ малого количества материала, трудоемкость, дороговизна исследования и значительные затраты времени [Umer M, Herceg Z. Deciphering the epigenetic code: an overview of DNA methylation analysis methods // Antioxid Redox Signal. - 2013. - V. 18. - P. 1972-1986].

Вторая группа методов включает в себя процедуры гидролиза ДНК метилчувствительными эндонуклеазами. Анализ статуса метилирования генов основан на том, что данные рестриктазы не способны распознавать и расщеплять последовательности, содержащие метилированные CG-сайты (например, фермент HpaII, узнающий и гидролизующий лишь неметилированный тетрануклеотид CCGG). Результаты реакции гидролиза могут быть проанализированы с помощью ПЦР с фланкирующими праймерами. Существенным ограничением для широкого применения этих методов является относительно небольшое число известных эндонуклеаз рестрикции, распознающих последовательности, содержащие CG-динуклеотиды, и при этом чувствительных к метилированию цитозиновых остатков в них [Shen L, Waterland RA. Methods of DNA methylation analysis // Curr Opin Clin Nutr Metab Care. - 2007. - V. 10. - P. 576-581]. Данный подход также не позволяет выявлять частично метилированную ДНК, тогда как именно такой паттерн метилирования CpG-островков характерен для самых ранних стадий канцерогенеза. Кроме того, использование данных методов предъявляет более высокие требования как к чистоте анализируемой ДНК, так и к качеству проведения исследования на всех стадиях, поскольку вывод о наличии метилирования в этих методах делается при отсутствии гидролиза ДНК метилчувствительными эндонуклеазами рестрикции. Однако недогидролиз ДНК может происходить в случаях наличия загрязнений или нарушений условий анализа. Это приводит к ложным выводам о наличии метилирования и как следствие к ложно-положительному диагнозу.

Третья группа методов базируется на использовании метил-связывающих белков (methyl binding domain containing proteins, MBD-белки) для изоляции метилированной ДНК и ее последующей амплификации. Известна, например, технология MethylMeter, разработанная специалистами американской компании RiboMed (патент Канады №2724343, опубл. 15.05.2008 г.), позволяющая достигать высоких показателей чувствительности и специфичности. Данная технология используется производителями некоторых тест-систем, например, G-CIMP DecisionDX американской компании Castle Biosciences. Для защиты данной тест-системы подана заявка США №2014272986, опубликованная 18.09.2014 г. Тем не менее, подобные методы остаются весьма трудоемкими, а для четкого количественного анализа результатов требуется сложное дорогостоящее оборудование.

Четвертая группа методов базируется на использовании сайт-специфических метилзависимых ДНК эндонуклеаз. После их открытия и начала коммерческого производства их препаратов появилась возможность использования этого нового класса ферментов в эпигенетических исследованиях. В отличие от обычных эндонуклеаз рестрикции, метилзависимые ферменты узнают только метилированные последовательности ДНК, что делает их еще одним удобным инструментом изучения статуса метилирования генов. В число ферментов данного класса входят производимые в России компанией ООО «СибЭнзайм» эндонуклеазы GlaI, BisI, BlsI, MteI и ряд других [http://russia.sibenzyme.com/products/m2_type].

Благодаря совпадению последовательности ДНК, являющейся продуктом метилирования de novo, и субстратной специфичности фермента GlaI исследователями ООО «СибЭнзайм» был разработан метод, названный GLAD-ПЦР (GlaI hydrolysis and Ligation Adapter Dependent PCR), который позволяет определять наличие сайтов R(5mC)GY в исследуемом участке ДНК [Кузнецов В. В. с соавт. Способ определения нуклеотидной последовательности Pu(5mC)GPy в заданном положении протяженной ДНК // Патент РФ №2525710 С1, опубл. 20.08.2014, Бюл. № 23]. Метод включает гидролиз ДНК ферментом GlaI, присоединение специфического адаптера к концам гидролизованной ДНК и последующую реакцию ПЦР в режиме реального времени с праймеров, окружающих целевой участок ДНК. Метод позволяет определить наличие одного или нескольких сайтов Pu(5mC)GPy внутри изучаемого фрагмента ДНК. Таким образом, метод GLAD-ПЦР может быть использован для определения статуса метилирования регуляторных участков генов.

Данный метод обладает рядом преимуществ, заключающихся в простоте выполнения, способности выявлять лишь метилированные сайты в сложных смесях ДНК и возможности количественно оценивать их число. Следует также отметить, что метод обладает значительной универсальностью и может быть применен для анализа любых сложных смесей ДНК, например, ДНК из опухолей, содержащей нуклеиновые кислоты не только из малигнантных, но и из нормальных клеток (клетки сосудов, соединительной ткани и т.д.). Апробация GLAD-ПЦР показала, что метод обладает высокой чувствительностью, позволяя детектировать метилированные сайты в сильноразбавленных растворах.

Указанный метод является универсальным методом детекции метилирования сайтов R(5mC)GY, позволяющим сформировать и описать конкретную панель генов, специфичную, например, для колоректального рака. Но в самом описании метода специфичные для различных видов онкологии панели генов отсутствуют.

Рак толстого кишечника и прямой кишки (колоректальный рак) - один из наиболее часто встречающихся видов злокачественных новообразований. В развитых странах мира ежегодно диагностируется более миллиона случаев этого заболевания, а летальность от рака этой локализации составляет более 33% даже в странах с высоким уровнем онкологической помощи [Walther A. et al. Genetic prognostic and predictive markers in colorectal cancer // Nat. Rev. Cancer. - 2009. - V. 9. - P. 489-499]. Как и в случае большинства других онкологических заболеваний, выявление данного вида рака на ранних стадиях во многом определяет успешность лечения, ввиду чего развитие чувствительных молекулярно-генетических, в том числе эпигенетических, методов диагностики колоректального рака несомненно является актуальной задачей. Однако начальные стадии патологии внутренних органов зачастую не сопровождаются определяемыми при наружном осмотре аномалиями или ощущаемыми пациентами нарушениями функций организма, что делает раннюю диагностику в этих случаях крайне затруднительной. Таким образом, использование биохимических и генетических анализов для диагностики колоректального рака является предпочтительным способом выявления заболевания, тем более, что такая диагностика возможна еще на бессимптомной стадии [Gyparaki MT, Basdra EK, Papavassiliou AG. DNA methylation biomarkers as diagnostic and prognostic tools in colorectal cancer // J Mol Med (Berl). - 2013. - V. 91. - P. 1249-1256].

Для разработки соответствующей диагностической системы необходимо найти ответ на второй вопрос: метилирование регуляторных участков каких именно генов ассоциировано с развитием колоректального рака?

Одна из первых масштабных работ по поиску маркерных генов для эпигенетической диагностики колоректального рака была проведена в 2008 году сотрудниками компании Epigenomics AG (Германия) [Lofton-Day C et al. DNA methylation biomarkers for blood-based colorectal cancer screening // Clin Chem. - 2008. - V. 54. - P. 414-423]. На первом этапе работы были использованы метилчувствительные ферменты рестрикции для анализа более 600 кандидатных фрагментов геномной ДНК, выделенной из опухолей и нормальной ткани. Были выбраны 56 участков ДНК, которые достоверно различались по степени метилирования в здоровых и малигнантных клетках. Далее эти участки дополнительно проверялись на микрочипах и в ПЦР в реальном времени. Это позволило сократить число генов, наиболее пригодных для использования в качестве эпигенетических маркеров колоректального рака, до семи (SEPT9, NGFR, TMEFF2, ALX4, EYA4, FOXL2, SIX6).

В дальнейшем большое число авторов опубликовало результаты своих исследований по поиску генов-онкомаркеров для эпигенетической диагностики колоректального рака, проведенных различными методами, включая такие современные подходы, как применение ДНК-микрочипов (например, серии Infinium HumanMethylation, Illumina, США), ограниченное (RRBS, Reduced Representation Bisulfite Sequencing) и полногеномное бисульфитное секвенирование (WGBS, Whole Genome Bisulphite Sequencing) секвенирующими системами нового поколения (Next Generation Sequencing, NGS) [Reinders J. et al. // Epigenomics. - 2010. - V. 2. - P. 209-220; Kaneda A., Yagi K. // Cancer Sci. - 2011. - V. 102. - P. 18-24; Kibriya M.G. et al. // BMC Med Genomics. - 2011. - 4:50; Kim Y.H. et al. // Ann Surg Oncol. - 2011. - V. 18. - P. 2338-2347; Gu H. et al. // Nat Protoc. - 2011. - V. 6. - P. 468-481; Yi J.M. et al. // Tumour Biol. - 2012. - V. 33. - P. 363-372; Hinoue T. et al. // Genome Res. - 2012. - V. 22. - P. 271-282; Lange C.P. et al. // PLoS One. - 2012. - 7:e50266; Li H. et al. // Oncol Rep. - 2012. - V. 28. - P. 99-104; Roperch J.P. et al. // BMC Cancer. - 2013. - P. 13-566; Naumov V.A. // Epigenetics. - 2013. - V. 8. - P. 921-934; Chen Y.A. et al. // Epigenetics. - 2013. - V. 8. - P. 203-209; Harper K.N. et al. // Cancer Epidemiol Biomarkers Prev. - 2013. - V. 22. - P. 1052-1060; Mitchell S.M. et al. // BMC Cancer. - 2014. - P. 14-54; Melson J. et al. // Int J Cancer. - 2014. - V. 134. - P. 2656-2662; Papadia C. et al. // Inflamm Bowel Dis. - 2014. - V. 20. - P. 271-277].

Некоторые из обнаруженных генов-онкомаркеров уже применяются в коммерческих тест-системах для диагностики колоректального рака. В 2008-2012 годах в компании Epigenomics AG (Германия) была разработана и запатентована тест-система «Epi proColon kit 2.0» для диагностики колоректального рака (международная заявка №WO2005001142, опубл. 06.01.2005 г.; заявка США №2014179563, опубл. 26.06.2014 г.) на основе выявления специфического эпигенетического маркера SEPT9 в периферической крови [Heichman KA. Blood-based testing for colorectal cancer screening // Mol Diagn Ther. 2014. - V. 18. - P. 127-135]. Метилирование другого гена (VIM, виментин) в малигнантных клетках послужило основой для создания тест-системы «ColoGuard assay» от компании LabCorp (США) [Lao VV, Grady WM. Epigenetics and colorectal cancer // Nat Rev Gastroenterol Hepatol. - 2011. - V. 8. - P. 686-700]. Однако подобные моно-тест-системы не предназначены для постановки окончательного диагноза, и их показатели могут служить лишь дополнительными индикаторами развития или отсутствия заболевания.

В совокупности полученные исследователями данные свидетельствуют о ненадежности диагностики, построенной на анализе одного гена и, соответственно, об актуальности разработки и внедрения тест-систем, основанных на определении статуса метилирования ДНК регуляторных областей ряда генов-онкомаркеров, позволяющих проводить диагностику более надежно и точно. Известна работа Lind с соавт., создавших диагностический набор для анализа метилирования шести генов: CNRIP1, FBN1, INA, MAL, SNCA и SPG20 [Lind G.E. et al. Identification of an epigenetic biomarker panel with high sensitivity and specificity for colorectal cancer and adenomas // Mol Cancer 2011. - V 10. - P. 85].

Наиболее близким аналогом (прототипом) является способ определения диагноза рака у индивидуума с подозрением на колоректальный рак (Международная заявка №WO2014062218, МПК C12Q1/68, опубл. 24.04.2014 г.), включающий: получение образца от индивидуума с подозрением на рак; гидролиз высокоочищенной геномной ДНК из исследуемого биоматериала с использованием бисульфитной конверсии ДНК; определения наличия или отсутствия высокого уровня экспрессии генов (определение уровня метилирования регуляторных областей генов-онкомаркеров с использованием цифровой ПЦР) по отношению к нормальному базовому стандарту для одной диагностической панели, включающей следующие биомаркеры: TFPI2, THBD, C9ORF50, ADHFEl, FGF12, PTPRT, ZNF568, KIAA1026, SFMBT2, и / или AUTS2; и диагностики рака при наличии высокого уровня экспрессии по отношению к нормальному базовому стандарту по меньшей мере одного биомаркера.

Недостатком известных аналогов и прототипа является использование бисульфитной конверсии ДНК, для которой характерны трудоемкость, дороговизна исследования и значительные затраты времени, а также деградация и значительные потери нуклеиновых кислот, что ведет к снижению точности и делает проблематичным анализ малого количества материала.

Техническим результатом предлагаемого изобретения является упрощение и повышение точности способа определения метилирования сайтов RCGY регуляторных областей генов-онкомаркеров колоректального рака и расширение его функциональных возможностей.

Указанный технический результат достигается разработанным набором олигонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации злокачественного поражения толстого кишечника и прямой кишки посредством анализа в образцах ДНК метилирования сайтов RCGY в заданных положениях регуляторных областей генов-онкомаркеров методом GLAD-ПЦР, имеющих структуру, приведенную в приложении (список последовательностей) и таблице 1:

Таблица 1

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера ADHFE1 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера ALX4 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера CNRIP1 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера EID3 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера ELMO1 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера ESR1 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера FBN1(1) (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера FBN1(2) (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера FBN1(3.1) (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера FBN1(3.3) (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера HLTF (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера LAMA1 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера NEUROG1 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера NGFR (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера RARB (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера RXRG (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера RYR2 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера SDC2 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера SEPT9 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера SFRP2 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера SOCS3 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера SOX17 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера THBD (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера TMEFF2 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера UCHL1 (5'→3'):

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера VIM (5'→3'):

где g - геномный праймер (genome); р - флуоресцентно-меченый зонд (zond); h - гибридный праймер (hybrid); FAM - флуоресцеин; BHQ1 - гаситель флуоресценции (Black Hole Quencher 1).

Учет результатов анализа проводится методом гибридизационно-флуоресцентной детекции продуктов ПЦР-амплификации в режиме реального времени.

Указанный технический результат достигается также созданием способа идентификации злокачественного поражения толстого кишечника и прямой кишки посредством анализа в образцах ДНК метилирования сайтов RCGY в заданных положениях регуляторных областей генов-онкомаркеров методом GLAD-ПЦР, включающем формирование панели генов-онкомаркеров колоректального рака: ADHFE1, ALX4, CNRIP1, EID3, ELMO1, ESR1, FBN1, HLTF, LAMA1, NEUROG1, NGFR, RARB, RXRG, RYR2, SDC2, SEPT9, SFRP2, SOCS3, SOX17, THBD, TMEFF2, UCHL1 и VIM путем отбора генов-онкомаркеров колоректального рака при биоинформационном анализе и рассмотрения нуклеотидных последовательностей предположительных регуляторных участков этих генов, выявление располагающихся в них CpG-островков, анализ первичной структуры CpG-островков и их соответствие определенным критериям выбора. В регуляторной области (промоторе или первом экзоне) этих генов обычно присутствуют несколько сайтов RCGY, метилирование которых может вызывать подавление экспрессии гена при колоректальном раке. Поэтому далее на образцах ДНК из опухолевого материала или клеточных линий осуществляют отбор наиболее метилированных сайтов с помощью GLAD-ПЦР-анализа, которые в могут использоваться для диагностики и/или прогнозирования течения колоректального рака.

Далее осуществляют гидролиз высокоочищенной геномной ДНК из исследуемого биоматериала метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI, лигирование универсального олигонуклеотидного адаптера , где р - фосфат с последующей амплификацией в реальном времени с использованием геномных праймеров и зондов, комплементарных последовательностям регуляторных областей указанных генов в исследуемой ДНК, и гибридных праймеров, 3'-концы которых комплементарны 5'-концам ДНК в заданных местах гидролиза GlaI, а оставшаяся часть комплементарнаадаптерной последовательности, и делают заключение о наличии последовательности R(5mC)GY, где 5mC - 5-метилцитозин, R-А или G, Y-Т или С в регуляторных областях указанных генов по появлению флуоресцентного сигнала для определения статуса метилирования сайтов в клинических образцах методом GLAD-ПЦР-анализа и на основе информации о статусе метилирования одного или нескольких сайтов делают вывод о наличии или отсутствия колоректального рака.

Структура адаптера подбирается таким образом, чтобы его нуклеотидная последовательность была уникальна для генома человека, оптимальная по GC составу и защищена от образования самокомплементарных структур.

Причем, при реализации способа используют вышеуказанный набор праймеров и зондов, представленных в Приложении (список последовательностей).

Изобретение иллюстрируется следующим графическим материалом, представленным на фигурах 1-3. На фиг. 1 представлен пример поиска наиболее часто метилированного сайта RCGY на выбранном участке регуляторной области гена FBN1(3.3). Как видно из фиг. 1, таким оказался третий сайт в ампликоне, которому соответствует гибридный праймер .

На панели А представлен фрагмент нуклеотидной последовательности; показаны участки связывания геномного праймера, зонда и геном-специфичных 3'-тетрануклеотидов гибридных праймеров. На панели Б приведены кривые накопления флуоресценции в ходе ПЦР с использованием различных гибридных праймеров. Заглавными буквами «GCGG» обозначен выбранный гибридный праймер, соответствующий точке гидролиза ДНК по наиболее часто метилированному третьему сайту RCGY в ампликоне.

На фиг. 2: представлен результат GLAD-ПЦР-анализа отобранного сайта RCGY в регуляторной области гена SEPT9 в клинических образцах. Погоризонтальной оси отображены номера клинических образцов, где T – соответствует опухолевому образцу, а N – здоровому. По вертикальной оси приведено усредненное значение Cq для каждого образца с указанием доверительного интервала.

На фиг. 3 приведена ROC (Receiver Operating Characteristic) кривая, полученная в результате ROC анализа результатов GLAD-ПЦР-анализа статуса метилирования RCGY сайта-маркера колоректального рака гена SEPT9. Параметры ROC-анализа приведены в таблице 4. ROC-анализ является стандартным методом оценки диагностической ценности тестов.

Сущность изобретения поясняется следующими примерами 1-3, реализующими способ определения метилирования сайтов RCGY регуляторных областей генов-онкомаркеров колоректального рака методом GLAD-ПЦР-анализа, а также состав олигонуклеотидных праймеров и флуоресцентно-меченых зондов для осуществления указанного способа.

Пример 1. Разработка специфических праймеров и флуоресцентно-меченых зондов на участки CpG-островков регуляторных областей генов-онкомаркеров колоректального рака.

Изучение опубликованных в литературе данных по метилированию генов при онкопатологиях нижних отделов кишечника, данных RRBS-секвенирования (Reduced Representation Bisulfite Sequencing, бисульфитное секвенирование ограниченных выборок локусов) в проекте ENCODE/HudsonAlpha и последующий биоинформационный анализ нуклеотидных последовательностей регуляторных участков описанных ранее генов позволил выбрать кандидатную комбинацию участков CpG-островков регуляторных областей генов-онкомаркеров колоректального рака, удовлетворяющих критериям анализа методом GLAD-ПЦР (табл. 2).

На первом этапе работы был проведен анализ литературных данных последних лет по метилированию генов при онкопатологиях нижних отделов кишечника, данных RRBS-секвенирования (Reduced Representation Bisulfite Sequencing, бисульфитное секвенирование ограниченных выборок локусов) в проекте ENCODE/HudsonAlpha и сформирован список из 57 генов-онкомаркеров, метилирование которых происходит с высокой частотой в ДНК клеток колоректального рака. Этот список включает в себя следующие гены: SEPT9, SYNE1, FGF12, GAD2, HAND1, CACNA1G, CNRIP1, TLX2, LOX, LAMA1, GAS7, SLC6A15, BOLL, TFPI2, SOCS3, TRH, MDFI, C1orf70, RUNX3, TMEFF2, SFRP2, WNT5A, IGFBP7, TFPI2, FOXE1, NPY, WIF1, CIDEB, RIC3, KCNQ5, COL4A1, SPG20, SND1, PENK, CDO1, THBD, EDIL3, DUSP26, UCHL1, STOX2, ELMO1, SLC30A10, IGF2, ESR1, EYA4, NALCN, FLI1, RXRg, RYR2, PRKAR1B, BEND5, ITGA4, ADHFE1, NGFR, GATA4, NEYROG1, FBN1. При выборе генов для данного списка учитывалось также количество проанализированных проб в описанных авторами статей экспериментах, так как достоверные данные могут быть получены лишь при большом числе образцов ДНК в выборке. Большое значение также придавалось такому описанному авторами работ свойству, как возможность выявления метилирования гена на ранних стадиях заболевания, хотя, к сожалению, число публикаций, в которых рассматривалась зависимость метилирования гена от стадии онкопатологии, очень незначительно.

На втором этапе работы были рассмотрены нуклеотидные последовательности предположительных регуляторных участков этих 57 генов и выявлены CpG-островки, располагающиеся в них. Первичные структуры CpG-островков были проанализированы на их соответствие критериям выбора:

1) Наличие данных из опубликованных работ, показывающих высокую частоту метилирования регуляторного участка гена в исследованных выборках образцов ДНК от больных колоректальным раком при низкой частоте метилирования данного участка у здоровых доноров или в прилегающих нормальных тканях толстой и прямой кишки онкопациентов.

2) Присутствие СpG-островка в области начала гена (или в районе точки старта кодирования альтернативной изоформы белка - продукта гена), что в большинстве случаев служит свидетельством регуляции активности данного гена путем метилирования этой области.

3) Присутствие потенциального сайта узнавания эндонуклеазы GlaI (RCGY) в нуклеотидной последовательности на выбранном участке.

4) Достаточное расстояние (50 п.н. и более) между двумя потенциальными сайтами узнавания эндонуклеазы GlaI для одновременного отжига на этом участке флуоресцентно-меченого зонда и геномного праймера и возможность подбора для этого участка праймера и зонда, не подверженных теоретической кросс-гибридизации между собой и с последовательностью адаптера.

5) Значение G+C состава на кандидатном участке, не превышающее 80%, что вызвано ограничениями системы амплификации ДНК in vitro, в которой используется HotStart Taq ДНК-полимераза.

6) Уникальность нуклеотидной последовательности кандидатного участка анализа (невхождение его в число повторяющихся элементов генома) во избежание неспецифического отжига подобранного геномного праймера в других областях генома, что может привести к значительному снижению эффективности амплификации и затруднению детекции результатов при проведении ПЦР в реальном времени.

В результате проведенного биоинформационного анализа регуляторных участков каждого из перечисленных генов для проведения экспериментального исследования были отобраны 26 областей из данных участков (табл.2), которые удовлетворяют всем требуемым критериям проведения анализа с помощью метода GLAD-ПЦР, и подобраны специфические праймеры и зонды на выбранные участки регуляторных областей генов-онкомаркеров (табл.3).

Таблица 2.

Участки регуляторных областей генов-онкомаркеров перспективные для GLAD-ПЦР-анализа.

Ген (регион) Название гена Расположение в хромосоме Координаты участка в хромосоме (версия генома человека GRCh38.p7)
ADHFE1 alcohol dehydrogenase, iron containing 1 8q12.3 chr8:66432540-66432621
ALX4 ALX homeobox 4 11p11.2 chr11:44304627-44304798
CNRIP1 cannabinoid receptor interacting protein 1 2p13 chr2:68319340-68319419
EID3 EP300 interacting inhibitor of differentiation 3 12q23.3 chr12:104303544-104303697
ELMO1 engulfment and cell motility 1 7p14.1 chr7:37448622-37448735
ESR1 estrogen receptor 1 6q24-q27 chr6:151807784-151807876
FBN1(1) fibrillin 1 15q21.1 chr15:48644977-48645057
FBN1(2) chr15:48645128-48645191
FBN1(3.1) chr15:48645489-48645638
FBN1(3.3) chr15:48645378-48645537
HLTF helicase-like transcription factor 3q25.1-q26.1 chr3:149086693-149086780
LAMA1 laminin subunit alpha 1 18p11.3 chr18:7117909-7118044
NEUROG1 neurogenin 1 5q23-q31 chr5:135536157-135536283
NGFR nerve growth factor receptor 17q21-q22 chr17:49495262-49495389
RARB retinoic acid receptor beta 3p24 chr3:25428290-25428491
RXRG retinoid X receptor gamma 1q22-q23 chr1:165445168-165445307
RYR2 ryanodine receptor 2 1q43 chr1:237043053-237043209
SDC2 syndecan 2 8q22-q23 chr8:96494024-96494159
SEPT9 septin 9 17q25.3 chr17:77372872-77372956
SFRP2 secreted frizzled-related protein 2 4q31.3 chr4:153789082-153789314
SOCS3 suppressor of cytokine signaling 3 17q25.3 chr17:78359402-78359490
SOX17 SRY-box 17 8q11.23 chr8:54458606-54458751
THBD thrombomodulin 20p11.21 chr20:23049725-23049846
TMEFF2 transmembrane protein with EGF-like and two follistatin-like domains 2 2q32.3 chr2:192195162-192195377
UCHL1 ubiquitin C-terminal hydrolase L1 4p13 chr4:41256767-41256854
VIM vimentin 10p13 chr10:17229414-17229552

Используемые в работе последовательности регуляторных участков генов по версии генома человека GRCh37/hg19 были получены из международной базы данных GenBank. Для анализа и расчетов праймеров и зондов, изучения их специфичности использовали семейство компьютерных программ Vector NTI 11.5 (Invitrogen, США) и онлайн интернет-ресурсы базы данных Национального центра биотехнологической информации США (Blast NCBI, http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Таблица 3.

Cпецифические праймеры и зонды на участки регуляторных областей генов-онкомаркеров.

Ген (регион) Последовательность праймеров и зондов*
ADHFE1 g: GTGGGCACCCTGCGGTCC
p: FAM-CCCGCCGGCCCCGCACTC-BHQ1
r: GGTCGCGTACTTGCTGAGGCA
ALX4 g: CGTCAACAACCTCTCATCC
p: FAM-TCCATTTCTTATTTCAGTTTGCCACCA-BHQ1
r: GGACTCTGGTTTCTAAGATCAG
CNRIP1 g: GCCAGACCCTCGCCCAGACA
p: FAM-CGAGGCCCGGCAGGTCCCCC-BHQ1
r: CGTCATTAGGCTGGATGCGCA
EID3 g: GCTCCGCGGGAAGACAGCC
p: FAM-CCCGGCCCAGCCACAAGC-BHQ1
r: TTTGAAAAAGAATAGCTGTCCCCTGA
ELMO1 g: GGGTCGCCGGAGCTCTGA
p: FAM-AACCCTTGCCGCTGCTGTCCTGC-BHQ1
r: CGCCAGCCCAGGAAACTTTAC
ESR1 g: CGCAGGGCAGAAGGCTCAGAA
p: FAM-TGCTCTTTTTCCAGGTGGCCCGCC-BHQ1
r: CGGGACATGCGCTGCGTC
FBN1(1) g: GCGGGGAGACTTTCAGGGCA
p: FAM-ATGCTGAAGCCTCGCGGTCCCC-BHQ1
r: CACGGGTTGGGCTTGGGA
FBN1(2) g: CAGCAGCCCCGGCCGATC
p: FAM-CCTCCCGGGCCCCGCCAGA-BHQ1
r: GGGTACTTTGCGCCGCGCTC
FBN1(3.1) g: GTAGCGGCCACGACTGGGA
p: FAM-CAGCCGCCGCCGCCTCCTC-BHQ1
r: CCGGCTGCACCCACTGGA
FBN1(3.3) g: GAGCCCGGCACCAAGAGC
p: FAM-CCCTCCCCTGCCTGACAGCTTCC-BHQ1
r: CACCGGGGCTGGAGCTGC
HLTF g: AACAAAACACCGGCACCGCA
p: FAM-CAGTCGCACTCCTGGGGCCTCGT-BHQ1
r: GTTCTTCCCCGCCCCCAA
LAMA1 g: ccaccttctctgcccacctccta
p: FAM-CTGACCGCGGCCGCCTCCC -BHQ1
r: CCGCCACCCAGACCCCTC
NEUROG1 g: GTGCCTCGGCCGCTAATCG
p: FAM-CCGACCCCGCCTCTGTTTCACTGC-BHQ1
r: CCGTAATTACCGCCGGCCAATC

NGFR g: TGGCTTCACCCAGCCTCTC
p: FAM-CAGCCAGAGCGAGCCGAGCC-BHQ1
r: TCCAGCTCGGTCCGCTTTG
RARB g: TTCAGAGGCAGGAGGGTCTATTC
p: FAM-TCCCAGTCCTCAAACAGCTCGCATGG-BHQ1
r: GGTTCCCAGAAAGATCCCAAGTTC
RXRG g: GCCGCCGTCACCGCTACT
p: FAM-CCACCGCCGTCGCTGCTGC-BHQ1
r: GTGCCACCCGGTAGGGACC
RYR2 g: GGGGACCACGGAGGCGACT
p: FAM-TTTCCCCCAAGTCAAGGTGCTGCGAAA-BHQ1
r: CGGGGGTGATGGTGCAGGA
SDC2 g: GCGATTGCGGCTCAGGCT
p: FAM-CCCCGAGCCCGAGTCCCCG-BHQ1
r: GGGAGTGCAGAAACCAACAAGTGA
SEPT9 g: GCAGGAGGCTGTATTTGGG
p: FAM-AGCCAAACAAAGTTCTCTGTCACCGCC-BHQ1
r: CGCTGCCGTTTAACCCTTG
SFRP2 g: GCACAGCCAGAGTTTTCTTG
p: FAM-TACCCTTCATTGGCTCCTCCCTTGCT-BHQ1
r: AGGCTTCTCTGTTTGTTGTTTAAAG
SOCS3 g: CAGTCCCGGGGGCCCTTCT
p: FAM-TGCTCCCCACCCGGCCACACTCC-BHQ1
r: CAAGGGCGCAGCGTGGGA
SOX17 g: CGCCCTCCGACCCTCCAA
p: FAM-TCCCGGATTCCCCAGGTGGCC-BHQ1
r: CAGTTCAGGGCCAAGGGTGCT
THBD g: GTTCGGGAAAAGGAAGGAAGTGC
p: FAM-ATTGCTGGGTTCTCTGGCCGCC-BHQ1
r: TTACTCATCCCGGCGAGGTGA
TMEFF2 g: GGTGGGCTACCCGCACACTCATA
p: FAM-CCATTCGCCTCACTCTCCGCTCCA-BHQ1
r: CGCCGACTCGCCCCTCTC
UCHL1 g: GCAGAACCAAGCGAGGGGGAA
p: FAM-CGTACCCATCTGGCCGCGACCGTC-BHQ1
r: GGGGCCCGGCCGTACCAC
VIM g: TCCGCAGCCATGTCCACCA
p: FAM-CCGTGTCCTCGTCCTCCTACCGCAG-BHQ1
r: GCTGCCCAGGCTGTAGGTGC

*Примечание: g – геномный праймер; p – флуоресцентно-меченый зонд; r – дополнительный геномный праймер (reverse), впоследствии заменяемый в GLAD-ПЦР гибридным праймером (пример 2); FAM – флуоресцеин; BHQ1 – гаситель флуоресценции (Black Hole Quencher 1).

Реакцию ПЦР в режиме реального времени проводили в объеме 20 мкл в трех повторах на детектирующем амплификаторе CXF-96 («Bio-Rad», США) по универсальной для всех амплифицируемых участков программе: 95°С 3 мин, далее 5 циклов без детекции: 95°С 10 сек, 61°С 15 сек, 72°С 20 сек; затем 50 циклов с детекцией по каналу FAM на стадии отжига: 95°С 10 сек, 61°С 15 сек, 72°С 20 сек. Концентрации реакционных компонентов ПЦР были аналогичны указанным в примере 2. В экспериментах использовали лейкоцитарную ДНК здорового донора, полученную и очищенную, как описано ранее [Абдурашитов М.А. с соавт. Рестрикционный анализ ДНК человека – новые возможности в ДНК-диагностике. Медицинская генетика. 2007. - Т. 6. - С. 29-36]. Pезультаты амплификации соответствовали ожидаемым. Последовательности разработанных праймеров и зондов представлены в таблице 3. Впоследствии, при проведении GLAD-ПЦР, один из праймеров, обозначенный в таблице как «r» (reverse), заменяли на отобранный гибридный праймер (пример 2).

Пример 2. Поиск метилированных сайтов RCGY для GLAD-ПЦР-анализа

Изучен статус метилирования сайтов RCGY в пределах выбранных участков ДНК с целью выбора оптимальных сайтов для дальнейшего GLAD-ПЦР-анализа клинических образцов. Для поиска перспективных сайтов R(5mC)GY в пределах выбранных для анализа участков регуляторных областей генов-онкомаркеров использовали препарат ДНК из клеток колоректального рака линии SW837 (линия клеток аденокарциномы ободочной кишки), выделенный известным методом [Sambrook J., Russel D. Molecular cloning: a laboratory manual. 3rd ed. – New York: Cold Spring Harbor Laboratory Press, 2001. – 2222 p.]. Поиск проводили методом подбора гибридных праймеров под близлежащие сайты RCGY на протяжении не более 400 п.о. от положения геномного праймера. Использовали методологию, структуры олигонуклеотидного адаптера и гибридных праймеров согласно известному способу [Кузнецов В. В. с соавт. Способ определения нуклеотидной последовательности Pu(5mC)GPy в заданном положении протяженной ДНК // Патент РФ №2525710 С1, опубл. 20.08.2014, Бюл. № 23].

Структура гибридного праймера представляет собой 19-звенную последовательность следующего состава: 5’-CCTGCTCTTTCATCGgYNN-3’, где подчеркиванием выделена 15-звенная часть праймера, комплементарная универсальному олигонуклеотидному адаптеру, а gYNN – 4-звенник, комплементарный геномной последовательности в точке гидролиза ДНК метилзависимой эндонуклеазой GlaI. Данная структура предполагает 32 варианта гибридных праймеров, соответствующих различным точкам гидролиза ДНК по сайту R(5mC)GY.

К 45 нг препарата ДНК добавляли метилзависимую сайт-специфическую ДНК-эндонуклеазу GlaI в количестве 1,5 е.а. и компоненты буфера для достижения следующего состава в объеме 21,7 мкл: 20 мМ Tris-SO4, pH 8.0, 4 мМ MgCl2, 1 мМ ß-меркаптоэтанол, 100 нг/мкл БСА. Гидролиз проводили в течение 30 мин при 30 С с последующей инактивацией GlaI при 65 С в течение 20 мин.

Далее в к GlaI-гидролизату добавляли АТФ до конечной концентрации 0,5 мМ, ß-меркаптоэтанол до 6,8 мМ, универсальный олигонуклеотидный адаптер 5’-CCTGCTCTTTCATCG-3’/3’-p-GGACGAGAAAGTAGC-p-5’, до конечной концентрации 0,5 мкМ и 1000 е.а. высокоактивной T4 ДНК-лигазы. Реакцию лигирования адаптера проводили в 30 мкл реакционной смеси в течение 15 мин при 25 С, затем лигазу термоинактивировали при 65 С в течение 20 мин.

Для проведения ПЦР в режиме реального времени к лигазной смеси добавляли следующие компоненты до достижения итоговых концентраций в конечном объеме, равном 60 мкл: 50 мМ Tris-SO4, pH 9,0, 30 мМ KCl, 10 мМ сульфата аммония, 3 мМ MgCl2, 0,2 мМ смеси дезоксирибонуклеозидтрифосфатов, 0,01 % Tween-20, смесь геномного праймера, гибридного праймера и зонда по 0,4 мкМ каждого и 0,05 е.а./мкл Hot Start ДНК-полимеразы. Для повышения эффективности амплификации GC-богатых участков ДНК использовали стабилизатор. Полученную реакционную смесь (60 мкл) разделяли на три равные части.

Реакцию ПЦР в режиме реального времени проводили в объеме 20 мкл в трех повторах на детектирующем амплификаторе CXF-96 («Bio-Rad», США) по программе: 95°С 3 мин, далее 5 циклов без детекции: 95°С 10 сек, 61°С 15 сек, 72°С 20 сек; затем 50 циклов с детекцией (канал FAM) на стадии отжига: 95°С 10 сек, 61°С 15 сек, 72°С 20 сек. Результаты анализировали при помощи программного обеспечения амплификатора CXF-96 и интерпретировали на основании наличия (или отсутствия) пересечения кривых флуоресценции образцов с пороговыми линиями, что соответствовало наличию или отсутствию значения порогового цикла «Cq» в соответствующей графе таблицы результатов программы амплификатора.

На фиг. 1 представлен пример поиска наиболее часто метилированного сайта RCGY на выбранном участке регуляторной области гена FBN1(3.3). Выбор наиболее метилированного сайта RCGY и соответствующего ему гибридного праймера для GLAD-ПЦР анализа в регуляторной области гена FBN1. (a) Фрагмент нуклеотидной последоваательности регуляторного участка гена FBN1. Показаны геномные праймеры, флуоресцентные зонды, GlaI специфичные сайты (RCGY) и четырехнуклеотидная последовательность соответствующего гибридного праймера. Гибридные праймеры, соответствующие наиболее метилированным сайтам RCGY показаны заглавными буквами. Координаты участка в хромосоме даны в соответствии с геномной сборкой GRCh38/hg38. (b) Кривые ПЦР в реальном времени полученные с применением различных гибридных праймеров в GLAD-ПЦР-анализе регуляторного участка гена FBN1 (3.1).

Как видно из фиг. 1, таким оказался третий сайт в ампликоне, которому соответствует гибридный праймер 5’- CCTGCTCTTTCATCGGCCG -3’.

Результаты поиска наиболее метилированных сайтов RCGY из регуляторных областей генов ADHFE1, ALX4, CNRIP1, EID3, ELMO1, ESR1, FBN1, HLTF, LAMA1, NEUROG1, NGFR, RARB, RXRG, RYR2, SDC2, SEPT9, SFRP2, SOCS3, SOX17, THBD, TMEFF2, UCHL1 и VIM, перспективных для GLAD-ПЦР-анализа клинических образцов и идентификации колоректального рака приведены в Таблице 1.

Пример 3. GLAD-ПЦР-анализ статуса метилирования генов-онкомаркеров колоректального рака

Образцы операционного материала опухолей (n = 21) и нормальной слизистой кишечника (n = 9) от больных колоректальным раком были получены из ФГУП Северский биофизический научный центр ФМБА России (г. Северск, Томская обл., РФ). Для GLAD-ПЦР-анализа статуса метилирования сайтов RCGY в заданных положениях участка ДНК определенного гена использовали препараты геномных ДНК, выделенные из клинических образцов известным методом фенол-хлороформной экстракции [Sambrook J., Russel D. Molecular cloning: a laboratory manual. 3rd ed. – New York: Cold Spring Harbor Laboratory Press, 2001. – 2222 p.], прошедшие обработку РНК-азой А для очистки от примесей РНК и фрагментацию редкощепящей эндонуклеазой рестрикции TaqI для более полного гидролиза ДНК. Концентрации образцов ДНК (нг/мкл) определяли спектрофотометрически. Реакцию GLAD-ПЦР проводили, как описано в примере 2. В реакцию брали 9 нг ДНК, ПЦР проводили в трех повторах для каждого образца (по 3 нг ДНК, т.е. по ~103 копий генома на реакцию). Один из геномных праймеров в ПЦР заменяли на подобранный, как описано в примере 2, т.е. гибридный праймер.

Результаты проведенного анализа для гена SEPT9 представлены на фиг. 2: результаты GLAD-ПЦР-анализа отобранного сайта RCGY в регуляторной области гена SEPT9 в клинических образцах. По горизонтальной оси отображены номера клинических образцов, где T – соответствует опухолевому образцу, а N – здоровому. По вертикальной оси приведено усредненное значение Cq для каждого образца с указанием доверительного интервала. В соответствии с полученными значениями Cq для каждого цикла экспериментов для оценки чувствительности и специфичности каждого маркера были построены ROC кривые и оценена площадь под кривой [E. R. DeLong, D. M. DeLong, and D. L. Clarke-Pearson, “Comparing the areas under two or more correlated receiver operating characteristic curves: a nonparametric approach,” Biometrics, vol. 44, no. 3, pp. 837–845, 1988]. Результаты оценки приведены в таблице 4, а соответствующие кривые на рисунке фиг.3 - ROC кривая для GLAD-ПЦР-анализа статуса метилирования RCGY сайта-маркера колоректального рака для гена SEPT9.

В ходе ROC-анализа рассчитывался оптимальный пороговый цикл отсечения «Ctопт», при котором суммарное значение чувствительности и специфичности было максимальным. Анализируемый образец считали положительным, если среднее значение «Ct» для образца было меньше или равно «Ctопт». Анализируемый образец считали отрицательным, если среднее значение «Ct» для образца превышало «Ctопт».

Таблица 4

Оценка диагностической ценности отобранного сайта RCGY в регуляторной области гена-онкомаркера колоректального рака SEPT9 методом GLAD-ПЦР-анализа.

Ген (регион) Количество детектировнных образцов колоректального рака / общее число образцов опухолей Чувствительность,
%
Количество отрицательных результатов / общее число здоровых образцов Специфичность,
%
Площадь под кривой
(стандартное отклонение)
95% доверительный интервал
SEPT9 16/21 76.2 9/9 100 0.862 (0.067) 0.688–0.960

Таким образом, в примере 3 показана возможность успешного применения метода GLAD-ПЦР для идентификации злокачественного поражения толстого кишечника и прямой кишки с использованием разработанного набора олигонуклеотидных праймеров и флуоресцентно-меченых зондов для анализа методом GLAD-ПЦР статуса метилирования заданных сайтов RCGY в регуляторных областях генов-онкомаркеров колоректального рака.

1. Набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации злокачественного поражения толстого кишечника и прямой кишки посредством анализа в образцах ДНК метилирования сайтов RCGY в заданных положениях регуляторных областей генов-онкомаркеров методом GLAD-ПЦР, имеющих следующую структуру:

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера ADHFE1 (5'→3'):

ADHFE1_g: 5'-GTGGGCACCCTGCGGTCC-3' (18 н.)
ADHFE1_p: 5'-FAM-CCCGCCGGCCCCGCACTC-BHQ1-3' (18 н.)
ADHFE1_h: 5'-CCTGCTCTTTCATCGGTAC-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера ALX4 (5'→3'):

ALX4_g: 5'-CGTCAACAACCTCTCATCC-3' (18 н.)
ALX4_р: 5'-FAM-TCCATTTCTTATTTCAGTTTGCCACCA-BHQ1-3' (18 н.)
ALX4_h: 5'-CCTGCTCTTTCATCGGCGC-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера CNRIP1 (5'→3'):

CNRIP1_g: 5'-GCCAGACCCTCGCCCAGACA-3' (20 н.)
CNRIP1_p: 5'-FAM-CGAGGCCCGGCAGGTCCCCC-BHQ1 (20 н.)
CNRIP1_h: 5'-CCTGCTCTTTCATCGGCGA-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера EID3 (5'→3'):

EID3_g: 5'-GCTCCGCGGGAAGACAGCC-3' (19 н.)
EID3_p: 5'-FAM-CCCGGCCCAGCCACAAGC-BHQ1-3' (18 н.)
EID3_h: 5'-CCTGCTCTTTCATCGGTGT-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера ELMO1 (5'):

ELMO1_g: 5'-GGGTCGCCGGAGCTCTGA-3' (18 н.)
ELMO1_p: 5'-FAM-AACCCTTGCCGCTGCTGTCCTGC-BHQ1-3' (23 н.)
ELMO1 _h: 5'-CCTGCTCTTTCATCGGCCG-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера ESR1 (5'→3'):

ESR1_g: 5'-CGCAGGGCAGAAGGCTCAGAA-3' (21 н.)
ESR1_p: 5'-FAM-TGCTCTTTTTCCAGGTGGCCCGCC-BHQ1-3' (24 н.)
ESR1_h: 5'-CCTGCTCTTTCATCGGTGT-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера FBN1(1) (5'→3'):

FBN1(1)_g: 5'-GCGGGGAGACTTTCAGGGCA-3' (20 н.)
FBN1(1)_p: 5'-FAM-ATGCTGAAGCCTCGCGGTCCCC-BHQ1-3' (22 н.)
FBN1(1)_h: 5'-CCTGCTCTTTCATCGGCGC-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера FBN1(2) (5'→3'):

FBN1(2)_g: 5'-CAGCAGCCCCGGCCGATC-3' (18 н.)
FBN1(2)_p: 5'-FAM-CCTCCCGGGCCCCGCCAGA-BHQ1-3' (19 н.)
FBN1(2)_h: 5'-CCTGCTCTTTCATCGGCTC-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера FBN1(3.1) (5'→3'):

FBN1(3.1)_g: 5'-GTAGCGGCCACGACTGGGA-3' (19 н.)
FBN1(3.1)_p: 5'-FAM-CAGCCGCCGCCGCCTCCTC-BHQ1-3' (19 н.)
FBN1(3.1)_h: 5'-CCTGCTCTTTCATCGGCGG-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера FBN1(3.3) (5'→3'):

FBN1(3.3)_g: 5'-GAGCCCGGCACCAAGAGC-3' (18 н.)
FBN1(3.3)_p: 5'-FAM-CCCTCCCCTGCCTGACAGCTTCC-BHQ1-3' (23 н.)
FBN1(3.3)_h: 5'-CCTGCTCTTTCATCGGCCG-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера HLTF(5'→3'):

HLTF_g: 5'-AACAAAACACCGGCACCGCA-3' (20 н.)
HLTF_p: 5'-FAM-CAGTCGCACTCCTGGGGCCTCGT-BHQ1-3' (23 н.)
HLTF_h: 5'-CCTGCTCTTTCATCGGCGG-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера LAMA1 (5'→3'):

LAMA1_g: 5'-CCACCTTCTCTGCCCACCTCCTA-3' (23 н.)
LAMA1_p: 5'-FAM-CTGACCGCGGCCGCCTCCC-BHQ1-3' (19 н.)
LAMA1_h: 5'-CCTGCTCTTTCATCGGCGG-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера NEUROG1 (5'→3'):

NEUROG1_g: 5'-GTGCCTCGGCCGCTAATCG-3' (19 н.)
NEUROG1_p: 5'-FAM-CCGACCCCGCCTCTGTTTCACTGC-BHQ1-3' (24 н.)
NEUROG1_h: 5'-CCTGCTCTTTCATCGGCGG-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера NGFR (5'→3'):

NGFR_g: 5'-TGGCTTCACCCAGCCTCTC-3' (19 н.)
NGFR_р: 5'-FAM-CAGCCAGAGCGAGCCGAGCC-BHQ1-3' (20 н.)
NGFR_h: 5'-CCTGCTCTTTCATCGGCTC-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера RARB (5'→3'):

RARB_g: 5'-TTCAGAGGCAGGAGGGTCTATTC-3' (23 н.)
RARB_p: 5'-FAM-TCCCAGTCCTCAAACAGCTCGCATGG-BHQ1-3' (26 н.)
RARB_h: 5'-CCTGCTCTTTCATCGGTTC-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера RXRG (5'→3'):

RXRG_g: 5'-GCCGCCGTCACCGCTACT-3' (18 н.)
RXRG_p: 5'-FAM-CCACCGCCGTCGCTGCTGC-BHQ1-3' (19 н.)
RXRG_h: 5'-CCTGCTCTTTCATCGGCGG-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера RYR2 (5'→3'):

RYR2_g: 5'-GGGGACCACGGAGGCGACT-3' (19 н.)
RYR2_p: 5'-FAM-TTTCCCCCAAGTCAAGGTGCTGCGAAA-BHQ1-3' (27 н.)
RYR2_h:. 5'-CCTGCTCTTTCATCGGCGT-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера SDC2 (5'→3'):

SDC2_g: 5'-GCGATTGCGGCTCAGGCT-3' (18 н.)
SDC2_p: 5'-FAM-CCCCGAGCCCGAGTCCCCG-BHQ1-3' (19 н.)
SDC2_h: 5'-CCTGCTCTTTCATCGGTTC-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера SEPT9 (5'→3'):

SEPT9_g: 5'-GCAGGAGGCTGTATTTGGG-3' (19 н.)
SEPT9_p: 5'-FAM-AGCCAAACAAAGTTCTCTGTCACCGCC-BHQ1-3' (27 н.)
SEPT9_h: 5'-CCTGCTCTTTCATCGGCAG-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера SFRP2 (5'→3'):

SFRP2_g: 5'-GCACAGCCAGAGTTTTCTTG-3' (20 н.)
SFRP2_p: 5'-FAM-TACCCTTCATTGGCTCCTCCCTTGCT-BHQ1-3' (26 н.)
SFRP2_h: 5'-CCTGCTCTTTCATCGGCGT-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера SOCS3 (5'→3'):

SOCS3_g: 5'-CAGTCCCGGGGGCCCTTCT-3' (19 н.)
SOCS3_p: 5'-FAM-TGCTCCCCACCCGGCCACACTCC-BHQ1-3' (23 н.)
SOCS3_h: 5'-CCTGCTCTTTCATCGGCGG-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера SOX17 (5'→3'):

SOX17_g: 5'-CGCCCTCCGACCCTCCAA-3' (18 н.)
SOX17_p: 5'-FAM-TCCCGGATTCCCCAGGTGGCC-BHQ1-3' (21 н.)
SOX17_h: 5'-CCTGCTCTTTCATCGGCCG-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера THBD (5'→3'):

THBD_g: 5'-GTTCGGGAAAAGGAAGGAAGTGC-3' (23 н.)
THBD_p: 5'-FAM-ATTGCTGGGTTCTCTGGCCGCC-BHQ1-3' (22 н.)
THBD_h: 5'-CCTGCTCTTTCATCGGCGA-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера TMEFF2 (5'→3'):

TMEFF2_g: 5'-GGTGGGCTACCCGCACACTCATA-3' (23 н.)
TMEFF2_p: 5'-FAM-CCATTCGCCTCACTCTCCGCTCCA-BHQ1-3' (24 н.)
TMEFF2_h. 5'-CCTGCTCTTTCATCGGCGG-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера UCHL1 (5'→3'):

UCHL1_g: 5'-GCAGAACCAAGCGAGGGGGAA-3' (21 н.)
UCHL1_p: 5'-FAM-CGTACCCATCTGGCCGCGACCGTC-BHQ1-3' (24 н.)
UCHL1_h: 5'-CCTGCTCTTTCATCGGCTG-3' (19 н.)

- для специфических праймеров и зонда на участки CpG-островков регуляторных областей гена-онкомаркера VIM (5'→3'):

VIM_g: 5'-TCCGCAGCCATGTCCACCA-3' (19 н.)
VIM_p: 5'-FAM-CCGTGTCCTCGTCCTCCTACCGCAG-BHQ1-3' (25 н.)
VIM_h: 5'-CCTGCTCTTTCATCGGCGC-3' (19 н.)

где g - геномный праймер (genome); р - флуоресцентно-меченый зонд (zond); h - гибридный праймер (hybrid); FAM - флуоресцеин; BHQ1 - гаситель флуоресценции (Black Hole Quencher 1).

2. Способ идентификации злокачественного поражения толстого кишечника и прямой кишки посредством анализа в образцах ДНК метилирования сайтов RCGY в заданных положениях регуляторных областей генов-онкомаркеров методом GLAD-ПЦР, включающий формирование панели генов-онкомаркеров колоректального рака: ADHFE1, ALX4, CNRIP1, EID3, ELMO1, ESR1, FBN1, HLTF, LAMA1, NEUROG1, NGFR, RARB, RXRG, RYR2, SDC2, SEPT9, SFRP2, SOCS3, SOX17, THBD, TMEFF2, UCHL1 и VIM; гидролиз высокоочищенной геномной ДНК из исследуемого биоматериала метилзависимой сайт-специфической ДНК-эндонуклеазой GlaI, лигирование универсального олигонуклеотидного адаптера 5'-CCTGCTCTTTCATCG-3'/3'-p-GGACGAGAAAGTAGC-p-5', где р - фосфат с последующей амплификацией в реальном времени с использованием геномных праймеров и зондов, комплементарных последовательностям регуляторных областей указанных генов в исследуемой ДНК, и гибридных праймеров, 3'-концы которых комплементарны 5'-концам ДНК в заданных местах гидролиза GlaI, а оставшаяся часть комплементарна адаптерной последовательности, и делают заключение о наличии последовательности R(5mC)GY, где 5mC - 5-метилцитозин, R-А или G, Y-Т или С в регуляторных областях указанных генов по появлению флуоресцентного сигнала для определения статуса метилирования сайтов в клинических образцах методом GLAD-ПЦР-анализа и на основе информации о статусе метилирования одного или нескольких сайтов делают вывод о наличии или отсутствии колоректального рака, причем при реализации способа используют набор праймеров и зондов по п. 1.



 

Похожие патенты:

Настоящее изобретение относится к биохимии, в частности к способу диагностики заболеваний, сопровождающихся повышенной гибелью клеток, и набору для его осуществления.

Изобретение относится к области медицины, в частности к акушерству и гинекологии, и предназначено для ранней диагностики цервикальных интраэпителиальных неоплазий (ЦИН).

Изобретение относится к области биотехнологии и медицины. Предложен набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для идентификации вируса клещевого энцефалита, вируса лихорадки Западного Нила, боррелий и риккетсий методом мультиплексной ПЦР в режиме реального времени.

Изобретение относится к области биомедицины и касается способа диагностирования острого повреждения почек и применения in vitro набора, содержащего праймеры, необходимые для выполнения способа.

Изобретение относится к области ветеринарии. Предложен способ профилактики африканской чумы свиней, включающий выявление животных с инфекционным заболеванием на начальной стадии развития, убой больных и дальнейшее обследование остальных животных.

Изобретение относится к области биохимии. Описана группа изобретений, включающая способ выявления РНК и ДНК из сухих биологических образцов и набор для выделения РНК и ДНК из сухих биологических образцов.

Предложенная группа изобретений относится к области медицины. Предложен способ неинвазивной пренатальной диагностики анеуплоидий плода, включающий выделение внеклеточной ДНК (вкДНК) из образца крови, полученной у беременной женщины, выбор регионов генома для проведения амплификации, приготовление геномных библиотек, картирование полученных последовательностей на референсный геном или части генома человека с определением их координат, определение значения покрытия для каждого региона генома, характеризующегося открытостью хроматина между плацентой и клетками крови матери, отличающейся не менее чем на 20%, и получение регионов генома с указанной открытостью хроматина, после чего делается вывод о наличии анеуплоидий плода.

Изобретение относится к области медицины и касается способа прогнозирования повышенного риска субарахноидального кровоизлияния вследствие разрыва аневризмы сосудов головного мозга у лиц азиатской расы.

Изобретение относится к области молекулярной биологии и медицины и предназначено для диагностики наличия мутации L576P гена c-KIT в тканях меланомы. Оценку наличия мутации проводят по соотношениям значений пороговых циклов Ct в трех реакциях ПЦР в реальном времени с аллель-специфичными праймерами.

Изобретение относится к области биотехнологии. Предложена тест-система для мультиплексного количественного анализа экспрессии генов интерферона лямбда, противовирусного белка МхА и интерлейкина 23 на основе обратной транскрипции в сочетании с полимеразной цепной реакцией в реальном времени, включающая специфические праймеры и соответствующие им флуоресцентные гидролизуемые зонды, а также отрицательный и положительные контрольные образцы.

Изобретение относится к области биохимии, в частности к способу определения зиготности гена fad-3c в растении канолы. Также раскрыт набор для осуществления указанного способа. Изобретение позволяет эффективно определять зиготность гена fad-3c в растении канолы. 2 н. и 12 з.п. ф-лы, 2 ил., 2 табл., 1 пр.

Изобретение относится к области биохимии. Описана группа изобретений, включающая композицию для реакции обратной транскрипции с горячим стартом, способ подготовки вышеуказанной композиции, композицию для ПЦР с обратной транскрипцией и горячим стартом, способ подготовки вышеуказанной композиции, набор для реакции обратной транскрипции с горячим стартом, который включает в себя композицию для реакции обратной транскрипции с горячим стартом и реакционную пробирку, набор для ПЦР с обратной транскрипцией и горячим стартом, способ обратной транскрипции РНК-матрицы, способ амплификации нуклеиновой кислоты, композицию ПЦР с обратной транскрипцией для диагностики злокачественного новообразования. Композиция для реакции обратной транскрипции содержит в своем составе ион Mg2+, четыре типа dNTP, обратную транскриптазу, пирофосфат и пирофосфатазу. Композиция для ПЦР помимо вышесказанного включает в себя ДНК-полимеразу. Изобретение расширяет арсенал средств, позволяющих проводить реакцию обратной транскрипции. 9 н. и 28 з.п. ф-лы, 13 ил., 3 табл., 13 пр.

Предложенная группа изобретений относится к области медицины, в частности к неврологии и молекулярной биологии. Предложены способ и набор реагентов для выявления генетического полиморфизма в полиморфных точках rs9652490 LINGO1 (A>G), rs11856808 LINGO1 (C>Т), rs10968280 LINGO2 (А>Т), rs7033345 LINGO2 (C>Т), rs1412229 LINGO2 (А>Т), rs10812774 LINGO2 (C>Т) и rs3794087 SLC1A2 (А>С), определяющих генетическую ассоциацию с эссенциальным тремором. Предложенная группа изобретений обеспечивает высокую специфичность и сокращение сроков идентификации олигонуклеотидных полиморфизмов за счет возможности в мультиплексном формате в одной постановке оценивать семь однонуклеотидных полиморфных маркеров. 2 н. и 1 з.п. ф-лы, 21 ил., 19 табл., 1 пр.

Изобретение относится к биотехнологии. Описана композиция для стандартизации эффективности амплификации набора олигонуклеотидных праймеров для амплификации перестроенных последовательностей нуклеиновых кислот, кодирующих один или более рецепторов адаптивной иммунной системы в биологическом образце, полученном из лимфоидных клеток субъекта-млекопитающего, причем каждый рецептор адаптивной иммунной системы содержит вариабельный участок и соединительный участок, причем композиция содержит: множество синтетических матричных олигонуклеотидов, причем каждый синтетический матричный олигонуклеотид имеет известную концентрацию до амплификации и олигонуклеотидную последовательность общей формулы: , причем: (а) V представляет собой олигонуклеотидную последовательность, содержащую по меньшей мере 20 и не более 1000 последовательных нуклеотидов генной последовательности, кодирующей вариабельный (V) участок рецептора адаптивной иммунной системы или его комплемент, и каждый V содержит уникальную олигонуклеотидную последовательность V-участка; (b) J представляет собой олигонуклеотидную последовательность, содержащую по меньшей мере 15 и не более 600 последовательных нуклеотидов генной последовательности, кодирующей соединительный (J) участок рецептора адаптивной иммунной системы или его комплемент, и каждый J содержит уникальную олигонуклеотидную последовательность J-участка; (с) U1 либо отсутствует, либо содержит олигонуклеотидную последовательность, выбранную из (i) первой универсальной последовательности олигонуклеотида-адаптера и (ii) первой специфической для секвенирующей платформы олигонуклеотидной последовательности, которая связана с положением 5' и находится в нем относительно первой универсальной последовательности олигонуклеотида-адаптера; (d) U2 либо отсутствует, либо содержит олигонуклеотидную последовательность, выбранную из (i) второй универсальной последовательности олигонуклеотида-адаптера и (ii) второй специфической для секвенирующей платформы олигонуклеотидной последовательности, которая связана с положением 5' и находится в нем относительно второй универсальной последовательности олигонуклеотида-адаптера; (e) присутствует по меньшей мере один из B1, В2, В3 и В4 и каждый из B1, В2, В3 и В4 содержит олигонуклеотид В, содержащий последовательность штрихкода из 3-25 последовательных нуклеотидов, которая уникальным образом идентифицирует в качестве спаренной комбинации, (i) уникальную олигонуклеотидную последовательность V-участка из (а) и (ii) уникальную олигонуклеотидную последовательность J-участка из (b); (f) R либо отсутствует, либо содержит сайт распознавания рестрикционного фермента, который содержит олигонуклеотидную последовательность, отсутствующую в (а)-(е); и причем: (g) множество синтетических матричных олигонуклеотидов содержит количество по меньшей мере а или по меньшей мере b уникальных олигонуклеотидных последовательностей в зависимости от того, какое значение больше, причем а представляет собой количество уникальных сегментов гена, кодирующего V-участок рецептора адаптивной иммунной системы у субъекта, а b представляет собой количество уникальных сегментов гена, кодирующего J-участок рецептора адаптивной иммунной системы у субъекта, и композиция содержит по меньшей мере один синтетический матричный олигонуклеотид для каждой уникальной олигонуклеотидной последовательности V-участка и по меньшей мере один синтетический матричный олигонуклеотид для каждой уникальной олигонуклеотидной последовательности J-участка. Также заявлен способ количественного определения множества перестроенных молекул нуклеиновых кислот, кодирующих один или множество рецепторов адаптивной иммунной системы в биологическом образце. 2 н. и 25 з.п. ф-лы, 14 ил., 17 табл., 12 пр.

Изобретение относится к области медицины, а именно к генетике и онкологии, и касается способа выявления генных мутаций BRAF в опухолях человека. Осуществляют амплификацию исследуемого фрагмента гена BRAF посредством асимметричной ПЦР в реальном времени с двумя зондами TaqMan: BRAF-15-sense – 5'-ROX-aggtgattttggtctagctacagtgaaatc-BHQ2 и BRAF-15-antisense – 5'-Су5-acccactccatcgagatttcactgta-BHQ2 и праймерами: прямой – 5'-gagatctactgttttcctttactt, обратный – 5'-ggccaaaaatttaatcagt. Этап отжига праймеров и зондов составляет 2 с, число циклов амплификации - 80-100, концентрация Taq-полимеразы - 0,63 ед., температура отжига праймеров и зондов - 57°С. Далее осуществляют плавление дуплекса зонд-однонитевая ДНК и построение пиков плавления. Идентифицируют мутации по асимметрии пиков плавления. Способ обладает высокой чувствительностью, от 10 до 15 раз превышающей чувствительность прототипа, прост в исполнении, реализуется в течение 2 ч в одной пробирке с однократной регистрацией результатов, снижает риск перекрестного загрязнения образцов. 4 ил.

Изобретение относится к области биотехнологии и медицины. Описан способ химической модификации антитромбинового аптамера и к получения нового антитромбинового аптамера, обладающего антикоагулянтными свойствами и пролонгированной антитромботической активностью. В изобретении описан аптамерный ДНК олигонуклеотид, специфически связывающийся с тромбином и характеризующийся нуклеотидной последовательностью общей формулы GGTTGGTGTGGTTGGTGGTTGGTGTGGTTGG, в котором по крайней мере один из нуклеотидов модифицирован для возможности связывания с молекулой полиэтиленгликоля и увеличения времени нахождения данного олигонуклеотида в кровотоке. В предпочтительных вариантах изобретения модификация произведена по тиминам в позициях 7, 9, 16, 23 и/или 25. Модифицированный аптамер обладает улучшенными фармакокинетическими параметрами, низкой токсичностью и высоким сродством к тромбину человека. Изобретение может быть использовано в качестве антикоагулянтного и антитромботического лекарственного средства для профилактики или лечения тромбозов различной природы. 4 н. и 7 з.п. ф-лы, 5 ил., 2 пр.
Изобретение относится к области медицины и биотехнологии. Заявлен набор для оценки полиморфизма генов фолатного цикла методом ПЦР, включающий компоненты для выделения ДНК, видоспецифичные олигонуклеотидные пары праймеров для проведения одностадийной экспресс-идентификации нескольких однонуклеотидных замен в аллелях генов MTHFR, MTR, MTRR и компоненты для детекции результатов гель-электрофорезом. Изобретение позволяет с высокой точностью определять степень предрасположенности к заболеваниям, связанным с нарушениями репродуктивной, сердечно-сосудистой систем, канцерогенезу и др. патологиям по изучению полиморфизма в генах фолатного цикла.

Настоящее изобретение относится к биохимии, биотехнологии, молекулярной биологии, в частности к набору олигонуклеотидных праймеров для идентификации медицински значимых микромицетов методом секвенирования ДНК путём амплификации и последующего определения нуклеотидной последовательности фрагмента гена 28S рРНК. Указанный набор содержит пару олигонуклеотидов, обладающих активностью прямого и обратного праймеров, комплементарных нуклеотидным последовательностям консервативных участков региона гена 28S рРНК микромицетов. Олигонуклеотидные праймеры имеет следующую структуру: 5'-CATATCAATAAGCGGAGG-3' (прямой праймер Fungi 28S-f) и 5'-CGACCAATATTTAGCTTTAG-3' (обратный праймер Fungi 28S-r). Настоящее изобретение позволяет расширить арсенал средств для амплификации и секвенирования фрагмента гена 28S рибосомальной РНК различных видов возбудителей микозов для анализа нуклеотидных последовательностей, установления видовой принадлежности чистых культур микромицетов, изучения их филогенетического родства на видовом уровне и идентификации медицински значимых микромицетов. 4 ил., 3 пр.

Изобретение относится к области медицины, в частности к онкологии, и предназначено для прогнозирования риска лимфогенного метастазирования при раке молочной железы. Проводят молекулярно-генетическое исследование биопсийных образцов опухолевой ткани с последующим выделением РНК и определением уровня гена YKL-39 с помощью количественной полимеразной цепной реакции в режиме реального времени. В качестве калибратора используют нормальную ткань молочной железы, в которой уровень экспрессии YKL-39 составляет 1 УЕ. При уровне экспрессии YKL-39 более 1 УЕ прогнозируют низкий риск развития лимфогенных метастазов. При уровне экспрессии YKL-39 менее 1 УЕ прогнозируют высокий риск лимфогенного метастазирования. Изобретение обеспечивает повышение точности способа за счет выявления новых маркеров и их числовых показателей, позволяющих прогнозировать течение заболевания и оценивать риск возникновения лимфогенного метастазирования у больных раком молочной железы. 1 табл., 2 пр.
Наверх